Aquaculture 434 (2014) 340–347

Contents lists available at ScienceDirect

Aquaculture

j ourna l homepage: www.e lsev ie r .com/ locate /aqua-on l ine

Effects of dietary choline supplementation on growth performanceand hepatic lipid transport in blunt snout bream(Megalobrama amblycephala) fed high-fat diets

Jun-yi Li, Ding-dong Zhang, Wei-na Xu, Guang-zhen Jiang, Chun-nuan Zhang, Xiang-fei Li, Wen-bin Liu ⁎Key Laboratory of Aquatic Animal Nutrition and Feed Science of Jiangsu Province, College of Animal Science and Technology, Nanjing Agricultural University, Nanjing 210095, China

⁎ Corresponding author at: Nanjing Agricultural Univ210095, Jiangsu Province, China. Tel./fax: +86 25 843953

E-mail address: wbliu@njau.edu.cn (W. Liu).

http://dx.doi.org/10.1016/j.aquaculture.2014.08.0060044-8486/© 2014 Elsevier B.V. All rights reserved.

a b s t r a c t

a r t i c l e i n f o

Article history:Received 7 April 2014Received in revised form 26 July 2014Accepted 5 August 2014Available online 13 August 2014

Keywords:Choline supplementationHigh-fat dietsGrowthLipid transportBlunt snout bream

In this study, we elucidated the choline metabolic pathways and its effects on growth and hepatic lipid transportin blunt snout bream, Megalobrama amblycephala. Fish were fed six experimental diets containing three lipidlevels (5%, 8%, and 11%) and two choline supplementation levels (1200 and 1800 mg kg−1) for 8 weeks. Afterthe feeding trial, viscera/body ratio, hepatosomatic index, plasma aspartate aminotransferase activities, andplasma triglyceride and cholesterol contents as well as liver lipid content all increased significantly (P b 0.05)as dietary lipid levels increased from 5 to 11% in terms of dietary lipid levels, whereas feed conversion ratio,plasma cholesterol content and liver lipid content decreased significantly (P b 0.05) with increasing choline sup-plementations. Weight gain increased significantly (P b 0.05) with increasing dietary choline supplementationswhen dietary lipid levels reached 11%. Additionally, hepatic lipid accumulation was further observed by oil redO staining. An increase in hepatic S-adenosylmethionine was found in fish fed diets supplemented with1800 mg kg−1 choline, indicating that extra choline supplementation increases very low density lipoprotein(VLDL) production through methylation of phosphatidylethanolamine to synthesize phosphatidylcholine.Additionally, increased SAMproduction resulted in a subsequent increase in glutathione concentration, suggestinga possible benefit inmitigating oxidative stress induced by a high-fat diet. 1800mg kg−1 choline supplementationin diet significantly up-regulated the relative mRNA expression levels of apolipoprotein B-100 and microsomaltriglyceride transfer protein, which induced VLDL synthesis and assembly.

© 2014 Elsevier B.V. All rights reserved.

1. Introduction

Choline is an essential nutrient that is primarily provided by the diet.It plays a pivotal role in maintaining cell structure and movement oflipids in and out of the cells (Blusztajn, 1998). It is a precursor to phos-phatidylcholine (Mehta et al., 2010), which is an important constituentof lipoproteins. Moreover, choline (after it has been irreversiblyoxidized to betaine by a two-stage reaction) is a provider of freemethylgroups (Simon, 1999), which act in methylation. Previous studies withseveral species of fish showed or indicated that dietary choline is re-quired for optimum growth as well as for preventing lipid deposition(Hung, 1989; Criag and Gatlin, 1997; Jiang et al., 2013). Hence, thecholine metabolic pathways and the effects on lipid metabolism in theliver of fish need to be understood.

Under normal physiological conditions, there is a balance betweenlipid deposition and transportation to sustain lipid homeostasis of

ersity, Weigang No. 1, Nanjing82.

the liver. Very low dense lipoprotein (VLDL) delivers endogenous anddietary lipids from the liver to peripheral tissues for storage or use(Davis et al., 1979). VLDL is a complex particle consisting of a core of neu-tral lipids (mostly triglycerides) surrounded by a monolayer of amphi-pathic lipids, such as phospholipids (Olofsson et al., 2000). Hence, theprocess of VLDL production involves the biosynthesis of phosphatidylcho-line, which is derived from free choline molecules (Kennedy and Weiss,1956), as well as a stepwise methylation of phosphatidylethanolamine(PEMT pathway) (Bremer and Greenberg, 1961; Vance and Ridgway,1988). The latter synthetic pathway requires S-adenosylmethionine(SAM), which functions as a direct methyl donor (Blusztajn et al., 1985).Additionally, apolipoprotein B-100 (apoB-100) is the major apolipopro-tein in VLDL secreted exclusively from the liver (Brodsky and Fisher,2008). Microsomal triglyceride transfer protein (MTTP) is an intracellularprotein that enhances the rate of neutral lipid transfer (Hussain et al.,2003; Wetterau et al., 1997) located within the endoplasmic reticulumof apoB-containing lipoprotein-secreting cells, predominantly hepato-cytes and intestinal enterocytes (Raabe et al., 1999; Wetterau et al.,1997), thus plays a vital role in the control of VLDL synthesis, assembly,and secretion (Shindo et al., 2010) and are closely associatedwith hepaticlipid transport. Although choline is regarded as a lipotropic agent in some

Table 1Ingredient and proximate composition of experimental diets.

Choline supplementation mg kg−1

1200 1800

Dietary lipid level %

5 8 11 5 8 11

Ingredient composition %Caseina 26.0 26.0 26.0 26.0 26.0 26.0Gelatinb 6.50 6.50 6.50 6.50 6.50 6.50Fish mealb 5.00 5.00 5.00 5.00 5.00 5.00Soybean oilc 4.70 7.80 10.9 4.70 7.80 10.9Corn starchb 39.0 39.0 39.0 39.0 39.0 39.0Cellulosed 13.0 10.0 7.00 13.0 10.0 7.00Vitamin and mineral premixe 1.20 1.20 1.20 1.20 1.20 1.20Calcium biphosphated 1.80 1.80 1.80 1.80 1.80 1.80Sodium chloride 0.50 0.50 0.50 0.50 0.50 0.50Carboxymethyl cellulosed 2.00 2.00 2.00 2.00 2.00 2.00Choline chloride 0.29 0.29 0.29 0.45 0.45 0.45

Proximate composition %Moisture 13.0 13.2 13.0 13.2 12.9 13.1Crude protein 32.5 32.9 33.0 32.9 32.7 32.5Crude lipid 5.22 8.07 11.2 5.21 8.11 11.0Ash 4.71 4.80 5.09 4.98 5.14 4.67Crude fiber 12.2 9.41 7.36 12.8 9.82 6.88Nitrogen-free extractf 32.4 31.6 30.4 31.1 31.3 31.9Methionine 0.76 0.75 0.76 0.76 0.76 0.76

a Provided by Hulunbeier Sanyuan Milk Co., Ltd (Inner Mongolia, China).b Provided by Zhengchang Feed Industry Co., Ltd (Huaian, China).c Purchased from Coland Feed Industry Co., Ltd (Wuhan, China).d Provided by Lanping Industry Co., Ltd (Shanghai, China).e Premix supplied the following minerals (g/kg) and vitamins (IU or mg/kg):

CuSO4·5H2O 2.0 g, FeSO4·7H2O 25 g, ZnSO4·7H2O 22 g, MnSO4·4H2O 7 g, Na2SeO3

0.04 g, KI 0.026 g, CoCl2·6H2O 0.1 g, VA 900000 IU, VD 200000 IU, VE 4500 mg, VK3

220 mg, VB1 320 mg, VB2 1090 mg, VB6 500 mg, VB12 1.6 mg, VC 10000 mg, pantothenate1000 mg, folic acid 165 mg, niacin 2500 mg, biotin 100 mg, myoinositol 150 mg.

f Calculated by difference (100 − moisture − crude protein − crude lipid − ash −crude fiber).

341J. Li et al. / Aquaculture 434 (2014) 340–347

species of animals, our knowledge about the link between dietary cholineand lipid metabolism in fish is limited.

Blunt snout bream (Megalobrama amblycephala) is a major herbivo-rous freshwater fish native to Chinawhere it is widely favored due to itstender flesh, high survival rate, fast growth, use of natural food, and highdisease resistance (Zhou et al., 2008). Like other herbivorous freshwaterfish, blunt snout bream cannot tolerate high dietary lipids, and excesslipids may cause lipid deposition in the liver (Arzel et al., 1994; Leeet al., 2002; Stephan et al., 1996; Stowell and Gatlin, 1992), whichleads to impaired liver function and metabolic and physiologicalabnormities (Lu et al., 2013a,b) and reduced resistance to disease (Liet al., 2012). Bearing this in mind, more information on the effects ofdietary choline supplementation in blunt snout bream fed a diet withdifferent lipid levels could be important for commercial production.The principal goal of this study is to elucidate the metabolic pathwayof choline and the effects of choline on growth and hepatic lipid trans-port in blunt snout bream in order to further understand how cholinesupplementation attenuates the harmful effects induced by high-fatdiets in this fish species.

2. Materials and methods

2.1. Experimental diets

A 3 × 2 factorial design with four replicates was used in this study.Six isonitrogenous (320 g kg−1 crude protein) semi-purified dietswere formulated to contain three lipid levels (5%, 8%, and 11%) andtwo choline supplementation levels (1200 and 1800 mg kg−1). Dietaryprotein was supplied by casein, gelatin, and fish meal. Soybean oil wasused as the lipid source. The diets were formulated to meet the optimaldietary protein, lipid and choline requirements of juvenile blunt snoutbream (Li et al., 2010; Jiang et al., 2013). The experimental diets wereformulated with a choline-free vitamin premix. Choline chloride(Sigma, St. Louis, MO, USA) was supplemented in the basal diet to for-mulate experimental diets containing 1195 and 1782 mg kg−1 choline(Venugopal, 1985). Formulation and proximate composition of theexperimental diets are presented in Table 1. All diets were prepared inthe laboratory. Ingredients were finely ground, well mixed, and pellet-ized through a pellet machine. After drying, all diets were stored at−20 °C in plastic bags until use.

2.2. Experimental fish and feeding trial

Juvenile blunt snout bream (M. amblycephala) were obtained fromthe fish hatchery of Yangzhou (Jiangsu, China). Prior to the experiment,fishwere kept in an indoor circulatory system to acclimate to the exper-iment conditions by feeding a diet which contains 5% lipid for onemonth. After a one-month acclimation, fish of similar sizes (average ini-tial weight: 9.80 ± 0.35 g) were randomly distributed into 24 tanks(300 L each) at a rate of 30 fish per tank. Fish in each aquarium wererandomly assigned one of six experimental diets. Each diet was testedin four replicates. Fish were hand-fed to apparent satiation three timesdaily (08:00, 12:00 and 17:00 h) for 8 weeks. A 12:12 h light:darkregime (07:30–19:30 h, light period) wasmaintained by timed fluores-cent lighting. Water temperature varied from 25 to 28 °C, and pHfluctuated between 7.2 and 7.6. Ammonia nitrogen and nitrite nitrogenwere maintained below 0.4 mg/L and 0.064 mg/L, respectively.Dissolved oxygen was maintained above 6.00 mg L−1 during the feed-ing trial.

2.3. Sample collection

At the end of the feeding trial, fish were starved for 24 h to evacuatealimentary tract contents prior to harvest. Then, fish were euthanizedby MS-222 (tricaine methanesulfonate, Sigma, USA) at a concentrationof 100 mg L−1. No mortalities were observed during the experiment.

Blood sample was rapidly taken from caudal vessel into heparinizedEppendorf tubes and centrifuged at 3000 rpm (850 g) for 10 min at4 °C. The supernatant was stored at −70 °C until analysis. After bloodcollection, the total number and weight of fish in each cage were deter-mined. Six fish were randomly sampled from each tank for analysis ofbody weight and length, viscera/body ratio and hepatosomatic index.Also, individual liver from fifteen fish in each tankwas quickly removedand stored at−70 °C for subsequent analysis.

2.4. Analysis

2.4.1. Proximate composition analysisThe proximate composition of diets was analyzed following the stan-

dardmethods (A.O.A.C., 1995).Moisturewas determined by oven dryinguntil constant weight (105 °C); crude protein (nitrogen × 6.25) wasdetermined by the Kjeldahl method using an Auto Kjeldahl System(FOSS KT260, Switzerland); crude lipid by ether-extraction using SoxtecSystemHT (Soxtec SystemHT6, Tecator, Sweden); ash by combustion at550 °C for 4 h; crude fiber by fritted glass cruciblemethod using an auto-matic analyzer (ANKOM A2000i, USA) and gross energy by an adiabaticbomb calorimeter (PARR 1281, USA). Liver lipid was extracted with achloroform:methanol (2:1 V:V)mixture according to Folch et al. (1957).

2.4.2. Measures of plasma biochemical parametersActivities of plasma aspartate aminotransferase (AST) and alanine

aminotransferase (ALT) were both measured following the methodsdetailed by Rietman and Frankel (1957). Concentrations of triglycerides(TG) and cholesterol (T-CHO) in plasmawere determined by colorimet-ric enzymatic methods using commercial kits (Beijing BHKT ClinicalReagent Co., 101 Ltd, China). Plasma glucose level was measured bythe glucose oxidase method as described by Asadi et al. (2009).

342 J. Li et al. / Aquaculture 434 (2014) 340–347

2.4.3. Analysis of hepatic glutathione (GSH) and glutathione disulfide (GSSG)concentrations, S-adenosylmethionine (SAM) and S-adenosylhomocysteine(SAH) levels

GSH and GSSG concentrations were all measured according to themethods described by Lygren et al. (1999). Liver tissuewas homogenizedin 1.15% KCl, and then added to one volume of 10% trichloroacetic acid.The homogenate was incubated on ice for 15 min, vortexed and centri-fuged at 10000 rpm (9500 g) for 20 min. The supernatant was passedthrough a 0.45 μm filter and then applied to a high-performance liquidchromatography (HPLC) column. The contents of SAM and SAH weremeasured as described previously (She et al., 1994).

2.4.4. Oil red O stainingAfter in vivo fixed by 4% paraformaldehyde and removed from body,

liver tissue was embedded in OCT, snap-frozen in liquid nitrogen, andstored at−80 °C. Frozen liver tissuewas sectioned (5 μm) and commit-ted to neutral lipid staining with oil red O (Direct Red 80; Aldrich,Milwaukee, WI, USA) following standard procedure (Gao et al., 2010).

2.4.5. Total RNA extraction, reverse transcription and real-time PCRTotal RNA was extracted from the liver tissue using Trizol

(Invitrogen, CA, USA). RNA samples were treated by RQ1 RNase-FreeDNase prior to RT-PCR (Takara Co. Ltd, Japan) to avoid genomic DNAamplification. cDNA was generated from 500 ng DNase-treated RNAusing an ExScript™ RT-PCR kit (Takara Co. Ltd, Japan), and the mixtureconsisted of 500 ng RNA, 2 μl buffer (5×), 0.5 μl dNTP mixture (10 mMeach), 0.25 μl RNase inhibitor (40 U/μl), 0.5 μl dT-AP primer (50 mM),0.25 μl ExScript™ RTase (200 U/μl), and DEPC H2O, with a total volumeup to 10 μl. The reaction conditions were as follows: 42 °C for 40 min,90 °C for 2 min, and 4 °C thereafter. Real-time PCR was employed todetermine mRNA levels based on the SYBR Green I Fluorescence Kit.Primers (Table 2) for the real-time PCR analysis were designed usingthe Primer5 Software, based on the cDNA sequences available inpublished papers. Real-time PCR was performed in a Mini Option real-time detector (BIO-RAD, USA). The fluorescent quantitative PCR reac-tion solution consisted of 12.5 μl SYBR® premix Ex Taq™ (2×), 0.5 μlPCR forward primer (10 μM), 0.5 μl PCR reverse primer (10 μM), 2.0 μlRT reaction (cDNA solution), and 9.5 μl dH2O. The reaction conditionswere as follows: 95 °C for 3 min followed by 45 cycles consisting of95 °C for 10 s and 60 °C for 20 s. The florescent flux was then recorded,and the reaction continued at 72 °C for 3 min. The dissolution rate wasmeasured between 65 and 90 °C. Each increase of 0.2 °C was main-tained for 1 s, and the florescent flux was recorded. All ampliconswere initially separated by agarose gel electrophoresis to ensure thatthey were of correct size. A dissociation curve was determined duringthe PCR program to make sure that specific products were obtained ineach run. To calculate relative expression levels, the β-actin gene ofblunt snout bream was used as internal control to normalize the Ct

value in each sample, and the relative expression levels under differentexperimental diets were calculated by 2−ΔΔCt method.

2.5. Statistical analysis

All data were analyzed using the statistical software SPSS (version16.0, Michigan Avenue, Chicago, IL, USA). Normality of the data and ho-mogeneity of the variancewere tested to ensure that the assumptions ofanalysis of variance (ANOVA) were satisfied using Levene's tests. If the

Table 2Primers used in the experiment.

Name Target Forward (5′–3′)

apoB-100 qPCR for apoB-100 ATTCCAACAACACGGCATTTMTTP qPCR for MTTP TACAAGGCTACCAAACAβ-Actin qPCR for β-actin CGGACAGGTCATCACCATTG

ApoB-100: apolipoprotein B-100; MTTP: microsomal triglyceride transfer protein.

variances were normally distributed, Tukey's test for multiple compari-sons of means was applied. Differences were considered significant at alevel of 95% (P b 0.05). All data are presented asmeanof 4 tank replicates.

3. Results

3.1. Growth performance

Growth, feed utilization, and biometric parameters are presented inTable 3. Both WG and condition factor were not affected by either lipidlevels or choline supplementation levels. VBR and HSI both increasedsignificantly (P b 0.05) as dietary lipid levels increased from 5 to 11%,whereas FCR decreased significantly (P b 0.05) with increasing cholinesupplementations. In addition, a significant interaction between dietarylipid and choline was observed in WG and FCR (P b 0.05). They bothshowed little difference (P N 0.05) with increasing dietary cholinesupplementations when dietary lipid was 5 and 8%. However, weightgain increased significantly (P b 0.05) with increasing choline supple-mentations from 1200 to 1800 mg kg−1 when dietary lipid levelreached 11%, whereas the opposite was true for FCR.

3.2. Plasma biochemistry parameters

Plasma parameters, indicating liver damage, and lipid metabolitesare presented in Table 4. Both ALT and glucose were not affected by ei-ther lipid levels or choline supplementation levels. AST activity, TG andT-CHO content all increased significantly (P b 0.01) as dietary lipidlevels increased from 5 to 11%, whereas T-CHO decreased significantly(P b 0.01) with increasing choline supplementations. Additionally,they all showed no significant (P N 0.05) interaction between dietarylipid and choline levels.

3.3. Hepatic lipid content and GSH and GSSG concentrations

Hepatic lipid content and GSH andGSSG concentrations are present-ed in Table 5. Both GSH concentration and GSH/GSSG were not affectedby either lipid levels or choline supplementation levels. Liver lipid con-tent increased significantly (P b 0.01) as dietary lipid levels increasedfrom 5 to 11%, whereas liver lipid content decreased significantly(P b 0.01) with increasing choline supplementations. In addition, asignificant interaction between dietary lipid and choline was observedin liver lipid content and GSH concentration (P b 0.01). They bothshowed little difference (P N 0.05) with increasing dietary cholinesupplementations when dietary lipid was 5 and 8%. However, liverlipid content decreased significantly (P b 0.05) with increasing cholinesupplementation levels from 1200 to 1800 mg kg−1 when dietarylipid level reached 11%, whereas the opposite was true for GSHconcentration.

3.4. Hepatic SAM and SAH levels

Hepatic SAM and SAH levels are shown in Table 6. Both SAM levelsand SAM/SAH decreased significantly (P b 0.05) as dietary lipid levelsincreased from 5 to 11%. Additionally, hepatic SAM level significantly(P b 0.05) elevated with increasing choline supplementations withthe highest value in fish fed 11% lipid and 1800 mg kg−1 choline

Reverse (5′–3′) Fragment length (bp)

GAGCAGTGGCAGTTTCATTT 426AGACTTCCCACTGACG 111CGCAAGACTCCATACCCAAGA 196

Table 3Growth performance in blunt snout bream fed diets containing three levels of lipid with two choline supplementation levels.

Diets Weight gain (WG)1 Feed conversion ratio (FCR)2 Condition factor Viscera/body ratio (VBR)3 Hepatosomatic index (HSI)4

Choline mg kg−1 Lipid %

1200 5 115.30ab 2.30ab 1.93 7.39 1.218 139.18b 2.13a 1.97 8.45 1.23

11 95.62a 2.73c 1.98 9.48 1.471800 5 118.47ab 2.05a 1.86 7.46 1.11

8 122.83ab 2.38ab 1.89 8.77 1.1811 145.44b 2.01a 1.93 8.79 1.29

Pooled SEM 5.31 0.08 0.02 0.17 0.04

Two-way ANOVA

Dietary lipid 0.427 0.588 0.335 0.000 0.049Choline supplementation 0.192 0.036 0.052 0.726 0.144Interaction 0.022 0.014 0.915 0.342 0.700

Means and pooled SEM are presented for each parameter. Means in the same column with different superscripts are significantly different (P b 0.05).1 Weight gain (WG, %) = (Wt − W0) × 100/W0.2 Feed conversion ratio (FCR, %) = feed consumption (g) / fish weight gain (g).3 Viscera/body ratio (VBR, %) = (viscera weight × 100) / wet body weight.4 Hepatosomatic index (HSI, %) = liver weight (g) × 100 / body weight (g).

343J. Li et al. / Aquaculture 434 (2014) 340–347

supplementation. Hepatic SAH levelwas little significantly (P N 0.05) af-fected by either lipid levels or choline supplementations.

3.5. Morphology of liver tissue

As shown in Fig. 1, frozen tissue sections of fish liver were stainedwith oil red O. Significant differences were observed between fish fedexperimental diets containing various levels of lipids and cholinesupplementations. Small individual lipid droplets within the liver cellsappeared in fish with 5% and 8% dietary lipids (Fig. 1A, B, D, and E),while a large number of lipid droplet clusters were seen in fish feddiet with 11% lipid and 1200 mg kg−1 choline supplementation(Fig. 1C). In contrast, decreased clusters of lipid droplets were observedin liver of fish fedwith 11% lipid and 1800mg kg−1 choline supplemen-tation (Fig. 1F).

3.6. Expressions of apolipoprotein B-100 (apoB-100) and microsomaltriglyceride transfer protein (MTTP) mRNA

ApoB-100 andMTTPmRNA expressions in the liver are presented inFigs. 2 and 3, respectively. Both apoB-100 and MTTP mRNA expressionlevels significantly (P b 0.05) increased as dietary lipid levels increasedfrom 5 to 11%. Additionally, apoB-100 and MTTP mRNA expressionlevels significantly (P b 0.05) increased with increasing choline supple-mentations from 1200 to 1800 mg kg−1. There is also a significant

Table 4Plasma biochemistry parameters in blunt snout bream fed diets containing three levels oflipid with two choline supplementation levels.

Diets AST(U L−1)

ALT(U L−1)

TG(mmol L−1)

T-CHO(mmol L−1)

Glucose(mmol L−1)

Cholinemg kg−1

Lipid%

1200 5 2.99 0.77 1.36 1.29 3.368 3.05 0.51 1.17 1.58 3.98

11 4.61 1.18 2.07 2.21 4.901800 5 3.13 0.65 1.38 0.98 3.50

8 2.90 0.78 1.01 1.01 3.8611 3.99 0.82 1.67 1.65 3.88

Pooled SEM 0.17 0.06 0.11 0.09 0.17

Two-way ANOVA

Dietary lipid 0.003 0.098 0.009 0.000 0.081Choline supplementation 0.135 0.796 0.390 0.006 0.316Interaction 0.372 0.175 0.710 0.828 0.340

Means and pooled SEM are presented for each parameter.Means in the same columnwithdifferent superscripts are significantly different (P b 0.05).

(P b 0.05) interaction between dietary lipid and choline in apoB-100and MTTP mRNA expression. They both increased significantly(P b 0.05) with increasing choline supplementations from 1200 to1800 mg kg−1 when dietary lipid levels reached 8 and 11%.

4. Discussions

Lipids, an effective energy source for fish, play a prominent role inproviding essential fatty acids and phospholipids, which are neededfor maintaining biological structure and normal functions of tissuesand organelles (Sargent et al., 1999). However, in many fish speciesan increase in dietary lipids may lead to increased lipid deposition intissues (Du et al., 2005), thus possibly being disadvantageous tothe growth and health of fish (Lu et al., 2013a). In the present study,weight gain tended to increase with increasing lipid levels, whereasthe lowest weight gain was observed in fish fed diet with 11% lipid and1200mgkg−1 choline supplementation. However, 1800mgkg−1 cholinesupplementation gave the best growth performance in high-fat (11%)diet. The interactive effect of dietary lipid levels and choline supplementa-tions on weight gain and FCR indicates that the appropriate increase indietary lipid could improve growth performance and feed utilization(Johnsen et al., 1993; Peres and Oliva-Teles, 1999; Watanabe et al.,1978). Furthermore, extra choline supplementation may be beneficial tomitigate the harmful effects of a high-fat diet on growth.

ALT and AST are quantitatively the most important aminotransfer-ases in fish and are commonly recognized as a valuable tool for indica-tions of tissue damage (Wroblewski, 1959; Wroblewski and Ladue,1956a,b). The elevated plasma AST and ALT levels in experimental fishfed the diet consisting of 11% lipid and 1200 mg kg−1 choline supple-mentation suggest that there was a release of intracellular enzymesinto the blood (Cheng and Kong, 2011), possibly indicating damage tomembranes of hepatocytes from oxidative stress and further lipidperoxidation. However, after 1800 mg kg−1 choline was added to thehigh-fat diet, plasma AST and ALT activities as well as the hepatic lipidcontent returned to normal values. Thismight be attributable to the res-olution of hepatic steatosis and injury (Takeuchi-Yorimoto et al., 2013).

The levels of energeticmetabolites (triglycerides, cholesterol) of fishare also considered important indices of health status (Coz-Rakovacet al., 2005, 2008; Mensinger et al., 2005; Wagner and Congleton,2004). Fish fed experimental diets with increased lipids had elevatedplasma triglycerides and cholesterol levels, with the highest values infish fed the 11% lipid and 1200 mg kg−1 choline supplementation.This may indicate metabolic disorders of lipids and lipoproteins aswell as liver dysfunction (Mensinger et al., 2005; Takeuchi-Yorimotoet al., 2013). Likewise, the higher glucose level in fish fed the diet of

Table 5Hepatic lipid content and GSH and GSSG concentrations in blunt snout bream fed dietscontaining three levels of lipid with two choline supplementation levels.

Diets Liver lipidcontent(mg kg−1)

GSH(mg g prot−1)

GSSG(mg g prot−1)

GSH/GSSG

Cholinemg kg−1

Lipid %

1200 5 117bc 10.7bc 1.07 10.18 123b 11.9c 1.29 10.2

11 157a 7.01a 1.31 5.601800 5 108c 10.3b 1.03 9.68

8 114bc 10.7bc 1.05 8.8911 125b 9.45b 1.24 7.04

Pooled SEM 4.80 0.23 0.04 0.43

Two-way ANOVA

Dietary lipid 0.001 0.630 0.472 0.745Choline supplementation 0.000 0.000 0.589 0.066Interaction 0.005 0.003 0.844 0.267

Means and pooled SEM are presented for each parameter.Means in the same columnwithdifferent superscripts are significantly different (P b 0.05).

344 J. Li et al. / Aquaculture 434 (2014) 340–347

11% lipid with 1200mg kg−1 choline supplementation compared to theother experimental groups suggests a stress response to high-fat diets inthis fish species since glucose production in fish is mostly mediated bythe action of cortisol, which stimulates liver glucogenesis and gluconeo-genesis when fish are subjected to suboptimal or stressful conditions(Iwama et al., 1999). In contrast, plasma triglycerides, cholesterol,and glucose concentrations showed a reversed trend with a diet of1800 mg kg−1 choline supplementation and 11% lipid, suggesting arole of choline in alleviating liver damage caused by a high-fat intake.However, supplementing 1800 mg kg−1 choline in the diet may nothave a significant influence on blunt snout bream fed with low (5%) oroptimum (8%) lipid levels.

Oil red O staining is commonly used for the detection of triacylglyc-erols and cholesteryl esters and for quantitative evaluation of steatosis(Fowler and Greenspan, 1985; Takeuchi-Yorimoto et al., 2013) and isa valuable tool in the diagnostic histopathologic process (Dekker et al.,1979). The appearance of lipid droplets in the liver cells stained withoil red O further confirmed the content of the liver lipids in the presentwork, which are stored in the primary form of triglycerides (Gaylordand Gatlin, 2000). Few lipid droplets were found in fish fed 5% and 8%lipids. Conversely, a large number of lipid droplets in fish fed the dietcontaining 11% lipid and 1200 mg kg−1 choline supplementation indi-cated excessive triglyceride accumulation in the cytosol of hepatocytes;this condition did not occur when supplemented with 1800 mg kg−1

choline, suggesting that hepatic lipidosis is a result of defective VLDLproduction and the subsequent reduced excretion of lipids or triglycer-ides (Chan, 1990; Corbin and Zeisel, 2012; de Wit et al., 2012; Walkey

Table 6Hepatic SAM and SAH levels in blunt snout bream fed diets containing three levels of lipidwith two choline supplementation levels.

Diets SAM(nmol g−1)

SAH(nmol g−1)

SAM/SAH

Choline mg kg−1 Lipid %

1200 5 4.27 0.439 9.368 4.31 0.429 10.1

11 4.16 0.455 8.981800 5 4.51 0.401 10.8

8 4.67 0.419 10.911 4.22 0.430 10.0

Pooled SEM 0.06 0.009 0.25

Two-way ANOVA

Dietary lipid 0.025 0.189 0.009Choline supplementation 0.046 0.686 0.492Interaction 0.357 0.840 0.858

Means and pooled SEM are presented for each parameter.Means in the same columnwithdifferent superscripts are significantly different (P b 0.05).

et al., 1998). Additionally, aberrant VLDL-mediated secretion of triglyc-erides is a central mechanism in hepatic steatosis, which is an earlymanifestation of liver dysfunction (Corbin and Zeisel, 2012; Vance,2008). The results were coincided with those reported by Jiang et al.(2013), who demonstrated a negative correlation between dietarycholine levels and liver lipid contents. Moreover, the increased lipidconcentration of dressed carcasswith increasing dietary choline supple-mentations observed in that study, may indicate that extra cholinesupplemented in high-fat diet enhanced the transport of lipid fromliver to other tissues, especially muscle for storage and use, as mightlead to the diminished hepatic lipid deposition, which was observedin the present study

SAMoccupies a central position in themetabolismof all cells as a pre-cursor molecule to three main pathways: methylation, transulfuration,and aminopropylation (Bottiglieri, 2002). A sufficient amount of SAM isessential for sustaining the normal function of these pathways. SAH, apotent competitive inhibitor of transmethylation reactions, is formedafter the transfer of the methyl-group of SAM to a methyl acceptor andis hydrolyzed to homocysteine (Chiang et al., 1996; Espe et al., 2010).As we know, there are several potential interactions of choline, methio-nine and SAM. The excessive methionine may promote the synthesis ofcholine and provide sufficient metabolic precursors for SAM production,thereby masking any effect from dietary choline supplementation(Kasper et al., 2000). In the present study, the dietary methionine levelof the experimental diet was 7.6 g kg−1, which is slightly less than theoptimal requirement of blunt snout bream (7.9 g kg−1), so endogenoussynthesis of choline from methionine would be limited. In the liver,oxidation of choline to betaine is the only known alternative source ofmethyl groups for the conversion of homocysteine to methionine(Abdelmalek et al., 2009). Choline depletion induced by a high-fat intakemight diminish phosphatidylcholine synthesis through the PEMTmethylation pathway (Corbin and Zeisel, 2012; Wortham et al., 2008).Additionally, the activity of PEMT should be limited by the availabilityof SAM (Sha et al., 2010). The present study showed elevated SAM levelsin fish fed diets supplemented with 1800 mg kg−1 choline, suggestingthat choline may regulate hepatic lipid transport by involving SAM syn-thesis (Abdelmalek et al., 2009; Lomba et al., 2010) and subsequentlyparticipating in the phosphatidylcholine synthetic pathway (Cheng andBlumenthal, 1999; Chiang et al., 1996; Espe et al., 2010).

GSH (gamma-glutamyl–cysteinyl–glycine) serves crucial functionsin animals (Wu et al., 2004). Endogenous GSH plays an important rolein scavenging reactive oxygen species (ROS) in the liver.While scaveng-ing ROS, GSH is oxidized to GSSG. In order tomaintain the cellular redoxequilibrium, GSSG is reduced to GSH by glutathione reductase (GR)(Husain and Somani, 1997), forming a redox cycle. Hence, a change inthe GSH/GSSG ratio can be an indication for oxidative stress (Husainand Somani, 1997). The diet containing 11% lipid and 1200 mg kg−1

choline supplementation resulted in a significant reduction in hepaticGSH content as well as an increase in the hepatic GSSG concentrationindicating increased oxidative utilization of GSH induced by high fatintake (Griffith, 1999; Lu et al., 2000; Speisky et al., 1985). In addition,severe oxidative stress may suppress the ability of liver cells to reduceGSSG to GSH, thus leading to GSSG accumulation in hepatocytes (Lu,1999).

As the ultimate product of SAM transsulfuration reactions, GSH alsofunctions as a modulator for the feedback regulation of SAM synthesis(Bottiglieri, 2002). Inactivation of methionine adenosyltransferase(MAT), which is the enzyme that makes SAM from methionine (Ross,2003), by ROS can be reversed by physiological concentrations of GSH.Therefore, liver MAT activity seems to be regulated on a minute-to-minute basis by ROS (which maintains the enzyme in an inactive con-formation) and GSH (which reactivates the enzyme) (Mato et al.,2002). Thismay be themechanism bywhich excess lipid intake inducesincreased ROS production,which in turn inactivatesMAT. Thismight re-sult in a subsequent reduction in hepatic SAM together with a depletionof GSH, finally predisposing the liver to oxidative stress and injury.

Fig. 1. Oil red O staining for liver tissue section to assess lipid accumulation in blunt snout bream fed diets containing three levels of lipid with two choline supplementation levels.Photomicrographs (×400) and scale bar (50 μm). (A) 5% lipid and 1200 mg kg−1 choline supplementation; (B) 8% lipid and 1200 mg kg−1 choline supplementation; (C) 11% lipid and1200 mg kg−1 choline supplementation; (D) 5% lipid and 1800 mg kg−1 choline supplementation; (E) 8% lipid and 1800 mg kg−1 choline supplementation; (F) 11% lipid and1800 mg kg−1 choline supplementation.

345J. Li et al. / Aquaculture 434 (2014) 340–347

Conversely, 1800 mg kg−1 choline supplementation elevated SAMlevels in liver, which ultimately promote the synthesis of GSH, whichis known to be of major importance in preventing a shift from the cellu-lar redox equilibrium and protecting hepatocytes against oxidativestress (Mato et al., 2002). Through this conversion to GSH, MAT isreactivated and subsequently leads to an increase in SAM synthesis. Inthis way, themetabolic pathways of choline, SAM, and GSHmay furtherexplain the effects of choline on mitigating abnormal physiological sta-tus in blunt snout bream fed high-fat diets.

Furthermore, apoB-100 and MTTP mRNA expression levels can bemarkers to indicate the association of VLDL forming and trafficking withhepatic lipid transport. VLDL synthesis and assembly is a substrate-dependent process highly regulated by the availability of hepatic triglyc-erides (Fisher and Ginsberg, 2002; Fisher et al., 2001; Olofsson et al.,2000). This might explain the up-regulation of apoB-100 and MTTP

mRNA expressions in fish with increasing the lipid levels from 5% to 8%in this work. However, the MTTP expression of fish fed diet with 11%lipid and 1200 mg kg−1 choline supplementation was significantlylower than that of the other groups. The results of hepatic lipid content,plasma triglycerides, cholesterol, and glucose all showed the highestvalues in the same experimental group, suggesting that a high-fat dietmay cause liver damage and dysfunction (Choi and Ginsberg, 2011) andinduce the blockage of VLDL assembly and export. Consequently, VLDLproduction was not sufficient to meet the demand for excessive hepaticlipid transport (Sparks et al., 2006; Tietge et al., 1999). The results furtherindicate that the complexity of VLDL synthesis, assembly, and secretion isgenerally regulated by the metabolic and physiological status of the liver(Choi and Ginsberg, 2011). However, 1800 mg kg−1 choline supplemen-tation increased the abundance of apoB-100 and MTTP mRNA, especiallyin the high-fat diets, suggesting that the mechanism of extra choline

Fig. 2. Relative mRNA expression analysis of apolipoprotein B-100 (apoB-100) in theliver of blunt snout bream fed diets containing three levels of lipid with two cholinesupplementation levels.

346 J. Li et al. / Aquaculture 434 (2014) 340–347

supplementation stimulating excessive hepatic lipid transport mightbe through increasing VLDL production, which was ascribed to the up-regulation of apoB-100 and MTTP gene expressions.

5. Conclusions

The study showed an overload of lipid deposition in the liver of fishfed a high-fat diet with 1200 mg kg−1 choline supplementation. Thispredisposes metabolic and physiological disorders as well as inhibitsthe growth of blunt snout bream. However, adequate dietary cholinecould resolve hepatic steatosis and enhance lipid transport fromthe liver by increasing VLDL production due to the up-regulation ofapoB-100 and MTTP mRNA expressions. Furthermore, extra supple-mental choline stimulated hepatic SAM production of blunt snoutbream and subsequently increased GSH concentration, which couldmitigate oxidative stress induced by a high-fat diet. Hence, this studyhas contributed to an improved understanding of how the pathway of

Fig. 3. Relative mRNA expression analysis of microsomal triglyceride transfer protein(MTTP) in the liver of blunt snout bream fed diets containing three levels of lipid withtwo choline supplementation levels. Group 5/1200: 5% lipid and 1200 mg kg−1 cholinesupplementation; Group 8/1200: 8% lipid and 1200 mg kg−1 choline supplementation;Group 11/1200: 11% lipid and 1200 mg kg−1 choline supplementation; Group 5/1800:5% lipid and 1800 mg kg−1 choline supplementation; Group 8/1800: 8% lipid and1800 mg kg−1 choline supplementation; Group 11/1800: 11% lipid and 1800 mg kg−1

choline supplementation.

choline metabolism and some related metabolites and genes impacthepatic lipid transport and liver physiology of blunt snout bream.

Acknowledgments

This work was funded by the National Nature Science Foundation ofChina (31172418) and theNational Nature Science Youth Foundation ofChina (31202005).

Appendix A. Supplementary data

Supplementary data to this article can be found online at http://dx.doi.org/10.1016/j.aquaculture.2014.08.006.

References

Abdelmalek, M.F., Sanderson, S.O., Angulo, P., et al., 2009. Betaine for nonalcoholic fattyliver disease: results of a randomized placebo-controlled trial. Hepatology 50,1818–1826.

A.O.A.C., 1995. Official Methods of Analysis of Official Analytical Chemists International,16th edn. Association of Official Analytical Chemists, Arlington, VA.

Arzel, J., Martinez, L.F.X., Me'tailler, R., Ste'phan, G., Viau, M., Gandemer, G., Guillaume, J.,1994. Effect of dietary lipid on growth performance and body composition of browntrout (Salmo trutta) reared in seawater. Aquaculture 123, 361–375.

Asadi, F., Hallajian, A., Asadian, P., Shahriari, A., Pourkabir, M., 2009. Serum lipid, free fattyacid, and proteins in juvenile sturgeons: Acipenser persicus and Acipenser stellatus.Comp. Clin. Pathol. 18, 287–289.

Blusztajn, J.K., Zeisel, S.H., Wurtman, R.J., 1985. Developmental changes in the activity ofphosphatidylethanolamine N-methyltransferases in rat brain. Biochem. J. 232,505–511.

Blusztajn, J.K., 1998. Choline, a vital amine Science. Science 281, 794–795.Bottiglieri, T., 2002. S-Adenosyl-L-methionine (SAMe): from the bench to the bedside—

molecular basis of a pleiotropic molecule. Am. J. Clin. Nutr. 76, 1151S–1157S.Bremer, J., Greenberg, D.M., 1961. Methyl transferring enzyme system of microsomes in

the biosynthesis of lecithin (phosphatidylcholine). Biochim. Biophys. Acta 46,205–216.

Brodsky, J.L., Fisher, E.A., 2008. The many intersecting pathways underlying apolipopro-tein B secretion and degradation. Trends Endocrinol. Metab. 19, 254–259.

Chan, M.M., 1990. Choline, In: Machlin, L.J. (Ed.), Handbook of Vitamins, 2nd ed. MarcelDekker, New York, NY, pp. 537–556.

Cheng, D., Kong, H., 2011. The effect of Lycium barbarum polysaccharide on alcohol-induced oxidative stress in rats. Molecules 16, 2542–2550.

Cheng, X., Blumenthal, R.M., 1999. S-Adenosylmethionine-dependentmethyltransferases:structures and functions. World Scientific Publication Co.

Chiang, P.K., Gordon, R.K., Tal, J., Zeng, G.C., Doctor, B.P., Pardhasaradhi, K., McCann, P.P.,1996. S-Adenosylmethionine and methylation. FASEB J. 10, 471–480.

Choi, S.H., Ginsberg, H.N., 2011. Increased very low density lipoprotein (VLDL) secretion,hepatic steatosis, and insulin resistance. Trends Endocrinol. Metab. 24, 353–363.

Corbin, K.D., Zeisel, S.H., 2012. Choline metabolism provides novel insights into nonalco-holic fatty liver disease and its progression. Curr. Opin. Gastroenterol. 28, 159–165.

Coz-Rakovac, R., Strunjak-perovic, I., Hacmanjek, M., Topic, P.N., Lipej, Z., Sostaric, B., 2005.Blood chemistry and histological properties of wild and cultured sea bass(Dicentrarchus labrax) in the north Adriatic Sea. Vet. Res. Commun. 29, 677–687.

Coz-Rakovac, R., Strunjak-Perović, I., Topić Popović, N., Hacmanjek, M., Smuc, T., Jadan, M.,Lipej, Z., Homen, Z., 2008. Cage culture effects on mullet (Mugilidae) liver histologyand blood chemistry profile. J. Fish Biol. 72, 2557–2569.

Criag, S.R., Gatlin III, D.M., 1997. Growth and body composition of juvenile red drum(Sciaenops ocektus) fed diets containing lecithin and supplemental choline. Aquacul-ture 151, 259–267.

Davis, R.A., Engelhorn, S.C., Pangburn, S.H., et al., 1979. Very low density lipoproteinsynthesis and secretion by cultured rat hepatocytes. J. Biol. Chem. 254, 2010–2016.

de Wit, N.J.W., Afman, L.A., Mensink, M., Muller, M., 2012. Phenotyping the effect of dieton non-alcoholic fatty liver disease. J. Hepatol. 57, 1370–1373.

Dekker, A., Watson, C.G., Barnes Jr., E.L., 1979. The pathologic assessment of primaryhyperparathyroidism and its impact on therapy. A prospective evaluation of 50cases with oil-red-O stain. Ann. Surg. 190, 671.

Du, Z.Y., Liu, Y.J., Tian, L.X., Wang, J.T., Wang, Y., Liang, G.Y., 2005. Effect of dietarylipid level on growth, feed utilization and body composition by juvenile grass carp(Ctenopharyngodon idella). Aquac. Nutr. 11, 139–146.

Espe, M., Rathore, R.M., Du, Z.Y., Liaset, B., El-Mowafi, A., 2010. Methionine limitation re-sults in increased hepatic FAS activity, higher liver 18:1 to 18:0 fatty acid ratio andhepatic TAG accumulation in Atlantic salmon, Salmo salar. Amino Acids 39, 449–460.

Folch, J., Lees, M., Sloane-Stanley, G.H., 1957. A simple method for the isolation andpurification of total lipids from animal tissues. J. Biol. Chem. 226, 497–509.

Fisher, E.A., Ginsberg, H.N., 2002. Complexity in the secretory pathway: the assembly andsecretion of apolipoprotein B-containing lipoproteins. J. Biol. Chem. 277, 17377–17380.

Fisher, E.A., Pan, M., Chen, X., et al., 2001. The triple threat to nascent apolipoprotein B:evidence for multiple, distinct degradative pathways. J. Biol. Chem. 276, 27855–27863.

Fowler, S.D., Greenspan, P., 1985. Application of Nile red, a fluorescent hydrophobicprobe, for the detection of neutral lipid deposits in tissue sections: comparisonwith oil red O. J. Histochem. Cytochem. 33, 833–836.

347J. Li et al. / Aquaculture 434 (2014) 340–347

Gao, S., He, L., Ding, Y., et al., 2010. Mechanisms underlying different responses of plasmatriglyceride to high-fat diets in hamsters and mice: roles of hepatic MTP and triglyc-eride secretion. Biochem. Biophys. Res. Commun. 398, 619–626.

Gaylord, T.G., Gatlin, D.M.I.I.I., 2000. Effects of dietary carnitine and lipid on growth andbody composition of hybrid striped bass (Morone chrysops♀ × M. saxatilis♂). FishPhysiol. Biochem. 190, 237–246.

Griffith, O.W., 1999. Biologic and pharmacologic regulation of mammalian glutathionesynthesis. Free Radic. Biol. Med. 27, 922–935.

Husain, K., Somani, S.M., 1997. Interaction of exercise training and chronic ethanolingestion on hepatic and plasma antioxidant system in rat. J. Appl. Toxicol. 17,189–194.

Hung, S.S.O., 1989. Choline requirement of hatchery-produced juvenile white sturgeon(Acipenser transmontanus). Aquaculture 78, 183–194.

Hussain, M.M., Shi, J., Dreizen, P., 2003. Microsomal triglyceride transfer protein and itsrole in apoB-lipoprotein assembly. J. Lipid Res. 44, 22–32.

Iwama, G.K., Vijayan, M.M., Forsyth, R.B., Ackerman, P.A., 1999. Heat shock proteins andphysiological stress in fish. Am. Zool. 39, 901–909.

Jiang, G.Z., Wang, M., Liu, W.B., Li, G.F., Qian, Y., 2013. Dietary choline requirement for ju-venile blunt snout bream. Megalobrama amblycephala. Aquacult. Nutr. 19, 499–505.

Johnsen, F., Hillestad, M., Austreng, E., 1993. High energy diets for Atlantic salmon. Effectson pollution. In: Kaushik, S.J., Luquet, P. (Eds.), Fish Nutrition in Practice. Proceedingsof the International Symposium on Fish Nutrition and Feeding. Biarritz, France,pp. 391–401.

Kasper, C.S., White, M.R., Brown, P.B., 2000. Choline is required by tilapia when methio-nine is not in excess. J. Nutr. 130, 238–242.

Kennedy, E.P., Weiss, S.B., 1956. Coenzymatic activity of cytidine diphosphate choline andcytidine diphosphate ethanolamine. J. Biol. Chem. 222, 193–214.

Lee, S.M., Jeon, I.G., Lee, J.Y., 2002. Effects of digestible protein and lipid levels in practicaldiets on growth, protein utilization and body composition of juvenile rockfish(Sebastes schlegeli). Aquaculture 211, 227–239.

Li, X.F., Liu, W.B., Jiang, Y.Y., Zhu, H., Ge, X.P., 2010. Effects of dietary protein and lipidlevels in practical diets on growth performance and body composition of bluntsnout bream (Megalobrama amblycephala) fingerlings. Aquaculture 303, 65–70.

Li, X.F., Liu, W.B., Lu, K.L., Xu, W.N., Wang, Y., 2012. Dietary carbohydrate/lipid ratios affectstress, oxidative status and non-specific immune responses of fingerling blunt snoutbream, Megalobrama amblycephala. Fish Shellfish Immunol. 33, 316–323.

Lomba, A., Milagro, F.I., García-Díaz, D.F., Marti, A., Campión, J., Martínez, J.A., 2010.Research obesity induced by a pair-fed high fat sucrose diet: methylation and expres-sion pattern of genes related to energy homeostasis. Lipids Health Dis. 9, 60.

Lu, K.L., Xu, W.N., Li, J.Y., Li, X.F., Huang, G.Q., Liu,W.B., 2013a. Alterations of liver histologyand blood biochemistry in blunt snout breamMegalobrama amblycephala fed high-fatdiets. Fish. Sci. 79, 661–671.

Lu, K.L., Xu, W.N., Li, X.F., et al., 2013b. Hepatic triacylglycerol secretion, lipid transportand tissue lipid uptake in blunt snout bream (Megalobrama amblycephala) fedhigh-fat diet. Aquaculture 408, 160–168.

Lu, S.C., Huang, Z.Z., Yang, H., MATO, J.M., AVILA, M.A., Tsukamoto, H., 2000. Changes inmethionine adenosyltransferase and S-adenosylmethionine homeostasis in alcoholicrat liver. Am. J. Physiol. Gastrointest. Liver Physiol. 279, 178–185.

Lu, S.C., 1999. Regulation of glutathione synthesis. Curr. Top. Cell. Regul. 36, 95–116.Lygren, B., Hamre, K., Waagbø, R., 1999. Effects of dietary pro- and antioxidants and some

health parameters in Atlantic salmon. J. Aquat. Anim. Health 11, 211–221.Mato, J.M., Corrales, F.J., Lu, S.C., Avila, M.A., 2002. S-Adenosylmethionine: a control switch

that regulates liver function. FASEB J. 16, 15–26.Mehta, A.K., Singh, B.P., Arora, N., et al., 2010. Choline attenuates immune inflammation

and suppresses oxidative stress in patients with asthma. Immunobiology 215,527–534.

Mensinger, A.F., Walsh, P.J., Halon, R.T., 2005. Blood biochemistry of the oyster toad-fish. J. Aquat. Anim. Health 17, 170–176.

Olofsson, S.O., Stillemark-Billton, P., Asp, L., 2000. Intracellular assembly of VLDL: twomajor steps in separate cell compartments. Trends Cardiovasc. Med. 10, 338–345.

Peres, H., Oliva-Teles, A., 1999. Effect of dietary lipid level on growth performance andfeed utilization by European sea bass juvenile (Dicentrarchus labrax). Aquaculture179, 325–334.

Raabe, M., Véniant, M.M., Sullivan, M.A., et al., 1999. Analysis of the role of microsomal tri-glyceride transfer protein in the liver of tissue-specific knockout mice. J. Clin. Investig.103, 1287–1298.

Rietman, S., Frankel, S., 1957. A colorimetric method for the determination of serumglutamic oxalacetic and glutamic pyruvic transaminases. Am. J. Clin. Pathol. 28,56–63.

Ross, S.A., 2003. Diet and DNA methylation interactions in cancer prevention. Ann. N. Y.Acad. Sci. 983, 197–207.

Sargent, J., Bell, G., McEvoy, L., Tocher, D., Estevez, A., 1999. Recent developments in theessential fatty acid nutrition of fish. Aquaculture 177, 191–199.

Sha, W., da Costa, K.A., Fischer, L.M., Milburn, M.V., Lawton, K.A., Berger, A., Wei, J., Zeisel,S.H., 2010. Metabolomic profiling can predict which humans will develop liverdysfunction when deprived of dietary choline. FASEB J. 24, 2962–2975.

She, Q.B., Nagao, I., Hayakawa, T., Tsuge, H., 1994. A simple HPLC method for the determi-nation of S-adenosylmethionine and S-adenosylhomocysteine in rat tissues: theeffect of vitamin B6 deficiency on these concentrations in rat liver. Biochem. Biophys.Res. Commun. 205, 1748–1754.

Shindo, N., Fujisawa, T., Sugimoto, K., et al., 2010. Involvement of microsomal triglyceridetransfer protein in nonalcoholic steatohepatitis in novel spontaneous mouse model.J. Hepatol. 52, 903–912.

Simon, J., 1999. Choline, betaine and methionine interactions in chickens, pigs and fish(including crustaceans). Worlds Poult. Sci. J. 55, 355–369.

Sparks, J., Collins, H., Chirieac, D., et al., 2006. Hepatic very-low-density lipoprotein andapolipoprotein B production are increased following in vivo induction of betaine-homocysteine S-methyltransferase. Biochem. J. 395, 363–371.

Speisky, H., Macdonld, A., Giles, G., Orrego, H., Israel, Y., 1985. Increased loss anddecreased synthesis of hepatic glutathione after acute ethanol administration.Turnover studies. Biochem. J. 225, 565–572.

Stephan, G., Dreanno, C., Guillaume, J., Arzel, J., 1996. Incidence of different amounts ofproteins, lipids and carbohydrates in diets on the muscle lipid composition in theturbot (Scophthalmus maximus). Ichtyophysiol. Acta 19, 11–30.

Stowell, S.L., Gatlin, D.M.I.I.I., 1992. Effects of dietary pantethine and lipid levels on growthand body composition of channel catfish (Ictalurus punctatus). Aquaculture 108,177–188.

Takeuchi-Yorimoto, A., Noto, T., Yamada, A., et al., 2013. Persistent fibrosis in the liverof choline-deficient and iron-supplemented L-amino acid-defined diet-induced non-alcoholic steatohepatitis rat due to continuing oxidative stress after choline supple-mentation. Toxicol. Appl. Pharmacol. 268, 264–277.

Tietge, U.J., Bakillah, A., Maugeais, C., et al., 1999. Hepatic overexpression of microsomaltriglyceride transfer protein (MTP) results in increased in vivo secretion of VLDLtriglycerides and apolipoprotein B. J. Lipid Res. 40, 2134–2139.

Vance, D.E., Ridgway, N.D., 1988. The methylation of phosphatidylethanolamine. Prog.Lipid Res. 27, 61–79.

Vance, D.E., 2008. Role of phosphatidylcholine biosynthesis in the regulation of lipopro-tein homeostasis. Curr. Opin. Lipidol. 19, 229–234.

Venugopal, P.B., 1985. Choline. In: Augustin, J., Klein, B.P., Becker, D., Venugopal, P.B.(Eds.), Methods of Vitamin Assay. John Wiley and Sons, New York, NY, pp. 555–573.

Wagner, T., Congleton, J.L., 2004. Blood-chemistry correlates of nutritional condition, tis-sue damage, and stress in migrating juvenile Chinook salmon (Oncorhynchustshawytscha). Can. J. Fish. Aquat. Sci. 61, 1066–1074.

Walkey, C.J., Yu, L., Agellon, L.B., Vance, D.E., 1998. Biochemical and evolutionarysignificance of phospholipid methylation. J. Biol. Chem. 273, 27043–27046.

Watanabe, T., Takeuchi, T., Ogino, C.H., 1978. Studies on the sparing effect of lipids ondietary protein in rainbow trout (Salmo gairdneri). Proceedings of the WorldSymposium on Finfish Nutrition and Fish Feed Technology, Hamburg, Germany,pp. 113–125.

Wetterau, J.R., Lin, M., Jamil, H., 1997. Microsomal triglyceride transfer protein. Biochim.Biophys. Acta, Lipids Lipid Metab. 1345, 136–150.

Wortham, M., He, L., Gyamfi, M., et al., 2008. The transition from fatty liver to NASHassociates with SAMe depletion in db/db mice fed a methionine choline-deficientdiet. Dig. Dis. Sci. 53, 2761–2774.

Wroblewski, F., Ladue, J.S., 1956a. Serum glutamic pyruvic transaminase in cardiac andhepatic disease. Exp. Biol. Med. 91, 569–571.

Wroblewski, F., Ladue, J.S., 1956b. Serum glutamic oxalacetic aminopherase (transaminase)in hepatitis. J. Am. Med. Assoc. 160, 1130–1134.

Wroblewski, F., 1959. The clinical significance of transaminase activities of serum.Am. J. Med. 27, 911–923.

Wu, G.Y., Fang, Y.Z., Yang, S., Lupton, J.R., Turner, N.D., 2004. Glutathione metabolism andits implications for health. J. Nutr. 134, 489–492.

Zhou, Z., Ren, Z., Zeng, H., Yao, B., 2008. Apparent digestibility of various feedstuffs forblunt nose black bream, Megalobrama amblycephala Yih. Aquac. Nutr. 14, 153–165.