development 136, 1675-1685 (2009) doi:10.1242/dev.031161 ... · research article 1675 introduction...

1675RESEARCH ARTICLE

INTRODUCTIONFormation of the vertebrate body plan depends on the organizer.Originally identified in amphibians (Spemann and Mangold, 1924)and later in fish (Ho, 1992; Oppenheimer, 1934; Saúde et al., 2000;Shih and Fraser, 1995), chick (Waddington, 1932) and mouse(Beddington, 1994), transplantation of dorsal organizer tissue toventral regions of a host embryo leads to secondary axis formation.Whereas the transplanted organizer contributes predominantly toaxial mesoderm, it also has the remarkable capacity to non cell-autonomously re-specify host cells from their original fates andrecruit them to compose the remaining tissues of the secondary axis.

In zebrafish, the organizer/shield elicits a secondary axis whentransplanted ventrally (Saúde et al., 2000; Shih and Fraser, 1996).By convention the shield marks dorsal but, because dorsal andanterior development are linked, dorsal and anterior tissues arisefrom the shield side of the embryo, whereas posterior and ventralstructures arise from non-shield regions (Schier and Talbot, 2005).The shield contributes to axial mesoderm and makes smallercontributions to paraxial mesoderm, ventral neural tissue, and skin(Saúde et al., 2000; Shih and Fraser, 1995; Shih and Fraser, 1996).

In Xenopus and zebrafish, maternal Wnt signaling results innuclear accumulation of β-catenin on the presumptive dorsal side ofthe embryo, where it activates expression of zygotic organizer genes.Nodal signaling is also involved in initial organizer formation (Erteret al., 1998; Feldman et al., 1998), whereas later in developmentboth Nodal and Wnt are inhibitory to organizer function.Historically, the organizer was thought to express inducers of dorsal

cell fates; however, it is now well established that a main functionof the organizer is to repress factors secreted from ventral regions ofthe embryo (Niehrs, 2004).

Secreted ventralizing factors of the BMP, Wnt and Nodal familiesfunction in gradients in the early embryo and organizer-derivedmolecules attenuate the activity of these factors (Niehrs, 2004).Ventrally expressed Wnt8 restricts the size of the zebrafish organizerin the late blastula/early gastrula by regulating the expression of thetranscriptional repressors Vox and Vent, whereas BMP signaling isrequired to maintain expression of these genes during lategastrulation (Ramel et al., 2005; Ramel and Lekven, 2004). Thus,Wnt and BMP act together to limit the organizer and to promoteventral development.

A distinctive feature of the organizer is its ability to influencedistant cell fates as well as to generate axial tissues. Surprisingly,investigation of the interrelationship between these short- and long-range organizer activities has not been a major research focus. It isknown that many genes implicated in organizer activity have highlyoverlapping functions, making it difficult to determine the preciseroles that individual genes play. Here we investigate basic questionsabout organizer activity, including: its short- and long-rangesignaling functions, the extent to which they are linked and themechanisms underlying the redundancy of organizer gene activity.

We focused on the first organizer gene discovered, goosecoid(gsc), which encodes a homeobox transcription factor (Blumberg etal., 1991). gsc is expressed in all vertebrate organizers examined,suggesting a fundamental role in organizer function (Blum et al.,1992; Blumberg et al., 1991; Izpisua-Belmonte et al., 1993; Schulte-Merker et al., 1994; Stachel et al., 1993). gsc has been most studiedin Xenopus, where gain-of-function experiments demonstrated thatGsc induces secondary axes, similar to an organizer transplant (Choet al., 1991; Niehrs et al., 1993; Sander et al., 2007). However,secondary axes were often incomplete, lacking head and notochord.Loss-of-function experiments using dominant-negative and

Short- and long-range functions of Goosecoid in zebrafishaxis formation are independent of Chordin, Noggin 1 andFollistatin-like 1bMonica Dixon Fox and Ashley E. E. Bruce*

The organizer is essential for dorsal-ventral (DV) patterning in vertebrates. Goosecoid (Gsc), a transcriptional repressor found in theorganizer, elicits partial secondary axes when expressed ventrally in Xenopus, similar to an organizer transplant. Although gsc isexpressed in all vertebrate organizers examined, knockout studies in mouse suggested that it is not required for DV patterning.Moreover, experiments in Xenopus and zebrafish suggest a role in head formation, although a function in axial mesodermformation is less clear. To clarify the role of Gsc in vertebrate development, we used gain- and loss-of-function approaches inzebrafish. Ventral injection of low doses of gsc produced incomplete secondary axes, which we propose results from short-rangerepression of BMP signaling. Higher gsc doses resulted in complete secondary axes and long-range signaling, correlating withrepression of BMP and Wnt signals. In striking contrast to Xenopus, the BMP inhibitor Chordin (Chd) is not required for Gscfunction. Gsc produced complete secondary axes in chd null mutant embryos and gsc-morpholino knockdown in chd mutantsenhanced the mutant phenotype, suggesting that Gsc has Chd-independent functions in DV patterning. Even more striking wasthat Gsc elicited complete secondary axes in the absence of three secreted BMP antagonists, Chd, Follistatin-like 1b and Noggin 1,suggesting that Gsc functions in parallel with secreted BMP inhibitors. Our findings suggest that Gsc has dose dependent effects onaxis induction and provide new insights into molecularly distinct short- and long-range signaling activities of the organizer.

KEY WORDS: Goosecoid, Chordin, Noggin, Follistatin-like, Axis formation, DV patterning, Zebrafish, Organizer

Development 136, 1675-1685 (2009) doi:10.1242/dev.031161

Department of Cell and Systems Biology, University of Toronto, 25 Harbord Street,Toronto, ON, M5S 3G5, Canada.

*Author for correspondence (e-mail: [email protected])

Accepted 10 March 2009 DEVELO

PMENT

1676

antisense gsc constructs led to either head or head and notochordreductions (Ferreiro et al., 1998; Steinbeisser et al., 1995; Yao andKessler, 2001). Results of gsc morpholino oligonucleotide injectionsdemonstrated that Gsc is required for head but not notochordformation (Sander et al., 2007). In addition, Sander et al. suggestedthat a major function of Gsc is to block the expression of theventralizing transcription factors Vent1/2. It has also been shownthat ectopic Gsc represses expression of the ventralizing factorsXWnt-8 and BMP4 (Christian and Moon, 1993; Fainsod et al., 1994;Steinbeisser et al., 1995).

A gene that is activated by ectopic Gsc, presumably indirectly, isthe organizer gene chd, which encodes an extracellular inhibitor ofBMPs (Piccolo et al., 1996; Sasai et al., 1994). Xenopus Chd is anessential downstream effector of Gsc function (Sander et al., 2007).The Xenopus work suggests that Gsc plays an important role inorganizer function. In sharp contrast, targeted gsc knockout inmouse had no effect on early DV patterning (Rivera-Perez et al.,1995; Yamada et al., 1995). However, in heterotypic transplantationexperiments the neural-inducing properties of the mutant organizerwere impaired (Zhu et al., 1999). Technical issues might explainsome of the differences in the severity of these effects, whereas realdifferences between species could stem from the known redundancyin DV patterning mechanisms, which might vary between differentorganisms. In either case, there are many unanswered questions thatwarrant further investigation.

In zebrafish, gsc transcripts are present maternally, with zygoticexpression beginning at the midblastula transition in the region ofthe future organizer (Schulte-Merker et al., 1994; Stachel et al.,1993). Typically, embryos with mutations that disrupt the organizerhave little or no gsc expression and reduced dorsal structures(Feldman et al., 1998; Gritsman et al., 1999; Kelly et al., 2000; Koosand Ho, 1999; Nojima et al., 2004; Sampath et al., 1998; Schier etal., 1997; Yamanaka et al., 1998), whereas gsc expression isexpanded in embryos dorsalized by lithium chloride treatment(Stachel et al., 1993). Thus gsc transcript levels correlate withorganizer activity. In loss-of-function studies, injection of gscmorpholinos cause head truncations in a small fraction of embryoswithout affecting the notochord, whereas head defects occur athigher frequency when morpholinos against gsc and foxa3 werecombined (Seiliez et al., 2006). As in Xenopus, ectopic zebrafishGsc represses wnt8 (Seiliez et al., 2006).

To investigate the molecular basis of organizer activity, weexamined Gsc function in zebrafish. Ventral injection of low dosesof gsc mRNA produced partial secondary axes that reflect a short-range activity of the organizer, whereas higher doses led to completesecondary axes, mimicking the long-range signaling activity of theorganizer. We propose that short-range signaling is accompanied byBMP repression and long-range signaling by BMP and Wntrepression. Surprisingly, Chd is not essential for Gsc function inzebrafish, unlike in Xenopus. In fact, Gsc exhibited organizeractivity in the absence of three secreted BMP antagonists, suggestingthat Gsc functions in a parallel pathway to BMP inhibitors.

MATERIALS AND METHODSZebrafishWild-type AB and chordintt250 (chdtt250) embryos were obtained from theZebrafish International Resource Center (ZIRC, Eugene, OR, USA). Adultchdtt250 were a gift from M. Mullins (University of Pennsylvania,Philadelphia, PA, USA). Embryos obtained by natural spawning were stagedas described (Kimmel et al., 1995). Animals were treated in accordance withthe policies of the local animal care committee.

Constructs and morpholinosgsc and follistatin-like 1b (fstl1b) ORFs were cloned from cDNA into pCS2+

(Rupp et al., 1994). mRNAs were transcribed using the SP6 mMESSAGEmMACHINE Kit (Ambion, Austin, TX, USA). mRNAs from chordin-pCS2+ and noggin1-pCS2+ (nog1-pCS2+) were prepared as described (Dal-Pra et al., 2006; Miller-Bertoglio et al., 1997).

Morpholino (MO) sequences (5� to 3�):gsc-MO: CAAGCGAAAAGATGTGTGAGATTTG (Open Biosystems,

Huntsville, AL, USA) (Seiliez et al., 2006);chd-MO: ATCCACAGCAGCCCCTCCATCATCC (Gene Tools,

Philomath, OR, USA);nog1-MO: GCGGGAAATCCATCCTTTTGAAATC (Gene Tools) (Dal-

Pra et al., 2006);fstl1b-MO: CCATATTACAACTCACCTGGACTGG (Open

Biosystems); andstandard control: CCTCTTACCTCAGTTACAATTTATA (Gene Tools).

gsc constructsThe gsc homeobox and 3� sequence (codons 126 to 241) were cloned intopVP16-N and pENG-N (Kessler, 1997) to generate VP16-gsc (VP-gscHD)and engrailed-gsc (eng-gscHD), respectively. A Xenopus constructconsisting of the Xenopus gsc ORF with two minimal VP16 domains at theC-terminus was a gift from J. Smith (Latinkic and Smith, 1999). To create azebrafish version (gsc-VP2), Xenopus gsc was removed and replaced withthe zebrafish gsc ORF.

MicroinjectionsInitial gsc microinjections were done double blind. Approximately 4 pl ofmRNA was injected into a single cell of 8-cell stage embryos as described(Bruce et al., 2003). gsc mRNA (12, 24 or 48 pg) and chd mRNA (200, lowerconcentrations had little effect, or 664 pg) were injected. gfp mRNA dosesranged from 130 to 340 pg. gsc constructs were injected at the followingdoses: 660 pg VP-gscHD, 24 pg eng-gscHD and 200-520 pg gsc-VP2. Forsubthreshold experiments gsc was injected at 4 pg and gsc-VP2 at 100 pg.

Approximately 100 pl of gsc, chd, nog1, fstl1b, and control MOs wereinjected into the yolk at the 1- to 2-cell stage. gsc-MO (330 pg) was injectedand nonspecific phenotypes, which were not rescued by coinjection of gscmRNA, included mild head necrosis and general developmental delay. Thepresence of the MO target site was confirmed by PCR and sequencing. chd-MO injected at 22 pg produced no phenotype and chd-MO injected at 100pg ventralized embryos. nog1- and fstl1b-MOs (3 ng) were injected,producing results as described (Dal-Pra et al., 2006). Dal-Pra et al. observeda range of phenotypes falling into three phenotypic classes, whereas weobserved phenotypes that fell predominantly into one class. This is likely tobe due to the fact that we injected into the chd mutants, whereas Dal-Pra etal. primarily employed chd-MO.

Morpholino rescue experimentsXenopus chd mRNA (Sasai et al., 1994) was used to rescue the effects of thechd-MO, as described (Nasevicius and Ekker, 2000). Other mRNAs weregenerated from constructs that either did not contain the MO binding site(gsc, fstl1b) or contained four silent mutations to prevent MO binding(nog1).

GenotypingGenotyping of embryos from chdtt250 heterozygous parents was performedas described by Oelgeschläger (Oelgeschläger et al., 2003) and ZIRC.

Time-lapseShield stage embryos were mounted in 3% methylcellulose. Volocity(Improvision, Lexington, MA, USA) was used to acquire DIC andfluorescent images at 5-minute intervals.

In situ hybridizationIn situ hybridizations were performed as described (Jowett and Lettice,1994) using riboprobes to bmp2b and bmp4 (Martinez-Barbera et al., 1997),chd (Miller-Bertoglio et al., 1997), dkk (Hashimoto et al., 2000), dlx2a(Akimenko et al., 1994), flh (Talbot et al., 1995), shha (Krauss et al., 1993)and wnt8 (Kelly et al., 1995).

RESEARCH ARTICLE Development 136 (10)

DEVELO

PMENT

ImmunohistochemistryEmbryos were fixed, blocked and incubated in primary antibody asdescribed (Bruce et al., 2001). The peroxidase anti-peroxidase method wasused. Anti-Ntl antibody was diluted 1:5000 (Schulte-Merker et al., 1992),goat anti-rabbit secondary antibodies and rabbit peroxidase anti-peroxidasetertiary antibodies were diluted 1:100 and 1:500, respectively (JacksonImmunoResearch, West Grove, PA, USA).

Cell countsEmbryos between bud and 2-somite stages, stained with anti-Ntl antibody,were flat-mounted and photographed on a Zeiss AxioImager Z1 compoundmicroscope using an Orca-ER camera (Hamamatsu, Bridgewater, NJ, USA).Stained nuclei visible in each focal plane, excluding the tailbud, were tracedonto transparencies and counted.

RESULTSgsc-overexpressing cells populate organizerderivativesTo examine the results of localized gsc overexpression, gfp mRNAor gfp together with gsc mRNA was injected into one cell at the 8-cell stage. Several doses were tested to determine the lowest dose(24 pg) of gsc mRNA that consistently produced completesecondary axes (see below). Because there is no direct correlationbetween the position of a cell at the 8-cell stage and the location ofits descendants along the DV axis (Abdelilah et al., 1994; Helde etal., 1994; Kimmel and Law, 1985; Kimmel and Warga, 1987), clonelocation was documented relative to the shield and embryos weresorted into dorsal, dorsolateral, lateral, ventral and ventrolateralclasses at 6 hours post-fertilization (hpf) (Fig. 1L). At 1 day post-fertilization (dpf), sorted embryos were scored for GFP-expressingcells in shield-derived structures: hatching gland, notochord, floorplate of the spinal cord and hypochord (Saúde et al., 2000; Shih andFraser, 1995; Shih and Fraser, 1996). In striking contrast to gfpcontrol clones, every gsc clone labeled one or more shieldderivative, regardless of its initial location (see Table S1 in thesupplementary material). This occurred in two ways: gsc-expressingcells contributed either to enlarged dorsal axial structures or to axialstructures in a secondary axis. Thus, gsc-overexpressing cellspopulated tissues normally derived from the shield.

Analysis of ventral clones allowed us to examine Gsc function inisolation from other organizer factors. gsc-injected embryos withventral/ventrolateral clones gave rise to secondary axes at highfrequency, whereas dorsal/dorsolateral gsc clones and gfp controlclones did not (see Table S2 in the supplementary material). Asexpected, in controls with ventral clones (Fig. 1A), GFP-positivecells were located posteriorly at the 1-somite stage and were absentfrom axial mesoderm (Fig. 1B) and, at 1 dpf, GFP-positive cellswere located mainly in the myotomes of the trunk and tail (Fig. 1C).By contrast, gsc-injected embryos with ventral clones (Fig. 1D)often had two axes on opposite sides of an elongated yolk cell at budstage, one of which was GFP labeled (Fig. 1E). Elongated yolkmorphology is also seen with dorsalized embryos (Mullins et al.,1996). GFP-positive cells populated axial tissues of the secondaryaxis, including an apparent prechordal plate (Fig. 1E,F) and asecondary notochord (Fig. 1F). Secondary axes did not alwayscontain notochord at bud stage (see Table S3 in the supplementarymaterial) although they did by 1 dpf.

Two distinct axes were often no longer apparent by 1 dpf, andwould have been missed if bud-stage embryos had not beenexamined. At 1 dpf, the severely abnormal embryo contained abroad head with two eyes (Fig. 1G) and a partially GFP-labelednotochord (Fig. 1I), thus the two axes moved together between budand 1 dpf. When double axes were generated, they moved together

in 36% (13/36) of cases, whereas in 58% (21/36) of cases the twoaxes remained distinct, although they shared a single posterior trunkand tail. Expression of the neural marker dlx2a (Akimenko et al.,1994) was often normal in secondary axes, indicating the presenceof telencephalic and diencephalic tissue (Fig. 1J,K; see Table S4 inthe supplementary material). Therefore secondary axes wereessentially complete, containing notochord and anterior-most brain,indicating that gsc overexpression mimicked an organizer transplant.

To determine whether Gsc has a role in organizer functiondorsally, where it is normally expressed, we examined embryos withdorsal/dorsolateral gsc clones and observed the effect on DVpatterning. In controls (Fig. 2A), GFP was predominantly confinedto shield derivatives at bud and at 1 dpf (Fig. 2B-D), consistent withpreviously described fate maps (Kimmel et al., 1990). Thedistribution of dorsal/dorsolateral gsc clones was similar to controls(Fig. 2E-H) and contrasted with results in Xenopus, in which dorsalgsc-overexpressing cells were excluded from axial tissues (Niehrset al., 1993).

The single axes in gsc-injected embryos often had enlarged shieldderivatives, but thinner posterior trunks and tails, suggesting thepresence of excess dorsal/anterior tissue at the expense ofventral/posterior tissues. For example, the notochord domain of anembryo with a dorsolateral gsc clone was much larger than thecontrol (see Figs S2B and S2F in the supplementary material). Toquantify this observation, notochord nuclei were stained in lategastrula stage embryos using the No tail (Ntl) antibody (Schulte-Merker et al., 1992). There was a 40% increase in Ntl-positive nucleiin embryos with dorsal, dorsolateral, or lateral gsc clones (Fig. 2I).

1677RESEARCH ARTICLEgoosecoid and DV patterning

Fig. 1. Ventral gsc overexpression induces complete secondaryaxes. (A-I) Live zebrafish embryo injected with gfp (A-C) or gsc (D-I)RNA. (A-F,H,I) DIC and fluorescence merge; (G) DIC. (A,D) Shield(arrowhead), animal view. (B,F) Bud; arrowheads indicate notochord,asterisk indicates prechordal plate. (C) 1 dpf, side view. (E) Bud; sideview, secondary prechordal plate (asterisk). (G-K) 1 dpf, dorsal view.(J,K) dlx2a and shha (red). (J) gfp RNA injected. (K) gsc RNA injectedshowing duplicated dlx2a expression (brackets): staining differs fromthe control because the embryo had a ventral third eye. (L) Schematicof injection procedure, clones in green; one clone was generated perembryo. dien, diencephalon; e, eye; fp, floor plate; hg, hatching gland;myo, myotomes; noto, notochord; tele, telencephalon.

DEVELO

PMENT

1678

The notochord was often shorter, but disproportionately wider, ingsc-injected embryos (Fig. 2J), although by 1 dpf embryos were ofsimilar lengths as controls. Recruitment of more cells to thenotochord domain, compared with controls, suggested thatincreasing the gsc dose dorsally enhanced organizer activity.

gsc overexpression has non cell-autonomous anddose dependent effects on cell fateThe organizer is defined by its ability to re-specify and patternsurrounding cells. Therefore, recruitment of unlabeled cells intoGsc-induced secondary axes would demonstrate organizer activity.

A representative embryo, with a ventrolateral gsc clone, containeda secondary GFP-labeled notochord, whereas its associatedmyotomes were unlabeled (Fig. 3A-C). In another embryo, neuraltissue of a secondary axis contained labeled and unlabeled cells (Fig.3F-H). Unlabeled cells were morphologically normal and wellintegrated into the tissue. Thus, just like an organizer transplant, gsc-overexpressing cells recruited surrounding cells, causing them tochange their fate and participate in secondary axis formation. Thisnon cell-autonomous activity of Gsc is most likely to be indirect, asGsc is a transcription factor.

We used a molecular readout to measure the distance over whichGsc exerts its non cell-autonomous effect by examining theexpression of the organizer gene chd in embryos with ventral gscclones. Double labeling of membrane GFP (to mark the clone) andchd showed that ectopic chd was induced at a distance of up to tencell diameters away from the gsc clone (Fig. 3D). Signaling overthis large distance constitutes long-range signaling, as defined byChen and Schier for the zebrafish protein Nodal-related 1 (Chenand Schier, 2001). Thus, Gsc exhibits long-range signaling activityby a molecular criterion, which is probably responsible for the long-range organizer activity observed morphologically. Anotherpotential explanation is that dorsal chd-expressing cells migratedtowards the ventral gsc clone. We eliminated this possibility bylabeling the shield with Rhodamine Dextran in embryos withventral gsc clones and observing no movement of Rhodaminepositive cells towards ventral gsc clones in live embryos (notshown).

We next asked whether gsc had dose dependent effects on axisformation by injecting half the standard dose (12 pg). Partialsecondary axes were produced that lacked heads and notochordsand consisted only of neural and somitic tissue that was nearlycompletely GFP labeled (Fig. 3I-K). Only a very few unlabeledcells were recruited to the partial axis (Fig. 3K, insets), suggestingthat short-range signaling occurred. Examination of ectopic chdexpression in ventral gsc clones revealed that chd was primarilyconfined to the clone itself and only extended at most one or twocell diameters away (Fig. 3E). Thus, lower gsc doses actedpredominantly cell-autonomously and were unable to elicit long-range signaling.

gsc also had dose dependent effects on DV gene expression atshield stage. At doses of gsc sufficient to induce complete secondaryaxes, we observed a reduction in wnt8, bmp2b and bmp4 expressionand ectopic expression of the organizer genes chd, floating head (flh)and dickkopf 1 (dkk1) (Fig. 3L-O; Table 1). In embryos injected witha lower dose of gsc, chd was induced at similar frequencies but dkk1(a Wnt signaling inhibitor) was induced only about half as often, andthe frequency of wnt8 inhibition was also moderately butconsistently reduced (Table 1). These results suggest that partialsecondary axes produced by low gsc doses might result frominhibition of BMP signaling but insufficient inhibition of Wntsignaling. In addition, we noticed that at the standard gsc dose, wnt8was always repressed in a relatively small domain, whereas chd wasconsistently induced in a large domain, that extended outside the gscclone. This spatial arrangement mimics what is normally seen in theorganizer, suggesting that Gsc is able to induce this organizer patternin a dose dependent fashion.

gsc overexpression induces secondary axes in chdnull mutantsIn Xenopus, Gsc function is mediated entirely by Chd (Sander etal., 2007). To determine if Chd was required for Gsc function inzebrafish, Gsc activity was examined in the absence of Chd by


Fig. 2. Dorsal gsc overexpression induces excess dorsal tissue.(A-H) Merged images of live zebrafish embryo injected with gfp (A-D)or gsc (E-H) RNA. (A,E) Shield (arrowhead). (B,F) Bud, arrowheadsindicate notochord. (C,D,G,H) 1 dpf. (I) Notochord cell counts withstandard deviations, five embryos per treatment. (J) Bud, anterior to thetop. Anti-Ntl staining is brown, injected RNA is listed in lower right.hypo, hypochord; peri, periderm.DEVELO

PMENT

overexpressing gsc in chdtt250 null mutant embryos (Schulte-Merker et al., 1997). chdtt250 mutants have expanded ventraltissues, most notably blood, blood island and tail fin and havereduced anterior neural tissue, whereas gsc expression is normalin most mutants (Fisher et al., 1997; Hammerschmidt et al., 1996;Schulte-Merker et al., 1997). gsc was injected into one cell at the8-cell stage and embryos were genotyped at the end of theexperiment. At the standard gsc dose (24 pg), the majority ofmutant embryos with ventral/ventrolateral clones (Fig. 4A)contained partial secondary axes with neural and somitic tissuebut not notochord (Fig. 4D), similar to the overexpression of a lowdose of gsc in wild-type embryos. However, these axesoccasionally had well developed heads, separate from theendogenous head (Fig. 4B). Interestingly, the endogenous headwas often more fully developed than in uninjected chdmutants (Fig. 4B), suggesting that ventral gsc injection couldpartially rescue the endogenous axis, indicative of a long-rangeeffect.

Strikingly, doubling the gsc concentration (48 pg) resulted incomplete secondary axes with GFP-labeled notochords (Fig. 4E-G).Thus, in the absence of chd, a higher concentration of gsc wasneeded to induce complete axes, suggesting that Chd facilitates, butis not essential for, Gsc-induced axis formation.

chd and gsc overexpression are not equivalentSince Chd facilitates the ability of Gsc to induce secondary axes,we next addressed whether it was sufficient to induce completesecondary axes by overexpressing chd ventrally. Global chdoverexpression in zebrafish dorsalizes embryos (Miller-Bertoglioet al., 1997) however, localized overexpression was notexamined. To test the axis-forming ability of Chd in zebrafish,200 pg of chd mRNA was injected into one cell at the 8-cellstage. Ventral/ventrolateral chd clones generated partialsecondary axes that never contained head or notochord and thatmerged with the endogenous axis posteriorly. Morphologically,secondary axes contained neural tissue (Fig. 5C,D), most hadectopic myotomes (Fig. 5E,F), some had beating cardiac tissue(not shown) and ectopic or enlarged otic vesicles (Fig. 5G,H).Notably, these partial axes resembled those induced by low gscdoses. Chd did not induce ectopic Gsc (see Fig. S3 in thesupplementary material). dlx2a expression was not detected inthe secondary neural tube and flh and wnt8 expression werenormal at shield stage (not shown). Interestingly, secondary axeswere typically well separated from the primary axis, in contrastto those seen following gsc overexpression. In addition, partialsecondary axes were nearly completely GFP labeled, suggestingthat Chd did not have long-range inductive effects.


Fig. 3. gsc recruits unlabeled cells to secondaryaxes. (A-K) Zebrafish embryos injected with gsc RNA.(A-C) Lateral views, (A) bud; (B,C) 1 dpf. (D,E) Animalviews; (F-K) dorsal views, 1 dpf. (A,B,F,I) DIC; (G,J)fluorescence; (C,H,K) merge. (A) Secondary notochordwith somites (arrowheads) at bud. (B,C) Myotomes(arrowheads) with GFP-labeled notochord (dashedlines). (D,E) Shield stage gsc RNA-injected embryosstained for membrane-GFP (brown) and chd (purple),with ectopic chd (arrowheads). (F-H) Secondary neuraltube with GFP-labeled (arrow) and unlabeled cells;arrowhead marks anterior GFP limit. (I-K) Low gsc RNAdose ventral clone produces partial secondary axis.(K) Arrows indicate unlabeled cells in neural tissue(right inset) and in myotomes (left inset). (L-O) Shield(arrowheads). (L,N) gfp RNA injected; (M,N) gsc RNAinjected, with wnt8 (L,M) and chd (N,O) in situ probe.nt, neural tissue.

Table 1. DV markers at shield stage in gsc-injected embryos

Injected mRNA wnt8 bmp2b bmp4 chd flh dkk1

gfp 13/71 (18%)reduced

2/24 (9%)reduced

2/38 (5%)reduced

2/46 (4%)ectopic

0/60 ectopic 0/12 (uninjected)ectopic

gsc (24 pg) + gfp 19/30 (63%)reduced

23/30 (77%)reduced

24/38 (63%)reduced

78/80 (98%)ectopic

54/62 (87%)ectopic

11/12 (92%) ectopic

gsc (12 pg) + gfp 14/30 (47%)reduced

n.d. n.d. 88/93 (95%)ectopic

n.d. 13/25 (52%) ectopic

Ventral markers appear less strongly affected than dorsal markers. This is likely to be a technical issue, as dorsal marker probes typically produced stronger signals thanventral marker probes, making these embryos easier to score. n.d., not defined. D

EVELO

PMENT

1680

Tripling the concentration of chd (664 pg) also produced partialsecondary axes (not shown). Therefore, no chd dose tested couldelicit a complete secondary axis. Thus, Chd neither had organizerproperties, nor did it generate axial mesoderm, the primary organizerderivative.

gsc overexpression induces secondary axes in theabsence of three BMP inhibitorsThe ability of Gsc to induce secondary axes in chd mutant embryoscould be explained by the presence of other, compensatory, BMPinhibitors. The BMP inhibitors Noggin1 (Nog1) and Follistatin-like1b (Fstl1b) were reported to be zygotically expressed and to functionredundantly with Chd (Dal-Pra et al., 2006; Fürthauer et al., 1999).As shown previously, coinjection of nog1- and fstl1b-MOs into chdmutant embryos enhances the mutant phenotype (see Fig. S3 in thesupplementary material) (Dal-Pra et al., 2006). mRNA rescueexperiments demonstrated morpholino specificity (see Fig. S4 in thesupplementary material). When gsc was injected ventrally intoembryos injected with nog1- and fstl1b-MOs, both partial (Fig. 5I,J)and complete (Fig. 5K,L) secondary axes were observed. Therefore,Gsc induced complete secondary axes when all known zygotic BMPantagonists expressed in the early embryo were reduced or

eliminated. In addition, the head of the endogenous axis waspartially rescued in embryos with ventral gsc clones, furtherdemonstrating the ability of Gsc to trigger long-range effects (notshown).

A caveat to these results is that the morpholino knockdowns mighthave been incomplete. However, in wild-type embryos, ventraloverexpression of nog1 induced only partial secondary axes, lackingnotochords, whereas ventral overexpression of fstl1b had no effect(not shown), similar to previous results in which these two geneswere globally overexpressed (Dal-Pra et al., 2006). Crucially, ventralcoinjection of chd, fstl1b and nog1 mRNAs in wild-type embryosalso induced only partial secondary axes (Fig. 5M,N). These dataindicate that Gsc can function in the absence of all three secretedBMP inhibitors.

Distinct mechanisms underlie long- and short-range signalingWe next addressed whether Gsc is normally involved in DVpatterning. No gsc mutant exists, and maternal gsc expression raisesthe possibility that maternal protein is present. For these reasons, weinitially took a dominant-negative approach to block Gsc function.Gsc is a transcriptional repressor in other systems (Danilov et al.,


Fig. 4. gsc induces secondary axes in the absence ofChd. (A-G) Live chdtt250 embryos injected ventrally with 24pg (A-D) or 48 pg (E-G) gsc RNA. (A,C,E) Shield, dorsal tothe right. (B,D) 1 dpf, anterior to the top. (F,G) 1 dpf,anterior to the left. (B) Secondary axis with head (2/7,29%). (D) Secondary axis without notochord (5/7, 71%).(F,G) Two notochords (arrows, 9/12, 75%). nt, neuraltissue.

Fig. 5. chd induces partialsecondary axes. (A-H) Live zebrafishembryo injected with chd RNA. Shield(A), 1 dpf (B-H). (B) Partial secondaryaxis (arrow, 13/21, 62%). GFP-labeledneural tissue (C,D) (13/13, 100%),myotomes (E,F) (9/13, 69%) andectopic otic vesicle (G,H) (6/13, 46%).Some injected embryos had beatingcardiac tissue (4/13, 31%). (I-L) Livechdtt250 embryos injected ventrally with48 pg gsc and nog1- and fstl1b-MOs.(I,J) Partial GFP-labeled secondary axiswith neural (arrow) and somitic(arrowheads) tissue. (K,L) Secondaryaxis containing GFP-labeled notochordand neural tissue (3/5, 60%). For anexample of an uninjected chd mutantembryo see Fig. 7D. (M,N) Wild-typeembryo injected ventrally with chd,fstl1b and nog1 mRNAs. Arrowheadmarks neural tissue. ov, otic vesicle.

DEVELO

PMENT

1998; Ferreiro et al., 1998; Latinkic and Smith, 1999; Mailhos et al.,1998; Smith and Jaynes, 1996). Therefore, we made two activatorconstructs designed to antagonize endogenous Gsc function. VP-gscHD contains the gsc homeodomain (HD) fused to the VP16transcriptional activator (Kessler, 1997) and is predicted to bind toand activate transcription of Gsc target genes. The second construct,gsc-VP2, contains the entire gsc coding region plus two minimalVP16 domains and, in Xenopus, the equivalent construct blocks Gscfunction by binding to Gsc target genes without activating theirtranscription (Latinkic and Smith, 1999). Thus, gsc-VP2 shouldproduce a phenotype more akin to Gsc loss-of-function than VP-gscHD. We also generated a repressor construct, consisting of thegsc HD fused to the engrailed repressor domain (eng-gscHD)(Kessler, 1997), that should mimic endogenous Gsc function.Similar constructs were originally used in Xenopus (Kessler, 1997;Latinkic and Smith, 1999) and our zebrafish versions performed asexpected in Xenopus embryos (see Fig. S5 in the supplementarymaterial and not shown).

Ventral injection of eng-gscHD (24 pg) into zebrafish oftenproduced complete secondary axes with GFP-positive cells located inorganizer derivatives (Fig. 6A,B), demonstrating that Gsc functionsas a transcriptional repressor in zebrafish. As predicted, ventralinjection of VP-gscHD had no effect, even at high doses (660 pg, notshown). To test whether VP-gscHD could inhibit Gsc function, weexamined its ability to block secondary axis formation by Gsc andfound, surprisingly, that it could not (not shown). However, VP-gscHD blocked eng-gscHD from eliciting complete secondary axes,leading to partial axes instead (Fig. 6H,I). This suggested that VP-gscHD could block the long-range organizer activity of eng-gscHD,producing an effect similar to injection of a low gsc dose.

Unexpectedly, ventral injection of gsc-VP2, at a moderate dose(200 pg) that was predicted to block Gsc function, occasionallyproduced partial secondary axes that were almost completelylabeled by GFP (Fig. 6C,D). High concentrations (520 pg) alsoproduced partial secondary axes. Thus, complete axes could notbe induced at every dose tested, again mimicking the effect of lowdose gsc. An analysis of chd expression in gsc-VP2-injectedembryos revealed that ectopic chd was transiently induced,presumably accounting for the infrequent partial secondary axesobserved (Fig. 6E-G and see Table S5 in the supplementarymaterial). Ectopic expression of Xenopus gsc-VP2 (Latinkic andSmith, 1999) or dominant-negative Xenopus myc-tagged gsc(Ferreiro et al., 1998) also occasionally produced partialsecondary axes in zebrafish (not shown). Significantly, we neverobserved partial secondary axes in Xenopus using either the frogor zebrafish constructs.

These findings suggest that constructs designed to block Gscfunction in Xenopus could partially mimic the short-range functionof Gsc in zebrafish. To confirm this, gsc was injected at asubthreshold dose (4 pg). This gsc dose had no effect alone butdorsalized embryos (6/7, 86%) when coinjected with a reduced doseof gsc-VP2 (100 pg), suggesting a synergistic effect.

Gsc and endogenous dorsal specificationSince the dominant-negative constructs failed to fully block Gscfunction, we used gsc morpholinos instead (Seiliez et al., 2006). gsc-MO had mild ventralizing effects, as shown previously (Seiliez etal., 2006). However, morphologically, most embryos appearednormal (Fig. 7E). To further investigate the extent to which Gscrequires Chd and to explore potential synergistic effects, we used afixed concentration of gsc-MO in combination with chdtt250 mutantembryos and two different doses of chd-MO to generate embryos

possessing no, low or intermediate levels of Chd (Nasevicius andEkker, 2000). Morpholino control experiments confirmed that theeffects were specific (see Fig. S4 in the supplementary material).

Firstly, gsc-MO was injected into chdtt250 mutants. gsc-MOexacerbated the chdtt250 phenotype, leading to a more severereduction in head and notochord (Fig. 7D,H,L,P). Thus, endogenousGsc plays a role in DV patterning that is independent of Chd,consistent with our overexpression results. We then examined theeffect of gsc-MO on embryos in which Chd levels were reduced,using concentrations of chd-MO that produced either a less severephenotype than that of chdtt250 mutants (Fig. 7C) or no phenotype atall (Fig. 7B). At both concentrations of chd-MO, coinjection of gsc-MO resulted in more severely ventralized embryos with furtherreduced heads and enlarged ventral structures (compare Fig. 7F to7B and Fig. 7G to 7C). Ntl antibody staining was used to examinethe notochord and in situ hybridization for dlx2a was used toexamine the anterior brain. Consistent with the increasedventralization observed by external morphology, we found thatnotochord and anterior neural structures were reduced when gsc-MO was added to chd-depleted embryos (Fig. 7I-P; Table 2 and notshown).

Analysis of DV markers at shield stage revealed no obviouschanges in bmp2b, chd, or flh expression in gsc-MO injectedembryos. bmp2b and flh expression were normal in chd-MO anddouble gsc-MO/chd-MO injected embryos (not shown). A slightdorsal expansion of wnt8 in a small percentage of gsc-MO injected


Fig. 6. gsc elicits distinct short- and long-range signalingactivities. Injected construct is listed in lower left. (A-D,H,I) Liveembryos at 1 dpf. (A,B) Embryo with two notochords (arrows).(C,D) Embryo with partial secondary axis, with neural (arrow) andsomitic (arrowheads) tissue. (E-G) Shield stage embryos stained for chd.(E) Control; (F,G) gsc-VP2-injected embryos. Arrowheads indicateectopic chd. (H,I) Dorsalized embryo with partial secondary axis.

DEVELO

PMENT

1682

embryos (Fig. 7R) was detected, as observed previously (Seiliez etal., 2006), whereas wnt8 was normal in chd-MO injected embryos(not shown). By contrast, there was an obvious difference in theexpression of wnt8 in double morpholino injected embryos versuscontrol and single morpholino injected embryos. In almost half ofdouble morpholino injected embryos, wnt8 was ectopicallyexpressed dorsally in the shield and this expression was more robustthan in gsc morphants (Fig. 7S). Thus, reducing gsc and chd levelsresulted in a more than additive effect on wnt8 expression. This isconsistent with our overexpression experiments showing that ahigher gsc concentration was necessary to induce completesecondary axes in the absence of chd, suggesting that they couldfunction cooperatively. Taken together, these results suggest asynergistic interaction between Gsc and Chd and that these twoproteins operate in parallel pathways.

We showed that Gsc could induce complete secondary axes in chdmutant embryos coinjected with fstl1b- and nog1-MOs, suggestingthat Gsc can function independently of these three BMP inhibitors.Consistent with this finding, triple morpholino knockdown of gsc,fstl1b and nog1 in chd mutant embryos produced a more severe

phenotype than the double knockdown of fstl1b and nog1 in chdmutants (see Fig. S3 in the supplementary material). These resultssuggest that Gsc functions independently of these three BMPinhibitors.

DISCUSSIONWhen ectopically expressed, Gsc appears to establish dorsal fates bydose dependently inhibiting the expression of ventralizing genes.The data suggest that Gsc functions in parallel with Chd and otherBMP antagonists. Our results are summarized in a simple model(Fig. 8), the key elements of which are discussed below.

Gsc and short-range signalingThe hallmark of the organizer is its ability, upon transplantation, topattern distant cells to form a secondary axis. Organizer function,therefore, requires cell-cell signaling. Our studies suggest that Gsccan trigger both short- and long-range signaling. Ventral injection oflow doses of gsc into wild-type embryos resulted in nearlycompletely GFP-labeled partial secondary axes, containing neuraland somitic tissue. Labeled cells were located in tissues that never


Table 2. Notochord morphology assessed by anti-Ntl staining at 1 dpf

Injected mRNA Normal Thin posteriorlySmall gapsposteriorly

Large gapsposteriorly

Absentfrom tail

Absentposterior to

yolk extension Absent

Uninjected (n=111) 111 (100%)gsc-MO (n=81) 81 (100%)chd-MO-l (n=71) 71 (100%)gsc-MO + chd-MO-l (n=81) 14 (17%) 50 (62%) 17 (21%)chd-MO-h (n=47) 2 (4%) 34 (72%) 6 (13%) 5 (11%)gsc-MO + chd-MO-h (n=37) 17 (46%) 8 (22%) 12 (32%)chdtt250 mutants (n=23) 16 (70%) 5 (21%) 2 (9%)gsc-MO + chdtt250 mutants (n=22) 9 (41%) 3 (14%) 2 (9%) 7 (32%) 1 (4%)chd-MO-l, low concentration of morpholino; chd-MO-h, high concentration of morpholino.

Fig. 7. gsc and chd morpholinos affect DVpatterning. Injected construct or genotype islisted in lower right. (A-H) Live embryos, 1 dpf.(I-P) Tails, 1 dpf; stained with anti-Ntl antibody,anterior to the left. Arrowheads indicate thinnotochords, arrows indicate truncatednotochords. (Q-S) 60% epiboly embryos stainedfor wnt8; arrowhead marks dorsal. (Q) Control.(R) gsc-MO-injected embryo with ectopic wnt8expression dorsally (11/81, 14%). (S) Ectopicstaining in embryo injected with gsc-MO and alow concentration of chd-MO (46/106, 43%).

DEVELO

PMENT

normally express gsc, such as retina and muscle, suggesting that gscdoes not interfere with the differentiation of specific cell types nordoes it appear to directly induce them. The observed effect is mainlycell-autonomous but not entirely, as a few unlabeled cells areincorporated into the partial secondary axes. We suggest that theshort-range effects result from Gsc acting in cells to triggerautocrine, short-range signaling and that only a few unlabeled cellsthat receive this local signal are incorporated into the partial axes.This is consistent with our molecular analysis showing thatinduction of ectopic chd extends only one or two cell diametersaway from the gsc clone.

Furthermore, we propose that the putative autocrine signal,responsible for induction of partial secondary axes, involvesrepression of BMP signaling (Fig. 8). In Xenopus, BMPrepression ventrally produces partial secondary axes containingneural and somitic tissue (Yasuo and Lemaire, 2001). In addition,zebrafish BMP pathway mutants and embryos globallyoverexpressing chd have expanded neural and somitic tissue butnot axial mesoderm (Miller-Bertoglio et al., 1997; Mullins et al.,1996; Tucker et al., 2008). Xenopus Gsc can repress bmp4transcription (Fainsod et al., 1994; Steinbeisser et al., 1995) andwe showed that Gsc can repress bmp2b and bmp4 transcription inzebrafish, although it is not known whether this is direct. Ventralchd overexpression also induced partial secondary axes,indicating that it is capable of short-range signaling. However,Chd is not required for axis induction by Gsc, suggesting thatadditional factors are involved.

What is the identity of the short-range signal? BMP signaling ismaintained by a positive autoregulatory feedback loop, thus anyreduction in BMP levels will be amplified as a result of disruptingthis loop (Little and Mullins, 2006). There is also in vitro evidencethat mouse, human, chick and zebrafish bmp2b transcript stability isreduced in cells expressing no or low levels of BMP (Fritz et al.,2004). It therefore seems likely that incorporation of a few unlabeledcells into the partial secondary axes occurs simply as a result of thelocal absence or reduction of BMP. How does Gsc repress BMP?The zebrafish transcriptional repressor Bozozok (Boz; Dharma -ZFIN), which acts upstream of zygotic Gsc, can directly bind andrepress the bmp2b promoter (Leung et al., 2003). Both Boz and Gscare paired-type homeodomain proteins, thus raising the possibilitythat Gsc binds the paired-type binding sites in the bmp2b promoter.Alternatively, Gsc might function via an unknown factor (Fig. 8,Factor X) to repress BMP signaling.

Gsc and long-range signalingIncreasing the gsc dose ventrally mimics both the short- and long-range activities of the organizer, resulting in complete secondaryaxes, in which GFP-labeled cells are predominantly confined toorganizer derivatives. Large-scale recruitment of unlabeled cellsindicates that long-range signaling occurred. A demonstration oflong-range signaling at the molecular level is that ectopic chd wasinduced at a distance from gsc clones; however, as discussed below,chd cannot mediate the long-range signal. We and others haveobserved that complete secondary axes move towards and oftenmerge with the primary axis. By contrast, we found that partialsecondary axes did not merge, suggesting that long-range signals areresponsible for this phenomenon.

Analysis of DV marker expression demonstrated that high gscdoses resulted in inhibition of both BMP and Wnt signaling. InXenopus, low levels of BMP and Wnt signaling are required dorsallyfor notochord formation and BMP, and Wnt signaling must berepressed ventrally for ectopic notochord induction (Yasuo andLemaire, 2001). In zebrafish, overexpression of wnt8a or inhibitionof the Wnt antagonist dkk1 results in head truncations (Seiliez et al.,2006), whereas overexpression of dkk1 and deletion of wnt8produces expanded brain and axial mesoderm (Hashimoto et al.,2000; Lekven et al., 2001). Although axial mesoderm is unaffectedin BMP mutants, when both wnt8 and bmp2b function are removed,axial mesoderm expands (Ramel et al., 2005). Thus, the ability ofGsc to induce complete secondary axes ventrally and increasenotochord cell number dorsally is probably the result of combinedinhibition of Wnt and BMP signaling. Gsc directly represses wnt8transcription in Xenopus and we propose that this is likely to be thecase in zebrafish as well (Fig. 8). Gsc might also directly inhibitexpression of the ventralizing factors ved/vox/vent as it does inXenopus (Sander et al., 2007).

What is the molecular identity of the long-range signal(s)?Induction of head and notochord was always accompanied by cellrecruitment, indicative of long-range signaling. However, it isnotable that we could see evidence of long-range signaling in theabsence of notochord induction. Ventral injection of gsc into chdmutants at the dose that gave rise to partial secondary axes oftenresulted in more fully developed endogenous heads. We also foundthat ventral overexpression of dkk1 led to enlarged endogenousheads, suggesting that it could be the long-range signal, althoughdkk1 did not elicit complete secondary axes when overexpressedventrally (our unpublished data). We also tested whether coinjectionof dkk1 and chd ventrally could elicit complete secondary axes andfound that it could not (our unpublished data). One possibility is thata combination of known factors is required, for example, Dkk1might act in combination with other Wnt signaling inhibitors.Alternatively, an unknown factor(s) might be involved (Fig. 8,Factor Y). A recent study showed that implanted cells from earlyzebrafish gastrula and pharyngula cell lines could induce secondaryaxes by inducing organizer gene expression in host tissue, but thiswas not mediated by known organizer inducers, including Nodals,Bozozok, and FGFs, leading the authors to suggest that an unknownsecreted factor was responsible (Hashiguchi et al., 2008). Clearly,additional experiments are required to identify these factors and tocharacterize their interactions.

Gsc does not require ChdXenopus Gsc function relies entirely on Chd (Sander et al., 2007).Furthermore, Xenopus Chd is required for complete secondary axisinduction by ventral organizer transplantation (Oelgeschläger et al.,2003). Thus, it appears that Xenopus Chd can mediate both short-


Fig. 8. Model of Gsc function. Gsc directly or indirectly inhibits wnt8and bmp transcription at high doses, whereas low Gsc dosespredominantly inhibit bmp transcription. Gsc indirectly activatesexpression of chd, the product of which acts together with Nog1 andFstl1b to inhibit the function of BMP proteins. See text for details.

DEVELO

PMENT

1684

and long-range organizer activities. We present evidence suggestingthat Chd is not required for Gsc function in zebrafish. Gsc inducedcomplete secondary axes in chdtt250 null mutant embryos andinjection of gsc-MO further ventralized chdtt250 mutants, suggestingthat Gsc has Chd-independent functions in DV patterning. Ourdatabase searches have not provided evidence for a second chd genein zebrafish, nor is chd maternally expressed (Miller-Bertoglio et al.,1997). Moreover, our data suggest that in zebrafish, Gsc and Chdoperate in parallel rather than in a simple linear pathway. We alsoshowed that Gsc does not require two other zygotic BMP inhibitors,Nog1 and Fstl1b. Although Gsc might require other BMP inhibitorsfor its function, we have eliminated the known zygotic BMPinhibitors that are expressed at the appropriate time and place.

ConclusionsOur findings suggest that Gsc has dose dependent effects on axisinduction and provide new insights into molecularly distinct short-and long-range signaling activities of the organizer. In addition, weshow that Gsc functions in parallel to three secreted BMP inhibitors.Our work also suggests that Gsc function in Xenopus and zebrafishis different. Thus, despite the conservation of organizer genes amongvertebrates, divergent functions have evolved for key organizergenes in different species.

We thank Stephanie Lepage for Fig. 8 and Fig. 1L; Olivia Luu for the Xenopuswork; Brian Ciruna, Marnie Halpern, Mary Mullins, Ian Scott and Jim Smith forreagents; and Brian Ciruna, Tony Harris, Robert Ho, Stephanie Lepage, HiroNinomiya, Ulli Tepass and Rudi Winklbauer for comments on the manuscript.A.E.E.B. thanks Rudi Winklbauer for many helpful discussions. ZIRC issupported by NIH-NCRR. A.E.E.B. was supported by NSERC and CFI.

Supplementary materialSupplementary material for this article is available athttp://dev.biologists.org/cgi/content/full/136/10/1675/DC1

ReferencesAbdelilah, S., Solnica-Krezel, L., Stainier, D. Y. and Driever, W. (1994).

Implications for dorsoventral axis determination from the zebrafish mutationjanus. Nature 370, 468-471.

Akimenko, M. A., Ekker, M., Wegner, J., Lin, W. and Westerfield, M. (1994).Combinatorial expression of three zebrafish genes related to distal-less: part of ahomeobox gene code for the head. J. Neurosci. 14, 3475-3486.

Beddington, R. S. P. (1994). Induction of a second neural axis by the mouse node.Development 120, 613-620.

Blum, M., Gaunt, S. J., Cho, K. W., Steinbeisser, H., Blumberg, B., Bittner, D.and De Robertis, E. M. (1992). Gastrulation in the mouse: the role of thehomeobox gene goosecoid. Cell 69, 1097-1106.

Blumberg, B., Wright, C. V. E., DeRobertis, E. M. and Cho, K. W. Y. (1991).Organizer-specific homeobox genes in Xenopus laevis embryos. Science 253,194-196.

Bruce, A. E., Oates, A. C., Prince, V. E. and Ho, R. K. (2001). Additional hoxclusters in the zebrafish: divergent expression patterns belie equivalent activitiesof duplicate hoxB5 genes. Evol. Dev. 3, 127-144.

Bruce, A. E., Howley, C., Zhou, Y., Vickers, S. L., Silver, L. M., King, M. L. andHo, R. K. (2003). The maternally expressed zebrafish T-box gene eomesoderminregulates organizer formation. Development 130, 5503-5517.

Chen, Y. and Schier, A. F. (2001). The zebrafish Nodal signal Squint functions as amorphogen. Nature 411, 607-610.

Cho, K. W., Blumberg, B., Steinbeisser, H. and De Robertis, E. M. (1991).Molecular nature of Spemann’s organizer: the role of the Xenopus homeoboxgene goosecoid. Cell 67, 1111-1120.

Christian, J. L. and Moon, R. T. (1993). Interactions between Xwnt-8 andSpemann organizer signaling pathways generate dorsoventral pattern in theembryonic mesoderm of Xenopus. Genes Dev. 7, 13-28.

Dal-Pra, S., Fürthauer, M., Van-Celst, J., Thisse, B. and Thisse, C. (2006).Noggin1 and Follistatin-like2 function redundantly to Chordin to antagonizeBMP activity. Dev. Biol. 298, 514-526.

Danilov, V., Blum, M., Schweickert, A., Campione, M. and Steinbeisser, H.(1998). Negative autoregulation of the organizer-specific homeobox genegoosecoid. J. Biol. Chem. 273, 627-635.

Erter, C. E., Solnica-Krezel, L. and Wright, C. V. (1998). Zebrafish nodal-related2 encodes an early mesendodermal inducer signaling from the extraembryonicyolk syncytial layer. Dev. Biol. 204, 361-372.

Fainsod, A., Steinbeisser, H. and De Robertis, E. M. (1994). On the function ofBMP-4 in patterning the marginal zone of the Xenopus embryo. EMBO J. 13,5015-5025.

Feldman, B., Gates, M. A., Egan, E. S., Dougan, S. T., Rennebeck, G.,Sirotkin, H. I., Schier, A. F. and Talbot, W. S. (1998). Zebrafish organizerdevelopment and germ-layer formation require nodal- related signals. Nature395, 181-185.

Ferreiro, B., Artinger, M., Cho, K. and Niehrs, C. (1998). Antimorphicgoosecoids. Development 125, 1347-1359.

Fisher, S., Amacher, S. L. and Halpern, M. E. (1997). Loss of cerebum functionventralizes the zebrafish embryo. Development 124, 1301-1311.

Fritz, D. T., Liu, D., Xu, J., Jiang, S. and Rogers, M. B. (2004). Conservation ofBmp2 post-transcriptional regulatory mechanisms. J. Biol. Chem. 279, 48950-48958.

Fürthauer, M., Thisse, B. and Thisse, C. (1999). Three different noggin genesantagonize the activity of bone morphogenetic proteins in the zebrafish embryo.Dev. Biol. 214, 181-196.

Gritsman, K., Zhang, J., Cheng, S., Heckscher, E., Talbot, W. S. and Schier, A.F. (1999). The EGF-CFC protein one-eyed pinhead is essential for nodalsignaling. Cell 97, 121-132.

Hammerschmidt, M., Pelegri, F., Mullins, M. C., Kane, D. A., van Eeden, F. J.,Granato, M., Brand, M., Furutani-Seiki, M., Haffter, P., Heisenberg, C. P. etal. (1996). dino and mercedes, two genes regulating dorsal development in thezebrafish embryo. Development 123, 95-102.

Hashiguchi, M., Shinya, M., Tokumoto, M. and Sakai, N. (2008).Nodal/Bozozok-independent induction of the dorsal organizer by zebrafish celllines. Dev. Biol. 321, 387-396.

Hashimoto, H., Itoh, M., Yamanaka, Y., Yamashita, S., Shimizu, T., Solnica-Krezel, L., Hibi, M. and Hirano, T. (2000). Zebrafish Dkk1 functions inforebrain specification and axial mesendoderm formation. Dev. Biol. 217, 138-152.

Helde, K. A., Wilson, E. T., Cretekos, C. J. and Grunwald, D. J. (1994).Contribution of early cells to the fate map of the zebrafish gastrula. Science265, 517-520.

Ho, R. K. (1992). Axis formation in the embryo of the zebrafish, Brachydanio rerio.Semin. Dev. Biol. 3, 53-64.

Izpisua-Belmonte, J. C., De Robertis, E. M., Storey, K. G. and Stern, C. D.(1993). The homeobox gene goosecoid and the origin of organizer cells in theearly chick blastoderm. Cell 74, 645-659.

Jowett, T. and Lettice, L. (1994). Whole-mount in situ hybridizations on zebrafishembryos using a mixture of digoxigenin- and fluorescein-labelled probes. TrendsGenet. 10, 73-74.

Kelly, C., Chin, A. J., Leatherman, J. L., Kozlowski, D. J. and Weinberg, E. S.(2000). Maternally controlled (beta)-catenin-mediated signaling is required fororganizer formation in the zebrafish. Development 127, 3899-3911.

Kelly, G. M., Greenstein, P., Erezyilmaz, D. F. and Moon, R. T. (1995). Zebrafishwnt8 and wnt8b share a common activity but are involved in distinctdevelopmental pathways. Development 121, 1787-1799.

Kessler, D. S. (1997). Siamois is required for formation of Spemann’s organizer.Proc. Natl. Acad. Sci. USA 94, 13017-13022.

Kimmel, C. B. and Law, R. D. (1985). Cell lineage of zebrafish blastomeres. III.Clonal analyses of the blastula and gastrula stages. Dev. Biol. 108, 94-101.

Kimmel, C. B. and Warga, R. M. (1987). Indeterminate cell lineage of thezebrafish embryo. Dev. Biol. 124, 269-280.

Kimmel, C. B., Warga, R. M. and Schilling, T. F. (1990). Origin and organizationof the zebrafish fate map. Development 108, 581-594.

Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B. and Schilling, T. F.(1995). Stages of embryonic development of the zebrafish. Dev. Dyn. 203, 253-310.

Koos, D. S. and Ho, R. K. (1999). The nieuwkoid/dharma homeobox gene isessential for bmp2b repression in the zebrafish pregastrula. Dev. Biol. 215, 190-207.

Krauss, S., Concordet, J. P. and Ingham, P. W. (1993). A functionally conservedhomolog of the Drosophila segment polarity gene hh is expressed in tissues withpolarizing activity in zebrafish embryos. Cell 75, 1431-1444.

Latinkic, B. V. and Smith, J. C. (1999). Goosecoid and mix.1 repress Brachyuryexpression and are required for head formation in Xenopus. Development 126,1769-1779.

Lekven, A. C., Thorpe, C. J., Waxman, J. S. and Moon, R. T. (2001). Zebrafishwnt8 encodes two wnt8 proteins on a bicistronic transcript and is required formesoderm and neurectoderm patterning. Dev. Cell 1, 103-114.

Leung, T., Bischof, J., Soll, I., Niessing, D., Zhang, D., Ma, J., Jackle, H. andDriever, W. (2003). bozozok directly represses bmp2b transcription andmediates the earliest dorsoventral asymmetry of bmp2b expression in zebrafish.Development 130, 3639-3649.

Little, S. C. and Mullins, M. C. (2006). Extracellular modulation of BMP activity inpatterning the dorsoventral axis. Birth Defects Res. C Embryo Today 78, 224-242.


DEVELO

PMENT

Mailhos, C., Andre, S., Mollereau, B., Goriely, A., Hemmati-Brivanlou, A. andDesplan, C. (1998). Drosophila Goosecoid requires a conserved heptapeptidefor repression of paired-class homeoprotein activators. Development 125, 937-947.

Martinez-Barbera, J. P., Toresson, H., Da Rocha, S. and Krauss, S. (1997).Cloning and expression of three members of the zebrafish Bmp family: Bmp2a,Bmp2b and Bmp4. Gene 198, 53-59.

Miller-Bertoglio, V. E., Fisher, S., Sanchez, A., Mullins, M. C. and Halpern, M.E. (1997). Differential regulation of chordin expression domains in mutantzebrafish. Dev. Biol. 192, 537-550.

Mullins, M. C., Hammerschmidt, M., Kane, D. A., Odenthal, J., Brand, M.,van Eeden, F. J., Furutani-Seiki, M., Granato, M., Haffter, P., Heisenberg,C. P. et al. (1996). Genes establishing dorsoventral pattern formation in thezebrafish embryo: the ventral specifying genes. Development 123, 81-93.

Nasevicius, A. and Ekker, S. C. (2000). Effective targeted gene ‘knockdown’ inzebrafish. Nat. Genet. 26, 216-220.

Niehrs, C. (2004). Regionally specific induction by the Spemann-Mangoldorganizer. Nat. Rev. Genet. 5, 425-434.

Niehrs, C., Keller, R., Cho, K. W. and De Robertis, E. M. (1993). Thehomeobox gene goosecoid controls cell migration in Xenopus embryos. Cell72, 491-503.

Nojima, H., Shimizu, T., Kim, C. H., Yabe, T., Bae, Y. K., Muraoka, O., Hirata,T., Chitnis, A., Hirano, T. and Hibi, M. (2004). Genetic evidence forinvolvement of maternally derived Wnt canonical signaling in dorsaldetermination in zebrafish. Mech. Dev. 121, 371-386.

Oelgeschläger, M., Kuroda, H., Reversade, B. and De Robertis, E. M. (2003).Chordin is required for the Spemann organizer transplantation phenomenon inXenopus embryos. Dev. Cell 4, 219-230.

Oppenheimer, J. M. (1934). Experiments on early developing stages of Fundulus.Proc. Natl. Acad. Sci. USA 20, 536-538.

Piccolo, S., Sasai, Y., Lu, B. and De Robertis, E. M. (1996). Dorso-ventralpatterning in Xenopus: inhibition of ventral signals by direct binding of Chordinto BMP-4. Cell 86, 589-598.

Ramel, M. C. and Lekven, A. C. (2004). Repression of the vertebrate organizer byWnt8 is mediated by Vent and Vox. Development 131, 3991-4000.

Ramel, M. C., Buckles, G. R., Baker, K. D. and Lekven, A. C. (2005). WNT8 andBMP2B co-regulate non-axial mesoderm patterning during zebrafishgastrulation. Dev. Biol. 287, 237-248.

Rivera-Perez, J. A., Mallo, M., Gendron-Maguire, M., Gridley, T. andBehringer, R. R. (1995). Goosecoid is not an essential component of the mousegastrula organizer but is required for craniofacial and rib development.Development 121, 3005-3012.

Rupp, R. A., Snider, L. and Weintraub, H. (1994). Xenopus embryos regulatethe nuclear localization of XMyoD. Genes Dev. 8, 1311-1323.

Sampath, K., Rubinstein, A. L., Cheng, A. M., Liang, J. O., Fekany, K.,Solnica-Krezel, L., Korzh, V., Halpern, M. E. and Wright, C. V. (1998).Induction of the zebrafish ventral brain and floorplate requires cyclops/nodalsignalling. Nature 395, 185-189.

Sander, V., Reversade, B. and De Robertis, E. (2007). The opposing homeoboxgenes Goosecoid and Vent1/2 self-regulate Xenopus patterning. EMBO J. 26,2955-2965.

Sasai, Y., Lu, B., Steinbeisser, H., Geissert, D., Gont, L. K. and De Robertis, E.M. (1994). Xenopus chordin: a novel dorsalizing factor activated by organizer-specific homeobox genes. Cell 79, 779-790.

Saúde, L., Woolley, K., Martin, P., Driever, W. and Stemple, D. L. (2000). Axis-inducing activities and cell fates of the zebrafish organizer. Development 127,3407-3417.

Schier, A. F. and Talbot, W. S. (2005). Molecular genetics of axis formation inzebrafish. Annu. Rev. Genet. 39, 561-613.

Schier, A. F., Neuhauss, S. C., Helde, K. A., Talbot, W. S. and Driever, W.(1997). The one-eyed pinhead gene functions in mesoderm and endodermformation in zebrafish and interacts with no tail. Development 124, 327-342.

Schulte-Merker, S., Ho, R. K., Herrmann, B. G. and Nusslein-Volhard, C.(1992). The protein product of the zebrafish homologue of the mouse T gene isexpressed in nuclei of the germ ring and the notochord of the early embryo.Development 116, 1021-1032.

Schulte-Merker, S., Hammerschmidt, M., Beuchle, D., Cho, K. W., DeRobertis, E. M. and Nusslein-Volhard, C. (1994). Expression of zebrafishgoosecoid and no tail gene products in wild- type and mutant no tail embryos.Development 120, 843-852.

Schulte-Merker, S., Lee, K. J., McMahon, A. P. and Hammerschmidt, M.(1997). The zebrafish organizer requires chordino. Nature 387, 862-863.

Seiliez, I., Thisse, B. and Thisse, C. (2006). FoxA3 and goosecoid promoteanterior neural fate through inhibition of Wnt8a activity before the onset ofgastrulation. Dev. Biol. 290, 152-163.

Shih, J. and Fraser, S. E. (1995). Distribution of tissue progenitors within theshield region of the zebrafish gastrula. Development 121, 2755-2765.

Shih, J. and Fraser, S. E. (1996). Characterizing the zebrafish organizer:microsurgical analysis at the early-shield stage. Development 122, 1313-1322.

Smith, S. T. and Jaynes, J. B. (1996). A conserved region of engrailed, sharedamong all en-, gsc-, Nk1-, Nk2- and msh-class homeoproteins, mediates activetranscriptional repression in vivo. Development 122, 3141-3150.

Spemann, H. and Mangold, H. (1924). Uber induction von embryonanlagendurch implantation artfremder organis atoren. Roux’s Arch. Dev. Biol. 100, 599-638.

Stachel, S. E., Grunwald, D. J. and Myers, P. Z. (1993). Lithium perturbation andgoosecoid expression identify a dorsal specification pathway in the pregastrulazebrafish. Development 117, 1261-1274.

Steinbeisser, H., Fainsod, A., Niehrs, C., Sasai, Y. and De Robertis, E. M.(1995). The role of gsc and BMP-4 in dorsal-ventral patterning of the marginalzone in Xenopus: a loss-of-function study using antisense RNA. EMBO J. 14,5230-5243.

Talbot, W. S., Trevarrow, B., Halpern, M. E., Melby, A. E., Farr, G.,Postlethwait, J. H., Jowett, T., Kimmel, C. B. and Kimelman, D. (1995). Ahomeobox gene essential for zebrafish notochord development. Nature 378,150-157.

Tucker, J. A., Mintzer, K. A. and Mullins, M. C. (2008). The BMP signalinggradient patterns dorsoventral tissues in a temporally progressive manner alongthe anterioposterior axis. Dev. Cell 14, 108-119.

Waddington, C. H. (1932). Experiments on the development of the chick and theduck embryo cultivated in vitro. Philos. Trans. R. Soc. London Ser. B 211, 179-230.

Yamada, G., Mansouri, A., Torres, M., Stuart, E. T., Blum, M., Schultz, M., DeRobertis, E. M. and Gruss, P. (1995). Targeted mutation of the murinegoosecoid gene results in craniofacial defects and neonatal death. Development121, 2917-2922.

Yamanaka, Y., Mizuno, T., Sasai, Y., Kishi, M., Takeda, H., Kim, C. H., Hibi, M.and Hirano, T. (1998). A novel homeobox gene, dharma, can induce theorganizer in a non-cell- autonomous manner. Genes Dev. 12, 2345-2353.

Yao, J. and Kessler, D. S. (2001). Goosecoid promotes head organizer activity bydirect repression of Xwnt8 in Spemann’s organizer. Development 128, 2975-2987.

Yasuo, H. and Lemaire, P. (2001). Role of Goosecoid, Xnot and Wnt antagonistsin the maintenance of the notochord genetic programme in Xenopus gastrulae.Development 128, 3783-3793.

Zhu, L., Belo, J. A., De Robertis, E. M. and Stern, C. D. (1999). Goosecoidregulates the neural inducing strength of the mouse node. Dev. Biol. 216, 276-281.


DEVELO

PMENT

development 136, 1675-1685 (2009) doi:10.1242/dev.031161 ... · research article 1675 introduction...

Documents