cox2009-tnt_creation_in_vitro_coupled_transcription_and_translation_reactions_using_e._coli_lysate_version_1.2...

Hellinga Lab Protocol Department of Biochemistry Duke University Medical Center

Protein Fabrication Automation (PFA) Protocol #3

TNT CREATION:

in vitro coupled transcription and translation reactions

Written by J. Colin Cox, Ph.D. Version 1.2 (December 23, 2009)

2

Introduction ......................................................................................................................... 4 1. Mark II system ............................................................................................................... 5

1.1 Description of a basic TnT reaction ......................................................................... 5 1.1.1 Cellular machinery ............................................................................................. 5 1.1.2 Raw materials.................................................................................................... 5 1.1.3 Energy and energy regeneration compounds .................................................... 6 1.1.4 Inhibitory compounds ....................................................................................... 6 1.1.5 Stabilizing compounds ...................................................................................... 6 1.1.6 DNA template ................................................................................................... 6

1.2 Analysis of the Swartz lab’s findings ...................................................................... 7 1.2.1 Pyruvate (and NAD, CoA, and oxalate) ........................................................... 7 1.2.2 Contrasting PANOxSP with Cytomim ............................................................. 7 1.2.3 Oxygen .............................................................................................................. 8 1.2.4 Buffering ........................................................................................................... 8

1.3 Changes from the Swartz lab system ....................................................................... 9 1.3.1 Fermentation ..................................................................................................... 9 1.3.2 Reaction mix components pre-mixing .............................................................. 9 1.3.3 BL21 Star cell strain ......................................................................................... 9 1.3.4 Template terminal blockage .............................................................................. 9 1.3.5 Additional reaction mix compounds ............................................................... 10

1.4 Description of the Mark II system ......................................................................... 11 1.4.1 Template ......................................................................................................... 11 1.4.2 Cell-free extract .............................................................................................. 12 1.4.3 Reaction mix ................................................................................................... 12 1.4.4 TnT reaction .................................................................................................... 12

1.5 Current yield example ............................................................................................ 13 2. Preparation of S30 extract ............................................................................................ 14

2.1 Day 1 (clonal isolation) .......................................................................................... 15 2.2 Day 2 (starting seed culture) .................................................................................. 16 2.3 Day 3 (culture growth & harvest) .......................................................................... 16 2.4 Day 4 (cell-free extract creation) ........................................................................... 17

2.4.1 Lyse the cells and remove debris .................................................................... 17 2.4.2 Perform the run-off reaction ........................................................................... 18 2.4.3 Dialyze the lysate ............................................................................................ 18 2.4.4 Aliquot and store the cell-free extract ............................................................. 18

2.5 Lysate yield example ............................................................................................. 19 3. Preparation of the reaction mix .................................................................................... 20 4. Recipes and materials .................................................................................................. 22

4.1 Media and Buffers.................................................................................................. 22 4.1.1 2xYT-PG ............................................................................................................. 22 4.1.2 S30 buffer............................................................................................................ 23 4.2 Reaction mix components ...................................................................................... 25

4.2.1 PEP .................................................................................................................. 26 4.2.2 NAD ................................................................................................................ 27 4.2.3 CoA ................................................................................................................. 28 4.2.4 Putrescine ........................................................................................................ 29

3

4.2.5 Spermidine ...................................................................................................... 30 4.2.6 Oxalic acid ...................................................................................................... 31 4.2.7 Mg(glu)2 .......................................................................................................... 32 4.2.8 NH4(glu) .......................................................................................................... 33 4.2.9 K(glu) .............................................................................................................. 34 4.2.10 Folinic acid .................................................................................................... 35 4.2.11 tRNAs ........................................................................................................... 36 4.2.12 Rifampicin ..................................................................................................... 37 4.2.12 ATP ............................................................................................................... 38 4.2.13 CTP ............................................................................................................... 39 4.2.14 GTP ............................................................................................................... 40 4.2.15 UTP ............................................................................................................... 41 4.2.16 AA Mix ......................................................................................................... 42

5. References .................................................................................................................... 44 Appendix A – Sample instruction sheet for the end user .................................................. 46 Appendix B – 5’ and 3’ sequences ................................................................................... 47 Appendix C – Reaction mix cost ...................................................................................... 48 Hellinga Research Group Department of Biochemistry Duke University Medical Center Nanaline Building, Room 415 Research Drive, DUMC 3711 Durham, NC, 27710, USA Author’s e-mail: [email protected] Investigator’s e-mail: [email protected]

Written by J. Colin Cox, Ph.D. This work is hereby released into the Public Domain. To view a copy of the public domain dedication, visit http://creativecommons.org/licenses/publicdomain/ or send a letter to Creative Commons, 171 Second Street, Suite 300, San Francisco, California, 94105, USA.

4

Introduction

This guide in intended to serve as a full, portable protocol to enable a molecular biology laboratory to routinely create robust in vitro coupled transcription and translation reactions (often abbreviated as TnT reactions). 1. The Mark II System; this section details the contributions to the field from the Swartz

lab at Stanford University, explains changes we have implemented to their system, and provides an overall description of the Mark II in vitro protein expression system.

2. Preparation of the S30 extract; this chapter provides a protocol for growth, lysis,

preparation, and storage of the cell-free extract. 3. Preparation of the reaction mix; a simple recipe is presented to create the reaction mix

component of the in vitro expression system. 4. Recipes and materials; this detailed section fully lists all chemicals and reagents

needed to replicate the Mark II System. Detailed instructions for solublizing certain reagents are provided to ensure the correct composition of the reaction mix.

5. References

5

1. Mark II system

The in vitro protein expression system described here is principally derived from the work of the James Swartz lab at Stanford University. They have developed systems they label PANOx [1, 2] PANOxSP [3, 4], and Cytomim [4]. “Mark II” refers to this system as the second incarnation and enhancement of an in vitro coupled transcription and translation (TnT) expression system developed within the Hellinga lab.

1.1 Description of a basic TnT reaction

Several biological components are required to synthesize protein from a DNA template. The soluble portion of the cytoplasm is crudely purified and contains the necessary proteins to carry out translation. Additionally, raw materials, energy sources, stabilizers, inhibitors and energy regeneration molecules are added.

1.1.1 Cellular machinery

In prokaryotic cells, the events of transcription and translation (TnT) are coupled, with translation starting before the RNA polymerase finishes transcribing the message RNA. Thus, a crude purification of bacterial cell lysate contains the necessary cellular machinery for mRNA transcription and protein translation. Extract contains the machinery required for translation, including ribosomes, ribosome initiation factors, ribosome elongation factors, ribosome termination factors, etc. Small molecules, raw materials and cofactors are added in addition to the DNA template to produce protein from a cell-free extract. A TnT reaction will produce protein for a limited amount of time, usually until either one of the amino acids or the energy supply is depleted and/or degraded.

One mechanism of energy and reagent depletion is through unregulated, endogenous cellular phosphatases that nonspecifically dephosphorylate ribonucleotide triphosphates in the reaction mix. This drastically cuts the effective energy supply, limiting protein production [5]. Scientific literature can provide some solutions to this issue, but at the cost of greatly increasing the complication of lysate production. However, one research group demonstrated that exogenous inorganic phosphate and glucose in the medium downregulates expression of some E. coli phosphatases [6]. This elegant and simple step more than doubles effective expression time with a ~ 35% increase in expressed protein.

1.1.2 Raw materials The so-called ‘building blocks’ of RNA and protein are of course required. The canonical four ribonucleotides are supplied for mRNA transcription, and the twenty

6

canonical amino acids are supplied for protein translation. In addition, total E. coli tRNAs are included.

1.1.3 Energy and energy regeneration compounds ATP (and to some extent, GTP) is the primary source of energy for a majority of processes involved in transcription and translation. However, energy in this form is quickly depleted, and a supplementary energy regeneration system is required. Many energy regeneration systems have been described in the literature, and often utilize phosphoenolpyruvate, creatine phosphate, or acetyl phosphate. (See [7] for a review of energy regeneration systems.) Additionally, these systems may require the addition of cofactors such as coenzyme A, nictotinamide–adenine dinucleotide (NAD), and folinic acid.

1.1.4 Inhibitory compounds Many of the endogenous enzymes in a cell-free extract may have undesirable activity. A variety of inhibitory compounds may be added to the TnT reaction for mitigation. These may include nuclease inhibitors, proteases inhibitors, and E. coli polymerase inhibitors. Additionally, inhibitors of enzymes that break down specific amino acids may be included. Specific enzymes within the TCA cycle or glycolytic pathway may be targeted as well.

1.1.5 Stabilizing compounds Conversely, some compounds are added to TnT reactions in order to stabilize the nucleic acid or protein products, or to enhance levels of expression. Message transcripts may be stabilized with polyamines or other polymers. Protein stabilization is sometimes achieved by the addition of molecular crowding agents, such as poly-ethylene glycol.

1.1.6 DNA template

Finally, a DNA template is supplied for transcription and subsequent translation. It is advantageous to supply a DNA template and perform transcription rather than just supplying a purified mRNA template. The activity of endogenous ribonucleases in the extract is high, and a mRNA template generally lasts on the order of seconds-to-minutes. By constantly regenerating mRNA from a DNA template, a large amount of protein may be produced. Additionally, the mRNA may have a stem-loop structure to enhance message stability.

7

1.2 Analysis of the Swartz lab’s findings The systems derived and conceived by the Swartz lab work well and are robust; however, their body of literature may be confusing to novices of in vitro protein expression. Below, “the authors” refer to Swartz lab publications.

1.2.1 Pyruvate (and NAD, CoA, and oxalate)

The authors initially reported that pyruvate can be employed as a secondary energy source (with the purinic nucleotides as the primary source)[2]. The theory is that pyruvate is metabolized into acetyl phosphate, driving endogenous ATP regeneration[2, 3]. In their conventional system which led to PANOx and Cytomim, it is reported that using pyruvate combined with NAD roughly triples protein production, while pyruvate with NAD and CoA roughly quadruples protein production[2]. However, in studying a time course with the newer Cytomim system, the authors discovered that pyruvate is depleted after 30 minutes (or 1/6th of the active production time)[3]. “The brief presence of pyruvate relative to the duration of protein synthesis is very curious and indicates that there is most likely another energy source for ATP regeneration. Furthermore, it implies that pyruvate may not be necessary for protein synthesis in the Cytomim system”[3]. Pyruvate subsequently is omitted from the ingredients of Cytomim (for example, refer to [7]).

It was stated that NAD and CoA are added to the reaction to yield additional

energy from pyruvate which is produced by pyruvate kinase from PEP[8]. This begs the question of the need to continue adding NAD and CoA to the reaction mix. In the same publication, the authors investigated this, finding that removal of CoA had no effect, while removal of NAD decreased apparent production by ~15%[3]. CoA continues to be included as an ingredient of the reaction mix (for example, refer to [7]). Finally, like NAD and CoA, it seems that oxalic acid was initially added to aid the pyruvate-based energy subsystem. The authors employ the use of oxalic acid to inhibit PEP-synthetase, which could waste energy by converting pyruvate into PEP[4, 9]. A publication containing an investigation into the necessity of oxalic acid in the newer systems is not found; however, they continue to use it in the reaction mix (for example, refer to [7]). It is then difficult to deductively assign defined, specific biochemical functions to oxalic acid, NAD, and CoA in this system in this light. Regardless, we continue to add them to the reaction mix, following the Swartz lab’s protocol.

1.2.2 Contrasting PANOxSP with Cytomim

The finding that pyruvate is depleted from the Cytomim system practically obviates the distinction between the PANOxSP and Cytomim systems. The major difference had been that PANOx utilized a PEP energy subsystem while cytomim utilized

8

the more cost-effective pyruvate for its energy regeneration. According to a recent review article[7], there is (now) very little difference in the makeup of the reaction mixes. The values of salts presented in this document’s recipes are closer to Cytomim for magnesium (10 mM) and is the PANOxSP value for potassium (175 mM). These values were provided via direct communication with the Swartz lab as to their current protocols.

1.2.3 Oxygen The authors state that the Cytomim system requires oxygen (for oxidative phosphorylation) while the PANOx(SP) system utilizing PEP does not[10, 11]. This statement is in contradiction to our empirical results when employing their reaction mix recipe including PEP. However, it is possible this is due to differences in cell strains, or other such phenomenon. Regardless, the expression system in our hands benefits from atmospheric oxygen during incubation. We incubate our reaction in vesicles covered with an air-permeable membrane. Shown is a test of GFP template after maturation in tubes either capped or uncapped during expression.

1.2.4 Buffering In their transition from PANOx to PANOxSP, the authors removed “unnatural” compounds, including pH buffers[4]. However, it is incorrect to view the system as being unbuffered because glutamate is used as the counter-ion in many of the salts. The high concentration of the glutamate salts, in addition to the remaining reaction mix components, serves as the biological buffer of the system. Failure to pH adjust the reaction mix ingredients produces nonfunctional reaction mix.

PANOxSP Cytomim [Mg++] (mM) 20 8 [K+] (mM) 175 130 [PEP] (mM) 33 none

9

1.3 Changes from the Swartz lab system

We have altered our protocols from the Swartz lab in the following ways:

1.3.1 Fermentation The Swartz lab makes extensive use of fermentation procedures that they have optimized for generating cell-free lysate[12, 13]. In lieu of having access to a highly configurable fermenter, we attempted to assess whether growing lysate in shaking cultures is feasible. Although cell mass is lower per volume of culture, the quality of lysate produced in shaking cultures is fine for TnT reactions.

1.3.2 Reaction mix components pre-mixing In order to provide a system that is easily distributed within a lab, it is advantageous to reduce the total amount of reagent tubes an end-user is required to handle. Additionally, this alleviates much burden of inventory tracking. The Swartz system is made of eleven reagent tubes[7]; we have reduced this to two. The T7 RNAP tube is obviated by the cell strain (see below), while all the other reaction mix components are simply mixed together and stored at -80°C. Details on creating the reaction mixture follow.

1.3.3 BL21 Star cell strain

We work with Invitrogen’s BL21 Star (DE3) cell strain (P/N C6010-03). BL21 Star contains a deletion in the rne131 gene, coding for RNase E. The deletion in this gene contains the N-terminal domain for ribosomal RNA processing but lacks the C-terminal domain[14, 15]. Removal of this domain increases the stability of the mRNA and improves protein production in cell-free extracts[16, 17]. This strain also contains a DE3 lysogen that harbors T7 RNA polymerase under control of a lac promoter. The full genotype is: F- ompT hsdSB(rB

- mB-) gal dcm rne131 (DE3)

1.3.4 Template terminal blockage The Swartz lab uses supercoiled plasmid DNA templates, whereas we typically transcribe from linear DNA templates produced by automated gene assembly[18]. Linear templates are susceptible to endogenous exonuclease activity. We surmised that chemically altering the ends of the DNA may physically block access to exonucleases. We block the 5’ ends with biotin by biotinylating the two terminal primers during gene

10

synthesis or downstream PCR amplification. This has a profound effect on protein expression (illustrated in the above figure).

1.3.5 Additional reaction mix compounds We were curious to determine if additional reaction mix compounds could have an enhancing effect on the yield of protein production. We identified several compounds that had no effect, damaged, or killed the reactions entirely: calcium phosphate, Roche Complete Mini EDTA-free protease inhibitor cocktail, E. coli poly(A) polymerase, A. niger catalase, E. coli Mn-superoxide dismutase, sheared salmon sperm DNA, polyvinylpyrollidone-40, and Ambion SUPERase•In RNase inhibitor. We identified two compounds which substantially increased protein protein: rifampicin and S. cervasie pyrophosphatase. Rifampicin is an antibiotic compound whose mode of action is to block transcription initiation by binding to the active site of E. coli RNA polymerase[19, 20]. Rifampicin is often included in in vitro coupled transcription and translation reactions[21, 22] to avoid the reagent and energy expenditure of the lysate and reaction mix to produce E. coli proteins from endogenous, preexisting mRNA. The antibiotic is often included in commercial E. coli lysate kits.

Pyrophosphate is known to inhibit many key cellular process events, including both transcription[23, 24] and translation[25, 26]. We have found that exogenously adding pyrophosphate inhibits protein expression at an initial concentration of ~ 1 µM. A reaction at 10 mM pyrophosphate completely

-1000.00

1000.00

3000.00

5000.00

7000.00

9000.00

11000.00

13000.00

0 500 1000 1500 2000 2500

Seconds

RFU

Esterase, 'plain'Esterase, biotinylatedNo template

0

10000

20000

30000

40000

50000

60000

70000

80000

90000

0 200 400 600 800 1000 1200 1400

Time (s)

RFU

Lysate onlypNBbiotinylated pNBbiotinylated pNB + 100 ug/ml RIFbiotinylated pNB + 20 ug/ml RIFbiotinylated pNB + 4 ug/ml RIFbiotinylated pNB + 0.8 ug/ml RIF

0

10000

20000

30000

40000

50000

60000

70000

80000

90000

0 200 400 600 800 1000 1200 1400

Time (s)

RFU

Lysate onlypNBbiotinylated pNBbiotinylated pNB + 2 U PPi-asebiotinylated pNB + 1 U PPi-asebiotinylated pNB + 0.5 U PPi-asebiotinylated pNB + 0.25 U PPi-ase

11

inhibits all protein expression. This prompted us to explore the enzymatic conversion of toxic pyrophosphate into less toxic phosphate. We first used E. coli pyrophosphatase. Surprisingly, addition of 20 U, 4 U, 0.8 U, or 1.6 U / 50 µl reaction volume completely inhibited protein production. We also assayed the pyrophosphatase from S. cervasie because it is commercially cheaper and more stable than its prokaryotic counterpart. We observed increases in protein expression at concentrations between 0.25 – 4 U / 50 µl reaction; 0.5 U / 50 µl was later verified as the optimal concentration (see above figure).

We tested whether inclusion of both yeast pyrophosphatase and rifampicin in our

reactions is additive. Unfortunately, the combination of the two items produced marginally more protein than that of rifampicin alone, suggesting that another agent becomes limiting. For the current implementation of the Mark II system, we have chosen to supplement the reaction mix with only rifampicin because it is less expensive.

1.4 Description of the Mark II system

The Mark II system is a simple, robust, cost-effective in vitro coupled transcription and translation reaction mixture for protein expression. The constituents of the assembled expression reactions can be categorized in terms of DNA template, cell-free extract, and the reaction mix. Instructions for end-users of the reactions are provided in Appendix A.

1.4.1 Template

A DNA template is supplied for transcription and subsequent translation. It is advantageous to supply a DNA template and perform transcription rather than just supplying a purified mRNA template. The activity of endogenous ribonucleases in the extract is high, and a mRNA template generally lasts on the order of seconds-to-minutes. By constantly regenerating mRNA from a DNA template, a large amount of protein may be produced. Additionally, the mRNA may have a stem-loop structure to enhance message stability. The template and its synthesis have been previously described. In addition to a gene, the synthetic construct contains a T7 RNA polymerase promoter [27,

0

5000

10000

15000

20000

25000

30000

0 500 1000 1500 2000 2500

Time (s)

RFU

s

No templateRoche, pNB templateMark II, bio-pNBMark II, bio pNB, 4ug/ml RIFMark II, bio pNB, 0.5 U PPi-aseMark II, bio-pNB, 4ug/ml RIF & 0.5U PPi-ase

12

28], a Shine-Dalgarno ribosome binding site [29, 30], an optimized open reading frame, and a T7 terminator stem-loop structure [31]. (Refer to Appendix B for sequences.)

1.4.2 Cell-free extract

The cell-free extract is essentially a crude purification of the total soluble, membrane-free cellular material. The extract contains the machinery required for translation, including ribosomes, ribosome initiation factors (IF1, IF2, IF3), ribosome elongation factors (EF-Tu, EF-Ts, EF-G), ribosome termination factors (RF1, RF2, RF3, RRF), met-tRNAf-formylation enzymes, tRNA synthetases, energy processing enzymes, etc. When inducing the BL21 Star cell strain during growth, the cell-free extract contains T7 RNA polymerase as well.

Unregulated, endogenous cellular phosphatases nonspecifically dephosphorylate

the ribonucleotide triphosphates in the reaction mix. This drastically cuts the effective energy supply, limiting protein production[5]. The literature provides a few solutions that greatly complicate lysate production. However, one lab demonstrated that exogenous inorganic phosphate and glucose in the medium downregulates expression of some E. coli phosphatases[6]. This elegant and simple step more than doubles effective expression time with a ~ 35% increase in expressed protein.

1.4.3 Reaction mix

The reaction mix contains the small molecules, energy compounds, raw materials, and co-factors required to fuel transcription and translation in the cell-free extract. In the Mark II system, the reaction mix is comprised of magnesium glutamate, ammonium glutamate, potassium glutamate, the canonical ribonucleotide triphosphates, folinic acid, E. coli total tRNAs (the canonical sixty-four), the canonical amino acids, phosphoenolpyruvate, nicotinamide adenine dinucleotide, coenzyme A, oxalic acid, putrescine, spermidine, and rifampicin.

1.4.4 TnT reaction

The reaction is created by adding equal volumes of cell-free extraction and reaction mix, along with two volumes of (water + template). This setup makes it simple for an end-user to set up reactions. Additionally, 50% of the reaction volume is saved for (water + template), which helps to facilitate the expression of protein from more dilute DNA samples without concentration; this also provides a large amount of space for additional components, such as disulfide bond-forming enzymes.

13

1.5 Current yield example

In the current configuration, we are able to produce ~ 2-5 µg / 50 µl TnT reaction. An example is provided below for p-nitro benzyl esterase from a linear DNA template (expect roughly ~10x more from a circular plasmid template). Enough product is made to easily visualize on a Comassie-stained gel.

para -nitro benzyl esterase (p NB) activity

0.000

0.500

1.000

1.500

2.000

2.500

3.000

3.500

4.000

Roche, No template Roche, pNB Mark II, No template Mark II, pNB Mark II, bio-pNB Mark II, bio-pNB +RIF + PPi-ase

Rel

ativ

e ac

tivity

0.0 0.57 0.0 0.39 1.60 2.44µg of protein per 50

µl TnT reaction

6152028

43

57

104

194

RocheNo template

RochepNB

Mark IINo template

Mark IIpNB

Mark IIbio-pNB

+RIF +PPi-ase

54kDpNB

5µl crude reaction on 4-12% gradient Bis-Tris

14

2. Preparation of S30 extract

The procedure to produce cell-free extract has been highly streamlined by the Swartz lab[32] and removes superfluous steps found in older extract preparation papers. Extract preparation requires four days. The first two days require a negligible amount of time, the third day requires roughly half a day’s time of work, and the last day requires the majority of the day to complete the extract.

The expression system presented here utilizes the BL21 Star (DE3) cell strain.

The BL21 Star strain contains a deletion in the rne131 gene, coding for RNase E. This specific deletion contains the N-terminal domain for obligate ribosomal RNA processing but lacks the C-terminal domain [14, 15]. Removal of this domain increases the stability of the mRNA and improves protein production in cell-free extracts [16, 17]. This strain also contains a DE3 lysogen that harbors T7 RNA polymerase under control of a lac promoter.

To begin the process of lysate creation, BL21 Star (DE3) competent cells

(Invitrogen, C6010-03) are plated on a LB agar plate in order to yield distinct colonies. The plate is incubated overnight at 37°C. The next day, a sterile, baffled 250 ml flask is filled with 75 ml of 2xYT-PG medium (16 g / l tryptone (Sigma Aldrich, T7293), 10 g / l yeast extract (Sigma Aldrich, 70161), 5 g / l NaCl (Sigma Aldrich, 71376), 22 mM NaH2PO4 (Sigma Aldrich, S5011), 40 mM Na2HPO4 (Sigma Aldrich, S5136), and 100 mM glucose (Sigma Aldrich, G7021)). One colony of BL21 Star (DE3) is used to inoculate the medium and the flask is incubated on a shaking platform overnight at 37°C.

The overnight seed culture is used to inoculate large, baffled flasks for growth.

During logarithmic growth phase, the cell strain is mildly induced to express T7 RNA polymerase. Prior to an initial fermentation, an optical density-based growth curve is performed to determine times of lagging and logarithmic growth, as these can greatly vary between medium ingredient lots, different flask sizes, different incubators, etc. Thus, baffled culture flasks containing 2xYT-PG medium are inoculated with 1/100th volume of overnight culture. The flasks are incubated on a shaking platform at 37°C (at 115 rpm for six liter baffled flasks) according to the preestablished growth curve; cultures are grown to approximately 30% of completion of logarithmic growth (~ 2.5 hours for 1.5 liter medium in a six liter baffled flask) and T7 RNA polymerase expression is induced with the addition of 0.25 M IPTG.

Cultures are permitted to grow and continue expression until reaching

approximately 75% of completion of logarithmic growth (an additional ~ 1.75 hours at the above conditions) and then immediately chilled on ice for 15 minutes. The cells are then harvested by centrifugation in a pre-chilled rotor at 4°C for 20 min at 5,000 g. Next, the cell pellets are washed by decanting the exhausted medium supernatant and resuspending them in 1/20th original medium volume of S30 buffer (10 mM Tris-acetate, (pH 8.2; Sigma Aldrich, T1258), 14 mM magnesium acetate tetrahydrate (Sigma Aldrich, M5661), 60 mM potassium acetate (Sigma Aldrich, P1190), and 2 mM dithiotheitol (Sigma Aldrich, D9779)). The pellets can be resuspended through vigorous agitation

15

with a microcentrifuge tube vortexer, or a cordless drill with a plastic spatula attached as the bit (VWR, 53800-005). Two empty 250 ml conical centrifuge tubes are weighed and the mass is recorded. The resuspended cell slurry is divided among the tubes and pelleted at 4°C for 10 min at 5,000 g. The tubes are then carefully decanted and weighed again to determine the wet cell paste mass. Finally, the pellets are flash frozen in liquid nitrogen and stored overnight at -80°C.

Next, the frozen cell pellets are thawed on ice for approximately one hour. S30

buffer is added at a volume of 1 ml per g of wet cell paste, and the pellets are resuspended by vortexing. DTT is added to the approximate volume of cell slurry to a concentration of 5 mM. The cells are then ruptured by application of a French press at 17,000 psi one or two times. The soluble fraction is enriched by centrifugation at 4°C, 30,000 g, for 30 min. The soluble portion is then clarified again by a second centrifugation application at 4°C, 30,000 g, for 30 min in a new centrifuge tube.

A simplified run-off reaction [32] is performed to facilitate release of E. coli

mRNA from the ribosomes; the run-off reaction does not require any reagents. The centrifuged supernatant is carefully aspirated and placed into centrifuge tubes (e.g., 15 ml or 50 ml conical tubes) and is incubated at 37°C for 80 min, rotating end-over-end on a Mini LabRoller (Labnet International, H5500) in the dark (alternatively, the tubes are covered with foil). Next, the lysate is dialyzed in order to control the pH and salt concentration, and then clarified to remove any precipitated proteins.

During the run-off reaction, dialysis tubing (6 – 8 kDa MWCO; Spectra/Por, 132-

650) is prepared by equilibration in Heavy Metals Cleaning Solution (Spectra/Por, 132-908) for approximately one-half hour. The tubing is then copiously washed with ultra-pure water. The run-off reaction is loaded into the tubing and then dialyzed into approximately 80 volumes of pre-chilled S30 buffer at 4°C for one-hour. After dialysis, the lysate is centrifuged at 4°C, 4,000 g, for 10 min to remove precipitated products. Finally, the cell-free extract is aliquoted into microcentrifuge tubes, flash-frozen in liquid nitrogen, and stored at -80°C. The lysate is stable without reduction in expression for at least two months.

2.1 Day 1 (clonal isolation) BL21 Star does not possess an antibiotic resistance gene; care must be taken not to contaminate the cell strain throughout the growth process.

1) Prepare LB-agar plates without antibiotic.

2) Using proper microbial technique, streak BL21 Star from a competent cell tube on the plate in order to isolate single colonies.

3) Incubate the plate overnight at 37°C.

16

2.2 Day 2 (starting seed culture)

A small liquid culture is grown overnight to seed the lysate culture the next day. It is recommended on this day to make and sterilize the growth medium and flasks for use the next day.

1) Make or aliquot 100 ml of 2xYT-PG

2) Place into a 250 ml baffled flask and sterilize

3) Inoculate the culture with a single colony of BL21 Star

4) Grow the culture overnight at 37°C with shaking (~ 250 rpm)

2.3 Day 3 (culture growth & harvest)

The overnight seed culture is used to inoculate large, baffled flasks for growth. During logarithmic growth phase, the cell strain is slightly induced to express T7 RNA polymerase. The cells are harvested, washed, and flash-frozen. It is recommended to construct a growth curve prior to a production run to determine precise timing, which may vary between individuals, medium ingredient lots, different flask size, different incubators, etc.

1) Inoculate baffled cultures flasks at 1:100 ratio. For example, inoculate 1.5 liters of 2xYT-PG in a 6 l baffled flask with 15 ml of overnight seed culture.

2) Incubate the flasks at 37°C with shaking (rpm dependant on the flask size; for instance, 115 rpm in a 6 liter flask).

3) When the cultures reach an OD indicating 30% completion of logarithmic growth, induce the cultures with 0.25 mM IPTG. It is not recommended to increase this concentration. (Typically 2.5 hours in a 6 l baffled flask)

4) Allow induction to continue until growth reaches 50-70% of logarithmic growth (approximately 1.75 hours).

5) Immediately place the flasks on ice.

6) Harvest the cells by centrifugation. Spin in a pre-chilled rotor for 20 min., 5,000 g, 4°C.

7) Begin washing the cell pellet by decanting the supernatant followed by the addition of ~ 1/20 volume of 1x S30 buffer (e.g., for 500 ml culture, add 25 ml of 1x S30 buffer).

8) Resuspend the pellet to wash the cells. With pellet sizes this large, it is often difficult to simply resuspend by vortexing. We use a cordless drill with a plastic spatula attached to the bit (for instance, VWR P/N 53800-005).

17

9) Weigh two empty 250 ml conical centrifuge tubes. Record the empty weight.

10) Combine the resuspended cells into the two tubes, balance.

11) Spin in a pre-chilled rotor for 10 min., 5,000 g, 4°C.

12) Decant the supernatant carefully, weigh the bottles again to determine the wet cell paste mass.

13) Flash-freeze the pellet by dipping the bottles in liquid nitrogen, store overnight at -80°C.

2.4 Day 4 (cell-free extract creation) The frozen cell paste is now ready to be lysed and centrifuged to separate soluble from nonsoluble cellular material. A simplied run-off reaction[32] is performed to facilitate release of E. coli mRNA from the ribosomes, making the mRNA available to endogenous RNases. Next, the lysate is dialyzed in order to control the pH and salt concentration, and then clarified to remove any precipitated proteins. Finally, the cell-free extract is aliquoted and stored for use.

2.4.1 Lyse the cells and remove debris

1) Add 1 ml of fresh 1x S30 buffer per gram of frozen cell paste. Thaw on ice (generally 30-60 minutes).

2) Suspend the cells carefully, using a combination of the drill-mixer and vortexing. This is a crucial step; any small clumps of cells will clog the small channel in the French-press cell diminishing proper cell lysis.

3) Estimate the volume of the resuspended cells and add DTT from a freshly prepared 1 M stock to a final concentratin of 5 mM to protect the lysate against oxidation.

4) Using a French press, lyze the cells in an ice-cold cell. Incorrect use of the French press can cause damage to the cell, the press, or to your body. (Ensure that you are correctly trained to use both the machine and the press cell you will employ.) Prior to use, the press cell should be rinsed with RNase-free deionized water.

5) Run the cell solution through once at 17,000 PSI. Capture lysate in a RNase-free vesicle kept on ice.

6) Reload the lysate and run through the press a second time at 17,000 PSI.

7) Separate the soluble fraction by centrifugation in a pre-chilled rotor, 30 min., 30,000 g, 4°C.

8) Immediately transfer the supernatant to a fresh centrifuge tube. Slowly pipet from the top down, to minimize the amount of insoluble material you carry over to the new tubes.

18

9) Spin again, 30 min., 30,000 g, 4°C.

2.4.2 Perform the run-off reaction

1) Cover two conical tubes (e.g., 15 ml RNase-free Falcon tubes) with aluminum foil (or use amber Falcon tubes).

2) Carefully transfer the supernatant, top down, from the centrifuge tubes to the conical tubes.

3) Incubate the lysate on a rotary or flipping shaker, 37°C, 120-280 rpm, 80 min

2.4.3 Dialyze the lysate 1) First, prepare a >40X volume of cold 1X S30 buffer. (Generally, a 80X volume is

employed.)

2) Cut an appropriate length of 6-8 kDa dialysis tubing (for instance, Spectra/Por P/N 132-650).

3) Soak the tubing for ~30 minutes in 100 mM sodium bicarbonate, 10 mM EDTA in order to chelate the trace amounts of heavy metals that may be present on the dialysis tubing. (Note: this step may be unnecessary, see manufacturer’s instructions)

4) Wash the dialysis tubing well, at least three times, with deionized water.

5) Load the tubing with the run-off reaction, and dialyze against >40 volumes of 1x S30 buffer, 4°C, 1 hour.

6) A small amount of protein will precipitate during dialysis; clarify by centrifugation for 10 min., 4,000 g, 4°C

2.4.4 Aliquot and store the cell-free extract

1) While the dialysis is processing, prepare an area to aliquot the cell-free extract. Fill a large tray or bucket with ice, and set eppendorf tube holders into the ice to cool.

2) Set up a number of DNase-, RNase-free eppendorf tubes into the holders. Approximate the rough volume and divide by the amount you will aliquot.

3) Place the freezer box that will house the aliquoted tubes and place on dry ice.

4) Fill an insulated dewer with liquid nitrogen.

5) Use a repeater pipette to aliquot the cell-free extract into the eppendorf tubes (suggested: 260 µl, which will facilitate 1 ml of reaction).

6) Cap the tubes and toss into the liquid nitrogen to flash-freeze the extract.

7) Remove the tubes (with, for instance, a plastic slotted kitchen spoon) and place into the freezer box.

19

8) Label the freezer box with initials, date, and extract batch number. Store at -80°C. No discernable decrease in quality is seen after three months of storage.

2.5 Lysate yield example

• In the current configuration, six liters of culture, grown in 1.5 l batches in six l baffled flasks, produces ~ 45 g of wet cell paste when cultured correctly.

• 45 g of wet cell waste is processed into ~ 45 ml of cell-free extract.

• 45 ml of cell-free extract accomplishes 180 ml of TnT reactions.

• Thus, 1 g of wet cell paste provides 1 ml of extract yielding 4 ml of TnT reaction.

• This equates to 1 ml of cell culture producing 30 µl of TnT reaction.

20

3. Preparation of the reaction mix

It is suggested to create a large batch of reaction mix, to minimize potential lot-to-lot variability and also to reduce the overall time per year spent on keeping the stocks up. We find a nice volume is 250 ml of reaction mix, enough to fuel 1 l of TnT reactions. (Refer to Appendix C for costs).

The 4X reaction mix contains the small molecules, energy compounds, raw

materials, and co-factors required to fuel transcription and translation in the cell-free extract. It is comprised of magnesium glutamate, ammonium glutamate, potassium glutamate, the canonical ribonucleotide triphosphates, folinic acid, E. coli total tRNAs, the canonical amino acids, phosphoenolpyruvate, nicotinamide adenine dinucleotide, coenzyme A, oxalic acid, putrescine, spermidine, and rifampicin.

*Tyrosine is handled separately because it is difficult to solublize at high concentrations.

1) Prepare the individual components of the reaction mix as indicated in Section 4.2.

2) Take a clean beaker, and rinse several times with pure water.

3) First, add the amino acid mixture aliquot to the beaker.

4) Add 371 mg of tyrosine to the beaker.

5) Next, add the pure water to the beaker.

6) Add the three glutamate salts. Now, mix well.

7) Add the folinic acid, tRNAs, PEP, NAD, coenzyme A, oxalic acid, putrescine, spermidine, and rifampicin. Again, mix well.

Solution Stock Amount to add 4x conc. 1x conc. 19 amino acids 50 mM 40 ml 8 mM 2 mM Tyrosine n/a 371 mg 8 mM 2 mM Water n/a 37.3 ml n/a n/a Mg++ glutamate 1 M 10 ml 40 mM 10 mM NH4

+ glutamate 1.5 M 6.7 ml 40 mM 10 mM K+ glutamate 3.5 M 50 ml 700 mM 175 mM Folinate 10.8 mg / ml 3.14 ml 136 µg / ml 34 µg / ml tRNAs 34 mg / ml 5 ml 682 µg / ml 171 µg / ml PEP 1 M 33.3 ml 120 mM 30 mM NAD 50 mM 6.67 ml 1.33 mM 0.33 mM CoA 40 mM 6.67 ml 1.08 mM 0.27 mM Oxalate 1 M 2.7 ml 10.8 mM 2.7 mM Putrescine 100 mM 10 ml 4 mM 1 mM Spermadine 100 mM 15 ml 6 mM 1.5 mM Rifampicin 1 mg/ml 15 ml 40 µg / ml 10 µg / ml rATP 500 mM 2.5 ml 5 mM 1.25 mM rCTP 500 mM 2 ml 4 mM 1 mM rGTP 500 mM 2 ml 4 mM 1 mM rUTP 500 mM 2 ml 4 mM 1 mM

21

8) Add the four ribonucleotide triphosphates. Mix.

9) Set up an area with eppendorf tube holders, and load with DNase-, RNase-free 0.5 ml eppendorf tubes.

10) Use a repeater pipette to aliquot the cell-free extract into the eppendorf tubes (suggested: 260 µl, which will facilitate 1 ml of reaction). Important: Keep the beaker constantly mixing on a magnetic stir plate to ensure the even distribution of tyrosine flakes throughout the reaction mix as you aspirate.

11) Cap the tubes (carefully to avoid the introduction of RNase), and place in a freezer box.

12) Label the freezer box with initials, date, and extract batch number. Store at -80°C. No discernable decrease in quality is seen after six months of storage.

22

4. Recipes and materials

The Mark II system employs 1 growth medium, 1 buffer, and 35 reaction mix components (20 of which are the canonical amino acids). The cost of reagents shown in this section was valid as of Spring 2008.

4.1 Media and Buffers

As discussed, 2xYT-PG is employed as the growth medium to inhibit the expression of certain phosphatases. S30 buffer is used to suspend, wash, and equilibrate the lysate.

4.1.1 2xYT-PG

2xYT-PG (Twice amount yeast and tryptone with phosphate and glucose) is comprised of the following concentrations of reagents: 16 g tryptone / liter, 10 g yeast extract / liter, 5 g NaCl / liter, 22 mM NaH2PO4, 40 mM Na2HPO4, and 100 mM glucose.

Item MW Vendor P/N Cost Tryptone n/a Sigma T7293 $156.50 / kg Yeast extract n/a Sigma (Fluka) 70161 $58 / 500 g Sodium phosphate dibasic

141.96 Sigma S5136 $76.30 / kg

Sodium phosphate monobasic

119.98 Sigma S5011 $82.20 / kg

Glucose 180.16 Sigma G7021 $25.60 / kg To make 1 liter of 2xYT-PG:

1) Fill a cylinder with ~ 500 ml pure water.

2) Dissolve 16 g tryptone

3) Dissolve 10 g yeast extract

4) Dissolve 5 g salt

5) Bring volume up to 825 ml

6) Autoclave

7) Allow the medium to cool

8) With aseptic technique, add 44 ml 0.5 M NaH2PO4

9) With aseptic technique, add 80 ml 0.5 M Na2HPO4

10) With aseptic technique, add 50 ml 2 M glucose

23

To make 1 liter of 0.5 M NaH2PO4:

Measure 60.0 g sodium phosphate monobasic; suspend in water up to 1000 ml. Filter sterilize. To make 1 liter of 0.5 M Na2HPO4:

Measure 71.0 g sodium phosphate dibasic; suspend in water up to 1000 ml. Filter sterilize. To make 1 liter of 2.0 M glucose:

Measure 360.3 g glucose; suspend in water up to 1000 ml. Filter sterilize.

4.1.2 S30 buffer 1x S30 buffer is comprised of the following reagents: 10 mM Tris-acetate, (pH 8.2), 14 mM magnesium acetate tetrahydrate, 60 mM potassium acetate, and 2 mM dithiotheitol.

Item MW Vendor P/N Cost Tris-OAc 181.19 Sigma T1258 $198.50 / 250 g MgOAc 214.45 Sigma M5661 $26.90 / 250 g KOAc 98.14 Sigma P1190 $56.60 / 500 g DTT 154.25 Sigma D9779 $192 / 10 g In order to ensure that the DTT in the buffer remains fresh, we find it useful to make a 20x stock of S30 buffer without DTT, and adding the DTT in when we dilute the stock to 1x concentration. To make 1 liter of 20X [S30 minus DTT] buffer:

1) Add 200 ml 1M Tris-OAc, pH 8.2

2) Add 280 ml 1M MgOAc

3) Add 300 ml 4M KOAc

4) Add 220 ml water

5) Filter sterilize

To make 1 liter 1X S30 buffer:

1) Add 50 ml 20X [S30 minus DTT]

2) Add 2 ml 1M DTT

3) Add 948 ml water

24

To make 1.0 liter of 1.0 M Tris-acetate, pH 8.2:

Measure 181.19 g Tris-acetate, suspend in 800 ml water. Adjust pH to 8.2 with acetic acid. Bring final volume up to 1000 ml. To make 1.0 liter of 1.0 M magnesium acetate:

Measure 214.5 g magnesium acetate tetrahydrate; suspend in water up to 1000 ml. To make 1.0 liter of 4.0 M potassium acetate:

Measure 392.6 g potassium acetate; suspend in water up to 1000 ml. To make 15 ml of 1.0 M DTT:

Measure 2.32 g DTT; place in 15 ml tube and fill with water up to 15 ml. Cap tightly and store at -20°C.

25

4.2 Reaction mix components

Extreme care is used in the creation of the individual reaction mix components. Chemical purity grades are generally selected near the highest purity, or a near-highest purity if cost is an issue. Chemicals are handled in a way to minimize the components with exogenous RNase sources. To adjust the pH of small volumes, a ‘micro’ pH probe will be needed. Potassium hydroxide (Sigma P5958) is often used to increase the pH. .

Table of stock concentrations, volumes, and pH used to construct the 4X reaction master mix solution. Solutions that are not completely consumed in one batch of reaction mix are stored at -80°C. Putrescine and spermidine are incubated at 37°C in order to change phase into liquid form and are pipetted rather than weighed. Solutions listed as “unbuffered” are not pH-corrected with acid or base due to the solutions’ weak buffering capacity, or because it was specifically left unbuffered in previous protocols

Solution [Stock] Sol’n Volume Amount Final pH Acid/base PEP 1 M 35 ml 7.22 g 6.8 – 7.3 10N KOH NAD 50 mM 7 ml 232 mg 6 – 7 10N KOH CoA 40 mM 7 ml 215 mg 7.3 10N KOH Putrescine 100 mM 10 ml 88.2 mg / 100.5 µl 7.3 glacial HOAc Spermidine 100 mM 15 ml 218 mg / 236 µl 7.3 glacial HOAc Oxalate 1 M 15 ml 2.76 g 8.4 unbuffered Mg++ glutamate 1 M 50 ml 19.43 g 7.3 10N KOH NH4

+ glutamate 1.5 M 50 ml 12.32 g 7.3 10N KOH K+ glutamate 3.5 M 250 ml 177.83 g 8.2 unbuffered Folinate 10.8 mg / ml 15 ml 162 mg 7.0 – 7.5 unbuffered tRNAs 34 mg / ml 5 ml 172 mg 7.2 dissolved in 10

mM K2PO4, pH 7.2 Rifampicin 1mg / ml 50 ml 50 mg 6 – 7 10N KOH rATP 500 mM 5 ml 1.38 g 7.3 10N KOH rCTP 500 mM 5 ml 1.32 g 7.3 10N KOH rGTP 500 mM 5 ml 1.31 g 7.3 10N KOH rUTP 500 mM 5 ml 1.38 g 7.3 10N KOH 19 amino acids 50 mM 250 ml Various n/a 10N KOH

26

4.2.1 PEP Phosphoenol-pyruvate monopotassium salt Roche 108294 $179.10 / 1 g For 1L of TnT (250 ml of 4x Reaction mix) You will make 35 ml of solution You will use 33.3 ml of solution Stock concentration = 1 M Reaction mix concentration = 120 mM Final reaction concentration = 30 mM FW: 206.1 Mass required = 7.22 g

• Weigh powder, place in 50 ml conical tube.

• Add 15 ml pure water and small magnetic stir bar.

• Increase pH with KOH to 6.8 - 7.3

o Initial pH will be ~ 2.5 and a majority of PEP is insoluble.

o Use will need ~ 6 ml of 10 N KOH to facilitate complete solvation (pH ~ 5.5)

o After fully solvated, then begin to pH read and adjust pH.

o You will use about 3 ml more to reach ~ pH 6.5

o At this point, add very small aliquots of KOH as the buffering capability of PEP is greatly diminished at this pH range.

• Remove stir bar, finalize volume to 35 ml.

Discard the unused portion. Date: Starting pH:

Final pH:

For lot #: KOH added:

27

4.2.2 NAD β-Nicotinamide adenine dinucleotide hydrate Sigma N6522 $305.00 / 5 g For 1L of TnT (250 ml of 4x Reaction mix) You will make 7 ml of solution You will use 6.67 ml of solution Stock concentration = 50 mM Reaction mix concentration = 1.33 mM Final reaction concentration = 0.33 mM FW: 663.43 Mass required = 232 mg



• Increase pH with KOH to 6-7.

o Initial pH will be ~ 2.3

o Use will need 20-35 µl of 10N KOH

o Stop increasing pH after solution is above 6.0; at this point, it has very little buffering capability and will easily overshoot.


• Discard the unused portion.

Date: Starting pH:

Final pH:


28

4.2.3 CoA Coenzyme A hydrate Sigma C4282 $198.50 / 100 mg For 1L of TnT (250 ml of 4x Reaction mix) You will make 7 ml of solution You will use 6.75 ml of solution Stock concentration = 40 mM Reaction mix concentration = 1.08 mM Final reaction concentration = 0.27 mM FW: 767.53 Mass required = 215 mg



• Increase pH with KOH to 7.3




Discard the unused portion. Date: Starting pH:

Final pH:


29

4.2.4 Putrescine 1,4-Butanediamine Aldrich D13208 $24.20 / 25 g For 1L of TnT (250 ml of 4x Reaction mix) You will make 10 ml of solution You will use 10 ml of solution Stock concentration = 100 mM Reaction mix concentration = 4 mM Final reaction concentration = 1 mM FW: 88.15 Density: 0.877 Mass required = 88.2 mg Volume required = 100.5 µl

• Melt solid by incubating in 37°C incubator.

• Add 7 ml pure water and small magnetic stir bar in 15 ml conical tube.

• Decrease pH with glacial acetic acid to 7.3


o Use will need 80-120 µl of acetic acid


• Before storing the Aldrich bottle, blanket well with argon; seal and wrap tightly. (Polyamines are sensitive to oxidation by atmospheric oxygen).

Note: Unpleasant smell.

Date: Starting pH:

Final pH:

For lot #: Acid added:

30

4.2.5 Spermidine N-(3-Aminopropyl)-1,4-diaminobutane Sigma S0266 $88.30 / 5 g For 1L of TnT (250 ml of 4x Reaction mix) You will make 15 ml of solution You will use 15 ml of solution Stock concentration = 100 mM Reaction mix concentration = 6 mM Final reaction concentration = 1.5 mM FW: 145.25 Density: 0.925 Mass required = 0.218 mg Volume required = 236 µl

• Melt solid by incubating in 37°C incubator.

• Add 10 ml pure water and small magnetic stir bar in 15 ml conical tube.

• Decrease pH with glacial acetic acid to 7.3

o Initial pH will be ~ 12

o Use will need 250-300 µl of acetic acid


• Before storing the Sigma bottle, blanket well with argon; seal and wrap tightly. (Polyamines are sensitive to oxidation by atmospheric oxygen).

Note: Unpleasant smell.

Date: Starting pH:

Final pH:

For lot #: Acid added:

31

4.2.6 Oxalic acid Potassium oxalate monohydrate Sigma O0501 $13.20 / 100 g For 1L of TnT (250 ml of 4x Reaction mix) You will make 15 ml of solution You will use 2.7 ml of solution (!) Is there frozen stock left? Stock concentration = 1 M Reaction mix concentration = 10.8 mM Final reaction concentration = 2.7 mM FW: 184.23 Mass required = 2.763 g


• Dissolve and bring the volume up to 15 ml.

o The pH of this solution is naturally 8.4; this solution is too weakly buffered to bother attempting to adjust the pH.

Store the remainder at -80°C

Date: Starting pH:

For lot #:

32

4.2.7 Mg(glu)2 L-Glutamic acid hemimagnesium salt tetrahydrate Fluka 49605 $34.10 / 250 g For 1L of TnT (250 ml of 4x Reaction mix) You will make 50 ml of solution You will use 10 ml of solution (!) Is there frozen stock left? Stock concentration = 1 M Reaction mix concentration = 40 mM Final reaction concentration = 10 mM FW: 388.61 Mass required = 19.43 g



• Rotate tube to dissolve powder; it may take 10-60 minutes.





• Filter sterilize.


Date: Starting pH:

Final pH:


33

4.2.8 NH4(glu) L-Glutamic acid ammonium salt Sigma G1376 $34.40 / 100 g For 1L of TnT (250 ml of 4x Reaction mix) You will make 50 ml of solution You will use 6.67 ml of solution (!) Is there frozen stock left? Stock concentration = 1.5 M Reaction mix concentration = 40 mM Final reaction concentration = 10 mM FW: 164.16 Mass required = 12.315 g



• Rotate tube to dissolve powder; it may take 10-60 minutes.







Date: Starting pH:

Final pH:


34

4.2.9 K(glu) L-Glutamic acid potassium salt monohydrate Sigma G1501 $98.60 / 500 g For 1L of TnT (250 ml of 4x Reaction mix) You will make 250 ml of solution You will use 50 ml of solution (!) Is there frozen stock left? Stock concentration = 3.5 M Reaction mix concentration = 700 mM Final reaction concentration = 175 mM FW: 203.23 Mass required = 177.83 g

• Weigh powder, place in 250 ml volumetric flask.


o The pH of this solution is naturally 8.2; the authors’ protocol does not call to adjust the pH of this salt.



Date: Starting pH:

For lot #:

35

4.2.10 Folinic acid Folinic acid calcium salt Sigma F7878 $358.50 / 1 g For 1L of TnT (250 ml of 4x Reaction mix) You will make 15 ml of solution You will use 3.15 ml of solution (!) Is there frozen stock left? Stock concentration = 10,800 µg/ml Reaction mix concentration = 136 µg/ml Final reaction concentration = 34 µg/ml FW: 511.5 Mass required = 162 mg

• Weigh powder, place in 15 ml conical tube


o The pH of this solution is naturally 7.0 – 7.5; this solution is too weakly buffered to bother attempting to adjust the pH.


Date: Starting pH:

For lot #:

36

4.2.11 tRNAs tRNA from E. coli MRE 600 Roche 109550 $418.00 / 500 mg For 1L of TnT (250 ml of 4x Reaction mix) You will make 5 ml of solution You will use 5 ml of solution Stock concentration = 34,000 µg/ml Reaction mix concentration = 682.4 µg/ml Final reaction concentration = 170.6 µg/ml FW: N/A Mass required = 172 mg

• Weigh powder, place in 15 ml conical tube


o Dissolve this solution in 10 mM potassium phosphate, pH 7.2.


Date: Starting pH:

For lot #:

37

4.2.12 Rifampicin Rifampicin Sigma R3501 $72.80 / 1 g For 1L of TnT (250 ml of 4x Reaction mix) You will make 50 ml of solution You will use 15 ml of solution (!) Is there frozen stock left? Stock concentration = 1,000 µg/ml Reaction mix concentration = 40 µg/ml Final reaction concentration = 10 µg/ml FW: 823.0 Mass required = 50 mg



• Increase pH with KOH


o Add 5 µl of 10N KOH



38

4.2.12 ATP Adenosine 5′-triphosphate disodium salt Sigma A2383 $123 / 10 g For 1L of TnT (250 ml of 4x Reaction mix) You will make 5 ml of solution You will use 2.5 ml of solution (!) Is there frozen stock left? Stock concentration = 500 mM Reaction mix concentration = 5 mM Final reaction concentration = 1.25 mM FW: 551.14 Mass required = 1.378 g Lot specific information: 8% water, 0.1% solvent Mass adjustment for water & solvent = 1.081 Real mass required = 1.489 g








Date: Starting pH:

Final pH:


39

4.2.13 CTP Cytidine 5′-triphosphate disodium salt Sigma C1506 $305.50 / 1 g For 1L of TnT (250 ml of 4x Reaction mix) You will make 5 ml of solution You will use 2 ml of solution (!) Is there frozen stock left? Stock concentration = 500 mM Reaction mix concentration = 4 mM Final reaction concentration = 1 mM FW: 527.12 Mass required = 1.318 g Lot specific information: 4% water, 2% solvent Mass adjustment for water & solvent = 1.06 Real mass required = 1.397 g








Date: Starting pH:

Final pH:


40

4.2.14 GTP Guanosine 5′-triphosphate sodium salt hydrate Sigma G8877 $397.50 / 1 g For 1L of TnT (250 ml of 4x Reaction mix) You will make 5 ml of solution You will use 2 ml of solution (!) Is there frozen stock left? Stock concentration = 500 mM Reaction mix concentration = 4 mM Final reaction concentration = 1 mM FW: 523.18 Mass required = 1.308 g Lot specific information: 5.4% water, 0.2% solvent Mass adjustment for water & solvent = 1.056 Real mass required = 1.381 g




o Initial pH will be ~ 5-6




Date: Starting pH:

Final pH:


41

4.2.15 UTP Uridine 5′-triphosphate trisodium salt hydrate Sigma U6750 (Sigma U6625) $147.50 / 1 g ($337.50 / 1 g) For 1L of TnT (250 ml of 4x Reaction mix) You will make 5 ml of solution You will use 2 ml of solution (!) Is there frozen stock left? Stock concentration = 500 mM Reaction mix concentration = 4 mM Final reaction concentration = 1 mM FW: 550.09 Mass required = 1.375 g Lot specific information: 6% water, 0% solvent Mass adjustment for water & solvent = 1.06 Real mass required = 1.458 g




o Initial pH will be ~ 5-6




Date: Starting pH:

Final pH:


42

4.2.16 AA Mix 19 amino acids mixture L-alanine Fluka 05129 $37.70 / 25 g 89.09 g/mol L-arginine Fluka 11009 $19.60 / 25 g 174.20 g/mol L-asparagine Fluka 11149 $36.10 / 25 g 132.12 g/mol L-aspartic acid Fluka 11189 $45.90 / 100 g 133.10 g/mol L-cysteine Fluka 30089 $45.90 / 25 g 121.16 g/mol L-glutamic acid Fluka 49449 $25.10 / 100 g 147.13 g/mol L-glutamine Fluka 49419 $31.60 / 25 g 146.14 g/mol Glycine Fluka 50049 $14.80 / 100 g 75.07 g/mol L-histidine Fluka 53319 $32.10 / 25 g 155.15 g/mol L-isoleucine Fluka 58879 $95.40 / 50 g 131.17 g/mol L-leucine Fluka 61819 $33.10 / 25 g 131.17 g/mol L-lysine monoHCl Fluka 62929 $27.10 / 100 g 182.65 g/mol L-methionine Fluka 64319 $21.60 / 25 g 149.21 g/mol L-phenylalanine Sigma P5482 $23.60 / 25 g 165.19 g/mol L-proline Fluka 81709 $33.70 / 25 g 115.13 g/mol L-serine Fluka 84959 $50.50 / 25 g 105.09 g/mol L-threonine Fluka 89179 $131.60 / 50 g 119.12 g/mol L-tryptophan Fluka 93659 $134.20 / 50 g 204.23 g/mol L-tyrosine Fluka 93829 $23.10 / 25 g 181.19 g/mol L-valine Fluka 94620 $23.10 / 25 g 117.15 g/mol For 1L of TnT (250 ml of 4x Reaction mix) You will make 250 ml of solution You will use 40 ml of solution (!) Is there frozen stock left? Stock concentration = 50 mM each Reaction mix concentration = 8 mM each Final reaction concentration = 2 mM each Start with 200 ml pure water Add: Valine 1.464 g Tryptophan 2.553 g Phenylalanine 2.065 g Isoleucine 1.640 g Shake / incubate for 15 minutes at 37°C

43

Add: Leucine 1.640 g Cysteine 1.515 g Shake / incubate for 15 minutes at 37°C Add: Methionine 1.865 g Alanine 1.114 g Arginine 2.178 g Asparagine 1.652 g Aspartic acid 1.664 g Glutamic acid 1.839 g Glycine 0.938 g Glutamine 1.826 g Add 1.0 ml of 10N KOH. Add: Histidine 1.939 g Lysine 2.283 g Proline 1.439 g Serine 1.314 g Threonine 1.489 g Tyrosine Added

later

• Finalize volume to 250 ml.

• Label six 50 ml conical tubes.

• Pipette 41 ml of the 19 amino acid mixture into each conical tube.

Test remainder or discard

Store aliquots at -80°C

Date: Starting pH:

Final pH:


44

5. References 1. Jewett, M.C. and J.R. Swartz, Rapid expression and purification of 100 nmol

quantities of active protein using cell-free protein synthesis. Biotechnol. Prog., 2004. 20(1): p. 102-109.

2. Kim, D.M. and J.R. Swartz, Regeneration of adenosine triphosphate from glycolytic intermediates for cell-free protein synthesis. Biotechnol. Bioeng., 2001. 74(4): p. 309-316.

3. Jewett, M.C. and J.R. Swartz, Substrate replenishment extends protein synthesis with an in vitro translation system designed to mimic the cytoplasm. Biotechnol. Bioeng., 2004. 87(4): p. 465-472.

4. Jewett, M.C. and J.R. Swartz, Mimicking the Escherichia coli cytoplasmic environment activates long-lived and efficient cell-free protein synthesis. Biotechnol. Bioeng., 2004. 86(1): p. 19-26.

5. Kawarasaki, Y., et al., A long-lived batch reaction system of cell-free protein synthesis. Anal. Biochem., 1995. 226(2): p. 320-324.

6. Kim, R.G. and C.Y. Choi, Expression-independent consumption of substrates in cell-free expression system from Escherichia coli. J. Biotechnol., 2001. 84(1): p. 27-32.

7. Calhoun, K.A. and J.R. Swartz, Energy systems for ATP regeneration in cell-free protein synthesis reactions. Methods Mol. Biol., 2007. 375: p. 3-17.

8. Yang, J., et al., Expression of active murine granulocyte-macrophage colony-stimulating factor in an Escherichia coli cell-free system. Biotechnol. Prog., 2004. 20(6): p. 1689-1696.

9. Kim, D.M. and J.R. Swartz, Oxalate improves protein synthesis by enhancing ATP supply in a cell-free system derived from Escherichia coli. Biotechnol. Lett., 2000. 22: p. 1537-1542.

10. Jewett, M.C. and J.R. Swartz, Rapid expression and purification of 100 nmol quantities of active protein using cell-free protein synthesis. Biotechnol Prog., 2004. 20(1): p. 102-109.

11. Voloshin, A.M. and J.R. Swartz, Efficient and scalable method for scaling up cell free protein synthesis in batch mode. Biotechnol. Bioeng., 2005. 91(4): p. 516-521.

12. Zawada, J., et al., High-density, defined media culture for the production of Escherichia coli cell extracts. Ferm. Biotechnol., 2003. 862: p. 142-156.

13. Zawada, J. and J. Swartz, Maintaining rapid growth in moderate-density Escherichia coli fermentations. Biotechnol. Bioeng., 2005. 89(4): p. 407-415.

14. Kido, M., et al., RNase E polypeptides lacking a carboxyl-terminal half suppress a mukB mutation in Escherichia coli. J. Bacteriol., 1996. 178(13): p. 3917-3925.

15. Lopez, P.J., et al., The C-terminal half of RNase E, which organizes the Escherichia coli degradosome, participates in mRNA degradation but not rRNA processing in vivo. Mol. Microbiol., 1999. 33(1): p. 188-199.

16. Hahn, G.H. and D.M. Kim, Production of milligram quantities of recombinant proteins from PCR-amplified DNAs in a continuous-exchange cell-free protein synthesis system. Anal. Biochem., 2006. 355(1): p. 151-153.

45

17. Ahn, J.H., et al., Cell-free synthesis of recombinant proteins from PCR-amplified genes at a comparable productivity to that of plasmid-based reactions. Biochem. Biophys. Res. Commun., 2005. 338(3): p. 1346-1352.

18. Cox, J.C., et al., Protein fabrication automation. Protein Sci., 2007. 16(3): p. 379-390.

19. Wehrli, W., et al., Interaction of rifamycin with bacterial RNA polymerase. Proc. Natl. Acad. Sci. USA, 1968. 61(2): p. 667-673.

20. Lowe, P.A. and A.D. Malcolm, Rifampicin binding as a probe for subunit interactions in Escherchia coli RNA polymerase. Biochim. Biophys. Acta., 1976. 454(1): p. 129-137.

21. Iskakova, M.B., et al., Troubleshooting coupled in vitro transcription-translation system derived from Escherichia coli cells: synthesis of high-yield fully active proteins. Nucleic Acids Res., 2006. 34(19): p. e135.

22. Nevin, D.E. and J.M. Pratt, A coupled in vitro transcription-translation system for the exclusive synthesis of polypeptides expressed from the T7 promoter. FEBS Lett., 1991. 291(2): p. 259-263.

23. Brooks, R.R. and J.A. Andersen, Substrate, metal and template effects on inhibition of bacteriophage-qbeta ribonucleic acid polymerase by ortho- and pyro-phosphate. Biochem J., 1978. 171(3): p. 725-732.

24. Rubin, H., Central role for magnesium in coordinate control of metabolism and growth in animal cells. Proc. Natl. Acad. Sci. USA, 1975. 72(9): p. 3551-3555.

25. Airas, R.K. and F. Cramer, Pyrophosphate-caused inhibition of the aminoacylation of tRNA by the leucyl-tRNA synthetase from Neurospora crassa. Eur. J. Biochem., 1986. 160(2): p. 291-296.

26. Ravel, J.M., et al., Glutamyl and Glutaminyl Ribonucleic Acid Synthetases of Escherichia Coli W. Separation, Properties, and Stimulation of Adenosine Triphosphate-Pyrophosphate Exchange by Acceptor Ribonucleic Acid. J. Biol. Chem., 1965. 240: p. 432-438.

27. Chamberlin, M., J. McGrath, and L. Waskell, New RNA polymerase from Escherichia coli infected with bacteriophage T7. Nature, 1970. 228(5268): p. 227-231.

28. Davanloo, P., et al., Cloning and expression of the gene for bacteriophage T7 RNA polymerase. Proc. Natl. Acad. Sci. USA, 1984. 81(7): p. 2035-2039.

29. Curry, K.A. and C.S. Tomich, Effect of ribosome binding site on gene expression in Escherichia coli. DNA, 1988. 7(3): p. 173-179.

30. Shine, J. and L. Dalgarno, The 3'-terminal sequence of Escherichia coli 16S ribosomal RNA: complementarity to nonsense triplets and ribosome binding sites. Proc. Natl. Acad. Sci. USA, 1974. 71(4): p. 1342-1346.

31. Mertens, N., E. Remaut, and W. Fiers, Increased stability of phage T7g10 mRNA is mediated by either a 5'- or a 3'-terminal stem-loop structure. Biol. Chem., 1996. 377(12): p. 811-817.

32. Liu, D.V., J.F. Zawada, and J.R. Swartz, Streamlining Escherichia coli S30 extract preparation for economical cell-free protein synthesis. Biotechnol. Prog., 2005. 21(2): p. 460-465.

46

Appendix A – Sample instruction sheet for the end user

Mark II TnT instructions:

1) You get reaction mix from the bottom shelf of the -80°C freezer. 2) You get S30 lysate from the bottom shelf of the -80°C freezer.

Both tubes are filled with 210µl, and are effectively 4x (to comprise ¼ of your final

reaction volume, each). Thus, each tube can make 0.84ml of TnT reaction. (Assume 0.8 ml) If you have spare master mix or S30 lysate (especially the master mix), please share it with lab mates also doing TnTs that day.

Recipe: ¼ volume master mix ¼ volume lysate ½ volume water and template and anything else Example: 12.5 µl master mix 12.5 µl lysate 25.0 µl water + 500 ng your template

Protocol:

1) Set up your water + template volumes in appropriate tubes for air exchange.

2) Vortex the master mix tube to disperse the precipitate (tyrosine) throughout the mixture. Do this just before aliquoting; the tyrosine settles quickly. At 1x, the tyrosine will be (nearly) completely solubilized.

3) Add the master mix and lysate to your templates. You can add them individually, or you can first mix the lysate and vortexed master mix together and then aliquot.

4) Mix each reaction well, do not vortex.

5) Incubate at 30°C or 37°C. Remember to provide air to the reactions! Use AirPore adhesive membrane (Qiagen 19571) to minimize water loss and prevent dust from entering the reaction. Set the incubator to 4°C after expression for overnight reactions.

Version 1.3, created 4/16/08, last revised 12/23/09

47

Appendix B – 5’ and 3’ sequences

For linear templates, we use the following DNA sequence amended to the 5’ portion of the open reading frame, directly preceding the start codon: 5’−GCCAGTGAATTCCGGTCACGCTTGGGACTGCCATAGGCTGGCCCGGTGATGCCGGCCACGATGCGTCCGGCGTAGAGGATCGAGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACC−3’ This contains the T7 promoter (in blue) and ribosomal binding site (in green). We add the following segment to the 3’ portion of the open reading frame: 5’−GGCGGCTCCCACCATCACCATCACCATTAATGAAAGGGCGATATCCAGCACACTGGCGGCCGTTACTAGTGGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATCCGGAGCGACTCCCACGGCACGTTGGCAAGCTCGAAGCTTGGCGTAATC−3’ This contains a linker (GlyGlySer, in orange), a purification tag (here, His6, in yellow) and stop codons (in red) followed by the T7 terminator.

48

Appendix C – Reaction mix cost The cost of creating 250 ml of reaction mix (to do a total of 1 l of TnT reaction) is shown. The prices were valid as of the Spring of 2008. Item Part # Mass (g) Price g needed $ used

Mg(Glu)2 Fluka 49604 250 $34.10 3.886 $0.53NH4(Glu) Sigma G1376 100 $34.40 1.642 $0.56 SaltsK(Glu) Sigma G1501 500 $98.60 35.56 $7.01 $8.11

Rifampicin Sigma R3501 1 $72.80 0.015 $1.09Folinic acid Sigma F7878 1 $358.50 0.03402 $12.20tRNAs Roche 109550 0.5 $418.00 0.172 $143.79PEP Roche 108294 1 $179.10 7.22 $1,293.10NAD Sigma N6522 5 $305.00 0.232 $14.15CoA Sigma C4282 0.1 $198.50 0.215 $426.78Oxalic acid Sigma O0501 100 $13.20 0.497 $0.07Putrescine Aldrich D13208 25 $24.20 0.0882 $0.09 "Biologics"Spermidine Sigma S0266 5 $88.30 0.218 $3.85 $1,895.11

ATP Sigma A2383 10 $123.00 1.489 $18.31CTP Sigma C1506 1 $305.50 1.397 $426.78GTP Sigma G8877 1 $397.50 1.381 $548.95 NTPsUTP Sigma U6750 1 $147.50 1.458 $215.06 $1,209.10

L-alanine Fluka 05129 25 $37.70 0.17824 $0.27L-arginine Fluka 11009 25 $19.60 0.34848 $0.27L-asparagine Fluka 11149 25 $36.10 0.26432 $0.38L-aspartic acid Fluka 11189 100 $45.90 0.26624 $0.12L-cysteine Fluka 30089 25 $45.90 0.2424 $0.45L-glutamic acid Fluka 49449 100 $25.10 0.29424 $0.07L-glutamine Fluka 49419 25 $31.60 0.29216 $0.37Glycine Fluka 50049 100 $14.80 0.15008 $0.02L-histidine Fluka 53319 25 $32.10 0.31024 $0.40L-isoleucine Fluka 58879 50 $95.40 0.2624 $0.50L-leucine Fluka 61819 25 $33.10 0.2624 $0.35L-lysine monoHCl Fluka 62929 100 $27.10 0.36528 $0.10L-methionine Fluka 64319 25 $21.60 0.2984 $0.26L-phenylalanine Sigma P5482 25 $23.60 0.3304 $0.31L-proline Fluka 81709 25 $33.70 0.23024 $0.31L-serine Fluka 84959 25 $50.50 0.21024 $0.42L-threonine Fluka 89179 50 $131.60 0.23824 $0.63L-tryptophan Fluka 93659 50 $134.20 0.408 $1.10L-tyrosine Fluka 93829 25 $23.10 0.3624 $0.33 Amino acidsL-valine Fluka 94620 25 $23.10 0.234 $0.22 $6.88

Total reaction mix cost for a 1L TnT rnx: $3,119.20

Reaction cost for a 50 ul TnT rnx $0.156

cox2009-tnt_creation_in_vitro_coupled_transcription_and_translation_reactions_using_e._coli_lysate_version_1.2...

Documents