1

DETECTION AND SEQUENCE DETERMINATION OF

BEGOMOVIRUSES ASSOCIATED WITH LEAF CURL DISEASE

OF CAPSICUM SPP.

SAMINA YASMIN

07-arid-1269

Department of Botany

Faculty of Sciences

Pir Mehr Ali Shah

Arid Agriculture University Rawalpindi

Pakistan

2018

2

DETECTION AND SEQUENCE DETERMINATION OF

BEGOMOVIRUSES ASSOCIATED WITH LEAF CURL DISEASE

OF CAPSICUM SPP.

by

SAMINA YASMIN

(07-arid-1269)

A thesis submitted in the partial fulfillment of

the requirements for the degree of

Doctor of Philosophy

in

Botany

Department of Botany

Faculty of Sciences

Pir Mehr Ali Shah

Arid Agriculture University Rawalpindi

Pakistan

2018

3

4

5

6

7

CONTENTS

Page

List of Figures x

List of Tables xii

List of abbreviations xiv

Acknowledgments xviii

Abstract 1

1 INTRODUCTION 3

1.1 Bemisiatabaci BIOLOGY 4

1.2 VIRUS CLASSIFICATION 6

1.3 GEMINIVIRIDAE 7

1.3.1 Mastrevirus 7

1.3.2 Curtoviruses 8

1.3.3 Topocuvirus 8

1.3.4 Begomoviruses 8

1.3.4.1 Function of begomovirus protein 9

1.3.4.1.1 Replication encoded protein gene 9

1.3.4.1.2 Transcription activator protein 12

1.3.4.1.3 Replication enhancer protein 13

1.3.4.1.4 AC4 protein 13

1.3.4.1.5 Coat protein 13

1.3.4.1.6 Pre-coat associated protein 14

8

1.3.4.1.7 Nuclear shuttle protein and movement protein 15

1.4 GEMINIVIRUSES AND SATELLITE COMPONENTS 15

1.4.1 Betasatellites 16

1.4.2 Alphasatellites 17

2 REVIEW OF LITERATURE 18

3 MATERIALS AND METHODS 33

3.1 SAMPLE COLLECTION 33

3.2 ENZYME LINKED IMMUNOSORBENT ASSAY (ELISA) 33

3.2.1 Monoclonal Antibodies (Mabs) 33

3.2.2 Sample Preparation 33

3.2.3 Triple Antibody Sandwich Immunosorbent Assay (TAS-ELISA) 34

3.3 DNA EXTRACTION 35

3.4 DNA QUANTIFICATION 35

3.5 AMPLIFICATION OF EXTRACTED DNA 36

3.6 ROLLING-CIRCLE AMPLIFICATION (RCA) 36

3.7 CLONING OF AMPLIFIED DNA 37

3.7.1 Cloning of PCR Product 37

3.7.2 Transformation of heat-shock competent E. coli cells 37

3.7.3 Cloning of RCA Product 37

3.7.4 Plasmid DNA Isolation 38

3.8 MINIPREPARATION 38

3.9 DIGESTION OF PLASMID DNA 39

9

3.10 AGAROSE GEL ELECTROPHORESIS 39

3.11 PURIFICATION OF DNA 39

3.11.1 Gel Extraction And PCR Product Purification 39

3.12 SEQUENCING AND SEQUENCE ANALYSIS 40

4 RESULTS 43

4.1 SAMPLES COLLECTION AND SYMPTOMS 43

4.2 EPITOPE PROFILE OF BEGOMOVIRUS 43

4.2.1 Reaction of Chili Isolates with ACMV, ICMV and OLCV Mabs 43

4.2.1.1 Group I 48

4.2.1.2 Group II 48

4.2.1.3 Group III 48

4.2.1.4 Group IV 48

4.3 DETECTION OF BEGOMOVIRUSES 50

4.3.1 Phylogenetic Analysis Of Partial Sequence Of

Begomoviruses Obtained By Core AC1/AV1 Primers

50

4.3.2 Phylogenetic Analysis of Core Region of Begomovirus

Isolates With Reference Sequence

62

4.4 BETASATELLITE 61

4.4.1 Phylogentic Analysis of Beta Component 74

4.4.2 Phylogentic Analysis of Beta Component with Reference

Betasatellite Component

75

4.4.3 Presence of Multiple Betasatellite in Single Plant 81

4.5 ALPHASATELLITES 81

4.5.1 Phylogentic Relationship Among Alphasatellites 81

10

4.5.2 Phylogentic Analysis With Some Reference Alphasatellite 91

4.6 ROLLING CIRCLE AMPLIFICATION OF BEGOMOVIRUS(RCA) AND

RESTRICTION LENGTH FRAGMENT POLYMORPHISM (RLFP)

92

4.7 ANALYSIS OF SEQUENCE OF DNA-A COMPONENT OF

BEGOMOVIRUS ISOLATES

92

4.7.1 4.7.1 Phylogenic tree and Pairwise Comparison of Presently

Characterized Begomovirus Isolates

101

4.7.2 Pairwise Sequence Comparison between Complete DNA-A of

Isolates 248, 249-1, 249-2 and 251 with Selected

Begomoviruses Available in Gen Bank

101

4.8 PHYLOGENTIC ANALYSIS OF CP 104

4.9 PHYLOGENTIC ANALYSIS OF AV2 111

4.10 PHYLOGENETIC ANALYSIS OF Rep GENE 114

4.11 PHYLOGENETIC ANALYSIS OF TRANSCRIPTION ACTIVATOR

(TrAP) GENE

114

4.12 PHYLOGENETIC ANALYSIS OF REPLICATION (REn) GENE 118

4.13 PHYLOGENTIC ANALYSIS OF AC4 GENE 122

5 DISSCUSSION 131

SUMMARY 139

LEITERATURE CITED 142

APPENDIX 164

11

ABSTRACT

The genus begomovirusbelongs to the family Geminiviridae that have

emerged as serious constraints worldwide and infect variety of crops including

vegetables, ornamental plants and weeds. To determine the diversity of

begomoviruses on chillies,samples were collected on the basis of symptoms from

Attock, Talagang, Chakwal, Islamabad and Hyderabad. Samples were tested by

TAS-ELISA against begomoviruses by use of monoclonal antibodies of African

cassava mosaic virus (ACMV), Indiancassava mosaic virus (ICMV) and Okra leaf

curl virus (OLCV). The results indicated that all isolates showed range of high to

moderate or low level of reaction. A panel of four monoclonal antibodies of

ACMV, three of ICMV and three of OLCV were used. Epitope profile pattern

slightly differed within each group, depending upon the location and concentration

of the virus in the tested isolates. It was also confirmed that symptomatic chilli

samples contained multiple infections of the begomoviruses in the studied area.

Diverse patterns were found indicating great diversity among

begomoviruses infecting chillies. The core region was amplified using two sets of

degenerate primers. The sequencing data of nineteen samples indicates the presence

of nine different species of begomoviruses, namely;Chilli leaf curl virus

(ChLCV),Mesta yellow vein mosaic virus (MYVMV), Tomato enation leaf curl

virus (ToELCV), Tomato leaf curl Karnataka virus (ToLCKV),Tomato leaf curl

Gujarat virus (ToLCGV),Papaya leaf curl virus (PLCV),Tomato yellow leaf curl

virus (ToYLCV),Chilli leaf curl Oman virus (ChLCOV),Pedilanthus leaf curl

virus(PeLCV).More than one virus was isolated from the single sample indicating

1

12

thepresence of mixed populations of begomoviruses in chilli crop.

Full length genome of four different begomovirus species was obtained,

(248)Pedilanthus leaf curl virus (PeLCV), (249)Cotton leaf curl Burewala virus

(CLCuBV), Pepper leaf curlvirus (PepLCV) and (251)Tomato leaf curl Gujarat

virus (ToLCGV). No evidence for the presence of DNA-B was available, using

abutting primers from the Intergenic Region (IR), when the same samples were

tested. This indicates the monopartite nature of begomoviruses isolates, associated

with betasatellites and alphasatellites. It becomes clear that CLCuBV and

PepLCVwere associated with PLCVβ and CLCuBα. However PeLCV possesses

PLCVβ but there was no association of alphasatellites. Furthermore, ToLCGV was

associated EYVβ; however, alphasatellite was absent.

Apart from understanding the nature of mix infection, this study has both

epidemiological and pathological implications. Diseases caused by begomoviruses

and associated DNA satellites have been expanding rapidly both in geographical

distribution and host range. Given the presence of large number of begomoviruses

throughout Asia and Africa, and ability of DNA-β to substitute for DNA-B, the

probability may exist that new species/strains of begomoviruses emerge. Any effort

towards developing resistance to disease, either by conventional or non-

conventional means would be wise to take into account the possibility of more

complex situation becoming important in chilies in the future.

13

Chapter 1

INTRODUCTION

The green revolution increased yield of cereal crops through advanced

farming technologies and genetically improved seeds particularly in Asia and Latin

America. The production of wheat, maize andricedouble from 1975 to 1985. But

vegetable crops has been largely ignored, a key component of a healthy diet. In

addition, vegetables make staple food easily palatable. Vegetables are an important

source of micronutrients, deficiencies of which lead to poor physical and mental

growth (anonymous-CGIAR, 2015).

Among vegetables chilli is one of economical important vegetable and spice

crop cultivated round the year in tropical and sub-tropicalareas.They are cultivated

both for fresh and processed industry. The production and processing of chilies

requires large number of human labor and as a result generatesdirect and indirect

job opportunities in producing areas (Ribeiro, 2006).Along with tomato and potato

it belongs to family Solanaceae. Approximately 150 various kinds of chilies have

been distinguished on the basis of shape, color and pungency in taste (Berke,

2002). The most cultivated species are Capsicum frutescens L. and Capsicum

annuum L. All sweet types are included in C. annuum group whereas hot types are

included in C. frutescens. It is an important source of vitamin A, B complex, C, E,

iron, phosphorus, sulphur, calcium, carotenoids and capsainoids with active

ingredient of capsaicin (Mehmood and Seepul, 2006). Capsicum also contains

some medicinal values such as appetite stimulant, tonic, carminative, astringent,

3

14

antispasmodic, antiseptic, condiment, accentuator and anti-rheumatic etc.

(Anonymous, 2003; Berke, 2002).

In Pakistan, the area under chilies cultivation is 62.9 hectareswith production

rate of 146.2 tonnesin 2014-2015. (AS)Its main production is concentrated in Sindh

province which account for 85% of total production.In south Asian countries

production is declined by both biotic and abiotic factors, but biotic including pests

and pathogens are responsible for considerable yield loses (Green and Kim, 1991).

In few decades, whitefly becomes increasingly important in agricultural system.

Increase in whitefly population is responsible for spread of viral diseases throughout

the world (Jones, 2003; Naranjo and Ellsworth, 2001; Oliveiroet al., 2001). Chilies

are naturally susceptible to range of viruses (Nigam et al., 2015). So far 65 viruses

have been reported throughout world infecting peppers. Among

these,begomoviruses have become increasingly important (Morales and Anderson

2001; Moriones and Nava-Castillo, 2000). Commercially grown chilies were

severely affected by leaf curl disease in 2007 and 2008 with 100 % incidence and

resulted in severe yield losses at several locations in Punjab province (Pakistan),

especially in Faisalabad (Akhteret al., 2009).

1.1BEMISIA TABACI BIOLOGY

Whitefly, Bemisiatabaci(genn) (Homoptera; Aleyrodidae), is responsible for

all ofbegomovirus diseases (Muniyappa and Veeresha, 1984). The B-biotype B.

tabaciis reported to be a potential vector of spreading begomovirusesas well as

serious pest that causes various types of disorders in many agricultural and

horticultural crops in subtropical and tropical parts of the world. New strains of

whitefly have appeared which are very difficult to control. They spread from

15

relatively restricted home ranges to many other countries in last 15 years. The new

strains of B. tabaciare more efficient as virus vector and have high fecundity

(Perringet al., 1993). Whitefly causes damage to plants through direct feeding

(Perringet al., 1991), leading to stunting of plants and yield loss and indirectly,

through the production of sticky exudates or ‘honey dew’, which encourage

development and growth of sooty mold caused by saprophytic fungi

(Capnodiumspp.) on the affected plants (Byrne et al., 1990). They also cause

induction of phytotoxic disorders resulting in silvering in some plants known as

sliver leaf disorder which is restricted to a few genotypes (Bedford et al., 1994;

Byrne et al., 1995). These effects are especially severe when large population of B.

tabacicolonize plants.

Under natural field conditions an average, 12 generations of whitefly are

attained annually (Fishpool and Burban, 1994). Temperature is the key-determining

factor and higher temperatures (30-33°C) result in faster development of adults.

Increase in whitefly population isfavored by radiation, low rainfall and relative

humidity. Great variability has been reported on fecundity, which is affected by

environmental conditions and host-plant species (Byrne and Bellows, 1991).

Whiteflies exhibit distinct biological traits such as range and adoptability in host-

plant, inducement of plant physiological disorders and plant virus transmission

(Maruthiet al., 2002). B. tabaciis a polyphagous species and some biotypes and

genotypes are extremely polyphagous. It colonizes mainly annual, herbaceous plants

(Fishpool and Burban, 1994). However, nearly monophagousB.tabacipopulations

have been recognized, 10 on Jatrophagossypifolia n. and Croton lobatus n. while

theB. tabaci colonizes only cassava in Africa (Storey and Nichols, 1938). B.

16

tabacidisperses mainly by the aid of wind and can move short or long distances but

also by humans who transport plant material carrying the immature and adult stages

(Byrne and Bellows, 1991). Furthermore, cropping practices such as planting date,

crop disposition and intercropping influence whitefly population dynamics and

hence encourage the spread of whitefly-transmitted begomoviruses. The virus can

be spread by nonpropagative and circulative manner. Begomoviruses have been

reported in the epithelial cells of gut and in the salivary gland of B. tabaci as shown

in figure 1.1 (Fargette and Fauquet, 1988). Diverse disease symptoms appear in the

plant invaded by begomoviruses. The symptoms are: vein yellowing, leaf curl,

yellow mosaic, yellow leaf curl, stunting, chlorosis, leaf crumple, vein thickening,

dark green discoloration and leaf distortion (Qaziet al., 2007). New strains of

begomoviruses have apparently emerged in last twenty five years, and they are

dangerously damaging various crops such as cucurbits, beans, peppers, tomatoes,

ornamental and weeds (Brown and Bird, 1992; Polston and Anderson, 1997;

Morales and Anderson, 2001; Jones, 2003).

1.2 VIRUS CLASSIFICATION

Currently thereare 73 families, 9 sub families, 287 genera and 1938 virus

spieces. (Fauquetet al.,2004). The majority of plant viruses have RNA genome

although a few plant viruses have DNA genome. DNA viruses are further grouped

into two general types:1. Circular double stranded DNA, which replicate by reverse

transcription through RNA intermediate i.e. culimoviruses and badnaviruses. 2:

circular single stranded DNA, which replicate through double stranded DNA

intermediate by rolling circle mechanism i.e. geminivirdae. “Geminiviridae”is the

second largest family.

http://onlinelibrary.wiley.com/doi/10.1111/j.1365-3059.2005.01226.x/full#b6#b6http://onlinelibrary.wiley.com/doi/10.1111/j.1365-3059.2005.01226.x/full#b7#b7http://onlinelibrary.wiley.com/doi/10.1111/j.1365-3059.2005.01226.x/full#b8#b8http://onlinelibrary.wiley.com/doi/10.1111/j.1365-3059.2005.01226.x/full#b5#b5

17

1.3 GEMINIVIRIDAE

Gemninviruses are small, single-stranded, circular DNA genomes enclosed

in a protein shell which have a geminate (twinned) quasi-icosahedral shape, on the

basis of which the family name has been derived(Stanelyet al., 2005). Genome of

majority of geminiviruses ranges from 2.7 to 5.2 kb.Geminiviruses are classified by

the International Committee on Taxonomy of Viruses (ICTV) into seven genera,

Begomovirus, Mastrevirus, Curtovirus, Becurtovirus, Eragrovirus, Topocuvirus and

Turncurtovirus on the basis of their genome organization and insect

vectors[http://ictv.org/ssdna.viruses/geminivirdae].

1.3.1Mastrevirus

Mastrevirus is second large genus of family geminivirdae and its type specie

is Maize streak virus. The viruses are necessarily transmitted by leaf hopper and

infect monocot or dicot plants. These viruses are basically phloem limited

(Willmentet al., 2007). Mastrevirus encoded four genes, movement protein gene and

coat protein gene are encoded by V1 and V2 on virion strand while Rep gene is

present on complementary strand and encoded by C1 (Palmer and Rybicki, 1998).

Mastrevirus has unique character with reference to Rep gene as its

expression requires splicing (Wright et al., 1997). Two intergenic region (IR), one

large (LIR) and one small (SIR), opposite of each other containing regulatory

element have been found. Promoters for C1 and V1 are located in LIR (Palmer and

Rybicki, 1998). LIR also contains origin of replication for virion strand synthesis

just like begomoviruses (Willmentet al., 2007),whereas SIR contains origin of

replication for complementary strand synthesis.

18

1.3.2 Curtoviruses

Beet curly top virus is type specie of genus curtoviruses. Curtoviruses are

monopartitegeminiviruses that damage dicot plants and spread by leafhopper. In

contrast, IR of curtoviruses is not enough for full regulation of replication gene.

Only few of curtoviruses are responsible for damage of large number of plants

species (Huret al., 2007).

1.3.3Topocuvirus

Topocuviruses have only one single stranded genome that infects only

dicots. Tomato pseudo-curly top virus is well characterized specie of this. ToPCTV

genome organization is typical to both curtoviruses and begomovirues thus indicates

it is natural recombinant of both of these. However, functions of gene V2, C2, C3,

C4 remains unclear (Briddon and Markham, 2001). Figure 1.2 showed the vector

and genome organization.

1.3.4Begomoviruses

Begomoviruses are whitefly transmitted monopartite or bipartite viruses that

infect only dicot plantswith diverse host range. Only this genus of geminivirdae

contains large number of reported virus species. More than 230 species of

begomoviruses are submitted in Gen bank (Fauquetet al., 2008). Hence, they are

responsible for huge loss worldwide. This large amount of economic loss is due to

polyphagous nature of whitefly,whereas few biotypes are host specific.

Begomovirus infected plants exhibit very diverse symptoms (Briddon,

2003).Bipartite begomoviruses have two genomes designed as DNA-A and DNA-B.

Both of these component share highest nucleotide sequence identity and designed as

common region. (Hanley-Bowdoin,1999). This common region encodes origin of

19

replication gene. Component A contains open reading frame for replication gene,

coat protein gene, transcription activator gene, replication enhancer gene. While

component B encodes inter and intracellular movement protein gene and symptoms

expression genes. CR contains motif for rep gene expression, iteron motif and stem

loop structure with nonanucleotide TAATATTAC, a distinguished character of

geminiviruses (Hanley-Bowdoin, 1999).

Begomoviruses with one circular single stranded genome (DNA-A) is

designed as monopartite. DNA-A of monopartite encode total six ORF, four on

virion sense strand and two on complementary strands. Replication gene, replication

enhancer gene, transcription activator gene and symptoms expression gene are

present on virion sense strand while coat proteinand movement protein geneare

present on complementary strand. Highly conserved region of

monpartitebegomoviruses are known as intergenic region with hair pin motif that

contains nonanucleotide TAATTTAC as shown in figure1.2.

1.3.4.1 Function ofbegomovirus protein

1.3.4.1.1 Replication encoded protein gene

Replication protein gene is also known as AC1, AL1 or C1

ismultifunctionand obligatorily required for replication of virus. Rep protein is

required for several necessary functions such as initiation and termination of rolling

circle replication by cleavage and rejoining of oriC of viral DNA-A (Laufset al.,

1995). Among all geminiviruses AC1 proteins are very similar and showed

sequence conservation (Orozco et al., 2000). Four functional domains required for

begomoviruses rep gene, 1: N terminal domain of approximately 1 to 120 amino

20

acid which is involved in initia

Figure 1.1: Circulative, nonpropagative mechanism of transmission of

begomoviruses by whitefly. Virus is ingested from plant tissue, up the food canal of

stylets, through the esophagus, foregut and mid gut where the virus must pass

through the membrane into the hemcoel. The virus moves with the hemocoel, which

bathes all organs, until contacting the salivary gland membrane. Here the virus must

pass through the barrier of salivary gland membrane to salivary duct and salivated

out through salivary canal of stylets, thus being injected into plant phloem cells

(Fargette and Fauquet, 1988).

21

Figure1.2:Geminivirus genome and viral protein organization (Bowdoinet al., 2013)

http://www.nature.com/nrmicro/journal/v11/n11/box/nrmicro3117_BX1.html#auth-1

22

initiation, 2: site specificnonanucleotide sequence TAATATT↓AC (Heyraud-

Nitschkeet al., 1995). Between the TATA box and transcription start site AC1

protein binding site is located act as replication initiation site (Hanley-Bowdoinet

al., 2004).

AC1 protein alone can start replication without any viral accessory factors

(Honget al., 2003).AC1 also possess helicase activity (Clerotandand Bernardi,

2006). Specific repeated sequences are present in the conserve region known as

iterons these are specie specific. AC1 bind to these sequence during rolling circle

replication and hydrolyses the phosphodiester bond between the seventh and eight

nucleotide of nonanucleotide TAATATT↓AC (Stanley, 1995; Laufset al., 1995).

Many molecules are attached with these iterons sequence, AC1 bind in highly

ordered forms which are obligatory to destabilize the replication start site (Shung

and Sunter, 2007). AC3 assist the AC1, which is replication enhancer (REn also

called C3 or AL3) (Settlageet al., 2005).

1.3.4.1.2 Transcription activator protein (TrAP)

AC2 or AL2 is unique protein only present in genus begomoviruses hence

seems to play distinguished function(Liu et al., 1998).TrAPinteractand move to

nucleus of host plant and facilitate the efficient activation of transcription (Yang et

al., 2007).In this protein three conserved domains are present, a basic domain with

nuclear localization signals at N-terminal and centralDNA binding with zinc finger

motif and acidic domain at C-terminus(Hartitzet al., 1999).TrAP function is not

virus specific. From absence of functional specificity it can be concluded that all

begomoviruses contains common sequence promoters recognized by C2 to interact

23

common sequence of begomovirus host plant to effect transcription activation

(Wang et al., 2005).

1.3.4.1.3 Replication enhancer protein

REn is approximately 16Kd protein also known as AC3 or AL3.This protein

greatly enhances the viral DNA accumulation by interacting with rep. Hence

mutation of AC3/AL3 gene lead to reduced level of viral DNA in transient

replication assay (Wang et al., 2005). Experimental result suggests that AC3 might

increase the affinity of rep for origin (Sunteret al., 1994).

1.3.4.1.4 AC4 protein

This protein open reading frame is embedded in the AC1 open reading frame

and found to be highly variable. AC4 protein plays a key role in symptom

development. Mutation of this protein in bipartite begomoviruses resultes in

wildtype symptoms and found to be non function. Further, it was demonstrated that

C4enhanced the amount viral of DNA and have anti PTGS activity

(Vanitharani,2004).

1.3.4.1.5 Coat protein

Coat protein is encoded by AV1 or V1 gene (Zhang et al., 2001). Coat

protein plays an important role in systemic spread of virus in host plant in case of

monopartitebegomoviruses(Boultonet al., 1991; Briddonet al., 1989). While in case

of bipartite it is not obligatory for this task (Gardiner et al., 1988; Unseldet al.,

2004). Nuclear shuttle protein (NSP) is mandatory for this role (Ingham et al.,

1995). Beside this, CP plays an important role in vector specificity (Briddon, 1990;

24

Hoferet al., 1997; Hohnleet al., 2001) and prevent virus DNA from degradation

during transmission of virus by mechanical inoculation or through insect vector

transmission (Frischmuth and Stanley, 1998).

Muntant coat protein result in low level of virus SSDNA without reduced

level of dsDNA as experimentally concluded in host plant protoplast (Liu et al.,

2001). This is due to the reason that geminiviruses were inoculated in plant cell

cytoplasm followed by their transport in nucleus for replication. This must contain

nuclear localization signals (Gafni and Epel, 2002). These types of signals are

obligatory in both cases i.e. monopartite and bipartite viruses and found in N-

terminal region (Unseldet al., 2001). Host receptors recognize nuclear export signals

(NES) which are necessary for export of virus DNA from nucleus to cytoplasm.

These NESsequence are present in C-terminus of coat protein (Rhee et al., 2000).

1.3.4.1.6Pre-coat associated protein

Old world begomoviruses have an additional protein that contrary to new

world viruses. This protein gene is known as AV2/V2. Movement of

monopartitebegomoviruses is partly dependant on AV2 protein; however, in case of

bipartite viruses its role is still unclear (Rothensteinet al., 2006).But further analysis

suggested that AV2 have role in intracellular transport of bipartite viruses

(Selchow2007). This indicates that new world begomoviruses diverge from old

world begomoviruses (Zrachyaet al., 2006; Rojas et al., 2001).

1.3.4.1.7 Nuclear shuttle protein and movement protein

Movement protein transports the virus from cortical of cytoplasm to barrier

across the cell wall. However, in case of bipartite begomoviruses,DNA-B encodes

25

two proteins nuclear shuttle protein (NSP) and cell to cell movement protein(MP).

Both of these proteins act synergistly to transport virus DNA from nucleus of host

cell where it is replicated to the cytoplasm for systemic spread in to adjacent cell

(Sanderfoot and Lazarowitz, 1996). NSP recognize newly synthesized viral DNA

and transport from nucleus to cytoplasm, whereas MP recognize NSP-viral DNA

complex in cytoplasm and carry them to adjacent cells where NSP-viral DNA

complex dissociate and allow to start another new cycle. This whole process is

highly controlled (McGarryet al., 2003).In few bipartite begomoviruses, MP protein

induces disease symptoms (Houet al., 2000). This was further supported by

evidence that NSP protein have role in pathogenicity (Hussainet al., 2005).

1.4 GEMINIVIRUSES AND SATELLITE COMPONENTS

Satellite components are considered as nucleic acid or viruses which are

dependent on the helper viruses for their replication. However, they encode their

own coat protein, whereas RNA satellites are packaged inside the coat protein of

helper virus (Hussainet al., 2005).

1.4.1 β-Satellites

The first satellite was reported from tomato leaf curl virus (ToLCV) from

Australia (Dry et al., 1997). Sizeof betasatellite was found to be 682nt and sequence

was not similar to the ToLCV but dependant on helper for replication and

encapsidation. But has no remarkable effect on symptoms induced by ToLCV. This

is contrary to the betasatellites which has great influence on symptom induction in

host plant (Briddonet al., 2001; Jose and Usha, 2003; Saunders etal., 2000; Zhou et

al., 2003).Cotton leaf curl virus(CuLCV) from Pakistan and ageratum yellow vein

mosaic virus(AYVV) from Singapore aremonopartitebegomoviruses.They are found

26

to be pathogenic but do not cause any symptoms but a unique component was found

associated with both of these viruses and causes specific symptoms in both host

plants (Saunders et al., 2000; Briddonet al., 2001).

Detailed study of betasatellite genome revealed that half of the helper virus

in size and are dependent on helper virus for replication, encapsidation and spread in

host plant (Saunders et al., 2000; Briddonet al., 2001). Betasatellites have three

distinctive attributes; a highly conserved region, a single open reading frame

encodingβC1 gene, and A-richregion (Zhou et al., 2003).Mutant A-rich region

containing beta cause mild symptoms (Tao and Zhou, 2004).Accurate function of

single gene of betasatellite is still unclear. But contemporary finding showed that it

was found to be pathogencity determinant and suppressor of RNA silencing (Cui et

al., 2005; Qaziet al., 2007). Betasatellites possess no iterons like helper viruses but

they must possess sequences that are recognized by begomovirus encoded

replication gene so that transreplication of betasatellites could occur (Saunders et

al., 2000).

1.4.2 Alphasatellites

There is anotherclassofsatetellites known as alphasatellites, just like

betasatellite they are half in size to that of helper virus (Briddonet al., 2004 and

stanelyet al., 2004). Alphasatellites encode only single gene similar to the

nanoviruses. In contrast to betasatellite, alphasatellites are not required for induction

of symptoms and proliferation of helper virus.However they are dependent on

helper virus for their encapsidation and proliferation.

This study has been proposed with the following objectives:

27

Epitope profile for detection and diversity of the begomoviruses.

Amplification of begomovirus isolates using degenerate primers.

Amplification and DNA sequencing of full length genome of begomovirus

isolates.

Phylogenetic anaylsis of sequence data.

18

Chapter 2

REVIEW OF LITERATURE

Kumar et al.(2016) collected chilies samples from Binjnour region of

utherperdesh, India. Isolated DNA from collected plant samples was amplified and

PCR product was subjected to cloning and sequencing. Pairwise study of whole

genome showed that it is greater than 91% similar with Tomato leaf curl New Dehli

virus whereas associated betasatellite shared less than 90% identity with Tomato

leaf curl Bangladesh betasatellite. According to current criteria of specie

demarcation they identified new species of begomovirus infecting chilies in

Bijinour and named this new specie Chili leaf curl Bijinour virus.

Khamenehet al.(2016) surveyed vegetable grown fields during 2102-2014,

to determine the prevalence of begomoviruses in these crops. Symptomatic 787

samples of vegetables and some other crops were tested by enzyme linked immune

sorbent assay, 81 samples were found to be ELISA positive which were further

confirmed through polymerase chain reaction by specific primers TYLCV-

Sar/TYLCV-Isr. Expected PCR product of size 670bps confirm the association of

begomoviruses with peppers, tomato, spinach and alfalfa. Universal primers

Begomo-F/Begomo-R yielded 2.8kbs product and sequence of these isolates were

compared with previously reported sequence available in database, they shared

99% nucleotide sequence homology with Tomato leaf curl New Dehli virus

(ToLCNDV). Thus this study reported the natural spread of ToLCNDV in

vegetable grown area in Iran. Zaidiet al.(2016) collected symptomatic plant sample

sesbaniabispinosa from cotton leaf curl disease affected cotton field. Selected plant

19

showed typical begomovirus symptoms. Extracted DNA was amplified, cloned and

sequenced along with associated betasatellite. Sequence comparison revealed that it

shared highest 97.9% homology with Pedilanthus leaf curl virus (PeLCV)

previously reported from soya bean and cognate betasatellite showed 96-97%

homology with tobacco leaf curl betasatellite. These results indicated the expansion

of host range.

Zaidiet al.(2015) carried out investigation during 2014 in Gossypium

cultivating region of Punjab, Pakistan. They collected few diseased samples from

Gojra region of Punjab on the basis of leaf curl symptoms of cotton. Total genome

was extracted and resolved agrose gel was transferred to nylon membrane with

Cotton leaf curl Burewala virus (CLCuBV) probe. Probe detected the presence of

begomovirus in two out of six samples. Further begomovirus specific primers was

used and 2.8bps amplified product was obtained and cloned product was

sequenced. Comparison of sequence revealed 99% homology with Tomato leaf curl

Gujarat virus a bipartite virus reported from India. For confirmation of bipartite

nature DNA-B specific primers was designed and 2.7bps product was obtained

which confirmed bipartite nature of reported virus from cotton.

Kumar et al.(2015) conducted the survey of chili growing areas in India. It

is famous all over the world especially in sub continents as spice crop but its

production is limited due chili leaf curl disease caused by whitefly transmitted

begomoviruse. Survey indicated that beside chili leaf curl disease (ChLCD) there

was complex association of other begomoviruses and betasatellites in numbers of

different crops and weeds. Cognate betasatellite enhance the symptom severity in

20

infected chili crop. Recombination is more evident in intra-species. AV1 gene of

helper virus and βC1 of betasatellites showed high variability among all other

genes of begomoviruses. This study demonstrates the important role of betasatellite

in disease severity.

Tang et al.(2015) worked on M. coromandelianum, a weed from

Guangdong a province of china. They isolated Malvastrum leaf curl Guangdong

virus along with satellite virus from infected weed. They described that satellite

particles had typical betasatellites features, a highly conserved SCR with hair pin

motif, adenine rich region and single ORF, βC1. Blast result showed that it had

71.9% sequence similarity with tomato leaf curl Philippine associated betasatellite.

But dendrogram of this revealed that it showed grouping with Laguna 1 and

Laguna 2 of ToLCPB. Established criteria for betasatellites demarcation showed

that it is different strain; name malvastrum leaf curl Guandongbetasatellites

assigned.

Schreinemacherset al.(2015) reported that in tropical and sub-tropical

countries vector transmitted diseases are common and responsible for huge

economic losses. Integrated approaches, resistant crops and crop management are

employed to reduce the loss. But such strategies are very rarely used in developing

countries. They visited 800 vegetable (chilli, tomato and mung bean) field in India,

Thailand and Vietnam to know the farmers perception in yield loss and their

control measures. Majority of grower correlated damage with pest and some

disease and few had knowledge of insect vector and its role in spread of viral

diseases. Synthetic pesticides are commonly used as solution. Spread of knowledge

21

among farmers is very important to overcome the problem in affected areas. Best

solution in long term is to introduce disease resistant crops.

Kumar et al.(2015) found that leaf curl disease of cotton is highly

destructive in the subcontinent. They investigated three begomovirusesCotton leaf

curl Multan virus. (CLCuMV), Cotton leaf curl Kokhran virus (CLCuKV), Cotton

leaf curl Burewala virus (CLCuBV) in association with Cotton leaf curl Multan

virus betasatellite (CLCuMB) and Cotton leaf curl Multan virus alphasatellite

(CLCuMA) infecting cotton crop. CLCuBV with mutant transcriptional activator

protein (TrAP) was detected in some infected plants along with its cognate

betasatellite cotton leaf curl Multan betasatellite. To check the pathogenicity of

mutant CLCuBV, inoculation of healthy plant with mutant CLCuBV with its

associated beta and alphasatellite was done, these produce typical cotton leaf curl

disease symptoms. Inoculation of CLCuKV with CLCuMB/CLCuMA severe

disease symptom was observed. Whereas CLCuMV induces mild symptoms, as

CLCuMV was reported to be recombinant in nature. From these finding it was

concluded that two strainsof CLCuBV exist one with intact TrAP and one with

mutant TrAP. In same way two strains of CLCuMV exist one produces mild

disease symptoms and other with severe symptoms.

Akhtaret al.(2014) studied begomovirus disease complex on chilies, a

common problem throughout the Indian sub-continent. They carried out detailed

analysis of Tomato leaf curl New Dehli virus and associated Chilli leaf curl

betasatellites. Extracted DNA-A and DNA-B of ToLCNDV and ChLCBfrom chilli

host was inoculated in Nicotianabenthamianaby biolistic gene gun method.

22

Experimental plant produced typical symptoms induced by ToLCNDV and

associated satellite cause severity in symptoms. This experiment demonstrated that

betasatellites spread severe disease complex in infected host and geographic area as

well.

Shujaet al.(2014) reported that leaf curl of cotton is highly devastating in

Pakistan and North West region of India caused by single circular stranded

begomoviruses. Disease severity occurs in the presence of specific betasatellites,

Cotton leaf curl Multan betasatellite (CLCuMB). In 2001 when resistance to cotton

leaf curl disease is over since then only single strain of begomovirus, Cotton leaf

curl Burewala virus (CLCuBuV) with disease symptoms of CLCuD is prevalent

according data available in Gen bank. A survey was conducted in 2012 in Layyah

district in Punjab province of Pakistan. Nucleotide sequence analysis showed that

βC1 of betasatellite is recombinant, possess typical feature of post resistance break.

Helper virus CLCuBuV was different from previously reported and depicts new

strain. Virus contains recombination and sequence was derived from two species

that was common before resistance breaks but contain unique resistance break sites.

Bandaranayakeet al. (2014) found that cucurbits are famous all over the

world especially in tropic and sub tropic areas. Plant viruses are responsible for

economic loss in vegetable crops. There was a large list of viral diseases reported

from Sri Lanka but till date no begomoviruses were reported. A bitter gourd plant

with leaf curl symptom was collected and subjected to PCR analysis by using

universal but begomovirus specific primers. Sequence analysis confirmed the

association of the leaf curl symptoms with begomovirus. Similarly begomovirus

23

was detected from bitter gourd, ridge gourd, pumpkin, cucumber and snake gourd

by using CP specific primers, as CP is most conserve part among the

begomoviruses and this part is usually amplified for detection of begomoviruses. A

PCR product of 550bps was obtained which was sequenced. Nucleotide sequence

analysis and phylogenic analysis showed close relationship with Tomato leaf curl

New Dehli virus bitter Gourd (ToLCNDV-BG) reported from Pakistan.

Srivastavaet al. (2014) screenedTabernaemontanacoronaria and Cestrum

nocturnumby employing the rolling circle amplification. They investigated that

these isolated shared greatest homology 95% with each other and 93% sequence

similarity with Pedilanthus leaf curl virus. Further phylogenetic analysis confirmed

strong relationship with PeLCV. Hence these studied isolates were recognized as

variant of PeLCV. This was firs report of PeLCV from C. nocturnum and T.

coronaria from Indian and all other the world.

Marwalet al.(2014) collected Vincaalba plant on the basis of some disease

symptoms from Rajistan and Bhatida city of Punjab province, India. Coat protein

gene is highly conserved among geminiviruses, for detection of begomoviruses CP

specific primers was used and 550bps product was obtained.Confirms the

association of disease with begomovirus, beside helper virus alphasatellite was also

obtained by using alpha specific primers but they were unable to find the

betasatellite particles. Sequence comparison showed that CP was 95% similar with

Papaya leaf curl crumple virus and Rose leaf curl virus.Whereas helper

begomovirus and alphasatellite was identical with isolates reported from Pakistan,

China, India, Taiwan etc. this study indicated emergence of new specie through

24

recombination and posses great threat to agricultural and horticultural crops.

Jyothsnaet al.(2013) organized a survey in tomato growing area in 2008,

Maharashtra state of India where yield loss was 100%. Detection results revealed

the presence of three species of begomoviruses in studied area and more than 60%

of samples were infected with Tomato leaf curl Gujarat virus (ToLCuGV). These

isolates differed from Tomato leaf curl Gujarat virus-Varnasi, as in these isolates

DNA-B was absent in spite a single species of betasatellite was present. They are

like the begomoviruses from old world, in this case tomato yellow leaf curl

Thailand betasatellite. ToLCuG alone is speedy infectious agent and spread

systemic infection in tomato and Nicotianabenthamiana. Inoculation of ToLCuGV

with associated betasatellite enhanced symptoms severity and reduces the

incubation period of virus for symptoms expression.

Xieet al.(2013) isolated a new begomovirus species from

Malvastrumcoromandelianum and tomato from Yunnan, China. Whole genome

except for C4 gene, showed similarity with Tomato leaf curl China

virus(ToLCCV). On this basis name Tomato leaf curl Yunnan virus (ToLCYV) was

proposed. Isolated DNA was inoculated into Agrobactrium, inoculation experiment

showed that ToLCYV is infection to range of host plants but poorly infectious to

M. coromandelianum. Despite this it was found ToLCCV did not produce disease

severity in absence of betasatellite; however, ToLCYV alone was infectious

without betasatellite particle. In majority of field collected samples betasatellites

were not present. Transgenic expression AC4 of both TYLCYV and TYLCCNV,

was checked and come out with this view that TYLCYV causes some

25

developmental abnormalities whereas TYLCCNV do not showed such

abnormalities. AC4 gene of TYLCYV was highly methylated as compare to

TYLCCNV and more efficient in post transcriptional and transcriptional gene

silencing. Thus it was concluded that AC4 gene evolved from recombination was

more virulent and manage the pathogenicity of helper virus.

Vanithaet al.(2013) characterized the WTGS responsible for spread of leaf

curl disease of sunflower in northern Karnataka, south India, sunflower is important

oil yielding crop and leaf curl disease reduce the yield. They cloned and sequenced

the helper virus and betasatellite and found 2761bps DNA-A and 1373bps

betasatellite.DNA-A showed highest (97.17%) sequence homology with Tomato

leaf curl Karnataka virus clone KH13, (ToLCKV-KH13), (96.9%) Tomato leaf

curl Karnataka virus clone IK3 (ToLCKV-IK3) and satellite particles shared

(93.07%) with potato leaf curl apical betasatellite and 94% with papaya leaf curl

betasatellite (PaLCuB) from India. Tomato leaf curl Karnataka virus with

accompanying betasatellites responsible for leaf curl disease of sunflower was first

time reported from India.

Jyothsnaet al.(2013) investigated the weeds for reservoirs of

begomoviruses. They observed bright yellow symptoms on abutilon pictum in

Udhagamandalam, Tamil Nadu, India. Amplification, cloning and sequencing

confirmed the association of Abutilon mosaic virus (AbMV). Clones generated

through rolling circle, inoculated by gene gun in Nicotianabenthamania, three out

of nine showed the presence of viral DNA-A, beside this mutation was detected in

AC1 gene. This was the first report of AbMV in India.

26

Leonardo et al. (2012) found greatest economic loss in tomato crop in

Brazil. They collected infectious plant from field and applied molecular techniques

for identification of disease causing agent. They are able to get three full lengths

DNA-A of Brazilian begomoviruses, one of them is total new specie, Tomato

interveinalchlorosis virus (ToICV), while other two were shown to be previously

reportedTomato mottle leaf curl virus (TMoLCV), Tomato golden vein virus

(TGVV) and Tomato severe rugose virus strains were also reported. Dendrogram

of studied isolates with other isolates retrieved from Genbank showed that all

studied isolates segregates with tomato infecting Brazilian begomoviruses.

Wyantet al.(2012) examined the structure of small circular DNA by

combination of rolling circle amplification, restriction digestion and pyro-

sequencing. A bulk of 61 samples was analysed from Asia, South America and

Central America. 83 contig sequence of geminiviral DNA and 4 contig sequence of

satellite DNA were obtained. The efficacy of this approach was proven for

Brazilian begomoviruses. Accuracy of sequence was found by comparing cloning

and sequencing of Bovilianbegomoviruses reported few years ago. Therefore

mixtures of all these technique called circomics reduce cost and labor for

characterization of geminivirdae genome.

Yang et al.(2011) characterized novel specie of tomato infecting

begomovirus together with associated betasatellite from Guangxi province of china.

Different recombination anaylsis was carried out to check the recombination and to

find out from which strain of begomovirus diverge. Finding of analysis showed that

it diverged from Tomato leaf curl Gujarat virus (ToLCGV), Tomato leaf curl

27

Vietnam (ToLCVV) virus and another unknown virus. Hence name tomato leaf

curl China virus (ToLCCNV) was assigned, a betasatellite was detected with

helper Tomato leaf curl China virus. Infectious clone of ToLCCNV was

constructed to fulfill the Koach postulates, ToLCCNV alone was not sufficient for

disease symptoms. βC1 protein suppress the RNA silencing and promoted the

nuclear location. This was confirmed through mutation analysis of βC1 gene, so

ToLCCNVB is necessary for spread of disease.

Singh et al.(2012) reported that begomoviruses are important devastating

pathogen throughout the world especially in tropical and sub-tropical countries

because of most favorable condition for spread of insect vector Bemisiatabaci. A

vast diversity of begomoviruses is present in subcontinent; recombination, pseudo

recombination and mutation are major factor for this great diversity. They found

that leaf curl disease of Radish in India is spread by the interaction of two

begomoviruses from old world and betasatellites were identified as recombinant

radish leaf curl disease. It shared 87.7% highest sequence similarity with Pepper

leaf curl Bangladesh virus whereas radish leaf curl- Pataudi is isolate of Croton

yellow vein mosaic virus and had 95.8% homology. Recombination analysis by

RDP revealed that RaLCD is hybrid of Euphorbia leaf curl virus and Papaya leaf

curl virus. Clone of RaLCD and their betasatellite was inoculated to check

pathogenicity of virus. It was concluded that interaction of betasatellite with helper

virus increase the symptoms severity in host plant.

Pratabet al.(2011) amplified, cloned and sequenced the complete

component-A and component-B component. Total genome was extracted from egg

28

plant with yellow mosaic symptoms. Sequence comparison indicated that it is

97.6% identical with Tomato leaf curl New Dehli virus (ToLCNDV-IND) and

87.9% with Tomato leaf curl papaya virus-papaya reported from Lucknow.

Whereas DNA-B shared 94.1 % with Tomato leaf curl New Dehli virus Indian

isolate (ToLCNDV-IND) and 76.2% with Tomato leaf curl Lucknow virus. Hence

from this study they concluded that it is new strain of Tomatoleaf curl new Dehli

virus, for which the name Tomato leaf curl New Dehli-Nagpurproposed.

Pathogenicity was further confirmed by inoculation in healthy plants. This is first

experimental proof of Koch postulates of begomovirus association with yellow

mosaic disease of egg plant.

Paprotkaet al.(2010) first time reported two new strains of bipartite along

with naturally present two DNA-1 (alphasatellite) in new world. They showed

resemblance to nanoviruses. Genome organization was typical to that of

nanoviruses, conserved region with stem loop motif with characteristics

nonanucleotide sequence TAA/GTATTAC, adenine rich region and single ORF.

Alphasatellite along with helper virus Euphorbia mosaic virus (EuMV) and Cleome

leaf crumple virus (CILCrV) was inoculated in natural host and experimental plant

Arabidopsis thaliana. New satellite particle causes disease symptoms and helper

virus transreplicate the satellite virus.

Ilyaset al. (2010)conducted survey across Pakistan for occurrence of

Legume yellow vein mosaic virus. They determined complete nucleotide sequence

of 44 isolates, 23 DNA-A, 19 DNA-B and 2 betasatellites. Their finding showed

that Mung bean yellow mosaic virus is prevalent in legumes cultivated areas. A

29

devastating pathogen reported in weeds from India, first identified in non cultivated

plants. Later this species was found in Pakistan together with novel betasatellite.

These provide evidence of interspecies recombination with non legume infecting

begomoviruses. Thus findings lead to conclusion that more virulent strains of

legume infecting begomoviruses could appear.

Pandeyet al. (2010) collected symptomatic tomato plants. Rolling circle

amplification was done to increase the amount of viral DNA which was then

subjected to restriction digestion by selected enzyme, cloning and sequencing.

Sequence comparison showed typical begomovirus genome organization, they are

unable to identify any DNA-B component and betasatllite. Two studied isolates

showed homology with Tomato leaf curl virus (ToLCV-CTM) and ToLCVK3/K5,

but this value is less than threshold value for specie demarcation. As result CTM

and K3/K5 are reported as novel specie in genus begomovirus, there is probability

that these novel species evolve due to recombination. Thus occurrence of new

species might cause a great economic threat to vegetable production in Asian

continent.

Trisnoet al.(2009) analyzed the pepper samples from Indonesia for presence

of begomoviruses. Degenerate primers pAL1v 1978 and pARc 715 were used for

PCR amplification, a product of 1.6kbs was visualized on agrose gel which was

directly send for sequencing. Sequence analysis showed conserved stem loop motif

is present along with nonanucleotide TAATATTAC, a character confined only with

geminiviruses. Based on phylogentic analysis and hair pin structure comparison

that studied isolate showed closet relationship with Pepper yellow leaf curl

30

Indonesia virus (PYLVIV) and Tomato yellow leaf curl Indonesia virus (TYLCIV).

But found to be different from begomoviruses those reported from Asia.

Cuong Haet al. (2008) characterized sixteen different species of

begomoviruses that infect weeds and crops in Vietnam. Nine species are identified

as novel of which six are monopartite and three are bipartite and rest of five species

were identified first time in Vietnam. These helper viruses were found associated

with betasatellites, five of them were novel satellite particles. Corchorus golden

mosaic virus is bipartite begomovirus close relative of previously

reportedCorchorus golden mosaic virus and some other new world bipartite

viruses. These finding provide evidence for the presence of new world viruses in

old world. Recombinant viruses, satellite viruses and some previously not well

characterized viruses with variation in stem loop structure supported that there is

great diversity among begomoviruses particularly in Southeast Asia and Vietnam.

Santosoet al.(2008) collected tomato samples on the basis of typical

begomovirus symptoms from eight locations in Java and Sumatra, Indonesia. Coat

protein (AV1) is highly conserved among geminivirdae, AV1 specific primers were

used for coat protein gene amplification. PCR product was direct sequenced which

was then subjected to blast analysis. Nucleotide sequence and amino acid sequence

comparison confirmed the association of begomoviruses and further analysis

demonstrated that these are variant of AYVV reported from Indonesia.

Haibleet al.(2006) described economical, simplified and most reliable

method for amplification of circular single stranded genome DNA viruses like

geminiviruses, nanoviruses and circoviruses as compared to antibody and PCR

31

detection method. Success of rolling circle amplification (RCA) is due to following

reasons, no need of expensive machinery, easy to handle, low template, no need of

prior information of sequence, and more economical per reaction. Beside this RCA

can be subjected to restriction digest and direct sequencing of linear DNA up to

900 bases in single run. The invention of this method accelerates the accurate

detection of geminiviruses.

Delatteet al.(2005) have determined biological and molecular properties of

Tomato leaf curl Madagascar isolate from moronodova and toliary (ToLCMGV-

[Tol], -[Mor]), Tomato leaf curl Mayotte virus isolate from Dembeni (ToLCYTV-

[Dem], -[Kah]) and kahani and Tomato leaf curl virus isolate (TYLCV-Mld[RE])

from Reunion. That was shown to be infectious to tomato. They found that all these

viruses have typicalmomopartite genome organization, (ToLCMGV-[Tol],-[Mor]),

(ToLCYTV-[Dem],-[Kah]) showed similarity with African

begomovirusesbutinphylogenic tree represent different monophyletic group. They

named them as south west island of Indian Ocean isolates. All these isolates

showed recombination and provide evidence of isolation of virus population.

Fauquetet al.(2005) reported that the great diversity of whitefly transmitted

geminiviruses was found across the Nile and Mediterranean basin since last twenty

years. Great diversity emerged as result of recombination event. Recombination

and phylogenetic analysis revealed that tomato infecting begomoviruses in this

geographic area formed two major groups Tomato yellow leaf curl sardinia virus

and Tomato yellow leaf curl virus. Pairwise sequence similarity dendrogram and

gene conversion were carried out from which biodiversity of virus can be

32

concluded. A total of six hotspot and three similar sequence in genome of tomato

infecting begomoviruses was found which provide evidence that recombination is

not a random event.

Nagata et al.(2004) employed the phi-29 DNA polymerase for whole

genome amplification in single step. This method is economical and easiest way to

get whole genome. Total genome was extracted and amplified product can be direct

sequenced or subjected to RFLP, cloned and sequenced. This rolling circle

amplification simplified the amplification of circular genome and make cloning

successful.

Ambrozeviciuset al. (2002)were of view that begomviruses infecting

tomato are highly diverse group of begomoviruses. They collected plants leaves

from south east region of Brazil and analysed direct nucleotide sequence of PCR

product. 137 out of 369 tested samples were infected with begomoviruses.

Dendrogram of these isolates showed a wide range of diversity among detected

begomoviruses in tomato from selected area. Tomato cholortic mottle virus is

mainly present in Minas Gerais and distinct specie was reported from Rio de

Janeiro that was not completely characterized yet. Further finding indicated four

more new species were present. This high level of diversity provides evidence of

transfer of wild species of begomoviruses in tomatoes.

33

Chapter 3

MATERIALS AND METHODS

3.1SAMPLE COLLECTION

Symptomatic samples were collected from farmer’s fields from Chakwal,

Attock, Talagang, Rawalpindi/Islamabad and Sindh and photographed with digital

camera. Leaves of symptomatic plants were kept in sample storage bags, labeled

and transported on ice before being stored at -20oCuntil they were processed for

DNA extraction.

3.2 ENZYME LINKED IMMUNOSORBENT ASSAY (ELISA)

The chilli samples were tested by triple antibody sandwich enzyme linked

immune sorbent assay (TAS-ELISA). It was also applied to confirm the

transmission of virus and to study the epitope profiles of samples.

3.2.1 Monoclonal Antibodies (Mabs)

The panels of monoclonal antibodies (Mabs) raised against particles of

African Cassava Mosaic Virus (ACMV), (number SCR 17,18,20,23),

IndianCassava Mosaic Virus (ICMV), (SCR54,55,56) and Okra Leaf Curl Virus

(OLCV), (SCR 102,104,106) were used for epitope profiling (Thomas et al.,1986;

Swanson and Harrison,1993).

3.2.2 Sample Preparation

Leaf extracts were made by grinding leaf sample in extraction buffer (0.05

M Tris-HCl, 0.005 M EDTA, pH 8.0, containing 2 %(w/v) PVP (MWt 44,000) and

0.05% (v/v) Tween-20, in a pestle and mortar. Control samples including leaf

34

extracts from healthy tomato (Lycopersicumesculentum) leaf samples, and

extraction buffer only were also used in ELISA.

3.2.3 Triple Antibody Sandwich Immunosorbent Assay(TAS-ELISA)

Triple antibody sandwich ELISA was used as applied by Harrison et al. (1997).

The wells of the plates were coated with purified polyclonal antibody against

ACMV (100µl/well), diluted in coating buffer (0.05M sodium carbonate buffer pH

9.6) 1:10,000 and placed at room temperature for 3 hrs. Washing of the plates was

done three times with 0.01M phosphate buffered saline, pH 7.4 (PBS), containing

0.05% Tween-20 (v/v) (PBST). Micro plates were coated with test samples

(100µl/well) and then placed at 4ºC for 24 hrs. Washing step was followed as

described earlier. Test antigens were blocked by five percent skimmed milk in

PBST containing 2% (w/v) polyvinylpyrollidine (PVP) and allowed at

approximately 28ºC for half an hour. The plates were drained. Mabs to ACMV,

ICMV and OLCV diluted at 1:5 in PBST+PVP were added to the wells (100µl) and

placed at room temperature for 2-3 hrs. Then washing of the plates were done as

described earlier. The rabbit anti-mouse IgG (whole molecule) conjugated with

alkaline phosphatase enzyme (ALP) diluted to 1:5000 in the conjugate buffer

(PBST+PVP) containing 0.2%(w/v) 0.2% ovalalbumin was put in micro plates

(100µl/well) and placed for 2 hrs at room temperature. The washing was again

performed and attached ALP was detected by the use of p-nitro phenyl phosphate at

0.6mg/ml in substrate buffer (10% v/v) diethanolamine pH 9.3; 150µl/well).

Absorbance (A 405nm) was determined in TitertekMultiscan Plus. Measurement

was taken after 1 hr at room temperature, and again after incubating overnight at

4ºC. A 405 nm values were the means of duplicate wells minus values for the

35

buffer control. All the values which were less than twice of healthy control were

given a score of zero.

3.3DNA EXTRACTION

Total DNA was from symptomatic leaf samples by Cetyltriethyl

Ammonium Bromide (CTAB) as described by Doyle and Doyle (1990). 100mg

tissue was crushed in liquid nitrogen. Powdered tissue was transferred in

microcentrifuge tube and mixed with 700µL pre warmed CTAB buffer (100mM

Tris-HCl [pH 8.0], 20mM EDTA, 1.4M NaCl, 2% [w/v] CTAB and 0.02% β-

mercaptoethanol and incubated for half hour at 65oC.

Samples were incubated at room temperature until sample’s temperature

becomes equal to room temperature. Equal volume of chloroform/isoamyl alcohol

(24:1) was added, mixed well and centrifuged for 10 min at 9000 rpm in a

microfuge eppendorf. Aqueous phase containing DNA was taken into new

eppendorf tube and 0.6% isoproponal was added to precipitate the DNA.

Centrifugation for 10 min at 13200 rpm transfers the DNA into pellet form.

Supernatant was discarded and pellet was washed with 70% (v/v) ethanol. Air dried

pellet was dissolved in double distilled water for final use.

3.4 DNAQUANTIFICATION

Concentrations of DNA was found out using nano drop (Thermo Scientific)

by measurning the absorbance at a wavelength of 260nm with conversion factor of

1 OD = 50 μg

3.5AMPLIFICATION OF EXTRACTED DNA

For amplification of DNA by PCR a reaction mixture of 25μL containing

36

1μl template DNA, 2.5 µlPCR Buffer D, containing 100mM Tris, pH 8.3, 25mM

MgCl2 and 500mM KCl. 1μl of 10mM dNTP mix, 0.5μM each of primers AV and

AC and 0.1ul Polymerase was prepared. The reaction mixture was incubated in

thermal cycler.The thermal cycler was programmed for a preheat treatment of 95oC

for 1 minutes followed by 35 cycles of 95oC for 1min, 58oC for 1min and extension

at 72oCfor different times (1min per 1000 nucleotides to be amplified), followed by

a final extension for 10 min at 72oC and PCR cycler was set at 4oC for infinite time

until the samples were removed.

3.6 ROLLING-CIRCLE AMPLIFICATION(RCA)

To increase the number of copies of circular genome by RCA a total

volume of 33.6μl of reaction mixture containing 50ng genomic DNA of infected

plant samples was prepared. 15μl of sample DNA and 3μl of sample buffer was

mixed in a PCR tube. The mixture was incubated in PCR cycler at 95°C for 3

minutes to denature double stranded DNA. A master mix of 15μl of reaction buffer

and 0.6μl of Phi29 enzyme was prepared in separate micro centrifuge tube. After

denaturation of template and sample buffer, this mixture was cooled to 4°C and

master mix of reaction buffer and enzyme was added in denatured, cooled template

and sample buffer. Incubation was followed at 30°C for 18hours followed by

another incubation at 65°C for 10 minutes to deactivate the enzyme.

3.7 CLONING OF AMPLIFIED DNA

3.7.1 Cloning of PCR Product

PCR amplified DNA was cloned using the pGEM T-Easy Vector System I,

PCR Cloning Kit (Promega) according to the instructions given by the

37

manufacturer. In brief, a reaction mixture of 10μL-20 μL containing 18 to 540ng

PCR product (depends upon thelength of DNA fragment), 1μLpGEM T-

EasyVector, 5μL 5XRapid Ligation Bufferand 1μL T4DNA Ligase, was prepared

in a 1.5mL microcentrifuge tube and incubated at 4°Covernight. The following day

the ligation mixture was transformed to competent cellsofE.coli(DH5α) by the

heat-shock method.

3.7.2Transformation of Heat-Shock Competent E. coli Cells

Competent E. coli cells were transformed by the methods as explained by

Sambrook, Frisch and Maniatis (1989). Whole ligation mixture that was incubated

at 4°C for overnight was added to thawed competent E. coli (200ul), mixed very

carefully followed by incubation on ice for 20min.The cells were subjected to heat

shock at 42°C in water bath for 1min. After heat shock cells were transferred to ice

and incubated for 5min. 500μL LB medium was added in each tube and mixed very

gently and put at 37°C in shaking machine for 30 min. Transformed cells were

spread on solid LB media plates with 100μg/mL amplicillin, spread and (50mg/mL)

X-Gal were used for plating-out the transformed cells and incubated at 37°Cfor 16

hours. On appearance of colonies, white colonies were picked by sterile tooth picks

and colony PCR was done.

3.7.3 Cloning of RCA Product

RCA product was digested with unique cutter enzymes into monomers.

Cloning vector (usually pGEM3Z and pGEM5Z) was also restricted with same

enzyme. Vector and insert were ligated in a reaction mixture of 20 μL containing

vector and insert in 1:3 ratios, 4μL 5X ligation buffer and 1μL T4 DNA ligase.

38

Ligation mixture was kept at 16°Covernight and next day transformed into

competent E. coli cells.

3.7.4 Plasmid DNA Isolation

A single transformed bacterial colony from agar plate was picked up with

the help of sterile tooth pick and inoculated into 500µL LB broth in presence of

selective conditions, appropriate antibody in a sterile culture tube. Bacterial culture

was grown overnight at 37°Cwith shaking at 250 rpm for logarithmic phase. When

the culture was ready, supernatant was removed through centrifugation and pelleted

bacterial cells were retrieved.

3.8 MINIPREPARATION

For DNA sequencing, the plasmid was isolated by GeneJET Plasmid

Miniprep Kit (Fermentas). The culture of E. coli was decanted into 1.5 mL

microcentrifuge tube and centrifuged for 20 minutes. The pellet was re-suspended

in 250μL resuspension solution and cells were lysed with 250μL lysis solution.

350μL neutralization solution was added mixed thoroughly and the tube was

centrifuged at 13,200 for five minutes. A mini-column provided with the kit was

inserted into the collection tube and the supernatant was transferred to the column.

The column was centrifuged for one minute to bind the DNA to the matrix and the

flow through in the collection tube was discarded. The matrix was washed twice,

first 700μL wash solution was added and incubated at room temperature for one

minute and then centrifuged for one minute. The wash solution was removed from

the column and the column washed with 500μl column wash solution.

Subsequently the column was centrifuged for one minute with an empty collection

tube to remove residual ethanol. Finally the column was inserted into a fresh

39

microcentrifuge tube. DNA in the column was dissolved in 50μL double disttled

water, incubated at room temperature and recovered by centrifugation.

3.9 DIGESTION OF PLASMID DNA

Purified plasmids DNA was digested with restriction endonucleases and

their corresponding buffers in accordance with the supplier’s (Fermentas or

Promega) guidelines. Reaction volume of 10μl was used for screening plasmid

preparations. A distinct banding pattern was visualized on agrose gel and size of

plasmid was confirmed by simply adding the size of DNA band.

3.10 AGAROSE GEL ELECTROPHORESIS

Agrose gel electrophoresis is the simplest technique for separating the DNA

fragments. Different percentage (0.7-1%) of agrose gel containing

ethdiumbromide(0.5µg/mL) was prepared depending on the size of fragment to be

resolved. Agrose gel was prepared in either 1X TBE (890mM Tris [pH 8.3],

890mM boric acid, 20mM EDTA,) or 1X TAE (40mM Tris-acetate [pH 8.4], 1mM

EDTA) buffer. TBE gels were electrophoresed at approximately 60V and TAE gels

at 120V. Nucleic acid was mixed with 6X loading dye (Thermo Fisher Scientific).

The DNA resolved band was visualized under gel documentation system. Fragment

size was confirmed by comparison with a co-electrophoresis 1kbp molecular

marker (Fermentas).

3.11 PURIFICATION OF DNA

3.11.1 Gel Extraction and PCR Product Purification

DNA was run on 0.8% (w/v) agarose gels and the desired fragments were

cut out from the gel using a scalpel under UV light. DNA from the gel was isolated

40

and PCR Clean-Up System (Promega) by the method described by the

manufacturer. The excised gel slice was weighed and placed in a 1.5mL

microcentrifuge tube to which was added 10μL membrane binding solution per

10mg of gel slice. The tube was vortex and incubated at 60°Cuntil the gel slice was

completely dissolved. An equal volume of membrane binding solution was mixed

with the dissolved gel mixture and then transferred to the mini column assembly,

incubated at room temperature for 1 minute, and centrifuged at 16,000×g for 1

minute. The flow-through was discarded and the mini column was reinserted into

the collection tube. 500μL of membrane wash solution was added and the tube with

column centrifuged at 16,000×g for 1 minute. Again the flow-through was

discarded and 500μL membrane wash solution was added in the column. After 5

minutes of centrifugation at 16,000×g the collection tube was emptied and the mini

column with empty collection tube was centrifuged for 1 minute. Finally the mini

column was transferred to a clean micro centrifuge tube, 50μL nuclease-free water

was added to the mini column, incubated at room temperature for 1 minute, and

centrifuged at 16,000×g for 1 minute. The mini column was discarded and purified

DNA was stored at -20°C.

3.12 SEQUENCING AND SEQUENCE ANALYSIS

Plasmids were purified using a GeneJET Plasmid Miniprep Kit (Fermentas)

and their sequences were determined commercially. Sequences at the ends of

clones were determined using the M13forward (-20) and M13reverse (40) primers.

These sequences were then extended by designing specific primers; a process

known as primer walking. Sequence data were assembled and analysed with the aid

of Lasergene package of sequence analysis software (DNAStar Inc., UA, AZ,

41

USA). A sequence similarity search (Blast) was performed by comparing the

sequence to other begomovirus sequences in the database

(http://www.ncbi.nlm.nih.gov/BLAST/) and open reading frames were located

using ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). Final sequences

were submitted to the EMBL sequence database. Multiple sequence alignments

were performed using Clustal W (Thompson et al., 1997) and Mega Align program

of the Lasergene package. Phylogenetic trees were constructed using the Neighbor

Joining algorithm of Clustal W and displayed, manipulated, and printed using Tree

view.

42

Table 3.1:Sequences of primers used during the study

Primers Nucleotide Sequence

Core (AV) 5’ GCC HAT RTA YAG RAA GCC MAG RAT 3’

Core (AC) 5’ GGR TTD GAR GCA TGH GTA CAN GCC 3’

Beta F 5’GGTACCGCCGGAGCTTAGCWCKCC3’

Beta R 5’GGTACCGTAGCTAAGGCTGCTGCG3’

Alpha F 5’AAGCTT AGAGGAAACTAGGGTTTC3’

Alpha R 5’AAGCTTTTCATACARTARTCNCRDG3’

Bur-F 5’ TAGGAATTATGTCGAAGCGACC 3’

Bur-R 5’GCCCTTATTACCAGGATTAAATC 3’

PAL1v1978 5’GCATCTGCAGGCCCACAT(Y)GTCTT(Y)CCNGT3’

PAR1c496 5’AATACTGCAGGGCTT(Y)CTRTACATRGG 3’

43

Chapter 4

RESULTS

4.1 SAMPLES COLLECTION AND SYMPTOMS

Chilli plants showing begomovirus symptoms i.e. upward leaf curling and

stunted growth chorosis were collected and stored in ice box. These symptoms are

shown in figure 2A, B, D, E, G, H,I and J. The major areas of sampling were

around Attock, Chakwal, Talagang and Islamabad (NARC and surrounding farms

areas).The chilli samples from Sindh showed severed leaf curling, leaf shorting,

short internodes, overall retarded growth and no fruit at allas shown in figure 4.4.

The details of samples presented in table 4.2 showed coding of isolates and

sampling area is mentioned in map (Figure 4.3).

4.2 EPITOPE PROFILE OF BEGOMOVIRUS

4.2.1 Reaction of Chili Isolates with ACMV, ICMV and OLCV Mabs

Serological relationship among begomoviruses was determined with the

panel of monoclonal antibodies raised against African cassava mosaic virus

(ACMV SCR 17, 18, 20, and 23), Indian cassava mosaic virus(ICMV SCR 54, 55,

56) and Okra leaf curl virus (OLCV SCR 102,104,106). A total of twenty nine

samples were tested of which 17 gave very strong reaction upto level four. These

samples mostly reacted strongly with ACMV and ICMV. Further detail showed

that Mab 20 and 23 of ACMV and 54 and 55 of ICMV reacted to level four. Few

samples reacted with only Mab 106 of OLCV to level four.

However, the rest of the twelve samples were positive, but reaction strength

was weak, they reacted withall of the Mabs with strength one or two, this might be

44

Table 4.2: Locations and coding of samples collected

Plant Name Area Sample Name

Capsicum annuum (Chilli) Attock (ATK) 1

Capsicum annuum(Chilli) Attock 2

Capsicum annuum(Chilli) Attock 9

Capsicum annuum(Chilli) Attock 10

Capsicum annuum(Chilli) Islamabad (ISB) 245

Capsicum annuum (Chilli) Islamabad 246

Capsicum annuum (Chilli) Islamabad 248

Capsicum annuum (Chilli) Islamabad 249

Capsicum annuum (Chilli) Islamabad 250

Capsicum annuum (Chilli) Islamabad 251

Capsicum annuum (Chilli) Sindh (SND) 312

Capsicum annuum (Chilli) Sindh 320

Capsicum annuum (Chilli) Sindh 321

Capsicum annuum (Chilli) Sindh 331

Capsicum annuum (Chilli) Sindh 332

Capsicum annuum (Chilli) Talagang (TLG) 503

Capsicum annuum (Chilli) Talagang 504

Capsicum annuum (Chilli) Chakwal (CHK) 509

Capsicum annuum (Chilli) Chakwal 510

45

Figure 4.3: Red circles on map showing sample collection area

46

332

A B

C D

E

251

1 2

331

249

G

47

F

Figure 4.4: Naturally infected symptomatic plant used in current study

Symptomatic leaves (A, B), from Attock, (C, D) from Sindh, (E, F) from

Islamabad, (G,H) Talagang region,(I,J) Chakwal

503

H

509

J

G

504

I

510

48

due to low virus concentration orintegration of epitopes during storage. The details

of epitope profiling are presented in table 4.3.

4.2.1.1 Group I

As two ACMV Mab 20, 23 and only one ICMV Mab 55 reacted to level

four, this reactivity pattern differentiate group I from group II. Total of three

isolates 248, 249 and 250 formed second groups on the basis of Mabs reactivity,

they showed distinct epitope profiling as two ACMV Mabs 20, 23 and one ICMV

Mabs 55 reacted upto level 3 and 4.

4.2.1.2 Group 1I

Strong reactivity with two ACMV Mab 20, 23 and two ICMV Mab 54 and

55 make group II unique from rest of groups. Samples were grouped on the basis of

Mabs reactivity from strong to very strong level. Seven samples 1, 9,10, 245, 251,

503 and 504 were grouped together, as isolate 1 reacted upto level 3 with ACMV

Mab 23 whereas isolates 9, 10,245 and 251 reacted from level 3 to 4 with ACMV

Mab 23, ICMV Mabs 54 and 55 respectively. However, isolates 503 and 504

reacted strongly with upto level 3 with ICMV Mab 54.

4.2.1.3 Group III

Strong reaction with OLCV Mab 106 make group III unique from group I

and II. Four isolates 320, 321, 509 and 510 formed group three. Distinct pattern

was observed as only these isolates reacted from level 3 to 4 with OLCV Mab 106.

4.2.1.4 Group IV

This group is unique in the sense as it reacted with one ICMV Mab 60 and one

OLCV Mab 106. Three isolates 312, 331 and 332 reacted with ICMV Mab 60

49

Table 4.3: Epitope profile of Geminivirus isolates from chilies

code

Monoclonal antibodies

African Cassava Mosaic virus

(ACMV)

Indian Cassava Mosaic

Virus (ICMV)

Okra Leaf Curl

Virus (OLCV)

17 18 20 23 54 55 60 62 102 106

1 1 1 2 3 1 1 2 1 1 2

9 1 2 2 3 4 4 2 1 1 1

10 1 2 2 3 4 2 1 1 1 1

245 0 1 1 3 3 2 1 0 0 1

503 1 1 2 2 3 2 1 0 0 1

504 1 1 2 2 3 1 1 0 0 1

251 1 1 4 4 3 4 2 0 0 1

248 0 0 4 4 1 2 0 0 0 1

249 0 1 3 2 1 2 0 0 0 1

250 0 0 3 2 1 4 0 0 0 1

320 2 1 1 1 2 2 2 2 2 3

321 1 1 1 1 2 2 2 1 1 4

509 1 1 1 2 2 2 1 1 1 3

510 1 2 1 2 2 2 1 1 1 4

312 2 2 2 2 2 2 3 2 2 4

331 2 2 2 2 2 2 3 2 1 4

332 2 2 2 1 2 2 3 2 2 3

*Absorbance values at A405 nm following incubation with substrate. The reaction was scored as: 4

(>1.80), 3 (1.21-1.80), 2 (0.61- 1.20), 1 (0.15- 0.60), 0 (

50

and OLCV Mab 106 with strong reaction strength from 3 to 4, respectively. Hence,

they formed group four with unique epitope profile pattern.

4.3 DETECTION OF BEGOMOVIRUSES

The total DNA was extracted from symptomatic plants by CTAB method

and Gene Jet kit manufactured by Fermentas. The quantification of extracted DNA

was determined by nanodrop and details were presented in annexure 1. Two sets of

diagnostic primers (as mentioned in table1.1) were used for amplification of

begomovirus genomes. The first primer pair PAlv 1978 and PARc 496 was used to

amplify a product of 1.2 kbp. A total of 34 samples were tested and 19 of them

gave expected size of product. The details of samples that gave expected PCR

product are given in table 4.4.

The second primers pairs, core AC1/AV1 amplified all intergenic or

common regions, part of Rep and AV1 gene along with complete AV2 gene. A

product was amplified having 650bp in size as shown in figure4.5. This was cloned

in pGEM T-easy vector and colonies were confirmed by colony PCR using M13

forward and reverse primers. After confirmation, the plasmid product was

sequenced from School of Biological Sciences. The obtained sequence were

analyzed by Laser DNA package v. 12 and blast search was carried out and

sequence that had maximum query cover were selected for further analysis.

4.3.1 Phylogenetic Analysis of Partial Sequence of Begomoviruses Obtained by

Core AC1/AV1 Primers

All the 19 product sequenced were of 650 bps. They were aligned using

Clustal W program. The phylogenic tree was constructed by using the maximum

51

likelihood method with 1,000 bootstraps in Molecular Evolutionary Genetics

Analysis (MEGA) v.7.0 software. The Boot strapping was applied to statistically

validate the tree using ML-plot. Topography of phylogenetic tree revealed that tree

is divided into two major clades, clade I is sub divided into four sub clade and clade

II is sub divided into two sub clade as shown in figure4.6. The sub clade IA has

isolates 9b, 10a, 10b, 10c and 2b from Attock region whereas 245a, 246b and 246c

from Islamabad region and one isolate 504 from Talagang region. In sub clade IB

three isolates falls, 251a from Islamabad, 9a from Attock and 509c from Chakwal

region. Sub clade IC has all isolates (248a, 248c, 249b, 250a and 250b) Islamabad

region, 510b and 510c lies in same sub clade IIIA. Sub clade ID has all isolates

(312a, 312b, 312c, 320a, 320b, 321a and 331c) from Sindh region with exception

of 503c from Talagang region.

Clade II has three sub clades, in sub clade IB all Sindh isolates (331a, 332a,

332b and320c) group together with 100 bootstrap values. 509a and 509b lies in

samesub cluster but they formed separate group with high bootstrap value 99. 251b

also present in same sub cluster. Sub clade IIB showed two groups in one group

allIslamabad isolates (249b, 249c, 248b and 250c) are present with one exception

of 321b from Sindh area. In sub clade IIB three Attock isolates (1a, 1b and 2a) and

331b (Sindh isolate) showed grouping, while 504a, 504c,246a, 245b and 9c

grouptogether.

4.3.2 Phylogenetic Analysis of Core Region of Begomovirus Isolates with

Reference Sequence

All partial sequence was aligned with eleven most closely related sequences

52

Figure 4.5:Detection of begomovirus

Water 1 2 9 10

M

100bps

500bps

1000bp

s

2000bps

600bps

53

Figure4.6: Phylogentic analysis of core region of begomoviruses

Cluster I

Cluster II

Sub clade IA

Sub clade IB

Sub clade IC

Sub clade ID

Sub clade IIA

Sub clade IIB

Sub clade IIB

54

245b_Islamabad

245b_Islamabad 100.0 246a_Islamabad 246a_Islamabad 97.4 100.0 246b_Islamabad

246b_Islamabad 96.7 99.4 100.0 246c_Islamabad 246c_Islamabad 97.4 100.0 99.4 100.0 248a_Islamabad

248a_Islamabad 82.3 83.9 83.1 83.9 100.0 248b_Islamabad 248b_Islamabad 81.9 84.3 83.5 84.3 99.7 100.0 248c_Islamabad

248c_Islamabad 81.9 84.3 83.5 84.3 99.7 100.0 100.0 249a_Islamabad 249a_Islamabad 81.9 84.3 83.5 84.3 99.7 100.0 100.0 100.0 249b_Islamabad

249b_Islamabad 81.9 84.3 83.5 84.3 99.7 100.0 100.0 100.0 100.0 249c_Islamabad 249c_Islamabad 81.9 84.3 83.5 84.3 99.7 100.0 100.0 100.0 100.0 100.0 250a_Islamabad

250a_Islamabad 81.9 84.3 83.5 84.3 99.7 100.0 100.0 100.0 100.0 100.0 100.0 250b_Islamabad 82.3 84.7 83.9 84.7 99.4 99.7 99.7 99.7 99.7 99.7 99.7

250c_Islamabad 81.9 84.3 83.5 84.3 99.7 100.0 100.0 100.0 100.0 100.0 100.0 251a_Islamabad 57.7 58.4 58.3 58.4 56.0 56.5 56.5 56.5 56.5 56.5 56.5 251b_Islamabad 57.7 58.4 58.3 58.4 56.0 56.5 56.5 56.5 56.5 56.5 56.5 2a_Attock 88.4 89.8 89.1 89.8 80.2 80.6 80.6 80.6 80.6 80.6 80.6 2b_Attock 88.0 90.2 89.5 90.2 80.6 81.0 81.0 81.0 81.0 81.0 81.0 312a_Sindh 60.6 62.6 61.6 62.6 67.3 67.8 67.8 67.8 67.8 67.8 67.8 312b_Sindh 60.6 62.6 61.6 62.6 67.3 67.8 67.8 67.8 67.8 67.8 67.8 312c_Sindh 60.0