Detection of mutation in rpoB gene of Multi Drug Resistant strains of Mycobacterium tuberculosis from the isolates of Nepal by Amplification Refractory Mutation System

(ARMS) – A pilot study

A thesis report presentation in partial fulfillment of the requirement for The Bachelor of science degree in Biotechnology

BYMr. Krishna Sundar Twayana

Mr. Nipin ShresthaMr. Prajwal Bhandari

04/17/2023 1

Supervisor:Mr. Bal Hari PoudelDepartment of Biotechnology Tribhuwan University

04/17/2023 2

Introduction:• TB is an infectious disease caused by Mycobacteria

species namely Mycobacterium tuberculosis, along with M. bovis, M. africanum, and M. microti; tuberculosis species complex.

• M tuberculosis was discovered by Robert Koch in 1882.• Primary infection takes place in respiratory system

called pulmonary TB, secondary infections may develop in other organs called extra pulmonary TB.

• Mycobacterium tuberculosis- a slow growing acid fast bacilli and an obligate aerobe.

04/17/2023 3

Current Scenario of TB cases:• 1/3rd of global population infected.• Nepal – 49 thousands population was reported to bear new

cases in TB. 6.2 thousand were dead.• China – 1 million new cases .• India – 2.3 million new cases.

4

Drugs against TB

• First drug Streptomycin (SM)1944, in the same year para-aminosalicylic (PAS) introduced and first combinatorial regimen trialed in the year 1950.

• In 1952, INH + SM +PAS – treatment regimen for 18-24 months.• 1960 EMB replaced PAS, regimen for 18 months• 1970 Rif, regimen 9 months• 1980 Pyrazinamide, regimen reduced to 6 months.• Directly Observed treatment short course (DOTS) introduced by

WHO in 1991 with combinatorial regimen of INH+RIF+PZA+EMB.• Drugs adminstered in two phases, Initial - INH+RIF+PZA+EMB, for two months, Continuation phase - INH+RIF, for 4-7 monthsThese are the first line drugs.

04/17/2023

04/17/2023 5

Drug resistance:

• Soon after development of drugs its resistant strains have been reported, particular genomic mutation in specific gene is traced as molecular cause.

Isoniazid (INH): • A prodrug, activated by peroxidase catalase, coded by katG to form

reactive oxygen species i.e superoxides, peroxides, hydroxyl radicals, nitric oxides and reactive organic species like isonicotinic-acyl radical.

• Primary target – product of InhA ;enoyl-acyl carrier protein reductase and DfrA ; NADPH dependent dihydrofolate

reductase required for DNA synthesis.• Resistant strains found to be mutated in - katG, most frequent point mutation S315T

- InhA, six point mutations reported Ile16Thr, Ile21Thr, Ile21Val,Ile47Thr, Val78Ala and Ile95Pro

04/17/2023 6

Rifampicin Introduced in1972, helped to reduce the treatment regimen to 6

months in combination with PZA. Rifampicin inhibits the transcription by binding to β-subunit of DNA

dependent RNA polymerase, coded by rpob. rpoB is a 3534 bp ORF which codes for 1178 amino acids. Resistant development due to mutation in rpoB gene. Mutation reported to be concentrated to 81bp region from codon 507 -

533 in more than 90% cases, so known as Rifampicin resistance determinant region (RRDR)

• Mutation involves point mutations at codon 531,526, 522,516, 513 and 511and some deletions 513-514.

• The resistant MTB against firstline drugs is countered with the secondline drug regimen involving aminoglycosides – kanamycin, amikacins, capreomycins, cycloserines, ethionamide and some fluroquinones.

04/17/2023 7

• Pyrazinamide (PZA): A prodrug activated to pyrazinoic acid by enzyme

pyrazinamidase coded by pncA. • Ethambutol (EMB):• Used in combination with INH, RIF and PZA• EMB is a bacteriostatic agent that is active for growing bacilli

and has no effect on non-replicating bacilli. EMB arabinogalactan(cell wall

component) synthesis Arabinogalactan is synthesized by arabinosyl transferase coded

by embB

04/17/2023 8

MultiDrug resistance(MDR) and diagnostic practices

• MTB resistant to at least rif and inh is refered as MDR• Rif resistant taken as surrogate marker.

A. Conventional phenotypic methods for diagnosis Assessing inhibition of MTB growth in presence of

antibiotics ; distinguishing susceptible and resistance strains Proportion method Resistance ratio method Absolute concentration method BACTEC radiometric method

04/17/2023 9

B. Genotypic method• Nucleic acid amplification , part of genome known to be altered• Assessing the product for mutation analysis by,

DNA sequencingSolid phase hybridisatonRestriction fragment length polymorphism (RFLP)Real time PCR – high resolution melt analysisMicro arrayLine probe assayGenotype MTBDRSingle stranded conformation polymorphism analysis (SSCP) Heteroduplex analysis (HA)

Amplification refractory mutation system (ARMS) or allele specific PCR

04/17/2023 10

Amplification Refractory Mutation System(ARMS)

• Simple PCR technique used in detection of point mutation and small deletions.

• Exploits the absence of 3’ 5’ exonuclease proofreading activity of Taq DNA polymerase.

• Mismatch of primer at 3’ OH renders taq polymerase unable to extend the chain.

• Used in diagnosis of various genetic diseases like CFTR, α1- anti trypsin deficiency, β- thalessemia and other SNPs.

• Can be an efficient and economic diagonostic tool in MDR TB diagonosis.

04/17/2023 11

General mechanism• ARMS assay can be directed either against wild type

or mutant allele.• Deliberate mismatch in the primer at 3’OH, resulting

two mismatches in mutant allele and a single mismatch in wild type allele or vice versa.

• High probability that polymerase extends allele with single mismatch but double mismatch is definitely refracted.

Mutant strands

04/17/2023 12

Materials and methods• Sample collection- 50 random samples From Germen Nepal Tuberculosis Project

(GENTUP), Kalimati.• DNA Isolation: Performed by using ACCU prep ® Purification Kit standard protocols.• PCR amplification: 1)Amplification of 537 bp of Rpob gene involving RRDR , for

confirmation. - Primers used- control forward 5’-CGAATATCTGGTCCGCTTGC-3’

- common reverse 5’-GTCGACCACCTTGCGGTACG-3’2) Amplification using ARMS primer,

-Primers used - ARMS 516 -5’CAGCTGAGCCAATTCACGGA 3 ’ - ARMS 526 – 5’CGCTGTCGGGGTTGTCCC 3’ - ARMS 531 – 5’ ACCCACAAGCGCCGACAGGTC 3’ • Gel electrophoresis in 2% agarose gel.

04/17/2023 13

PCR cocktail

Sn Reagent Amount

1 DNTPs 0.5

2 Taq polymerase

0.2U

3 Taqbuffer 5

4 Forward Primer 1

5 Reverse primer 1

6 Template 1.5

7 NFW 15.8

Total 25

Sn Reagent Amount

1 DNTPs 0.5

2 Taq polymerase 0.2U

3 Taq buffer 5

4 Forward Primer 1

5 Reverse primer 3

6 ARMS primer 1.5

7 Template 1.5

8 NFW 12.3

Total 25

Master mix for PCR of 537bp rpoB Master mix for ARMS PCR

04/17/2023 14

THERMOCYCLER PROGRAMSn Step Temperature Time

1 Initial Denaturation 94°C 10 min

2 Cycle - 35

i) Denaturation 94°C 35s

ii)Annealing 56°C 35s

iii)Extension 72°C 35s

3 Final Extension 72°C 10 min

Thermocycler program for both normal PCR and ARMS

04/17/2023 15

Result:• The initial amplification of 537 bp fragment of rpoB

containing RRDR confirmed the presence of desired segment in our template used. 33 out of 50 samples showed the amplification.

• Out of 33 phenotypic resistant samples analyzed by ARMS assay, 30 samples showed mutation in any of the 3 codons we selected on the basis of high prevalence.

• Highest frequency of mutation was in codon 531, which accounts for 48% of total samples analyzed, followed by 36% in codon 526 and 24% in codon 516.

04/17/2023 16

Sn Mutated codon Number of sample Frequency

1 531 16 48.4%

2 526 12 36.3%

3 516 8 24.2%

Result of ARMS PCR representing Frequency of mutation in respective codons

537 bp control band

Control fwd

Common reverse

261bp ARMS 516WT

246bp ARMS 526WT

216bp ARMS 531WT

GAC CAC TCG

Schematic representation of rpoB gene targeted by ARMS PCR

04/17/2023 17

Discussion:• Due to lack of 3’ exonucleolytic proofreading activity in Taq

DNA polymerase, oligonucleotides with any mismatch at 3’ OH end will not function as primer.

• ARMS assay can be successfully developed as a diagnostic tool for detection of mutation in rpoB gene, which is partly justified by this study though further verification is required.

• Codon 531, 526 and 516 are the most frequently mutated region that has been reported in case of rif resistance.

• Some samples analyzed showed no mutation in the respective regions, though the samples were phenotypically rif resistant, it can either be due to presence of mutation some where other than the selected codon or might not have mutation in RRDR at all.

04/17/2023 18

• The assay described may be used for rapid detection of mutation in rpoB as it is convenient sensitive and fast. Under optimized condition the whole process can be completed in a day.

• Integration of the assay to microarray technique and other probing, huge number of samples can be analyzed at a time.

• The assay can be developed as a multiplex PCR shortening the time and making cost effective.

Limitations:• Can not be used for detection of all the mutations as only

RRDR covers 87 types of mutation.• The assay can detect only existence of mutation but not

the nature of mutation.

04/17/2023 19

Conclusion:

• Rif resistance serve as a surrogate marker for MDR , so detection of mutation in rpob can help early diagnosis and treatment stopping rapid transmission.

• ARMS can be developed as a prominent tool for mutation detection in resource limited nation like Nepal.

• The study is just a pilot scale thesis research, if it could be upgraded to higher level could be helpful in discovery of new diagnosis technique and even Novel drug discovery is possible.

04/17/2023 20

References:• The rpoB gene of Mycobacterium. L P Miller, J T Crawford and T M Shinnick, 1994, Antimicrob. Agents Chemother.• Mycobacterium tuberculosis Pathogenesis and Molecular Determinants of Virulence Issar Smith*,TB Center, Public Health Research Institute, International Center for Public Health, Newark, New Jersey 07103-3535• Drug Resistance in Mycobacterium tuberculosis, Rabia Johnson†, Elizabeth M. Streicher†, Gail E. Louw, Robin M. Warren, Paul D. van Helden,and Thomas C. Victor*• Molecular Characterization of Multidrug-Resistant Isolates of Mycobacterium tuberculosis from

Patients In North India, Noman Siddiqi, Mohammed Shamim, Seema Hussain, Rakesh Kumar Choudhary, Niyaz Ahmed, Prachee,

Sharmistha Banerjee, G. R. Savithri, Mahfooz Alam, Niteen Pathak, Amol Amin, Mohammed Hanief, V. M. Katoch, S. K. Sharma and Seyed E. Hasnain.

Antimicrob, Agents Chemother. 2002• Molecular basis and mechanisms of drug resistance in Mycobacterium tuberculosis: classical and new

drugs Pedro Eduardo Almeida Da Silva1 and Juan Carlos Palomino2*• Distribution of rpoB mutations among multidrug-resistant Mycobacterium tuberculosis (MDRTB) strains

from Thailand and development of a rapid method for mutation detection T. Prammananan1,2, W. Cheunoy3, D. Taechamahapun3, J. Yorsangsukkamol3, S. Phunpruch4, P. Phdarat2, M. Leechawengwong2,5 and A. Chaiprasert2,3

• Gene Mutations in rpoB Rapid Detection of Mycobacterium Rifampin-Resistant Isolates in Shanghai by Using tuberculosis the Amplification Refractory Mutation System

04/17/2023 21

• Analysis of any point mutation in DNA. The ampliflcation refractory mutation system (ARMS)

C.R.Newton, A.Graham, L.E.Heptinstall, S.J.Powell, C.Summers, N.Kalshekerl, J.C.Smith and A.F.Markham

• Evaluation of a new efficient procedure for single-nucleotide polymorphism genotyping: tetra-primer amplification refractory mutation system-polymerase chain reaction.

• Microarray and allele specific PCR detection of point mutations in Mycobacterium tuberculosis genes associated with drug resistance

Xing Tanga,*, Sheldon L. Morrisb, John J. Langonea, Larry E. Bockstahlera

• Analysis for a Limited Number of Gene Codons Can Predict Drug Resistance of a Mycobacterium tuberculosis in High-Incidence Community.

Annelies Van Rie, Robin Warren, Idris Mshanga, AnnemarieM Jordaan, Gian D. van der Spuy, Madalene RichardsonJohn Simpson, Robert P. Gie, Donald A. Enarson, NuldaBeyers, Paul D. van Helden and Thomas C. Victor,2001, J. Clin. Microbiol.