Research Collection
Doctoral Thesis
Engineering of synthetic mammalian gene networks and theircross-kingdom conservation
Author(s): Gitzinger, Marc
Publication Date: 2010
Permanent Link: https://doi.org/10.3929/ethz-a-006425023
Rights / License: In Copyright - Non-Commercial Use Permitted
This page was generated automatically upon download from the ETH Zurich Research Collection. For moreinformation please consult the Terms of use.
ETH Library
Diss. ETH No. 19335
Engineering of Synthetic Mammalian Gene Networks and their Cross-Kingdom Conservation
A dissertation submitted to
ETH ZURICH
for the degree of
Doctor of Sciences
presented by
MARC GITZINGER
Diplom Biologe, Albert Ludwigs University of Freiburg i.Br. (M.Sc.)
born on the 6th of April, 1981
citizen of Canach, Luxembourg
Accepted on the recommendation of
Prof. Dr. Martin Fussenegger / Examiner Prof. Dr. Sven Panke / Co-Examiner
Zurich, 2010
Summary ___________________________________________________________________________
2
Summary ___________________________________________________________________________
3
Table of contents
!"##$%&'(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((')!
*"+$##,-.$++"-/'((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((('0!
1-2%34"5263-'((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((('7!8,-,%$9'1-2%34"5263-'(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((':!;<,'#3++'!"#$%&'()*+,,-./-)+0$'$-4'62+'%39,'6-'#34,%-'=632,5<-393/&'(((((((((((((((((((((((((((((((('>!!&-2<,265'?6393/&'(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((('@@!;%6//,%A1-4"56=9,'8,-,'B,/"9$263-'!&+2,#+'(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((('@C!D3-2%6="263-+'3.'2<6+'E3%F'(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((('@G!
D<$H2,%'1'(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((('C0!I"-5263-$9'5%3++AF6-/43#'53-+,%J$263-'3.'#$##$96$-'$-4'#3++'K!"#$%&'()*+,,-.
/-)+0$L'2%$-+5%6H263-M'2%$-+9$263-'$-4'+,5%,263-'#$5<6-,%6,+'(((((((((((((((((((((((((((((((((((((((((((((('C0!
D<$H2,%'11'(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((('0>!D3-2%3996-/';%$-+/,-,'NOH%,++63-'1-'!"=5"2$-,3"+'1#H9$-2+'P+6-/'Q'!F6-'R3263-'
D3-2$6-6-/';<,'QHH9,'S,2$=3962,'T<93%,26-'((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((('0>!
D<$H2,%'111'((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((('>U!;%$-+5%6H263-'D3-2%39'1-'S$##$96$-'D,99+'$-4'S65,'V6$';<,'I334'Q44626J,'V$-69965'Q564
'(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((('>U!
D3-59"+63-'((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((('@C>!
Q5F-3E9,4/,#,-2+'(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((('@U@!
D"%%65"9"#'V62$,'((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((('@UC!
T"=965$263-+'(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((('@U)!
Summary ___________________________________________________________________________
4
Summary
The engineering and the refinement of novel trigger-induced gene expression
systems are an ongoing quest for biological research fields including gene therapy,
drug discovery, functional genomics and proteomic analysis, and biopharmaceutical
manufacturing. The cross-kingdom transferability, the design and the application of
precisely tailored systems enabling advanced biopharmaceutical manufacturing and
prototype gene therapy scenarios are the topic of this work.
The moss Physcomitrella patens could serve in the future as a valid organism
for high yield and high quality biopharmaceutical manufacturing. We were able to
show the functional cross-kingdom conservation of mammalian and P.patens
transcription, translation and secretion machineries, by transferring several genetic
building blocks without extra modifications directly to the moss. Employing these
molecular building blocks, we were able to establish constitutive, conditional and
autoregulated expression of different product genes within the moss. Furthermore, we
were able to run a prototype biopharmaceutical production using microencapsulated
protoplasts in a Wave Bioreactor, rather than protonema cultures in a glass stirred-
tank bioreactor.
Beside the cross-kingdom transferability of a synthetic biology toolbox to
moss, we have pioneered the first gene regulation system that can be induced in a
completely non-invasive manner, via the skin. Taking advantage of the Pseudomonas
putida DOT-TE1 TtgABC efflux pump response regulator TtgR, we have engineered
a synthetic mammalian phloretin responsive control element (PEACE), which was
responsive to the apple metabolite phloretin. PEACE showed excellent regulation
performance in a multitude of mammalian cells and phloretin, when formulated within
a skin lotion enabled tight regulation of product gene expression via the skin of mice.
Employing the Caulobacter crescentus derived VanR response regulator, we
engineered a second synthetic mammalian gene regulation system with excellent
regulatory behavior, showing high maximal expression and tight repression of product
gene expression. This system is responsive to the licensed food additive vanillic acid,
thus enabling physiologically inert adjustability of gene expression.
Summary ___________________________________________________________________________
5
Zusammenfassung
Die Weiterentwicklung und die graduelle Verbesserung von neuen
regulierbaren Genexpressionssystemen ist das fortwährende Bestreben in vielen
biologischen Forschungsbereichen, wie z.B. innerhalb der Gentherapie, der
Wirkstoffermittlung, der Genom- und Proteom- Analytik, sowie in der Produktion von
Biopharmazeutika. Diese Arbeit fokussiert sich auf das Design, die Verwendung und
die Transferierbarkeit, über biologische Reiche hinweg, von solchen präzise
zugeschnittenen Systemen für die Anwendung in der Biopharmazeutika-Produktion
und in der Gentherapie.
Das Moos Physcomitrella patens könnte in Zukunft als eine echte Alternative
zu Säugerzellen bei der Produktion von großen Mengen an qualitativ hochwertigen
Biopharmazeutika dienen. Indem wir verschiedene synthetische, molekulare
Funktionseinheiten von Säugetieren direkt und ohne Modifikation in das Moos
transferiert haben, konnten wir die funktionelle Erhaltung der Transkriptions-,
Translations- und Sekretions-Maschinerien zwischen beiden Organismen feststellen.
Unter Verwendung dieser Funktionseinheiten konnten wir sowohl konstitutive,
konditionelle und auch autoregulierte Expression von Genprodukten im Moos zeigen.
Zudem gelang es uns mikro-verkapselte Protoplasten in einer exemplarischen
Biopharmazeutika-Produktion zu verwenden.
Neben dem Transfer einer Art molekularen Werkzeugkiste von Säugetieren zu
einem Moos, gelang es uns noch das erste Genregulationssystem zu entwickeln,
welches vollständig nicht-invasiv über die Haut reguliert werden kann. Wir
verwendeten hierzu den Repressor der TtgABC-Efflux Pumpe aus Pseudomonas
putida DOT-TE1 und konstruierten daraus einen säugerzell-kompatiblen Regulator,
welcher von dem Apfelmetabolit Phloretin induziert werden kann (PEACE-system).
Das PEACE-system zeigte hervorragende Regulations-eigenschaften in einer Vielzahl
verschiedener Säugerzellen und als wir Phloretin in eine Hautcreme gemischt hatten,
konnten wir die Proteinproduktion gezielt durch die Haut von Mäusen steuern.
Unter Verwendung des aus Caulobacter crescentus stammenden Repressors
VanR, konnten wir ein zweites synthetisches Regulationssystem zur Verwendung in
Säugetierzellen konstruieren. Auch dieses System zeigte sehr gute Regulations-
Summary ___________________________________________________________________________
6
eigenschaften mit einer sehr hohen maximalen Expression und einer nahezu
vollständigen Hemmung der Genexpression im ausgeschalteten Zustand. Das System
reagiert sehr spezifisch auf den Lebensmittelzusatz Vanillinsäure und ermöglicht
damit ebenfalls eine physiologisch inerte Justierbarkeit der Genexpression.
Introduction ___________________________________________________________________________
7
Introduction
Introduction ___________________________________________________________________________
8
General Introduction
The large amount of data generated by classical biological research has resulted
in great advances of understanding the complexity of molecular interactions within
living organisms. Current interdisciplinary research fields like bioinformatics,
biophysics, systems biology and medicine are combining this knowledge striving
towards unprecedented industrial applications, such as the affordable production of
complex to produce biopharmaceuticals, more efficient drug discovery and next
generation gene therapy approaches. Engineering of complex genomic circuits, which
have the potential to achieve these goals, require a large toolbox of well-characterized
genetic modules that can be assembled according to the desired output function. In
recent years, precise transcription control of specific transgenes formed the functional
basis for the design of such synthetic gene networks and heterologous transcription
control circuits represent the fundamental biological parts for their construction, no
matter what complexity. From this panoply of biological building blocks an
impressive set of functional outputs, such as synthetic biologic gates, bistable
expression networks, such as toggle- or hysteretic switches, transcriptional cascades,
time-delay circuits or cellular oscillators, have been engineered recently and are
expected to provide solutions for novel cell-based therapeutic strategies, drug
discovery, biotechnology and environmental protection.
In this work we have shown (i) the cross-kingdom conservation of essential
genetic tools required for efficient transgene regulation systems between mammalian
cells and the moss Physcomitrella patens and we have constructed two novel synthetic
circuits enabling (ii) transdermal control of transgene expression and (iii) transcription
control via a physiological inert food additive.
Introduction ___________________________________________________________________________
9
The moss Physcomitrella patens and its role in modern biotechnology
The production of biopharmaceuticals is currently still dominated by
mammalian production cell cultures, as most of the protein therapeutics on the market
originate from mammalian cell bioprocesses (Wurm 2004). New solutions need to be
evaluated though, as broader product pipelines and an increasing demand for
biopharmaceuticals drive the manufacturing capacities to their limits. Hence,
researchers are evaluating alternative host cell systems for efficient, cost-effective and
high quality biopharmaceutical manufacturing (Decker and Reski 2007; Hamilton et
al. 2006).
Plants play a pivotal role in closing this gap, as they combine advantages of
microbial- and mammalian- production systems. They eliminate the risk of product
contamination by human pathogens possibly hidden within mammalian cell lines or in
their complex organic production media and yet, as higher eukaryotes, they have the
ability to synthesize complex multimeric proteins with post-translational
modifications closely resembling the ones from mammalian cells (Decker and Reski
2008).
In particular, the moss Physcomitrella patens, brings along a panoply of
interesting traits that put this small land plant in a leading position to become an
alternative high through-put production organism in biotechnology. Other than in seed
plants, in mosses the dominating generation is not formed by the diploid sporophyte,
but rather by the haploid gametophyte (Reski and Frank 2005) (Fig. 1 a and b). As
there are no dominant / recessive traits in haploids, there is no back-crossings needed
to obtain isogenic lines and even more important is the high rate of homologous
recombination within P. patens (Schaefer 2001), as this feature allows for fast forward
reverse genetics approaches and for targeted integration of any gene of interest for
production purposes. (Decker and Reski 2007; Reski and Frank 2005). Most
importantly, the moss can be cultivated in vitro under fully controlled conditions as
intact plant with differentiated cells in the form of so called protonema (Decker and
Reski 2007). In small scale, moss plants are grown in agitated glass flasks, while a
scale up is achieved in either 15 L highly controllable photo-bioreactors or in up to
Introduction ___________________________________________________________________________
10
100 L tubular moss bioreactors (Decker and Reski 2007; Lucumi et al. 2005) (Fig. 1 c
and d).
Fig. 1: In vitro cultivation of a moss, Physcomitrella patens for production of biopharmaceuticals. a) Life cycle of mosses with haploid (1n) and diploid (2n) stages. R!: meiosis b) Storage of transgenic moss lines on multi-well agar plates. c and d) In vitro propagation of moss protonema in stirred glass-tank and tubular photobioreactors, respectively. Photographs courtesy of Andreas Schaaf (b) and Clemens Posten (d). (Decker and Reski 2007). In recent years, the increasing genetic toolbox for mammalian cells has
considerably improved the production capacity of mammalian-cell biopharmaceutical
production (Wurm 2004). Consequently, it would significantly ease the introduction
of a novel production organism if these genetic tools where transferable without labor
intensive adjusting of codon usage, re-cloning of the genes of interest into adapted
high expression vectors and re-designing molecular tools, such as Internal Ribosome
Entry Sites (IRES) and trigger induced gene regulation modalities. We have therefore
shown in chapter I of this work the cross compatibility of the transcription, translation
and secretion machineries of mammalian cells and the non-seed plant P.patens.
Introduction ___________________________________________________________________________
11
Synthetic Biology
Biochemistry and molecular biology focus mainly on investigating individual
genes or proteins as a basis to move on to single individual pathways, one at the time.
Genomic and proteomic research continue to unveil the inventory of life. However,
these more classical disciplines remain largely reductive sciences that deduce the
operation of living systems by mutating them or breaking them apart with the
limitation that the whole cell remains beyond the reach of the methodologies and
cannot be studied as a whole. Nonetheless, the breakthroughs from these disciplines
enabled researchers to start studying whole cells and larger parts within an organism
as interconnected systems. Describing larger structures and the processes within cells
was the starting point for systems biology (Ideker et al. 2001). To fully understand the
general principles that govern the structures and their interconnected networks, it is
necessary though, to start with synthetic biology, which start connecting the
experimental and the theoretical work in order to reconstruct biological systems by
assembly of minimal functional building blocks, rather than a stepwise devolution of
the organism (Hartwell et al. 1999; Hasty et al. 2001). Synthetic biology is a highly
interdisciplinary field that unites engineers, biologists, mathematicians and chemists
in order to design and build novel biomolecular components, networks and pathways
to rewire and reprogram organisms (Khalil and Collins 2010). The three major goals
within this ambitious field are defined as (Gibbs 2004):
• To learn about life by building it (or at least some modular parts), rather than
breaking it apart. Accomplishments range from simple building blocks such as
toggle switches (Gardner et al. 2000; Kramer et al. 2004b), to synthetic
oscillators (Atkinson et al. 2003; Elowitz and Leibler 2000; Tigges et al. 2009;
Tigges et al. 2010) up to the creation of synthetic viral genomes (Cello et al.
2002; Smith et al. 2003) and recently even to the first synthetic bacterial
genome (Gibson et al. 2010).
• Advance genetic engineering to a real engineering discipline that builds
systems from well-defined standardized modules, in order to improve previous
creations and to recombine such modular building blocks to higher order
systems (Brent 2004).
Introduction ___________________________________________________________________________
12
• To re-write the genetic program of a cell to obtain novel functions or behavior
and eventually yield truly controllable organisms. This involves the linking of
fully synthetic gene networks to the host organism (Kemmer et al. 2010;
Kobayashi et al. 2004; Kramer et al. 2005), the engineering of cell-to-cell
communication (Chen and Weiss 2005; Weber et al. 2007b; You et al. 2004)
and eventually the creation of life (Gibson et al. 2010).
As the applications of synthetic networks and even whole organisms slowly rise from
prototype devices towards real applications within human gene therapy, the
production of biofuels, pharmaceuticals and novel biomaterials, the requirements for
the underlying modular building parts constantly raise in terms of environmental
safety, long term applicability, versatility and to be physiologically inert towards
interacting host organisms.
In the next section we will give an introduction to the general principle of the
underlying regulatory building blocks, which are essential for synthetic biology
applications.
Trigger-Inducible Gene Regulation Systems
Fine-tuning of gene expression via synthetic transgene regulation systems is of
paramount importance for a variety of research areas and applications, including
functional genomics (Baumgartel et al. 2008), biopharmaceutical manufacturing of
complex to produce proteins (Ulmer et al. 2006; Weber and Fussenegger 2007), drug
discovery (Sharpless and Depinho 2006; Weber et al. 2008), tissue engineering
(Greber and Fussenegger 2007; Sanchez-Bustamante et al. 2006; Weber and
Fussenegger 2006), the design of complex synthetic networks (Deans et al. 2007;
Kramer and Fussenegger 2005; Tigges et al. 2010; Tigges et al. 2009), gene therapy
(Gersbach et al. 2006; Kemmer et al. 2010; Weber and Fussenegger 2006) and the
design of functional materials (Ehrbar et al. 2008).
The vast amount of applications that directly rely on the precise expression-
control of a gene of interest, reaches from basic research to applied fields such as
synthetic biology. This broad applicability accounts for the high demand of ever-
improving synthetic transgene control systems, which enable intricate regulation of
Introduction ___________________________________________________________________________
13
either a single gene or complex synthetic networks. Genetic circuits enabling such
precise expression management upon specific external or intrinsic stimuli have first
been described within prokaryotes, like upon the response to nutrients (Jacob and
Monod 1961), temperature (Hurme et al. 1997; Servant and Mazodier 2001), toxic
agents (Folcher et al. 2001; Schumacher et al. 2002) or for communication purposes
(Prithiviraj et al. 2003; Takano et al. 2001).
Fig. 2: Molecular configuration of OFF-type (A) and ON-type (B) mammalian gene regulation systems. (A) OFF-type systems. A bacterial DNA-binding response regulator (DBR), fused to a mammalian transactivation domain (TA) binds to a specific operator module and induces polymerase (Poly)-mediated transcription of the gene of interest (goi) from a minimal promoter (Pmin). DPR-TA only binds to its cognitive operator in the absence of the regulating trigger molecule (white diamond). (B) ON-type systems. The DPR, fused to a mammalian transcription repressor domain (TR), binds to the specific operator sequence located downstream of a constitutive promoter, and thus represses its transcription. Upon addition of the regulating trigger molecule (represented by the diamond), repression is abolished and the gene of interest (goi) is expressed.
In this work we will focus on synthetically engineered circuits, which enable
heterologous expression control within eukaryotic cells that are based on similar
Trigger Molecule
TA
DBR
Pmin goi pA Operator
Poly
TA
DBR
Poly
OFF
DBR
PConst goi pA Operator
Poly
DBR
ON
TR
TR
A
B
Introduction ___________________________________________________________________________
14
design principles as their prokaryotic predecessors. The majority of currently available
eukaryotic transgene control systems benefit from a generic design principle
comprising a prokaryotic DNA-binding response regulator (DBR) fused to a
mammalian transactivation (TA) (transrepression/TR) domain, thus forming a
synthetic transactivator (transrepressor) with the ability to activate (repress) a hybrid
promoter engineered from a specific operator in close proximity to an eukaryotic
minimal (constitutive) promoter (Urlinger et al. 2000; Weber et al. 2002a; Weber et
al. 2002b). Employing these modular building blocks offers the possibility of creating
two output functions depending on the ability of an inducer molecule to either (i)
activate (ON-type system) (Fussenegger et al. 2000; Gossen et al. 1995; Neddermann
et al. 2003; Weber et al. 2004) or repress (OFF-type system) (Fussenegger et al. 2000;
Gossen and Bujard 1992) gene expression upon binding to the transactivator
(transrepressor) protein (Fig 2).
The first generation of mammalian gene regulation systems resulted in an array
of various inducer molecules enabling transcription control, ranging from clinically
approved small-molecule drugs, such as antibiotics (Fussenegger et al. 2000; Gossen
et al. 1995; Weber et al. 2002a), immunosupressives or antidiabetic drugs (Pollock
and Clackson 2002; Rollins et al. 2000), steroid hormones and hormone analogs
(Nordstrom 2002; Palli et al. 2005), to quorum sensing molecules (Neddermann et al.
2003; Weber et al. 2006). All of these established gene regulation systems fulfill the
basic requirements for transcriptional control with a low level of leakage and high
maximum transgene expression levels. However, due to several drawbacks, such as (i)
limited pharmacokinetic and pharmacodynamic properties (ii) the risk of pleiotropic
side effects and (iii) the risk to develop new bacterial antibiotic-resistant strains
(Alanis 2005; Lautermann et al. 2004; Sanchez et al. 2004), the broad adaptability of
these trigger molecules to more sophisticated synthetic biology applications is
constricted. Gene therapy approaches rely on traceless inducer molecules with no side
effects (Ehrbar et al. 2008; Kemmer et al. 2010), complex synthetic networks need
interference-free regulation within the host organism (Kramer et al. 2004a; Tigges et
al. 2010; Tigges et al. 2009) and drug screening approaches need very specific
response patterns (Weber et al. 2008). Hence, researchers are striving to create the
Introduction ___________________________________________________________________________
15
second generation of synthetic molecular building blocks, which are responsive to
inducer molecules that are directly derived from endogenous metabolites, such as
amino acids (Hartenbach et al. 2007), vitamins (Weber et al. 2007a; Weber et al.
2009), gaseous acetaldehyde (Weber et al. 2004), pathological signals, such as urate
(Kemmer et al. 2010), or which are already licensed as food additives (Weber et al.
2008). Employing these trigger molecules in the most recent synthetic biology
networks resulted in unprecedented advances in the field and could result, in the not-
too-distant future, in the first human gene therapy trials capitalizing on synthetic
biology (Aubel and Fussenegger 2010; Khalil and Collins 2010; Tigges and
Fussenegger 2009; Weber and Fussenegger 2009). In this work, we showed in
Chapters II and III two important contributions towards the second generation of
trigger inducible-synthetic gene circuits.
Introduction ___________________________________________________________________________
16
Contributions of this work
Chapter I: Functional cross-kingdom conservation of mammalian and
moss (Physcomitrella patens) transcription, translation and secretion
machineries
Biopharmaceutical manufacturing of complex to produce proteins plays an
ever-increasing role in modern healthcare. Transgenic mammalian cell cultures are
currently the most successful production platform, though the global demand for
biopharmaceuticals exceeds already the worldwide manufacturing capacity. Hence,
alternative production organisms are being assessed for their potential to produce high
quality mammalian proteins at high yields and at low costs. One of the most
interesting plant organisms to fulfill these requirements is the moss Physcomitrella
patens. This non-seed land plant unifies some unique features, like homologous
recombination and glycosylation patterns similar to mammalians, which put it in a
favorite position to become a valid alternative to mammalian cell culture production.
We have shown here that on top of these features, P. patens has the ability to translate,
transcribe and secrete mammalian genetic modules and proteins without further
modification. This significantly simplifies the transfer of well-established expression
machineries from mammalian production to the moss. Furthermore, we have
introduced native and synthetic promoters and polyadenylation sites, viral and cellular
internal ribosome entry sites, secretion signal peptides and secreted product proteins,
and synthetic transactivators and transrepressors, which were all designed for
mammalian cells, to the moss. Using these molecular building blocks, we were able to
establish constitutive, conditional and autoregulated expression of different product
genes within P.patens, which resulted in a completely new genetic toolbox for
researches in this field. As an alternative to the standard protonema stirred-tank
bioreactors, we have also been able to show a prototype biopharmaceutical production
scenario using microencapsulated transgenic P. patens protoplasts producing human
vascular endothelial growth factor 121 (VEGF121) at similar rates as the standard
Introduction ___________________________________________________________________________
17
method. This provides yet another option for biopharmaceutical production within the
moss P. patens.
Chapter II: Controlling transgene expression in subcutaneous implants
using a skin lotion containing the apple metabolite phloretin
For future gene therapy applications to be accepted by patients and thus be
broadly applicable, there are certain requirements to be fulfilled. On top of the clear
medical indication and a therapeutic benefit, new technologies always need to have a
good patient compliance and ideally traceless, side effect free mode of action. In this
chapter, we designed a novel synthetic gene network for mammalian cells that was
able to precisely regulate transgene expression via the skin of mice, by simply
applying a cream containing the apple metabolite phloretin. This novel transgene
regulation system did thus not only show excellent regulation performance, but also
serves as a prototype gene therapy approach where implanted cells producing a
therapeutic protein can be controlled in an absolutely non-invasive manner. On top of
that the system shows interference free regulation, when applied in parallel with other
gene regulation systems, broad applicability within a large set of mammalian cells and
enables a timed production start within a prototype bioreactor setup. Taken these
features together, the system also offers a valid alternative to existing gene regulation
systems for the synthetic biology community.
Chapter III: Transcription control in mammalian cells and mice via the
food additive vanillic acid
The requirements for second generation gene regulation systems are clearly set
towards improving the inducer molecules, as the precise functionality, adjustability
and reversibility of synthetically engineered transcription control elements was
already covered by the first generation and is thus “a given”. However the inducer
molecules employed in the first generation accounted for their drawback within highly
sophisticated applications of synthetic biology. In brief, inducer molecules need to be
physiological inert to ensure long term applicability and side effect free efficacy,
alongside with interference free regulation of the regulation circuit. We present here,
Introduction ___________________________________________________________________________
18
vanillic acid as an inducer for a novel gene regulation system. Vanillic acid is licensed
as a food additive by the U.S. Food and Drug Administration (FDA) and thus has a
great chance to fulfill, at physiological concentrations all safety requirements for
future gene therapy applications. The vanillic acid responsive system (VAC) was
engineered by taking advantage of the Caulobacter crescentus VanR-response
regulator, which showed very high specificity towards vanillic acid, as we tested a
library of several chemical derivatives of vanillic acid within mammalian cell culture
for their ability to interact with the VAC-system. None of the tested chemicals showed
the ability to modulate the activity of VAC. This specificity puts the VAC-system to
the forefront of synthetic building blocks, when engineering complex synthetic
networks, where interference free regulation is the main requirement. Taken together
with its broad applicability within different mammalian cell lines and the excellent
functionality within a prototype in vivo scenario in mice, the VAC-system adds a
precise gene regulation tool to the synthetic biology community with broad spectrum
of implementations, such as gene therapy, complex synthetic networks and precise
gene expression control.
Introduction ___________________________________________________________________________
19
References
Alanis AJ. 2005. Resistance to antibiotics: are we in the post-antibiotic era? Arch Med Res
36(6):697-705.
Atkinson MR, Savageau MA, Myers JT, Ninfa AJ. 2003. Development of genetic circuitry
exhibiting toggle switch or oscillatory behavior in Escherichia coli. Cell 113(5):597-
607.
Aubel D, Fussenegger M. 2010. Mammalian synthetic biology--from tools to therapies.
Bioessays 32(4):332-45.
Baumgartel K, Genoux D, Welzl H, Tweedie-Cullen RY, Koshibu K, Livingstone-Zatchej M,
Mamie C, Mansuy IM. 2008. Control of the establishment of aversive memory by
calcineurin and Zif268. Nat Neurosci 11(5):572-8.
Brent R. 2004. A partnership between biology and engineering. Nat Biotechnol 22(10):1211-
4.
Cello J, Paul AV, Wimmer E. 2002. Chemical synthesis of poliovirus cDNA: generation of
infectious virus in the absence of natural template. Science 297(5583):1016-8.
Chen MT, Weiss R. 2005. Artificial cell-cell communication in yeast Saccharomyces
cerevisiae using signaling elements from Arabidopsis thaliana. Nat Biotechnol
23(12):1551-5.
Deans TL, Cantor CR, Collins JJ. 2007. A tunable genetic switch based on RNAi and
repressor proteins for regulating gene expression in mammalian cells. Cell
130(2):363-72.
Decker EL, Reski R. 2007. Moss bioreactors producing improved biopharmaceuticals. Curr
Opin Biotechnol 18(5):393-8.
Decker EL, Reski R. 2008. Current achievements in the production of complex
biopharmaceuticals with moss bioreactors. Bioprocess Biosyst Eng 31(1):3-9.
Ehrbar M, Schoenmakers R, Christen EH, Fussenegger M, Weber W. 2008. Drug-sensing
hydrogels for the inducible release of biopharmaceuticals. Nat Mater 7(10):800-4.
Elowitz MB, Leibler S. 2000. A synthetic oscillatory network of transcriptional regulators.
Nature 403(6767):335-8.
Folcher M, Morris RP, Dale G, Salah-Bey-Hocini K, Viollier PH, Thompson CJ. 2001. A
transcriptional regulator of a pristinamycin resistance gene in Streptomyces
coelicolor. J Biol Chem 276(2):1479-85.
Introduction ___________________________________________________________________________
20
Fussenegger M, Morris RP, Fux C, Rimann M, von Stockar B, Thompson CJ, Bailey JE.
2000. Streptogramin-based gene regulation systems for mammalian cells. Nat
Biotechnol 18(11):1203-8.
Gardner TS, Cantor CR, Collins JJ. 2000. Construction of a genetic toggle switch in
Escherichia coli. Nature 403(6767):339-42.
Gersbach CA, Le Doux JM, Guldberg RE, Garcia AJ. 2006. Inducible regulation of Runx2-
stimulated osteogenesis. Gene Ther 13(11):873-82.
Gibbs WW. 2004. Synthetic life. Sci Am 290(5):74-81.
Gibson DG, Glass JI, Lartigue C, Noskov VN, Chuang RY, Algire MA, Benders GA,
Montague MG, Ma L, Moodie MM and others. 2010. Creation of a bacterial cell
controlled by a chemically synthesized genome. Science 329(5987):52-6.
Gossen M, Bujard H. 1992. Tight control of gene expression in mammalian cells by
tetracycline-responsive promoters. Proc Natl Acad Sci U S A 89(12):5547-51.
Gossen M, Freundlieb S, Bender G, Muller G, Hillen W, Bujard H. 1995. Transcriptional
activation by tetracyclines in mammalian cells. Science 268(5218):1766-9.
Greber D, Fussenegger M. 2007. Mammalian synthetic biology: engineering of sophisticated
gene networks. J Biotechnol 130(4):329-45.
Hamilton SR, Davidson RC, Sethuraman N, Nett JH, Jiang Y, Rios S, Bobrowicz P,
Stadheim TA, Li H, Choi BK and others. 2006. Humanization of yeast to produce
complex terminally sialylated glycoproteins. Science 313(5792):1441-3.
Hartenbach S, Daoud-El Baba M, Weber W, Fussenegger M. 2007. An engineered L-arginine
sensor of Chlamydia pneumoniae enables arginine-adjustable transcription control in
mammalian cells and mice. Nucleic Acids Res 35(20):e136.
Hartwell LH, Hopfield JJ, Leibler S, Murray AW. 1999. From molecular to modular cell
biology. Nature 402(6761 Suppl):C47-52.
Hasty J, McMillen D, Isaacs F, Collins JJ. 2001. Computational studies of gene regulatory
networks: in numero molecular biology. Nat Rev Genet 2(4):268-79.
Hurme R, Berndt KD, Normark SJ, Rhen M. 1997. A proteinaceous gene regulatory
thermometer in Salmonella. Cell 90(1):55-64.
Ideker T, Galitski T, Hood L. 2001. A new approach to decoding life: systems biology. Annu
Rev Genomics Hum Genet 2:343-72.
Jacob F, Monod J. 1961. Genetic regulatory mechanisms in the synthesis of proteins. J Mol
Biol 3:318-56.
Introduction ___________________________________________________________________________
21
Kemmer C, Gitzinger M, Daoud-El Baba M, Djonov V, Stelling J, Fussenegger M. 2010.
Self-sufficient control of urate homeostasis in mice by a synthetic circuit Nat
Biotechnol 28(4):355-60.
Khalil AS, Collins JJ. 2010. Synthetic biology: applications come of age. Nat Rev Genet
11(5):367-79.
Kobayashi H, Kaern M, Araki M, Chung K, Gardner TS, Cantor CR, Collins JJ. 2004.
Programmable cells: interfacing natural and engineered gene networks. Proc Natl
Acad Sci U S A 101(22):8414-9.
Kramer BP, Fischer C, Fussenegger M. 2004a. BioLogic gates enable logical transcription
control in mammalian cells. Biotechnol Bioeng 87(4):478-84.
Kramer BP, Fischer M, Fussenegger M. 2005. Semi-synthetic mammalian gene regulatory
networks. Metab Eng 7(4):241-50.
Kramer BP, Fussenegger M. 2005. Hysteresis in a synthetic mammalian gene network. Proc
Natl Acad Sci U S A 102(27):9517-22.
Kramer BP, Viretta AU, Daoud-El-Baba M, Aubel D, Weber W, Fussenegger M. 2004b. An
engineered epigenetic transgene switch in mammalian cells. Nat Biotechnol
22(7):867-70.
Lautermann J, Dehne N, Schacht J, Jahnke K. 2004. [Aminoglycoside- and cisplatin-
ototoxicity: from basic science to clinics]. Laryngorhinootologie 83(5):317-23.
Lucumi A, Posten C, Pons MN. 2005. Image analysis supported moss cell disruption in
photo-bioreactors. Plant Biol (Stuttg) 7(3):276-82.
Neddermann P, Gargioli C, Muraglia E, Sambucini S, Bonelli F, De Francesco R, Cortese R.
2003. A novel, inducible, eukaryotic gene expression system based on the quorum-
sensing transcription factor TraR. EMBO Rep 4(2):159-65.
Nordstrom JL. 2002. Antiprogestin-controllable transgene regulation in vivo. Curr Opin
Biotechnol 13(5):453-8.
Palli SR, Kapitskaya MZ, Potter DW. 2005. The influence of heterodimer partner
ultraspiracle/retinoid X receptor on the function of ecdysone receptor. Febs J
272(23):5979-90.
Pollock R, Clackson T. 2002. Dimerizer-regulated gene expression. Curr Opin Biotechnol
13(5):459-67.
Prithiviraj B, Zhou X, Souleimanov A, Khan WM, Smith DL. 2003. A host-specific bacteria-
to-plant signal molecule (Nod factor) enhances germination and early growth of
diverse crop plants. Planta 216(3):437-45.
Introduction ___________________________________________________________________________
22
Reski R, Frank W. 2005. Moss (Physcomitrella patens) functional genomics--Gene discovery
and tool development, with implications for crop plants and human health. Brief
Funct Genomic Proteomic 4(1):48-57.
Rollins CT, Rivera VM, Woolfson DN, Keenan T, Hatada M, Adams SE, Andrade LJ,
Yaeger D, van Schravendijk MR, Holt DA and others. 2000. A ligand-reversible
dimerization system for controlling protein-protein interactions. Proc Natl Acad Sci U
S A 97(13):7096-101.
Sanchez AR, Rogers RS, 3rd, Sheridan PJ. 2004. Tetracycline and other tetracycline-
derivative staining of the teeth and oral cavity. Int J Dermatol 43(10):709-15.
Sanchez-Bustamante CD, Kelm JM, Mitta B, Fussenegger M. 2006. Heterologous protein
production capacity of mammalian cells cultivated as monolayers and microtissues.
Biotechnol Bioeng 93(1):169-80.
Schaefer DG. 2001. Gene targeting in Physcomitrella patens. Curr Opin Plant Biol 4(2):143-
50.
Schumacher MA, Miller MC, Grkovic S, Brown MH, Skurray RA, Brennan RG. 2002.
Structural basis for cooperative DNA binding by two dimers of the multidrug-binding
protein QacR. EMBO J 21(5):1210-8.
Servant P, Mazodier P. 2001. Negative regulation of the heat shock response in
Streptomyces. Arch Microbiol 176(4):237-42.
Sharpless NE, Depinho RA. 2006. The mighty mouse: genetically engineered mouse models
in cancer drug development. Nat Rev Drug Discov 5(9):741-54.
Smith HO, Hutchison CA, 3rd, Pfannkoch C, Venter JC. 2003. Generating a synthetic
genome by whole genome assembly: phiX174 bacteriophage from synthetic
oligonucleotides. Proc Natl Acad Sci U S A 100(26):15440-5.
Takano E, Chakraburtty R, Nihira T, Yamada Y, Bibb MJ. 2001. A complex role for the
gamma-butyrolactone SCB1 in regulating antibiotic production in Streptomyces
coelicolor A3(2). Mol Microbiol 41(5):1015-28.
Tigges M, Denervaud N, Greber D, Stelling J, Fussenegger M. 2010. A synthetic low-
frequency mammalian oscillator Nucleic Acids Res 38(8):2702-11.
Tigges M, Fussenegger M. 2009. Recent advances in mammalian synthetic biology-design of
synthetic transgene control networks. Curr Opin Biotechnol 20(4):449-60.
Tigges M, Marquez-Lago TT, Stelling J, Fussenegger M. 2009. A tunable synthetic
mammalian oscillator. Nature 457(7227):309-12.
Introduction ___________________________________________________________________________
23
Ulmer JB, Valley U, Rappuoli R. 2006. Vaccine manufacturing: challenges and solutions.
Nat Biotechnol 24(11):1377-83.
Urlinger S, Helbl V, Guthmann J, Pook E, Grimm S, Hillen W. 2000. The p65 domain from
NF-kappaB is an efficient human activator in the tetracycline-regulatable gene
expression system. Gene 247(1-2):103-10.
Weber W, Bacchus W, Daoud-El Baba M, Fussenegger M. 2007a. Vitamin H-regulated
transgene expression in mammalian cells. Nucleic Acids Res 35(17):e116.
Weber W, Daoud-El Baba M, Fussenegger M. 2007b. Synthetic ecosystems based on
airborne inter- and intrakingdom communication. Proc Natl Acad Sci U S A
104(25):10435-40.
Weber W, Fussenegger M. 2006. Pharmacologic transgene control systems for gene therapy.
J Gene Med 8(5):535-56.
Weber W, Fussenegger M. 2007. Inducible product gene expression technology tailored to
bioprocess engineering. Curr Opin Biotechnol 18(5):399-410.
Weber W, Fussenegger M. 2009. Engineering of synthetic mammalian gene networks. Chem
Biol 16(3):287-97.
Weber W, Fux C, Daoud-el Baba M, Keller B, Weber CC, Kramer BP, Heinzen C, Aubel D,
Bailey JE, Fussenegger M. 2002a. Macrolide-based transgene control in mammalian
cells and mice. Nat Biotechnol 20(9):901-7.
Weber W, Kramer BP, Fux C, Keller B, Fussenegger M. 2002b. Novel
promoter/transactivator configurations for macrolide- and streptogramin-responsive
transgene expression in mammalian cells. J Gene Med 4(6):676-86.
Weber W, Lienhart C, Daoud-El Baba M, Fussenegger M. 2009. A Biotin-triggered Genetic
Switch in Mammalian Cells and Mice. Metab Eng.
Weber W, Link N, Fussenegger M. 2006. A genetic redox sensor for mammalian cells. Metab
Eng 8(3):273-80.
Weber W, Rimann M, Spielmann M, Keller B, Daoud-El Baba M, Aubel D, Weber CC,
Fussenegger M. 2004. Gas-inducible transgene expression in mammalian cells and
mice. Nat Biotechnol 22(11):1440-4.
Weber W, Schoenmakers R, Keller B, Gitzinger M, Grau T, Daoud-El Baba M, Sander P,
Fussenegger M. 2008. A synthetic mammalian gene circuit reveals antituberculosis
compounds. Proc Natl Acad Sci U S A 105(29):9994-8.
Wurm FM. 2004. Production of recombinant protein therapeutics in cultivated mammalian
cells. Nat Biotechnol 22(11):1393-8.
Introduction ___________________________________________________________________________
24
You L, Cox RS, 3rd, Weiss R, Arnold FH. 2004. Programmed population control by cell-cell
communication and regulated killing. Nature 428(6985):868-71.
Chapter I ___________________________________________________________________________
25
Chapter I
Functional cross-kingdom conservation of mammalian and moss
(Physcomitrella patens) transcription, translation and secretion machineries
Marc Gitzinger, Juliana Parsons, Ralf Reski and Martin Fussenegger
Plant Biotechnology Journal. 2009 7: 73-86
Chapter I ___________________________________________________________________________
26
Summary
Plants and mammals are separated by a huge evolutionary distance.
Consequently, biotechnology and genetics have traditionally been divided into
“green” and “red”. Here, we provide comprehensive evidence that key components of
the mammalian transcription, translation and secretion machineries are functional in
the model plant Physcomitrella patens. Cross-kingdom compatibility of different
expression modalities originally designed for mammalian cells such as (i) native as
well as synthetic promoters and polyadenylation sites, (ii) viral and cellular internal
ribosome entry sites, (iii) secretion signal peptides and secreted product proteins, and
(iv) synthetic transactivators and transrepressors, was established. This mammalian
expression portfolio enabled constitutive, conditional as well as autoregulated
expression of different product genes in a multicistronic expression format optionally
adjusted by various trigger molecules such as butyrolactones, macrolide antibiotics
and ethanol. Capitalizing on a cross-kingdom-compatible expression platform we
pioneered a prototype biopharmaceutical manufacturing scenario using
microencapsulated transgenic P. patens protoplasts cultivated in a Wave Bioreactor.
Vascular endothelial growth factor 121 (VEGF121) titers matched those typically
achieved by standard protonema populations grown in stirred-tank bioreactors. The
full compatibility of mammalian expression systems in P. patens further promotes the
use of moss as a cost-effective alternative for the manufacturing of complex
biopharmaceuticals and as a valuable host system to advance synthetic biology in
plants.
Introduction
The moss Physcomitrella patens, unique for its high rate of homologous
recombination, generic codon usage, haploidy, simple body plan, physiologic
properties and its exclusive phylogenetic position (Quatrano et al., 2007; Rensing et
al., 2007), is gathering momentum for biopharmaceutical manufacturing of protein
therapeutics due to favorable bioprocess and downstream processing economics
(Decker and Reski, 2008). In-vitro cultivation of P. patens throughout its complete
life cycle (Frank et al., 2005), transgenic protonema and transient protoplast cultures
Chapter I ___________________________________________________________________________
27
(Baur et al., 2005a), stirred-tank and tubular photo-bioreactors (Decker and Reski,
2007), the generation of moss mutants devoid of immunogenic product protein
glycosylation (Huether et al., 2005) and the production of human antibodies with
improved ADCC activity (Nechansky et al., 2007) have been important milestones in
establishing the moss as a promising biopharmaceutical manufacturing platform
(Decker and Reski, 2007).
Transgenic mammalian cell cultures are currently the most successful platform
for the production of biopharmaceuticals since most of the protein therapeutics on the
market originate from mammalian cell bioprocesses (Wurm, 2004). However, since
the global product pipeline exceeds the worldwide manufacturing capacity, alternative
host cell systems for biopharmaceutical manufacturing are on the rise (Decker and
Reski, 2007; Hamilton et al., 2006). Since the mid-1980s the productivity of
mammalian cells cultivated in bioreactors has reached the gram per liter range, an
over 100-fold yield improvement over titers achieved for the first commercial
bioprocesses (Wurm, 2004). Part of this success is based on the development of
sophisticated expression technologies and metabolic engineering strategies
(Hartenbach and Fussenegger, 2005; Umana et al., 1999). The latest generation of
expression vectors harbor (i) compact strong constitutive promoters for high-level
transcription of product genes (Hartenbach and Fussenegger, 2006), (ii) multicistronic
expression units enabling one-vector-based selection and expression of multiprotein
complexes (Fux et al., 2004) and (iii) regulated expression systems for production of
difficult-to-express protein therapeutics (Weber and Fussenegger, 2007).
In mammalian cells, initiation of translation is typically managed by a cap
structure which is posttranscriptionally attached to the 5’ end of mRNAs (Kozak,
1989). Alternatively, internal ribosome entry sites (IRES), which adopt a specific
secondary RNA structure triggering ribosome assembly and translational initiation,
have evolved to ensure a minimal level of protein synthesis for survival during cap-
compromising physiologic emergency situations (coordination of viral defense;
cellular IRES) (Gan and Rhoads, 1996) or to redirect the cellular translation
machinery to the production of virus proteins (viral IRES) (Dirks et al., 1993;
Kaufman et al., 1991). Tandem arrangement of different transgenes, each preceded by
Chapter I ___________________________________________________________________________
28
an IRES element, enables transcription of a multicistronic mRNA producing
stoichiometric levels of various proteins. Recently, a sophisticated vector platform
(pTRIDENT) has been designed for multicistronic expression of up to three different
transgenes (Fux et al., 2004).
Heterologous mammalian transcription control modalities have been designed
in two different configurations: ON-type systems, which are induced following
addition of a trigger molecule and OFF-type systems, which are repressed after
administration of the regulating compound (Weber and Fussenegger, 2007). ON-type
systems typically consist of a transrepressor (optionally containing a silencing
domain), which binds to specific (tandem) operator sequences and blocks transcription
from upstream constitutive promoters until the transrepressor is released after
interaction with the inducer (Weber et al., 2002; Weber et al., 2005). Transactivators,
which only bind to their operator modules in the presence of the inducer are also
classified as ON-type systems (Hartenbach and Fussenegger, 2005; Weber et al.,
2004). OFF-type systems usually consist of a chimeric transactivator, which binds a
specific (tandem) operator sequence and triggers transcription from an adjacent
minimal promoter until it is released by interaction with the inducer (Weber et al.,
2002; Weber et al., 2003). A variety of these transcription control systems have been
used for basic and applied research (Weber and Fussenegger, 2007).
The protein production machineries of mammalian cells and plants are known
to be largely incompatible which requires mammalian expression technology to be
specifically modified for use in plant cells and plants (Frey et al., 2001; Mayfield et
al., 2003). Availability of cross-kingdom-compatible protein expression technology
would significantly improve the use of plant cells for biopharmaceutical
manufacturing. We provide comprehensive evidence that transcription, translation and
secretion machineries of mammalian cells and the non-seed plant P. patens are
compatible, pioneer a novel protoplast-based fermentation technology for the
production of human glycoproteins, and thus establish P. patens as a valuable host
system for synthetic biology, in particular, to functionally understand the most
conserved molecular devices controlling biological signaling in different kingdom.
Chapter I ___________________________________________________________________________
29
Results
Profiling of mammalian promoter activities in P. patens. Swapping of
expression units between mammalian and plant cell platforms for gene-function
analysis has been hampered by incompatibilities in the
transcription/translation/secretion machineries. These systems require exclusive
genetic elements (promoters, reporter genes, polyadenylation sites) for expression of
transgenes (Frey et al., 2001). In order to measure the activity of mammalian
promoters in P. patens isogenic, all-mammalian expression vectors were designed
harboring the human placental alkaline phosphatase (SEAP), an easy-to-assay reporter
gene, a polyadenylation site derived from the simian virus 40, and various mammalian
promoters (PhCMV, PSV40, PGTX, PhEF1!) including the smallest synthetic promoter PGTX
(Hartenbach and Fussenegger, 2006). The polioviral internal ribosome entry site
(IRESPV), known to be devoid of any promoter activity, was used as a negative
control. Of the promoters tested, only PhEF1! was not functional in P. patens.
Interestingly, the world’s smallest synthetic promoter (182bp) was fully functional
reaching PhCMV-driven expression levels in the moss. The SEAP expression profiles
reached using mammalian expression vectors were compared with those of an
isogenic plant expression vector encoding SEAP under the control of the cauliflower
mosaic virus 35S promoter (PCaMV35S) (Figure 1).
Figure 1. Expression performance of different constitutive mammalian promoters in P. patens compared to PCaMV35S. Isogenic SEAP expression vectors (PhCMV [pSS173], PSV40 [pMG31], PGTX [pSH17], PhEF1! [pMG32], -SEAP-pASV40) were transfected into P. patens protoplasts and compared to a standard plant expression vector (pMG65, PCaMV35S-SEAP-
PCaMV35S PSV40 PGTX IRESPV PhEF1
SE
AP
Pro
duct
ion
(μg/
L)
PhCMV 0
0.2
0.4 1.0
0.3
0.1
1.5
Chapter I ___________________________________________________________________________
30
pACaMV35S). SEAP production was scored after five days. The polioviral internal ribosome entry site (IRESPV), which lacks promoter activity in mammalian cells, was used as control (pSH49, IRESPV-SEAP-pASV40). Error bars indicate the standard deviation of at least three independent experiments.
The secretory machineries of mammalian cells and P. patens are
compatible. Previous studies on mammalian promoter compatibility in the moss
revealed that the human placental secreted alkaline phosphatase (SEAP) could be
secreted by P. patens protoplasts (Figure 1). In order to assess whether product genes
containing mammalian secretion signals are generically secreted by P. patens several
product genes including SEAP, the Bacillus stearothermophilus-derived secreted !-
amylase (SAMY) containing an IgG-derived secretion signal, human vascular
endothelial growth factor 121 (VEGF121) and human erythropoietin (EPO) were
cloned into isogenic PGTX-driven mammalian and isogenic PCaMV35S-driven plant
expression vectors. The product levels were profiled in the supernatant of transfected
moss protoplast cultures, as well as in the cytosol, in order to assess the overall
product secretion efficiency (Table 1). All of the mammalian product proteins were
efficiently secreted by moss protoplasts, while the control protein AMY lacking the
IgG secretion signal sequence (AMY) could only be detected in the plant cytosol
(Table 1). In order to characterize the processing of secreted mammalian proteins in P.
patens, we N-terminally sequenced human VEGF121 purified from moss culture
supernatants. The finding that the first 10 amin
o acids of secreted VEGF121 were A(OH-
Pro)MAEGGGQN suggests that secreted mammalian proteins are identically
processed in P. patens
Chapter I ___________________________________________________________________________
31
Table 1: Expression levels of mammalian reporter constructs in Physcomitrella patens
Abbreviations: AMY, Bacillus stearothermophilus-derived !-amylase; EPO, human erythropoietin; PCaMV35S, cauliflower mosaic virus promoter 35s; PGTX, synthetic promoter derived from the GTX homeodomain protein; SAMY, Bacillus stearothermophilus-derived secreted !-amylase; SEAP, human placental secreted alkaline phosphatase; VEGF121, human vascular endothelial growth factor 121.
Mammalian cap-independent translation initiation is functional in P.
patens. Internal ribosome entry sites (IRES) are capable of managing cap-independent
translation-initiation under physiological conditions which compromise classical cap-
mediated translation (Pestova et al., 2001). Non-limiting examples of IRES-mediated
translation include (i) virus infection during which the virus interferes with the
cellular translation machinery and redirects it to translation of its IRES-tagged
transcripts (viral IRES) (Dirks et al., 1993; Kaufman et al., 1991) and (ii) hijacked
cells may coordinate a molecular defense by translating a set of IRES-containing
transcripts (cellular IRES) (Gan and Rhoads, 1996). With the functionality of
mammalian promoters and protein secretion established in P. patens, mammalian cell-
Expression vector Expression level (supernatant)
Expression level (intra-cellular)
PGTX-SEAP-pA (pSH17)
0.36 ± 0.02 µg/L 0.06 ± 0.007 µg/L
PCaMV35S-SEAP-pA (pMG65)
1.02 ± 0.09 µg/L 0.19 ± 0.01 µg/L
PGTX-SAMY-pA (pSH102)
9.0 ± 0.54 µmol/s/L 2.1 ± 0.02 µmol/s/L
PCaMV35S-SAMY-pA (pMG66)
18.6 ± 2.3 µmol/s/L 4.1 ± 0.3 µmol/s/L
PGTX-AMY-pA (pMG60)
1.65 ± 0.05 µmol/s/L 6.73 ± 0.34 µmol/s/L
PCaMV35S-AMY-pA (pMG67)
2.5 ± 0.1 µmol/s/L 13.2 ± 1.23 µmol/s/L
PGTX-VEGF121-pA (pSH100)
4.0 ± 0.1 ng/mL 0.42 ± 0.07 ng/mL
PCaMV35S-VEGF121-pA (pMG68)
13.5 ± 0.5 ng/mL 1.1 ± 0.1 ng/mL
PGTX-EPO-pA (pMG61)
48 ± 10.6 mU/mL 5.2 ± 0.9 mU/mL
PCaMV35S-EPO-pA (pMG69)
159 ± 8.1 mU/mL 22 ± 0.95 mU/mL
Chapter I ___________________________________________________________________________
32
pMG40 (pTRIDENT45) PhCMV SAMY pA IRESPV VEGF121
I-SceI
IRESEMCV SEAP
I-CeuI I-PpoI PI-PspI HindIII NotI PmeI SpeI
pMG41 (pTRIDENT46) PhCMV SAMY pA IRESPV VEGF121
I-SceI
IRESRbm3 SEAP
I-CeuI I-PpoI PI-PspI HindIII NotI PmeI SpeI
pMG42 (pTRIDENT47) PhCMV SAMY pA IRESPV VEGF121
I-SceI
IRESPV SEAP
I-CeuI I-PpoI PI-PspI HindIII NotI PmeI SpeI
and virus-derived IRES’s were evaluated in P. patens to determine if they could
trigger translation-initiation and enable multicistronic expression.
We have designed a variety of latest-generation pTRIDENT vectors, which
contain (i) a constitutive PhCMV driving transcription of multicistronic mRNAs, (ii) an
artificial polyadenylation site (apA) signaling the terminus of the multicistronic
transcript (Hartenbach and Fussenegger, 2005), (iii) two tandem IRES elements of
poliovirus (IRESPV) (Dirks et al., 1993) or encephalomyocarditis virus (IRESEMCV)
(Kaufman et al., 1991) and IRESRbm3, derived from the human RNA-binding motif
protein 3 (Rbm3; (Chappell and Mauro, 2003), (iv) vast multiple cloning sites (MCS)
flanking each IRES element (many of which are targets for rare-cutting 8bp-
recognizing restriction endonucleases) for complication-free sequential insertion of
(v) product genes including SAMY, VEGF121 and SEAP. (vi) PhCMV, SAMY-IRES-
VEGF121-IRES-SEAP and apA are flanked by rare-cutting homing endonucleases (I-
CeuI, I-SceI, I-PopI, PI-PspI), which enable, together with the MCS, straightforward
exchange/swapping of expression modules and transgenes among different members
of the pTRIDENT vector family (Fux et al., 2004).
Following transfection of pTRIDENT45 (PhCMV-SAMY-IRESPV-VEGF121-
IRESEMCV-SEAP-apA), pTRIDENT46 (PhCMV-SAMY-IRESPV-VEGF121-IRESRbm3-
SEAP-apA) and pTRIDENT47 (PhCMV-SAMY-IRESPV-VEGF121-IRESPV-SEAP-apA)
into P. patens protoplasts significant levels of product protein were produced from all
positions within the vectors indicating that mammalian cell/virus-derived IRES
elements are functional and enable multicistronic transgene expression in the moss
(Figure 2).
A
Chapter I ___________________________________________________________________________
33
D
C
B
Figure 2. IRES-mediated translation-initiation in P. patens. (A) Schematic representation of tricistronic mammalian expression cassettes encoding a PhCMV-driven multicistronic expression unit harboring SAMY, VEGF121 and SEAP in cistrons 1, 2 and 3, respectively. SAMY is translated in a classic cap-dependent manner, VEGF121 requires cap-independent
SA
MY
Pro
duct
ion
(μm
ol/s
*L)
pMG40 pMG41 pMG42
SAMY-1.Cistron
0
2
5
4
3
1
VE
GF 1
21 P
rodu
ctio
n (n
g/m
l)
pMG40 pMG41 pMG42
VEGF121-2.Cistron
0
0.2
0.3
0.1
0.4
0
SE
AP
Pro
duct
ion
(μg/
L)
pMG40 pMG41 pMG42
SEAP-3.Cistron
0.1
0.2
0.3
Chapter I ___________________________________________________________________________
34
A
translation-initiation by the polioviral internal ribosome entry site (IRESPV) and translation of SEAP is mediated by either IRESPV, the encephalomyocarditis virus IRES (IRESEMCV) or the IRES element derived from the human RNA-binding motif protein 3 (IRESRbm3). (B) SAMY, (C) VEGF121 and (D) SEAP expression levels of moss protoplast cultures transfected with pTRIDENT45, pTRIDENT46 and pTRIDENT47. Reporter protein production was scored five days after transformation. Error bars indicate the standard deviation of at least three independent experiments.
Tunable product gene expression in P. patens using mammalian transgene
control technology. Transcription control of specific genes by small trigger
molecules is essential for gene-function analysis (Malleret et al., 2001), drug
discovery (Weber et. al. submitted), design of complex artificial gene circuits (Kramer
and Fussenegger, 2005), precise and timely molecular interventions in gene therapy
(Gersbach et al., 2006), engineering of preferred cell phenotypes for tissue
engineering (Niwa et al., 2000) and biopharmaceutical manufacturing (Fussenegger et
al., 1998). While a variety of transgene control systems are available for fine-tuning
transgene transcription in mammalian cells (Weber and Fussenegger, 2007), the
choice for controlling transgene expression in plant cells, in particular in P. patens, is
limited (Saidi et al., 2005). Recently, mammalian transcription control circuits were
designed which are responsive to the butyrolactone 2-(1’-hydroxy-6-methylheptyl)-3-
(hydroxymethyl)-butanolide (SCB1) (QuoRex; Q-ON, Q-OFF, (Weber et al.,
2005; Weber et al., 2003), the macrolide antibiotic erythromycin (E.REX; EON, EOFF;
(Weber et al., 2002)) and to acetaldehyde or ethanol (AIR; (Weber et al., 2007; Weber
et al., 2004)). AIR-controlled transgenes are induced by acetaldehyde/ethanol whereas
E.REX and QuoRex are available in two different design versions, which could either
be induced (EON, Q-ON) or repressed (EOFF, Q-OFF) by addition of the regulating
molecule (Weber et al., 2002; Weber et al., 2005; Weber et al., 2003).
All mammalian transgene control systems were optimized for regulated SEAP
expression and were transfected into P. patens which were grown in the presence and
absence of different trigger molecules at various concentrations. SCB1 was well
tolerated by the moss (toxic only above 20!g/ml, data not shown) and mediated
adjustable, up to 15-fold induction (Q-ON; pWW504, PSV40-scbR-KRAB-pA;
pWW162, PSCAON8-SEAP-pA) as well as repression (Q-OFF; pWW122, PSV40-scbR-
Chapter I ___________________________________________________________________________
35
VP16-pA; pWW124, PSPA-SEAP-pA), of SEAP expression within a concentration
range of 0-15!g/ml (Figure 3A and B). The Q-ON system is so sensitive in P. patens
that the moss senses the presence of co-cultivated SCB1-producing S. coelicolor, and
participates in S. coelicolor’s quorum-sensing crosstalk by adjusting SEAP production
in response to the size of the bacterial population (Figure 3C).
Figure 3. Quorum-sensing control of transgene expression in P. patens. The mammalian Q-ON (A) and Q-OFF (B) systems, which are induced and repressed, respectively, by the S. coelicolor quorum-sensing butyrolactone SCB1, have been transfected into moss protoplasts and dose-response profiles of SEAP were recorded after five days.
SCB1 (µg/ml)
SE
AP
Pro
duct
ion
(μg/
L)
0
0.50
1.25
0
1.00
0.75
0.25
5 10 15
Q-ON
SE
AP
Pro
duct
ion
(μg/
L)
0
0.50
1.25
0
1.00
0.75
0.25
5 10 15
SCB1 (µg/ml)
Q-OFF
B
A
Chapter I ___________________________________________________________________________
36
Figure 3: (C) Co-cultivation of Q-ON-transgenic moss protoplasts with SCB1-producing S. coelicolor reveals quorum-sensing-based cross-species communication resulting in a correlation between plant-based SEAP production and S. coelicolor population size. (D and E) Macrolide-responsive transgene expression in moss protoplasts. SEAP expression profiles of moss protoplast cultures transfected with the mammalian EON (D) and EOFF (E) systems
S. coelicolor population (µl/200µl moss culture)
SE
AP
Pro
duct
ion
(μg/
L)
5 10 20 0 40
0.45
0.40
0.35
0.30
0.25
0.20
0.15
0.10
0.05
0.0
SE
AP
Pro
duct
ion
(μg/
L)
Erythromycin (µg/ml)
0
0.2
0.4
0.5
0.3
0.1
0.6
5 10 20 30 0
EON
SE
AP
Pro
duct
ion
(μg/
L)
Erythromycin (µg/ml)
0
0.2
0.4
0.5
0.3
0.1
0.6
2.5 5 10 20 0
EOFF
C
D
E
Chapter I ___________________________________________________________________________
37
and cultivated for five days in the presence of varying erythromycin concentrations. Error bars indicate the standard deviation of at least three independent experiments.
The EON (pWW43, PSV40-E-KRAB-pA; pWW56, PETRON8-SEAP-pA) and
EOFF (pWW35, PSV40-E-VP16-pA; pWW37, PETR2-SEAP-pA) systems were able to
induce or repress SEAP expression up to 13-fold using erythromycin levels not
exceeding 20!g/ml (toxic above 30!g/ml) (Figure 3D and E). AIR-controlled SEAP
expression attained a 20-fold SEAP expression (AIR; pWW195, PSV40-alcR-pA;
pWW192, PAIR-SEAP-pA) in the moss when induced by 20!l/ml ethanol (Figure 4A).
This compares favorably with the regulated performance of plant-specific ethanol-
mediated transgene regulation in tobacco (Caddick et al., 1998), Arabidopsis thaliana
(Roslan et al., 2001), potato and oilseed rape (Sweetman et al., 2002). The AIR-
control system is incredibly sensitive in P. patens that SEAP production can be
induced by S. cerevisiae populations cultivated at a distance. As part of its
metabolism, S. cerevisiae converts ethanol into gaseous acetaldehyde which reaches
moss cultures “over the air” and induces SEAP production in a distance-dependent
manner (Figure 4B ).
The combination of AIR-based transcription control with multicistronic
expression technology (pTRIDENT42; PAIR-SAMY-IRESPV-VEGF121-IRESEMCV-
SEAP-apA) enabled coordinated induction of three different transgenes after addition
of 10!l/ml ethanol (Figure 4C-E).
SE
AP
Pro
duct
ion
(μg/
L)
Ethanol (µl/ml)
0
0.2
0.4
0.5
0.3
0.1
0.6
2.5 5 10 20 0
A
Chapter I ___________________________________________________________________________
38
Figure 4. Ethanol and gas-inducible transgene expression in P. patens. (A) Ethanol
inducible SEAP expression in moss protoplasts transfected with the mammalian AIR system. (B) S. cerevisiae producing gaseous acetaldehyde as part of their native metabolism trigger SEAP expression “over-the-air” in distant P. patens cultures harboring the mammalian AIR system. (C-E) Ethanol-controlled tricistronic gene expression in moss protoplasts with SAMY encoded in the first (C), VEGF121 in the second (D) and SEAP in the third cistron (E). Protein production was scored five days after transformation of moss protoplasts with pWW195 (PSV40-alcR-pA) and pSH3 (PAIR-SAMY-IRESPV-VEGF121-IRESEMCV-SEAP-apA) and cultivation in the presence or absence of ethanol. (F) Autoregulated transgene expression in P. patens. Moss protoplasts transfected with the ethanol-inducible autoregulated expression vector pSH28 (PAIR-SEAP-IRESPV-alcR-apA) were cultivated for five days in the
SE
AP
Pro
duct
ion
(μg/
L)
Distance of moss to the S.cervisiae (cm)
0
0.2
0.4
0.5
0.3
0.1
0.6
1.9 3.9 7.5 1.5 11.3
SE
AP
Pro
duct
ion
(μg/
L)
Ethanol (µl/ml)
SEAP-3.Cistron
0
0.05
0.10
0.15
0 10 Ethanol (µl/ml)
SE
AP
Pro
duct
ion
(μg/
L)
0
0.2
0.4
0.5
0.3
0.1
0.6
0 10
SA
MY
Pro
duct
ion
(μm
ol/s
*L)
Ethanol (µl/ml)
0 10
SAMY-1.Cistron
0
2
5
4
3
1
Ethanol (µl/ml)
VE
GF 1
21 P
rodu
ctio
n (n
g/m
l)
0 10
VEGF121-2.Cistron
0
0.1
0.2
0.3
B
C D
F E
Chapter I ___________________________________________________________________________
39
presence and absence of ethanol before SEAP expression levels were determined in the culture supernatant. Error bars indicate the standard deviation of at least three independent experiments.
Autoregulated transgene expression in P. patens. Classic transgene control
systems consist of two expression vectors, one harboring the
transrepressor/transactivator and the other encoding the transgene driven by the
trigger-inducible promoter (Weber and Fussenegger, 2007). Such two-vector design is
more complex to engineer compared to latest-generation autoregulated one-vector
configurations (Hartenbach and Fussenegger, 2005). Capitalizing on the functionality
of IRES elements in P. patens, protoplasts were transfected with the ethanol-
controlled autoregulated SEAP expression vector pAutoRex8 (PAIR-SEAP-IRESPV-
alcR-apA; (Hartenbach and Fussenegger, 2005). pAutoRex8 contains a PAIR-driven
dicistronic expression unit encoding SEAP in the first and the acetaldehyde-dependent
transactivator alcR in the second cistron. Leaky PAIR-driven transcripts provide
sufficient AlcR to kickstart maximum SEAP expression in the presence of inducing
ethanol concentrations. In the absence of exogenous ethanol the autoregulated circuit
remains silent. The autoregulated AIR control system reaches SEAP induction factors
of up to 36-fold when transfected into P. patens (Figure 4F).
VEGF121-based biopharmaceutical manufacturing using
microencapsulated moss protoplasts. The use of P. patens for biopharmaceutical
manufacturing of protein therapeutics has been established but remains challenging.
The moss needs to be constantly blended in order to enable mixing in custom-
designed stirred-tank bioreactors (Decker and Reski, 2007) and the plant cell wall
potentially compromises efficient secretion of larger product proteins. Since plant
protoplasts lack any cell wall and can be grown in single-cell suspension cultures,
they would be the ideal plant cell system for biopharmaceutical manufacturing.
However, protoplasts are too fragile and shear force-sensitive for use in state-of-the-
art bioprocesses.
We have pioneered a process to microencapsulate P. patens protoplasts in
coherent alginate beads. Alginate bead polymerization is compatible with W5 culture
Chapter I ___________________________________________________________________________
40
medium which was also used for the bioprocess. 4x107 tWT11.51VEGF (Baur et al.,
2005b) -derived protoplasts were microencapsulated in 500!m capsules (165
protoplasts per capsule) using state-of-the-art encapsulation technology and cultivated
for nine days in a 2L Wave Bioreactor operated at a culture volume of 1L (Figure 5).
VEGF121 production reached 53!g/L in a nine-day process which compares with
forefront bioprocesses using moss protonema. A fluorescein/trypan blue-based
live/dead staining revealed that microencapsulated protoplasts cultivated for nine days
in a Wave Bioreactor were still 74.8% ± 7.2% viable, which represent only a 5%
viability decrease compared to a freshly prepared protonema-derived protoplast
population.
Figure 5. Prototype biopharmaceutical manufacturing of VEGF121 using P. patens
protoplasts microencapsulated in alginate beads and cultivated in a Wave Bioreactor. (A)
Bioreactor set-up. (B) Light micrographs moss protoplasts encapsulated in alginate beads.
Sampling port
Filter for sterile air-intake
Filling port
Disposable Wave Bag with encapsulated P. patens
protoplasts
Pressure relief air-outlet, including heater
Wave Bioreactor rocking platform
100µm 100µm
A
B
Chapter I ___________________________________________________________________________
41
Figure 5: (C) VEGF121 production profiles of microencapsulated transgenic moss protoplasts. Error bars indicate the standard deviation of between three measurements of the samples.
Discussion
The complete functionality of the central mammalian expression portfolio
which includes various promoters, mRNA processing signals, transcription factors,
translation elements and secretion peptides (Table 2) in the moss P. patens suggests
that mammalian expression vectors and product proteins are generically compatible
with this evolutionary old and simple plant. Interestingly, not only the functionality
but also the relative performance profiles of different genetic elements in the moss
matched those of mammalian cells. Examples of this include: (i) PhCMV being a
stronger promoter than PSV40, with comparable strength to the smallest synthetic
promoter PGTX (Hartenbach and Fussenegger, 2006), (ii) IRESPV and IRESEMCV being
equally efficient in triggering translation initiation and outperforming IRESRbm3 (Fux
et al., 2004), (iii) terminal IRES-driven translation units showing lower expression
levels from multicistronic mRNAs compared to cap-dependent translation initiation,
(iv) the AIR control system responsiveness to gaseous acetaldehyde or ethanol being
the most sensitive transgene-control modality (Weber et al., 2004), and (v) one-
vector-based auto-regulated expression configuration providing superior regulation
performance.
VE
GF 1
21 P
rodu
ctio
n (n
g/m
L)
0
20
40
50
30
10
60 Wave-Bioreactor
Time (h)
50 250 100 150 200 0
C
Chapter I ___________________________________________________________________________
42
Table 2. Mammalian genetic elements functional in Physcomitrella patens
Genetic element
Name Description Reference or Source
Promoter PhCMV Human cytomegalovirus immediate early promoter
Invitrogen
PSV40 Simian virus 40 promoter Clontech PGTX Synthetic promoter derived from the
GTX homeodomain protein Hartenbach and Fussenegger, 2006
PhCMVmin Minimal version of PhCMV Clontech Operator OalcA Operator of the Aspergillus nidulans
alcohol dehydrogenase promoter Weber et al. 2004
ETR Operator of the E. coli 2’-phosphotransferase 1 (mph(A)) promoter
Weber et al. 2002
OscbR Operator of the Streptomyces coelicolor butyrolactone-specific quorum-sensing receptor (ScbR)
Weber et al. 2003
Transactivator AlcR Transcription factor coordinating ethanol metabolism in Aspergillus nidulans
Weber et al. 2004
Repressor E Repressor of the E. coli macrolide-resistance gene (mph(A))
Weber et al. 2002
ScbR Butyrolactone-sensitive quorum-sensing receptor of Streptomyces coelicolor
Weber et al. 2003
Transactivation domain
VP16 Herpes simplex virus-derived transactivation domain
Gossen et al. 1992
Transrepression domain
KRAB Human kruppel-associated box-protein Moosmann et al. 1997
Internal ribosome entry site
IRESPV Poliovirus-derived IRES Dirks et al. 1993
IRESEMCV Encephalomyocarditis virus-derived IRES
Kaufman et al. 1991
IRESRbm3 IRES derived from the human RNA-binding motif protein 3 (Rbm3)
Chappell et al. 2001
polyadenylation site
pA Simian virus 40-derived polyadenylation site
Clontech
apA Artificial polyadenylation site Fux et al. 2001 Product proteins
SEAP Human placental alkaline phosphatase Dirks et al. 1993
SAMY Bacillus stearothermophilus-derived secreted !-amylase
Schlatter et al. 2002
AMY Bacillus stearothermophilus-derived !-amylase
Schlatter et al. 2002
VEGF121 Human vascular endothelial growth factor 121
Weber et al. 2003
EPO Human erythropoietin Donation by P. Aebischer
Chapter I ___________________________________________________________________________
43
Secretion signal SIg" Murine Ig" secretion signal Schlatter et al. 2002
This cross-kingdom conservation of mammalian and moss protein production
machineries is phylogenetically profound and has several implications for basic and
applied research. Comparative genomics as well as functional studies have recently
established major differences in metabolic pathways and gene function between
flowering plants and P. patens and suggested that a substantial moss gene pool is
more closely related to mammals than to flowering plants (Frank et al., 2007; Rensing
et al., 2007). In combination with the functional data presented here, these findings
may expand our classical view on the molecular division between plants and animals
(e.g., in (Yamamoto et al., 2007).
This differentially expressed gene pool may reveal unique cross-kingdom
functionalities useful to future advances in agriculture and human health. With the
discovery that two fundamentally different living systems such as the moss and
mammalian cells can utilize the other’s gene expression and protein production
machineries may expand the way of how we perceive ecosystems in which different
species co-exist and could, at least theoretically, exchange a compatible gene pool.
Synthetic ecosystems have recently established the principle of cross-kingdom
communication between S. cerevisiae or E. coli and mammalian cells which replicated
co-existence patterns as complex as oscillating predator-prey population dynamics
(Weber et al., 2007), thus expanding our view on quorum-sensing between bacteria
(Keller and Surette, 2006). We have shown here that P. patens harboring mammalian
gene circuits were responsive to quorum-sensing communication initiated by co-
cultivated S. coelicolor as well as to “over-the-air” signaling triggered by S. cerevisiae
cultivated adjacently. Rational interventions into the quorum-sensing networks may
foster unprecedented advances in agriculture replicating the progress achieved in
attenuating host-pathogen interaction in human therapy (Benghezal et al., 2006).
Moreover, our recent findings establish P. patens as a promising host system for
synthetic biology, a novel approach in the life sciences that relies on iterative cycles
between analysis and synthesis (Benner and Sismour, 2005), utilizing devices of
signaling networks in a cross-kingdom approach (e.g., (Khandelwal et al., 2007).
Chapter I ___________________________________________________________________________
44
Several biopharmaceutical production platforms including E. coli (Georgiou
and Segatori, 2005), (glyco-engineered) S. cerevisiae (Hamilton et al., 2006),
mammalian cells (Wurm, 2004) and transgenic animals (Larrick and Thomas, 2001)
are competing for industrial production of protein therapeutics (Fussenegger and
Hauser, 2007). Mammalian cells have become the dominant system for the production
of recombinant protein pharmaceuticals in part due to availability of a highly
advanced portfolio of expression vectors and engineering strategies (Hartenbach and
Fussenegger, 2005; Umana et al., 1999; Wurm, 2004). With the global mammalian
cell-based production capacity plateauing into a bottleneck, this compromises the
availability of drugs to patients. Alternative easy-to-implement bioprocessing
concepts are urgently needed (Fussenegger and Hauser, 2007). The moss P. patens
has recently come into the limelight as an easy-to-handle/engineer organism which
could be cultivated in scale-up-compatible bioreactors and was able to produce
ADCC-optimized therapeutic IgGs in a GMP-approved bioprocess (Decker and Reski,
2007).
Utilizing a compatible mammalian expression and engineering toolbox, the
moss as emerging biopharmaceutical manufacturing platform could be propelled to an
ex-aequo competitor of mammalian cell-based production systems. Major bioprocess
advantages of P. patens include the use of an inexpensive salt solution as production
medium, which reduces downstream processing challenges and cost, and the
availability of an efficient homologous recombination toolkit that provides stable and
predictable production cultures (Kamisugi et al., 2006). Best-in-class production
systems include transient protoplast cultures for rapid evaluation of bioprocess
parameters and a scalable stirred-tank photo-bioreactor that uses stable moss
protonema.
Moss protonema tissue needs to be constantly blended to avoid complications
in bioreactor operation, which may hinder large-scale biopharmaceutical
manufacturing and the established cell wall may compromise secretion of larger
proteins. Protoplasts could be an alternative (Baur et al., 2005a) but they are not
sufficiently robust to survive long-term bioreactor operation. The microencapsulation
protocol established during this study is compatible with the W5 medium and enables
Chapter I ___________________________________________________________________________
45
cultivation of encapsulated protoplasts in a proliferation-inhibited and cell wall-free
state. Being protected by a physiologically inert alginate shell, the protoplasts are able
to devote all of their metabolic energy to the production of heterologous protein rather
than biomass. And being devoid of any secretion-limiting cell wall,
microencapsulated protoplasts cultivated in a standard Wave Bioreactor, equipped
with a photosynthesis kit were able to produce the human growth factor VEGF121 at
titers comparable to the highly optimized best-in-class protonema cultures. The use of
Wave Bioreactor systems, which can be easily upscaled to 500L cultures, has recently
gathered momentum used in pilot production of proteins for clinical trials (Haldankar
et al., 2006).
The combination of a novel protoplast-based bioprocess with powerful
mammalian expression technology will further enhance the use of P. patens as a
complementary and competitive platform for the biopharmaceutical manufacturing of
protein therapeutics and establishes this evolutionary old and simple plant as a
valuable host for synthetic biology.
Material and Methods
Expression vector design. Table 3 lists all plasmids used in this study and
provides detailed information about their construction.
Table 3. Expression vectors designed and used in this study
Plasmid Description Reference or Source
pEF4/Myc-His
Mammalian expression vector containing PhEF1!. Invitrogen
pSEAP2-Basic
Mammalian SEAP expression vector. Clontech
pCF292 (pTRIDENT37)
PSV40-driven tricistronic expression vector. (I-CeuI)-PSV40-(I-SceI)-SAMY-IRESPV-VEGF121-IRESRbm3-SEAP-(I-PpoI)-apA-(PI-PspI).
Fux et al. 2004
pCF297 (pTRIDENT36)
PSV40-driven tricistronic expression vector. (I-CeuI)-PSV40-(I-SceI)-SAMY-IRESPV-VEGF121-IRESEMCV-SEAP-(I-PpoI)-apA-(PI-PspI).
Fux et al. 2004
pMF208 Streptogramin-repressible SEAP expression vector. PPIR3-SEAP-pA
Fussenegger et al. 2000
pMF242 PhCMV-driven EPO expression vector. PhCMV-EPO-pA Fussenegger et al. 2000
pMG31 PSV40-driven SEAP expression vector. The PIP-specific This work
Chapter I ___________________________________________________________________________
46
operator was excised from pMF208 (HindIII/EcoRI), and the Klenow-polished vector backbone was religated. PSV40-SEAP-pA.
pMG32 PhEF1!-driven SEAP expression vector. PhEF1! was excised from pEF4/Myc-His (NruI/EcoRI) and cloned into pSEAP2-Basic (Clontech) (NruI/EcoRI). PhEF1!-SEAP-pA.
This work
pMG40 (pTRIDENT45)
PhCMV-driven tricistronic expression vector. PhCMV was PCR-amplified from pSS173 using oligonucleotides OMG23/OMG24 and cloned (I-CeuI/I-SceI) into pCF297. (I-CeuI)-PhCMV-(I-SceI)-SAMY-IRESPV-VEGF121-IRESEMCV-SEAP-(I-PpoI)-apA-(PI-PspI).
This work
pMG41 (pTRIDENT46)
PhCMV-driven tricistronic expression vector. PhCMV was PCR-amplified from pSS173 using oligonucleotides OMG23/OMG24 and cloned (I-CeuI/I-SceI) into pCF292. (I-CeuI)-PhCMV-(I-SceI)-SAMY-IRESPV-VEGF121-IRESRbm3-SEAP-(I-PpoI)-apA-(PI-PspI).
This work
pMG42 (pTRIDENT47)
PhCMV-driven tricistronic expression vector. PhCMV was PCR-amplified from pSS173 using oligonucleotides OMG23 (5´ gatcgacgtctaactataac-ggtcctaaggtagcgaTAGTAATCAATTACGGGGTCATTAGTTCATAGC 3´) and OMG24 (5´ gatcgaattcattaccctgttatccctaCTGACGGTTCAC-TAAACCAGCTCTGC 3´) and cloned (I-CeuI/I-SceI) into pMG43. (I-CeuI)-PhCMV-(I-SceI)-SAMY-IRESPV-VEGF121-IRESPV-SEAP-(I-PpoI)-apA-(PI-PspI). (Upper case, annealing sequence, lower case italic I-CeuI and I-SceI for OMG23 and OMG24 respectively)
This work
pMG43 PSV40-driven expression vector. IRESPV was excised from pSAM241 (AscI/SpeI) and cloned into pCF292. (I-CeuI)-PSV40-(I-SceI)-SAMY-IRESPV-VEGF121-IRESPV-SEAP-(I-PpoI)-apA-(PI-PspI).
This work
pMG60 PGTX-driven AMY expression vector. AMY was excised from pSS188 (HindIII/XbaI) and cloned into pSH17 (HindIII/XbaI). PGTX-AMY-pA.
This work
pMG61 PGTX-driven EPO expression vector. EPO was excised from pMF242 (EcoRI/XbaI) and cloned into pSH17 (EcoRI/XbaI). PGTX-EPO-pA
This work
pMG65
PCaMV35S-driven SEAP expression vector. SEAP was PCR-amplified from pSH17 using OMG53 (5´ ccgctcgagggcccaccATGCTGCTGCT-GCTGCTGCTG 3´) and OMG54 (5´ ttgctctagagctcagtggtgatggtgatga-tgTGTCTGCTCGAAGCGGCCGGCCGCCCCGACCCTAGAGTAAC 3´) and cloned XhoI/XbaI into pRT101neo. PCaMV35S-SEAP-his-pA. (Upper case, annealing sequence; lower case italic, restriction enzymes)
This work
pMG66 PCaMV35S-driven SAMY expression vector. SAMY was PCR-amplified from pSH102 using OMG55 (5´ ccgctcgagggcccaccATGGAGA-CAGACACACTCCTG 3´) and OMG56 (5´ ttgctctagagctcagtggt-gatggtgatgatgAGGCCATGCCACCAACCGTGGTTCG 3´)
This work
Chapter I ___________________________________________________________________________
47
and cloned XhoI/XbaI into pRT101neo. PCaMV35S-SAMY-his-pA.
pMG67 PCaMV35S-driven AMY expression vector. AMY was PCR-amplified from pMG60 using OMG57 (5´ ccgctcgagggcccaccATGGCCGCACCGTTT-AACGGC 3´) and OMG58 (5´ ttgctctagagctcagtggtgatggtgatgatgAGG-CCATGCCACCAACCGTGGTTCGGTCC 3´) and cloned XhoI/XbaI into pRT101neo. PCaMV35S-AMY-his-pA
This work
pMG68 PCaMV35S-driven VEGF expression vector. VEGF was PCR-amplified from pSH100 using OMG59 (5´ ccgctcgagggcccaccATGAACTTTCT-GCTGTCTTGG 3´) and OMG60 (5´ ttgctctagagctcagtggtgatggtgatgatg-CCGCCTCGGCTTGTCACATTTTTCTTGTCTTGC 3´) and cloned XhoI/XbaI into pRT101neo. PCaMV35S-VEGF-his-pA
This work
pMG69 PCaMV35S-driven EPO expression vector. EPO was PCR-amplified from pMG61 using OMG61 (5´ ccgctcgagggcccaccATGGGGGTGCCCGA-ACGTCCCACCC 3´) and OMG62 (5´ ttgctctagagctcagtggtgatggtgat-gatgCCTGTCCCCTCTCCTGCAGACC 3´) and cloned XhoI/XbaI into pRT101neo. PCaMV35S-EPO-his-pA
This work
pRT101neo PCaMV35S -driven expression vector for plant cells, carrying the nptII cassette for neomycin resistance. PCaMV35S-nptII-pA (pA, 35s-Terminator).
Huether et al. 2005
pSAM241 (pTFT1)
PhCMV*-1-driven tricistronic expression vector. PhCMV*-1-ECFP-IRESPV-RFP-IRESPV-EYFP-pA.
Moser et al. 2000
pSH3 (pTRIDENT42)
PAIR-driven tricistronic expression vector. (I-CeuI)-PAIR-(I-SceI)-SAMY-IRESPV-VEGF121-IRESEMCV-SEAP-(I-PpoI)-apA-(PI-PspI).
Hartenbach et al. 2005
pSH12 VEGF121-encoding control vector. IRESPV-VEGF121-pA Hartenbach and Fussenegger 2006
pSH17 PGTX-driven expression vector. PGTX-SEAP-pA. Hartenbach and Fussenegger 2006
pSH28 (pAutoRex8)
Autoregulated acetaldehyde-inducible tricistronic expression vector. (I-CeuI)-PAIR-(I-SceI)-SEAP-IRESPV-alcR-(I-PpoI)-apA-(PI-PspI).
Hartenbach et al. 2005
pSH49 SEAP-encoding control vector. SEAP was excised from pSS173 (EcoRI/NotI) and cloned into pSH12 (EcoRI/NotI). IRESPV-SEAP-pA.
Unpublished
pSH100 PGTX-driven VEGF121 expression vector. PGTX-VEGF121-pA. Hartenbach and Fussenegger 2006
pSH102 PGTX-driven SAMY expression vector. PGTX-SAMY-pA. Hartenbach and Fussenegger
Chapter I ___________________________________________________________________________
48
2006 pSS173 PhCMV-driven SEAP expression vector. PhCMV-SEAP-pA. Schlatter et al.
2002 pSS188 PhCMV-driven AMY expression vector. PhCMV-AMY-pA. Schlatter et al.
2002 pWW35 PSV40-driven expression vector encoding the macrolide-
dependent transactivator ET1. PSV40-ET1-pA; ET1, E-VP16. Weber et al. 2002
pWW37 Erythromycin-repressible, PETR2-driven SEAP expression vector. PETR2-SEAP-pA.
Weber et al. 2002
pWW43 PSV40-driven expression vector encoding the macrolide-dependent transrepressor ET4. PSV40-ET4-pA; ET4, E-KRAB.
Weber et al. 2002
pWW56 Erythromycin-inducible, PETRON8-driven SEAP expression vector. PETRON8-SEAP-pA.
Weber et al. 2002
pWW122 PSV40-driven expression vector encoding the butyrolactone-dependent transactivator SCA. PSV40-SCA-pA; SCA, scbR-VP16.
Weber et al. 2003
pWW124 Butyrolactone-repressible, PSPA-driven SEAP expression vector. PSPA-SEAP-pA.
Weber et al. 2003
pWW162 Butyrolactone-inducible, PSCAON8-driven SEAP expression vector. PSCAON8-SEAP-pA.
Weber et al. 2005
pWW504 PSV40-driven expression vector encoding the butyrolactone-dependent transrepressor SCS. PSV40-SCS-pA, SCS, scbR-KRAB.
Weber et al. 2005
pWW192 Acetaldehyde-inducible, PAIR-driven SEAP expression vector. PAIR-SEAP-pA.
Weber et al. 2004
pWW195 PSV40-driven alcR expression vector. PSV40-alcR-pA. Weber et al. 2004
Abbreviations: alcR, Aspergillus nidulans acetaldehyde-dependent transactivator (1521bp); AMY, Bacillus stearothermophilus-derived #-amylase (1551bp); apA, artificial polyadenylation site (91bp); E, E.coli-derived macrolide-dependent repressor (585bp); ECFP, enhanced cyan fluorescent protein (720bp); EPO, human erythropoietin (579bp); ET1, macrolide-dependent transactivator (E-VP16) (972bp); ET4, macrolide-dependent transrepressor (E-KRAB) (1044bp); EYFP, enhanced yellow fluorescent protein (720bp); IRESEMCV, encephalomyocarditis virus internal ribosome entry site (502bp); IRESPV, poliovirus internal ribosome entry site (635bp); IRESRbm3, internal ribosome entry site derived from the human RNA-binding motif protein 3 (Rbm3) (732bp); KRAB, human kruppel-associated box protein (450bp); NptII, neomycin phosphotransferase II (921bp); pA, polyadenylation site (145bp); PAIR, acetaldehyde-responsive promoter (456bp); PCaMV35S, cauliflower mosaic virus 35s promoter (384bp); PETR2, erythromycin-repressible promoter (200bp); PETRON8, erythromycin-inducible promoter (530bp); PGTX, synthetic promoter derived from the GTX homeodomain protein (182bp); PhCMV, human cytomegalovirus immediate early promoter (663bp); PhCMV*-1, tetracycline-responsive promoter (156bp); PhEF1!, human elongation factor 1# promoter (1185bp); PIP, pristinamycin-induced protein (867bp); PPIR3, streptogramin-repressible promoter (534bp); PSCAON8, butyrolactone-inducible promoter (576bp); PSPA, butyrolactone-repressible promoter (194bp); PSV40, simian virus 40 promoter (308bp); RFP, red fluorescent protein;
Chapter I ___________________________________________________________________________
49
SAMY, Bacillus stearothermophilus-derived secreted #-amylase (1611bp); SCA, butyrolactone-dependent transactivator (ScbR-VP16) (1035bp); scbR, Streptomyces coelicolor butyrolactone-dependent repressor (648bp); SEAP, human placental secreted alkaline phosphatase (1560bp); VEGF121, human vascular endothelial growth factor 121 (444bp); VP16, Herpes simplex virus-derived transactivation domain (387bp).
Cultivation and transformation of P. patens. P. patens (Hedw.) B.S.G. was
grown axenically in Erlenmeyer flasks or modified stirred-tank bioreactors (5L,
Applikon, Schiedam, The Netherlands) using a 10% modified Knop salt solution
(100mg/L Ca(NO3)2$4H2O, 25mg/L KCl, 25mg/L KH2PO4, 25mg/L MgSO4$7H2O
and 1.25mg/L FeSO4$7H2O; pH5.8) (Reski and Abel, 1985). Protoplasts of P. patens
were generated by incubation for 2h in 0.5M mannitol containing 4% Driselase
(Sigma, Buchs, Switzerland), followed by two centrifugation steps (10min, 50xg) and
resuspension of the protoplast-containing pellet at a desired cell density in 3M-
medium (87.5g/L mannitol, 3.1g/L MgCl2$6H2O, 1g/L MES (2-(N-
morpholino)ethansulfonic acid hydrate; Sigma); pH5.6 and 580mOsm). 300,000
protoplasts were chemically transfected with 50!g/ml DNA (80!g/ml for transgene
control systems) as previously described (Jost et al., 2005) and cultivated in Knop’s
regeneration medium (1g/l Ca(NO3)2$4H2O, 250mg/l KCl, 250mg/l KH2PO4, 250mg/l
MgSO4$7H2O, 12.5 mg/l FeSO4$7H2O, 5% glucose, 3% mannitol, pH 5.7, 540mOsm).
Protein production. Protein production was measured five days after
transformation using standardized assays: (i) human placental secreted alkaline
phosphatase (SEAP), a p-nitrophenylphosphate-based light-absorbance time course
(Berger et al., 1988; Schlatter et al., 2002); (ii) Bacillus stearothermophilus-derived
secreted (SAMY) and intracellular (AMY) !-amylase, a blue starch Phadebas® assay
(Pharmacia Upjohn, Peapack, NJ, cat. no. 10-5380-32) (Schlatter et al., 2002);
quantification of intracellular reporter proteins required lysis of the plant cells by four
freeze-thaw cycles and elimination of cell debris by centrifugation (2min at 12000 g);
(iii) human vascular endothelial growth factor 121 (VEGF121), using a VEGF121-
specific ELISA (Peprotech, Rocky Hill, NJ, USA, cat. no. 900-K10, lot. no.
1006010); (iv) human erythropoietin (EPO), using an EPO-specific ELISA
Chapter I ___________________________________________________________________________
50
(Quantikine® IVD®; R&D Systems, Minneapolis, MN, USA, cat. no. DEP00, lot. no.
243030).
Transgene regulation. All regulating agents were administered at indicated
concentrations immediately after transformation. The butyrolactone 2-(1’-hydroxy-6-
methylheptyl)-3-(hydroxymethyl)-butanolide (SCB1) was synthesized and purified as
described previously (Weber et al., 2003). Erythromycin (cat. no. 45673, lot. no.
1195447; Fluka, Buchs, Switzerland) was prepared as a stock solution of 1mg/ml in
ethanol. The AIR system was induced by the addition of indicated volumes of 100%
ethanol.
Microencapsulation of P. patens protoplasts. 4x107 protoplasts generated
from transgenic VEGF121-producing moss tWT11.51VEGF (Baur et al., 2005b) were re-
suspended in 8ml 3M-medium and stirred gently with 40ml 1.5% sodium-alginate
solution (Inotech Biotechnologies Ltd, Basel, Switzerland, cat. no. IE1010, lot. no.
060125B1). Protoplasts were encapsulated in 500µm alginate capsules (165
protoplasts per capsule) using an Inotech Encapsulator Research IE-50R (Inotech
Biotechnologies Ltd, Basel, Switzerland) set at the following parameters: 0.5mm
nozzle, 853unit flow rate using a 50ml syringe, 1250s-1 nozzle vibration frequency,
1.4kV for bead dispersion. W5 medium (18.4g/l CaCl2, 8g/l NaCl2, 0.99g/l Glucose,
0.75g/l KCl; pH5.8, 600mOsm) was used as a precipitation solution. It contains
sufficient CaCl2 for precipitation of alginate beads and enables direct cultivation of
microencapsulated protoplast populations without the need for a medium exchange.
Microencapsulated tWT11.51VEGF (high expressing P.patens plant containing the
VEGF121-encoding cDNA under the control of the moss actin 5 5´ region) protoplasts
(240.000 capsules, 1L W5 medium) were cultivated in a BioWave 20SPS-F bioreactor
(Wave Biotech, Tagelswangen, Switzerland), equipped with 2L Wave Bags and set at
the following parameters: aeration, 100ml/min sterilized air; rocking rate, 19 min-1;
rocking angle, 10º. The Wave Bioreactor was placed in an ISF-1-W incubator
equipped with a photosynthesis kit set to 25°C and a day/night cycle of 16/8h
(Kuehner, Birsfelden, Switzerland).
Edman sequencing. VEGF121 was precipitated from tWT11.51VEGF protoplast
culture supernatants for 10 min at 4°C with 100% w/v trichloroacetic acid (TCA,
Chapter I ___________________________________________________________________________
51
Sigma) (supernatant: TCA 9 : 1). The samples were centrifuged for 5 min at 12000 g,
and the VEGF121-containing pellet was washed twice in ice-cold acetone, dried and
resuspended in 2 x sodium dodecylsulphate-polyacrylamide gel electrophoresis (SDS-
PAGE) reducing sample buffer [50% glycerol, 250 mM
tris(hydroxymethyl)aminomethane (Tris), 10% SDS, 500 mM dithiothreitol, 0.01%
bromophenol blue, pH 6.8]. The samples were then denatured for 5 min at 50 °C, and
the proteins were size-fractionated on a 12% SDS-polyacrylamide gel and blotted on
to a polyvinylidene fluoride membrane (cat. no. IPVH20200; Millipore Corporation,
Bedford, MA, USA). VEGF121 (35 kDa) was N-terminally sequenced on an Applied
Biosystems (Foster City, CA, USA) model 492cLC Procise protein/peptide sequencer
with an on-line Perkin-Elmer (Waltham, MA, USA) Applied Biosystems Model 140C
PTH Amino Acid (Phenylthiohydantoin amino acid) Analyser. The PTH amino acids
were automatically transferred to a reverse-phase C-18 column (0.8 mm inside
diameter) for detection at 269 nm, and identified by comparison with individual runs
with a standard mixture of PTH amino acids.
Cultivation of Saccharomyces cerevisiae and Streptomyces coelicolor. S.
cerevisiae (wild type strain W303, BMA 64, European S. cerevisiae archive for
functional analysis [EUROSCARF], Frankfurt, Germany) was cultivated on yeast-
peptone-dextrose agar (YPD; 1% yeast extract, 2% peptone, 2% dextrose, 1% agar)
and Streptomyces coelicolor MT1110 (kindly provided by Marc Folcher) was
cultivated on mannitol-soy agar (2% soy flour, 2% mannitol, 1.5% agar). For co-
cultivation of S. coelicolor and P. patens, Streptomyces were pre-cultured in Luria
Bertani (LB) medium to an OD600 of 340 and indicated volumes were then transferred
to P. patens maintained in regeneration medium.
Viability profiling of microencapsulated P. patens protoplasts. Viability of
microencapsulated moss protoplasts was determined by scoring live protoplasts,
stained with fluorescein diacetate (FDA), and dead protoplasts, stained with trypan
blue using (fluorescence) microscopy (Leica DM-RB fluorescence microscope; Leica
Heerbrugg, Switzerland). 20 protoplast-containing alginate beads were incubated for
10 min in a staining solution containing 200!l W5 medium, 20!l phosphate-buffered
saline (PBS, Dulbecco’s Phosphate-Buffered Saline, Invitrogen, Basel, Switzerland,
Chapter I ___________________________________________________________________________
52
cat. no. 21600-0069) containing 0.01% FDA (Sigma) and 40!l of a 0.4% trypan blue
stock solution (Flucka, Buchs, Switzerland; lot. No. 1230532).
Acknowledgements
We thank Wilfried Weber, Eva Decker and Marcel Tigges for productive
discussions, Dr. Gilbert Gorr, Greenovation Biotech GmbH, for the P. patens strain
tWT11.51VEGF used in this study, Peter Hunzicker, Functional Genomics Center
Zurich, for the help with the Edman sequencing, and Domenick Grasso and Wilfried
Weber for critical comments of the manuscript. This work was supported by the Swiss
National Science Foundation (grant no. 3100AO-112549) and the Excellence
Initiative of the German Federal and State Governments (EXC 294).
Chapter I ___________________________________________________________________________
53
References
Baur A, Kaufmann F, Rolli H, Weise A, Luethje R, Berg B, Braun M, Baeumer W,
Kietzmann M, Reski R and Gorr G (2005a) A fast and flexible PEG-mediated
transient expression system in plants for high level expression of secreted
recombinant proteins. J. Biotechnol. 119:332-342.
Baur A, Reski R and Gorr G (2005b) Enhanced recovery of a secreted recombinant human
growth factor using stabilizing additives and by co-expression of human serum
albumin in the moss Physcomitrella patens. Plant Biotechnol. J. 3:331-340.
Benghezal M, Fauvarque MO, Tournebize R, Froquet R, Marchetti A, Bergeret E, Lardy B,
Klein G, Sansonetti P, Charette SJ and Cosson P (2006) Specific host genes required
for the killing of Klebsiella bacteria by phagocytes. Cell. Microbial. 8:139-148.
Benner SA and Sismour AM (2005) Synthetic biology. Nature. Rev. Genet. 6:533-543.
Berger J, Hauber J, Hauber R, Geiger R and Cullen BR (1988) Secreted placental alkaline
phosphatase: a powerful new quantitative indicator of gene expression in eukaryotic
cells. Gene 66:1-10.
Caddick MX, Greenland AJ, Jepson I, Krause KP, Qu N, Riddell KV, Salter MG, Schuch W,
Sonnewald U and Tomsett AB (1998) An ethanol inducible gene switch for plants
used to manipulate carbon metabolism. Nat. Biotechnol. 16:177-180.
Chappell SA and Mauro VP (2003) The internal ribosome entry site (IRES) contained within
the RNA-binding motif protein 3 (Rbm3) mRNA is composed of functionally distinct
elements. J. Biol. Chem. 278:33793-33800.
Chappell SA, Owens GC and Mauro VP (2001) A 5’ Leader of Rbm3, a cold stress-induced
mRNA, mediates internal initiation of translation with increased efficiency under
conditions of mild hypothermia. J. Biol. Chem. 276, 36 917-36 922.
Decker, EL and Reski, R (2007) Moss bioreactors producing improved biopharmaceuticals.
Curr. Opin. Biotechnol. 18:393-398.
Dirks W, Wirth M and Hauser H (1993) Dicistronic transcription units for gene expression in
mammalian cells. Gene 128:247-249.
Frank W, Baar KM, Qudeimat E, Woriedh M, Alawady A, Ratnadewi D, Gremillon L,
Grimm B and Reski R (2007) A mitochondrial protein homologous to the mammalian
peripheral-type benzodiazepine receptor is essential for stress adaptation in plants.
Plant J. 51:1004-1018.
Chapter I ___________________________________________________________________________
54
Frank W, Decker EL and Reski R (2005) Molecular tools to study Physcomitrella patens.
Plant Biology 7:220-227.
Frey AD, Rimann M, Bailey JE, Kallio PT, Thompson CJ and Fussenegger M (2001) Novel
pristinamycin-responsive expression systems for plant cells. Biotechnol. Bioeng.
74:154-163.
Fussenegger M and Hauser H (2007) Protein expression by engineering of yeast, plant and
animal cells. Curr. Opin. Biotechnol. 18:385-386.
Fussenegger M, Morris RP, Fux C, Rimann M, von Stockar B, Thompson CJ, and Bailley JE
(2000) Streptogramin-based gene regulation systems for mammalian cells. Nat.
Biotechnol. 18, 1203-1208.
Fussenegger M, Schlatter S, Datwyler D, Mazur X and Bailey JE (1998) Controlled
proliferation by multigene metabolic engineering enhances the productivity of
Chinese hamster ovary cells. Nat. Biotechnol. 16:468-472.
Fux C, Langer D, Kelm JM, Weber W and Fussenegger M (2004) New-generation
multicistronic expression platform: pTRIDENT vectors containing size-optimized
IRES elements enable homing endonuclease-based cistron swapping into lentiviral
expression vectors. Biotechnol. Bioeng. 86:174-187.
Gan W and Rhoads RE (1996) Internal initiation of translation directed by the 5'-untranslated
region of the mRNA for eIF4G, a factor involved in the picornavirus-induced switch
from cap-dependent to internal initiation. Journal Biol. Chem. 271:623-626.
Georgiou G and Segatori L (2005) Preparative expression of secreted proteins in bacteria:
status report and future prospects. Curr. Opin. Biotechnol. 16:538-545.
Gersbach CA, Le Doux JM, Guldberg RE and Garcia AJ (2006) Inducible regulation of
Runx2-stimulated osteogenesis. Gene Ther. 13:873-882.
Gossen M and Bujard H (1992) Tight control of gene expression in mammalian cells by
tetracycline-responsive promoters. Proc. Natl. Acad. Sci. USA 89:5547-5551.
Haldankar R, Li D, Saremi Z, Baikalov C and Deshpande R (2006) Serum-free suspension
large-scale transient transfection of CHO cells in WAVE bioreactors. Mol.
Biotechnol. 34:191-199.
Hamilton SR, Davidson RC, Sethuraman N, Nett JH, Jiang Y, Rios S, Bobrowicz P,
Stadheim TA, Li H, Choi BK, Hopkins D, Wischnewski H, Roser J, Mitchell T,
Strawbridge RR, Hoopes J, Wildt S and Gerngross TU (2006) Humanization of yeast
to produce complex terminally sialylated glycoproteins. Science 313:1441-1443.
Chapter I ___________________________________________________________________________
55
Hartenbach S and Fussenegger M (2005) Autoregulated, bidirectional and multicistronic gas-
inducible mammalian as well as lentiviral expression vectors. J. Biotechnol 120:83-
98.
Hartenbach S and Fussenegger M (2006) A novel synthetic mammalian promoter derived
from an internal ribosome entry site. Biotechnol. Bioeng. 95:547-559.
Huether CM, Lienhart O, Baur A, Stemmer C, Gorr G, Reski R and Decker EL (2005)
Glyco-engineering of moss lacking plant-specific sugar residues. Plant Biol. 7:292-
299.
Jost W, Link S, Horstmann V, Decker EL, Reski R and Gorr G (2005) Isolation and
characterisation of three moss-derived beta-tubulin promoters suitable for
recombinant expression. Current Genetics 47:111-120.
Kamisugi Y, Schlink K, Rensing SA, Schween G, von Stackelberg M, Cuming AC, Reski R
and Cove DJ (2006) The mechanism of gene targeting in Physcomitrella patens:
homologous recombination, concatenation and multiple integration. Nucleic Acids
Res. 34:6205-6214.
Kaufman RJ, Davies MV, Wasley LC and Michnick D (1991) Improved vectors for stable
expression of foreign genes in mammalian cells by use of the untranslated leader
sequence from EMC virus. Nucleic Acids Res. 19:4485-4490.
Keller L and Surette MG (2006) Communication in bacteria: an ecological and evolutionary
perspective. Nat. Rev. Microbiol. 4:249-258.
Khandelwal A, Chandu D, Roe CM, Kopan R and Quatrano RS (2007) Moonlighting activity
of presenilin in plants is independent of gamma-secretase and evolutionarily
conserved. Proc. Natl. Acad. Sci. USA 104:13337-13342.
Kozak M (1989) The scanning model for translation: an update. Journal Cell Biol. 108:229-
241.
Kramer BP and Fussenegger M (2005) Hysteresis in a synthetic mammalian gene network.
Proc. Natl. Acad. Sci. USA 102:9517-9522.
Larrick JW and Thomas DW (2001) Producing proteins in transgenic plants and animals.
Curr. Opin. Biotechnol. 12:411-418.
Malleret G, Haditsch U, Genoux D, Jones MW, Bliss TV, Vanhoose AM, Weitlauf C, Kandel
ER, Winder DG and Mansuy IM (2001) Inducible and reversible enhancement of
learning, memory, and long-term potentiation by genetic inhibition of calcineurin.
Cell 104:675-686.
Chapter I ___________________________________________________________________________
56
Mayfield SP, Franklin SE and Lerner RA (2003) Expression and assembly of a fully active
antibody in algae. Proc. Natl. Acad. Sci. USA 100:438-442.
Moosmann P, Georgiev O, Thiesen HJ, Hagmann M and Schaffner W (1997) Silencing of
RNA polymerases II and III-dependent transcription by the KRAB protein domain of
KOX1, a Kruppel-type zinc finger factor. Biol. Chem. 378:669-677.
Moser S, Schlatter S, Fux C, Rimann M, Bailey JE and Fussenegger M (2000) An update of
pTRIDENT multicistronic expression vectors: pTRIDENTs containing novel
streptogramin-responsive promoters. Biotechnol. Progress 16:724-735.
Nechansky A, Schuster M, Jost W, Siegl P, Wiederkum S, Gorr G and Kircheis R (2007)
Compensation of endogenous IgG mediated inhibition of antibody-dependent cellular
cytotoxicity by glyco-engineering of therapeutic antibodies. Mol. Immunol. 44:1815-
1817.
Niwa H, Miyazaki J and Smith AG (2000) Quantitative expression of Oct-3/4 defines
differentiation, dedifferentiation or self-renewal of ES cells. Nat. Genet. 24:372-376.
Pestova TV, Kolupaeva VG, Lomakin IB, Pilipenko EV, Shatsky IN, Agol VI and Hellen CU
(2001) Molecular mechanisms of translation initiation in eukaryotes. Proc. Natl.
Acad. Sci. USA 98:7029-7036.
Quatrano RS, McDaniel SF, Khandelwal A, Perroud PF and Cove DJ (2007) Physcomitrella
patens: mosses enter the genomic age. Curr. Opin. Plant Biol. 10:182-189.
Rensing SA, Lang D, Zimmer AD, Terry A, Salamov A, Shapiro H, Nishiyama T, Perroud
PF, Lindquist EA, Kamisugi Y, Tanahashi T, Sakakibara K, Fujita T, Oishi K, Shin
IT, Kuroki Y, Toyoda A, Suzuki Y, Hashimoto SI, Yamaguchi K, Sugano S, Kohara
Y, Fujiyama A, Anterola A, Aoki S, Ashton N, Barbazuk WB, Barker E, Bennetzen
JL, Blankenship R, Cho SH, Dutcher SK, Estelle M, Fawcett JA, Gundlach H,
Hanada K, Heyl A, Hicks KA, Hughes J, Lohr M, Mayer K, Melkozernov A, Murata
T, Nelson DR, Pils B, Prigge M, Reiss B, Renner T, Rombauts S, Rushton PJ,
Sanderfoot A, Schween G, Shiu SH, Stueber K, Theodoulou FL, Tu H, Van de Peer
Y, Verrier PJ, Waters E, Wood A, Yang L, Cove D, Cuming AC, Hasebe M, Lucas S,
Mishler BD, Reski R, Grigoriev IV, Quatrano RS and Boore JL (2008) The
Physcomitrella Genome Reveals Evolutionary Insights into the Conquest of Land by
Plants. Science 8: 319
Reski R and Abel WO (1985) Induction of Budding on Chloronemata and Caulonemata of
the Moss, Physcomitrella patens, Using Isopentenyladenine. Planta 165:354-358.
Chapter I ___________________________________________________________________________
57
Roslan HA, Salter MG, Wood CD, White MR, Croft KP, Robson F, Coupland G, Doonan J,
Laufs P, Tomsett AB and Caddick MX (2001) Characterization of the ethanol-
inducible alc gene-expression system in Arabidopsis thaliana. Plant J. 28:225-235.
Saidi Y, Finka A, Chakhporanian M, Zryd JP, Schaefer DG and Goloubinoff P (2005)
Controlled expression of recombinant proteins in Physcomitrella patens by a
conditional heat-shock promoter: A tool for plant research and biotechnology. Plant
Mol. Biol. 59:697-711.
Schlatter S, Rimann M, Kelm J and Fussenegger M (2002) SAMY, a novel mammalian
reporter gene derived from Bacillus stearothermophilus alpha-amylase. Gene 282:19-
31.
Sweetman JP, Chu C, Qu N, Greenland AJ, Sonnewald U and Jepson I (2002) Ethanol vapor
is an efficient inducer of the alc gene expression system in model and crop plant
species. Plant Physiol. 129:943-948.
Umana P, Jean-Mairet J, Moudry R, Amstutz H and Bailey JE (1999) Engineered glycoforms
of an antineuroblastoma IgG1 with optimized antibody-dependent cellular cytotoxic
activity. Nat. Biotechnol. 17:176-180.
Weber W, Daoud-El Baba M and Fussenegger M (2007) Synthetic ecosystems based on
airborne inter- and intrakingdom communication. Proc. Natl. Acad. Sci. USA
104:10435-10440.
Weber W and Fussenegger M (2007) Inducible product gene expression technology tailored
to bioprocess engineering. Curr. Opin. Biotechnol. 18:399-410.
Weber W, Fux C, Daoud-el Baba M, Keller B, Weber CC, Kramer BP, Heinzen C, Aubel D,
Bailey JE and Fussenegger M (2002) Macrolide-based transgene control in
mammalian cells and mice. Nat. Biotechnol. 20:901-907.
Weber W, Schoenmakers R, Keller B, Gitzinger M, Grau T, El-Baba MD, Sander P and
Fussenegger M (2008) A synthetic mammalian gene circuit reveals antituberculosis
compounds. Proc. Natl. Acad. Sci. USA, 105, 9994-9998.
Weber W, Malphettes L, de Jesus M, Schoenmakers R, El-Baba MD, Spielmann M, Keller B,
Weber CC, van de Wetering P, Aubel D, Wurm FM and Fussenegger M (2005)
Engineered Streptomyces quorum-sensing components enable inducible siRNA-
mediated translation control in mammalian cells and adjustable transcription control
in mice. J. Gene Med. 7:518-525.
Chapter I ___________________________________________________________________________
58
Weber W, Rimann M, Spielmann M, Keller B, Daoud-El Baba M, Aubel D, Weber CC and
Fussenegger M (2004) Gas-inducible transgene expression in mammalian cells and
mice. Nat. Biotechnol. 22:1440-1444.
Weber W, Schoenmakers R, Spielmann M, El-Baba MD, Folcher M, Keller B, Weber CC,
Link N, van de Wetering P, Heinzen C, Jolivet B, Sequin U, Aubel D, Thompson CJ
and Fussenegger M (2003) Streptomyces-derived quorum-sensing systems engineered
for adjustable transgene expression in mammalian cells and mice. Nucleic Acids Res.
31: 71.
Wurm FM (2004) Production of recombinant protein therapeutics in cultivated mammalian
cells. Nat. Biotechnol. 22:1393-1398.
Yamamoto YY, Ichida H, Abe T, Suzuki Y, Sugano S and Obokata J (2007) Differentiation
of core promoter architecture between plants and mammals revealed by LDSS
analysis. Nucleic Acids Res. 35:6219-6226.
Chapter II ___________________________________________________________________________
59
Chapter II
Controlling Transgene Expression In Subcutaneous Implants Using A Skin
Lotion Containing The Apple Metabolite Phloretin
Marc Gitzinger, Christian Kemmer, Marie Daoud El-Baba, Wilfried Weber and
Martin Fussenegger
Proceedings of the National Academy of Sciences USA. 2009 106: 10638-
10643
Chapter II ___________________________________________________________________________
60
Abstract
Adjustable control of therapeutic transgenes in engineered cell implants
following transdermal and topical delivery of non-toxic trigger molecules would
increase convenience, patient compliance and elimination of hepatic first-pass effect
in future therapies. Pseudomonas putida DOT-T1E has evolved flavonoid-triggered
TtgR operon which controls expression of a multisubstrate-specific efflux pump
(TtgABC) to resist plant-derived defense metabolites in its rhizosphere habitat. Taking
advantage of the TtgR operon, we have engineered a hybrid P. putida-mammalian
genetic unit responsive to phloretin. This flavonoid is contained in apples and, as
such, or as dietary supplement, regularly consumed by humans. The engineered
mammalian phloretin-adjustable control element (PEACE) enabled adjustable and
reversible transgene expression in different mammalian cell lines and primary cells.
Due to the low half-life of phloretin in culture PEACE could also be used to program
expression of difficult-to-produce protein therapeutics during standard bioreactor
operation. When formulated in skin lotions and applied to the skin of mice harboring
transgenic cell implants, phloretin was able to fine-tune target genes and adjust
heterologous protein levels in the bloodstream of treated mice. PEACE-controlled
target gene expression could foster advances in biopharmaceutical manufacturing as
well as gene- and cell-based therapies.
Introduction
Synthetic mammalian expression systems which enable reversible and
adjustable transgene expression have been essential for recent advances in (i)
functional genomic research (1), (ii) drug discovery (2, 3), (iii) manufacturing of
difficult-to-produce protein therapeutics (4, 5), (iv) the design of synthetic gene
networks replicas reaching the complexity of electronic circuits (6-9) and gene
therapy applications (10-12).
To date, a multitude of heterologous transgene expression systems, for use in
mammalian cells and transgenic animals, have been described (4). The prevailing
design consists of a heterologous small molecule-responsive transactivator engineered
Chapter II ___________________________________________________________________________
61
by fusing a prokaryotic repressor to a eukaryotic transactivation domain and a
transactivator-specific promoter containing the matching prokaryotic operator linked
to a minimal eukaryotic promoter. Inducer-triggered modulation of the
transactivator’s affinity to its cognate promoter results in adjustable and reversible
transcription control of the specific target gene (13-16). In recent years, a panoply of
such heterologous transcription control modalities have been developed which are
responsive to a variety of inducer molecules such as antibiotics (13, 14, 17), steroid
hormones and their analogs (18, 19), quorum-sensing molecules (20, 21),
immunosuppressive and anti-diabetic drugs (22, 23), biotin (24), L-arginine (25) as
well as volatile acetaldehyde (16). Apart from gaseous acetaldehyde which can simply
be inhaled, all other inducers need to be either taken up orally or be administered by
injection in any future gene therapy application. Transdermal and topical delivery of
inducer molecules, which would provide advantages over conventional injection-
based or oral administration such as convenience, improved patient compliance and
elimination of hepatic first-pass effect, have not yet been developed.
Phloretin is mainly found in the root bark of apple trees and in apples where it
acts as a natural antibacterial plant defense metabolite (26). Phloretin has been studied
as a possible penetration enhancer for skin-based drug delivery (27-31), attenuates
inflammation by antagonizing prostaglandins (32), protects the skin from UV light-
induced photodamage (33, 34) and is currently evaluated as a chemopreventive agent
for cancer treatment (35). Since the plant rhizosphere is one of the natural habitats of
Pseudomonas putida (strain DOT-T1E), this prokaryote has evolved the RND family
transporter TtgABC with multidrug recognition properties which is controlled by its
cognate repressor TtgR binding to a specific operator, (OTtgR) in the TtgR promoter
(PTtgR). Phloretin has been shown to bind to the TtgR-operator complex at a
stoichiometric ratio of one effector molecule per TtgR-dimer and to release TtgR from
OTtgR which results in induction of TtgABC production and effective pump-mediated
efflux of the flavonoid from P. putida (26, 36).
Capitalizing on the phloretin-responsive TtgR-OTtgR interaction of P. putida
DOT-T1E we have assembled a synthetic mammalian phloretin-adjustable control
element (PEACE), which was able to reversibly adjust product gene expression of
Chapter II ___________________________________________________________________________
62
transgenic cells grown in culture, standard bioreactors or implanted into mice
following addition of pure phloretin or topical administration of a phloretin-containing
skin lotion.
Results
Design of a synthetic mammalian phloretin-adjustable control element
(PEACE). With a half-life of 70h in culture and no negative influence on viability,
growth or production of CHO-K1 cells, phloretin is a valid flavonoid candidate for
trigger-inducible transcription control in mammalian cells !supporting information
(SI) Text and Fig.S1". Living in the plant rhizosphere, Pseudomonas putida DOT-T1E
has evolved resistance to a variety of plant-derived antimicrobials (37, 38) which is
triggered by phloretin-induced release of TtgR from the operator (OTtgR) of its target
promoter and subsequent induction of a broadly specific TtgABC efflux pump (26,
36). By fusing TtgR (36) to the Herpes simplex-derived transactivation domain VP16
(39) we created a synthetic mammalian transactivator (TtgA1), which is able to bind
and activate transcription from chimeric promoters (PTtgR1) harboring OTtgR linked to a
minimal human cytomegalovirus immediate early promoter (PhCMVmin), in a phloretin-
responsive manner (Fig. 1A and B). Co-transfection of the constitutive TtgA1
expression vector pMG11 (PSV40-TtgA1-pA) and pMG10 (PTtgR1-SEAP-pA) encoding
a TtgA1-specific PTtgR1-driven SEAP expression unit, resulted in high-level SEAP
expression (23.6±3.1U/L), which compares with an isogenic vector containing a
constitutive PSV40-driven SEAP expression cassette (pSEAP2-Control; 21.4±1.0U/L).
Addition of increasing concentrations of phloretin (0-70µM) to a culture of pMG10-
and pMG11-co-transfected CHO-K1 cells resulted in dose-dependent reduction of
SEAP expression up to complete repression (Fig. 1C). These data suggest that
PEACE-controlled transgene expression is adjustable and enables complete repression
within a non-toxic phloretin concentration range. We have also designed PTtgR1
variants with different tandem OTtgR modules and TtgA1 variants harboring various
transactivation domains and provide a detailed combinatorial performance analysis in
different cell lines and different expression configurations including auto-regulated
Chapter II ___________________________________________________________________________
63
that are known to be essential for the assembly of complex synthetic gene networks
(6, 9, 40) (SI Materials and Methods, Fig. S2 and S3, Table S1).
Fig. 1. Design and functionality of phloretin-adjustable control element (PEACE). The Pseudomonas putida DOT-T1E-derived bacterial repressor TtgR was fused to the VP16 transactivation domain of Herpes simplex virus and the resulting transactivator TtgA1 (TtgR-VP16) was cloned under control of the constitutive simian virus 40 promoter (PSV40) (pMG11). The phloretin-responsive promoter (PTtgR1; OTtgR-PhCMVmin) contains a chimeric TtgR-specific operator sequence (OTtgR, CAGTATTTACAAACAACCATGAATGTA
Chapter II ___________________________________________________________________________
64
AGTATATTC; TtgR binding sites in italic), which is located 5' of a minimal human cytomegalovirus immediate early promoter (PhCMVmin) and was set to drive expression of the human placental secreted alkaline phosphatase (SEAP) (pMG10). (A) ON status; TtgA1 is constitutively expressed and binds to PTtgR1 in the absence of phloretin thereby inducing SEAP expression. (B) OFF status; Addition of phloretin releases TtgA1, from PTtgR1, which switches SEAP expression off. (C) SEAP expression profiles of CHO-K1 transiently transfected with pMG11 (PSV40-TtgA1-pA) and pMG10 (PTtgR1-SEAP-pA) and cultivated for 48h in the presence of different phloretin concentrations (0-70µM).
PEACE control by phloretin and other flavonoids. Since TtgR of P. putida
was shown to bind several plant-derived flavonoids with high affinity (26) we profiled
their PEACE-controlling capacities in mammalian cells. CHO-K1 were transiently
(co-)transfected with either pMG10 (PTtgR1-SEAP-pA) and pMG11 (PSV40-TtgA1-pA),
to score regulation performance, or with pSEAP2-Control (PSV40-SEAP-pA), to assess
compound-related cytotoxicity, and then cultivated for 48h in medium containing
different concentrations (0, 25, 50#M) of specific flavonoids (berberine, butylparaben,
genistein, luteolin, !-naphthol, naringenin, phloretin, phloridzin or quercetin) before
SEAP production was profiled (Fig. 2A). Whereas genistein, luteolin, !-naphthol,
naringenin and quercetine were cytotoxic within the tested concentration range
(genistein only at 50!M) berberine, butylparaben, phloridzin and phloretin did not
reduce cell viability. However, berberine failed to control PEACE and butylparaben as
well as phloridzin were able to regulate but not fully repress SEAP production (Fig.
2B). Therefore, phloretin which enabled maximum expression levels as well as full
transgene repression was chosen as the ideal PEACE inducer for all further
experiments.
Phloretin-controlled transgene expression is functional in different
mammalian cell lines and human primary cells. To assess its versatility we tested
PEACE in several immortalized mammalian cell lines as well as in human primary
cells. Therefore, pMG10 (PTtgR1-SEAP-pA) and pMG11 (PSV40-TtgA1-pA) were co-
transfected into BHK-21, COS-7, HaCaT, HEK-293, HT-1080 and NIH/3T3 cell lines
as well as into primary human fibroblasts and keratinocytes, and cultivated for 48h in
the presence (50!M) and absence of phloretin, followed by scoring of SEAP levels
Chapter II ___________________________________________________________________________
65
(Table 1). PEACE-controlled transgene expression was functional in all tested cell
lines suggesting that this technology will be broadly applicable.
Fig. 2. PEACE responsiveness to different flavonoids. (A) CHO-K1 cells transiently expressing all PEACE components (pMG10 and pMG11) were cultivated in the presence of different flavonoids and SEAP expression was profiled after 48h. (B) Toxicity of flavonoids. CHO-K1 were transiently transfected with pSEAP2-Control, cultivated in medium supplemented with different flavonoids (0, 25, 50#M) SEAP levels were scored after 48h. Table 1: PEACE-controlled transgene expression in different mammalian cells
Cell Line 0 µµM Phloretin 50 µµM Phloretin BHK-21 14.4 ± 0.4 U/L 1.5 ± 0.2 U/L
0
5
10
15
20
25
30
35
Berberi
ne
Butylpa
raben
Genist
ein
Luteo
lin
-Nap
hthol
Naring
enin
Phloret
in
Phlorid
zin
Querce
tin
SE
AP
Pro
duct
ion
(U/L
) PEACE-system
0 µM 25 µM 50 µM
A
0
5
10
15
20
25
30
35
Berberi
ne
Butylpa
raben
Genist
ein
Luteo
lin
-Nap
hthol
Naring
enin
Phloret
in
Phlorid
zin
Querce
tin
SE
AP
Pro
duct
ion
(U/L
)
Constitutive SEAP 0 µM 25 µM 50 µM
B
Chapter II ___________________________________________________________________________
66
COS-7 1.3 ± 0.02 U/L *
HaCaT 0.9 ± 0.03 U/L *
HEK-293 27.3 ± 0.8 U/L 0.2 ± 0.04 U/L
HT-1080 7.8 ± 0.2 U/L *
NIH/3T3 8.5 ± 0.3 U/L *
Primary human fibroblasts 1.0 ± 0.04 U/L *
Primary human keratinocytes 1.5 ± 0.05 U/L *
SEAP production was quantified 48h after co-transfection pMG10 (PTtgR1-SEAP-pA) and pMG11 (PSV40-TtgA1-pA) into indicated cell lines and primary cells. *Undetectable
Expression kinetics, adjustability and reversibility of PEACE-controlled
transgene expression in a stable transgenic CHO-K1 cell line. We have generated
5 double-transgenic cell lines (CHO-PEACE) by sequential transfection and clonal
selection of pMG11 and pMG10 into CHO-K1. All of these PEACE-transgenic cell
lines showed phloretin-regulated SEAP expression but differed in their overall
regulation performance (maximum and leaky expression levels) as a result of
differences in transgene copy number and integrations sites which remains beyond
control using standard transfection technology (41) (Fig. S4). CHO-PEACE8, which
was considered the best cell line and was therefore used in all follow-up experiments,
showed (i) unchanged maximum SEAP expression levels and unaffected regulation
performance in long-term cultures over 60 days (day 0, ON, 70.9±3.1U/L, OFF,
1.8±0.1U/L; day 60, ON, 67.6±2.7U/L, OFF, 2.1±0.2U/L; OFF at 50!M phloretin),
(ii) excellent adjustability (Fig. 3A), (iii) exponential SEAP expression kinetics (Fig.
3B), (iv) full reversibility of transgene expression (Fig. 3C) and (v) optimal
compatibility with other transgene regulation systems (SI Materials and Methods and
Table S2 A and B).
Chapter II ___________________________________________________________________________
67
Fig. 3. Design and characterization of the stable CHO-PEACE8 cell line transgenic for phloretin-responsive SEAP expression. (A) Dose-response profile of CHO-PEACE8. (B) SEAP expression kinetics of CHO-PEACE8 cultivated for 72h in the presence and absence of
A
0
10
20
30
40
50
60
70
80
0 5 10 15 20 25 30 40 50 60 70
SE
AP
Pro
duct
ion
(U/L
)
Phloretin (µM)
CHO-PEACE8
(µ )
0
20
40
60
80
100
120
140
0 10 20 30 40 50 60 70 80
SE
AP
Pro
duct
ion
(U/L
)
Time (h)
- Phloretin + Phloretin
B
0
10
20
30
40
50
60
70
80
90
0 20 40 60 80 100 120 140
SE
AP
Pro
duct
ion
(U/L
)
Time (h)
- +
C + - Phl. Phl. - Phl. - + Phl. Phl. + Phl.
Chapter II ___________________________________________________________________________
68
50!M phloretin. (C) Reversibility of CHO-PEACE8-based SEAP production. 2x105 CHO-PEACE8 were cultivated for 144h in the presence or absence of 50!M phloretin. Every 48h the cell density was readjusted to 2x105 and the phloretin status of the culture was reversed.
Time-delayed induction of product gene expression in a prototype
biopharmaceutical manufacturing scenario. Since phloretin is a non-toxic fruit
component, it could be an ideal product gene inducer for biopharmaceutical
manufacturing scenarios which require precise timing or dosing of difficult-to-express
protein pharmaceuticals (4, 42-44). Also, since phloretin has a determined half-live of
70h in mammalian cell culture systems (SI Results) any production culture can be
programmed to start product gene expression at a predefined point in time as phloretin
concentrations drop below a repressing threshold level. We have inoculated a 1L
BioWave® bioreactor with 2x103 CHO-PEACE8 and different transgene-repressing
phloretin doses of 60, 80 or 100µM. While CHO-PEACE8 grew exponentially from
the start of the bioprocess, SEAP production gradually increased once phloretin was
degraded to non-repressive levels (40µM; Fig. 4). Using PEACE mammalian
production cultures could indeed be programmed for timely induction of product gene
expression without any process intervention.
Fig. 4. Automatically programmed product gene expression in bioreactors using well-defined phloretin degradation profiles. 2x103 cells/mL CHO-PEACE8 were cultivated in a bioreactor containing 1L culture medium supplemented with either 60, 80 or 100µM phloretin and SEAP production was profiled for 211h. Owing to a defined phloretin degradation profile in
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
0
20
40
60
80
100
120
140
160
180
200
0 50 100 150 200
SEAP
Pro
duct
ion
(U/L
)
Time (h)
Phloretin (60µM) Phloretin (80µM) Phloretin (100µM) Phloretin degradation (60µM) Phloretin degradation (80µM) Phloretin degradation (100µM) Cell Number
Viab
le C
ells
Mill.
/mL
Chapter II ___________________________________________________________________________
69
culture and a precise induction threshold of 40!M phloretin, the onset of SEAP production can be programmed to occur at a very precise point in time by defining the cell density and the phloretin concentration at production start.
Phloretin-mediated transdermal gene expression in subcutaneous implants
in mice. Since phloretin has been suggested as a penetration enhancer for transdermal
drug delivery (27-31) and was shown to propagate systemically in rodents following
local skin-based administration (28), we have evaluated phloretin as a potential
transdermal therapeutic transgene expression inducer. Therefore, we have
microencapsulated CHO-PEACE8 in coherent alginate-PLL-alginate capsules and
implanted them subcutaneously into mice. The back of treated mice was partially
shaved and vaseline-based skin lotions (200µL) containing different amounts of
phloretin (0-42mg) were put on every day. The SEAP levels detected in treated mice
72h after implantation showed phloretin-dependent dose-response characteristics akin
to the ones observed with the same microencapsulated implant batch cultivated and
exposed to phloretin in vitro (Fig. 5A and B). Control mice receiving CHO-K1 cells
transgenic for constitutive SEAP expression were insensitive to any treatment with
phloretin-containing skin lotion (0mg phloretin: 6.2±0.43U/L; 42mg phloretin:
6.02±0.58U/L).
Chapter II ___________________________________________________________________________
70
Fig. 5. PEACE-controlled transgene expression in mice. (A) Microencapsulated CHO-PEACE8 were implanted subcutaneously into female OF1 mice (2x106 cells/mouse). 200!L of a cream containing different amounts of phloretin (0, 5.25, 10.5, 21 and 42mg) was applied to a shaved skin area near the implant site. SEAP serum levels were quantified 72h post implantation. (B) SEAP expression profiles of the microencapsulated CHO-PEACE8
implant batch cultivated in vitro for 72h at different phloretin concentrations.
Discussion
Flavonoids such as phloretin are polyphenols widely distributed in the plant
kingdom and are present in fruits and vegetables regularly consumed by humans. The
recent findings that phloretin and some of its derivatives have potent anti-
inflammatory (32), antioxidative (33, 45) and even some anti-cancer (35, 46) activities
form the scientific basis for the common saying “an apple a day keeps the doctor
0
2
4
6
8
10
12
14
0 5.25 10.5 21 42
SE
AP
Pro
duct
ion
(U/L
)
Phloretin within applied skin lotion (mg)
A
0
20
40
60
80
100
120
140
0 10 20 30 40 50
SE
AP
Pro
duct
ion
(U/L
)
Phloretin (µM)
B
Chapter II ___________________________________________________________________________
71
away”. Phloretin has also been successfully evaluated as a penetration enhancer for
transdermal drug delivery (27-31) and as skin protectant reducing oxidative stress
resulting from external insults, such as UV irradiation which triggers skin cancer and
photo aging (33, 34, 47). Recent studies in rodents have confirmed that dermal
administration of phloretin will systemically spread in the animal (28) and that
phloretin has a rather short half-life in vivo (48). All of the aforementioned
characteristics corroborate phloretin to be a non-toxic natural compound with high
metabolic turnover, which could be ideal for reversible transdermal induction of
therapeutic transgenes. Transdermal and topical delivery of drugs and regulating
molecules provide advantages over conventional oral or injection-based
administrations, such as convenience, improved patient compliance and elimination of
hepatic first-pass effect. However, most molecules are not applicable to dermal
administration due to the excellent barrier properties of the skin which requires
penetrating molecules to pass the stratum corneum with its compact keratinized cell
layers and the viable epidermis before reaching the papillary dermis and crossing the
capillary walls into systemic circulation. Phloretin-containing skin lotions put on the
skin of mice containing cell implants harboring a synthetic phloretin-responsive
expression system were able to precisely fine-tune target gene expression in the
animal. This pioneering transdermal transcription control system may enable precise
patient-controlled dosing of protein pharmaceuticals that are produced in situ by cell
implants contained in clinically licensed devices (49-52). There should be no risk of
nutrition-based interference of PEACE-controlled therapeutic transgene expression in
transgenic cell implants since a patient (70kg) would need to eat over 2000 apples to
reach PEACE-modulating phloretin levels in his bloodstream (48, 53). Besides this
gene therapy-focused in-vivo scope of phloretin-responsive transgene expression the
system showed excellent regulation performance including adjustability and
reversibility in vitro. Owing to its short half-life in culture, phloretin-responsive
production cultures grown in bioreactors could be pre-programmed for timely
production initiation by inoculation with excessive phloretin concentrations. While the
production cell cultures grow and phloretin levels decrease following precise kinetics,
production will be initiated at a defined point in time, which is a function of the
Chapter II ___________________________________________________________________________
72
inoculum and the initial phloretin concentration. Such a time-delayed production
concepts would be particularly valuable for difficult-to-express protein therapeutics
like those, which impair growth or are cytotoxic (4,42-44). The fact that phloretin is a
natural fruit component regularly consumed by humans and licensed for use in skin
lotions (34) may facilitate approval of such biopharmaceutical manufacturing
protocols by governmental agencies. Also, since the PEACE system has been
assembled following a standard binary transactivator/promoter design it is conceivable
that its performance can easily be adapted to specific control requirements using an
established refinement program (54, 55).
Considering all facts, the pioneering phloretin-based transgene control
technology is unique and may foster advances in the production of difficult-to-express
protein pharmaceuticals as well as in cell implant-based therapeutic applications.
Material and Methods
Expression vector design. pMG10 (PTtgR1-SEAP-pA) harbors a phloretin-
reponsive SEAP expression unit and pMG11 (PSV40-TtgA1-pA) encodes constitutive
expression of the phloretin-dependent transactivator. Detailed information on
expression vector design and plasmids used in this study is provided in SI Table S3.
Cell culture and transfection. Wild-type Chinese hamster ovary cells (CHO-
K1, ATCC: CCL-61) and their derivatives were cultivated in standard medium:
ChoMaster® HTS (Cell Culture Technologies, Gravesano, Switzerland) supplemented
with 5% (v/v) fetal calf serum (FCS, PAN Biotech GmbH, Aidenbach, Germany, Cat.
No. 3302, Lot No. P251110) and 1% (v/v) penicillin/streptomycin solution (Sigma, St
Louis, MO, USA, Cat. No. P4458). Human embryonic kidney cells (HEK-293, (56)),
African green monkey kidney cells (COS-7, ATCC: CRL-1651), baby hamster kidney
cells (BHK-21, ATCC: CCL10), human fibrosarcoma cells (HT-1080, ATCC: CCL-
121), the human keratinocyte cell line HaCaT (57) and mouse fibroblasts (NIH/3T3,
ATCC: CRL-1658) were cultured in Dulbecco’s modified Eagle’s medium (DMEM;
Invitrogen, Cat. No. 52100-39) supplemented with 10% FCS (v/v) and 1% (v/v)
penicillin/streptomycin solution. Primary human foreskin fibroblasts were cultivated
in DMEM supplemented with 20% FCS (v/v) and 1% (v/v) penicillin/streptomycin
Chapter II ___________________________________________________________________________
73
solution and primary human foreskin keratinocytes were cultured in chemically
defined serum-free keratinocyte medium (Invitrogen, Cat. No. 10744019) (all kindly
provided by Sabine Werner). All cell types were cultivated at 37°C in a 5% CO2-
containing humidified atmosphere. For transient transfection of CHO-K1, 1µg of total
plasmid DNA (for co-transfection an equal amount of each plasmid) was transfected
into 50,000 cells per well of a 24-well plate according to an optimized calcium
phosphate protocol, which resulted in typcal transfection efficiencies of 35±5% (58).
Plasmid DNA was diluted to a total volume of 25µL 0.5M CaCl2 solution, which was
mixed with 25µL 2x HBS solution (50mM HEPES, 280mM NaCl, 1.5mM Na2HPO4,
pH7.1). After incubation for 15min at room temperature, the precipitates were
immediately added to the well and centrifuged onto the cells (5min at 1,200xg) to
increase transfection efficiency. After 3h, the cells were treated with 0.5mL glycerol
solution (ChoMaster® HTS medium containing 15% glycerol) for 60s. After washing
once with phosphate-buffered saline (PBS, Dulbecco’s Phosphate-Buffered Saline;
Invitrogen, Cat. No. 21600-0069), cells were cultivated in 0.5mL standard
ChoMaster® HTS medium in the presence or absence of different concentrations of
phloretin. For transfection of BHK-21, COS-7 and HEK-293, plasmid DNA-
Ca3(PO4)2 precipitate was prepared and applied to the cells as described above. HEK-
293 and COS-7 cells were washed once with PBS after 3h incubation with the DNA-
Ca3(PO4)2 precipitate and subsequently cultivated in standard DMEM, while BHK-21
cells were incubated overnight with the precipitates and then cultivated in DMEM
medium after being washed once with PBS. HaCaT, HT-1080, NIH/3T3 as well as
primary human fibroblasts and keratinocytes were transfected with Fugene" 6
(Roche Diagnostics AG, Basel, Switzerland, Cat. No. 11814443001) according to the
manufacturer’s protocol and cultivated in the cell culture medium specified above.
After transfection, all cells were cultivated in DMEM supplemented with different
concentrations of phloretin and reporter protein levels were profiled 48h after
transfection, unless otherwise indicated.
Construction of stable cell lines. The stable CHO-PEACE8 cell line,
transgenic for phloretin-controlled SEAP expression, was constructed in two steps: (i)
CHO-K1 cells were co-transfected with pMG11 (PSV40-TtgA1-pA) and pSV2neo
Chapter II ___________________________________________________________________________
74
(Clontech, Cat. No. 6172-1) at a ratio of 20:1 and clonal selection resulted in the cell
line CHO-TtgA. (ii) CHO-TtgA was co-transfected with pMG10 (PTtgR1-SEAP-pA)
and pPur (Clontech, Cat. No. 6156-1) (ratio of 20:1) and the phloretin-responsive
SEAP-producing double-transgenic cell line CHO-PEACE8 was chosen after clonal
selection. Phloretin-dependent dose-response characteristics of CHO-PEACE8 were
analyzed by culturing 100,000 cells/mL for 48h in standard ChoMaster® HTS medium
at different phloretin concentrations ranging from 0 to 70µM. Reversibility of
phloretin-mediated SEAP production was assessed by cultivating CHO-PEACE8
(100,000 cells/mL) for 144h while alternating phloretin concentrations from 0 to
50µM every 48h.
Quantification of reporter protein production. Production of the human
placental secreted alkaline phosphatase (SEAP) was quantified using a p-
nitrophenylphosphate-based light absorbance time course (59).
In vivo methods. CHO-PEACE8 and CHO-SEAP18 (60) were encapsulated in
alginate-poly-(L-lysine)-alginate beads (400µm; 200 cells/capsule) using an Inotech
Encapsulator Research IE-50R (Recipharm, Basel, Switzerland) according to the
manufacturer’s instructions and the following parameters: 0.2mm nozzle, 20mL
syringe at a flow rate of 405 units, nozzle vibration frequency of 1024Hz and 900V
for bead dispersion. The back of female OF1 mice (oncins France souche 1, Charles
River Laboratories, France) was shaved and 300µL of ChoMaster® HTS containing
2x106 encapsulated CHO-PEACE8 were subcutaneously injected. Control mice were
injected with microencapsulated CHO-K1. Shaving ensured direct contact of the
phloretin-containing cream with the skin of the animal. One hour after implantation
200µL of the phloretin-containing cream was applied to the skin around the injection
site. The phloretin amounts in creams ranged from 0 to 42mg. The cream was applied
once a day for up to three days. Thereafter, the mice were sacrificed, blood samples
collected and SEAP levels were quantified in the serum which was isolated using
microtainer SST tube according to the manufacturer’s instructions (Beckton
Dickinson, Plymouth, UK). All the experiments involving mice were performed
according to the directives of the European Community Council (86/609/EEC),
Chapter II ___________________________________________________________________________
75
approved by the French Republic (No. 69266310) and performed by Marie Daoud El-
Baba at the Université de Lyon, F-69622 Lyon, France.
Bioreactor operation. CHO-PEACE8 (inoculum of 2x103 cells/mL) were
cultivated in a BioWave 20SPS-F bioreactor (Wave Biotech AG, Tagelswangen,
Switzerland) equipped with a 2L Wave Bag® optimized for optical pH and DO
(dissolved oxygen concentration) control of the 1L culture. The bioreactor was
operated at a rocking rate of 15min-1, a rocking angle of 6° and an aeration rate of
100mL/min with inlet gas humidification (HumiCare® 200, Gruendler Medical,
Freudenstadt, Germany) to prevent evaporation of the medium. The medium
(ChoMaster® HTS, 5% FCS, 1% penicillin/streptomycin) was supplemented with 60,
80 or 100µM phloretin.
Inducer compounds and formulation of the skin lotion. Berberine (Acros,
Geel, Belgium, Cat. No. 20425-0100) and luteolin (Alfa Aesar, Karlsruhe, Germany,
Cat. No. L14186) were prepared as 10mM stock solutions in 1:5 (v/v) DMSO/H2O.
Butylparaben (ABCR, Karlsruhe, Germany, Cat. No. AV14043), genistein (Axonlab,
Baden, Switzerland, Cat. No. A2202.0050), !-naphthol (Sigma, Cat. No. 185507),
naringenin (Sigma, Cat. No. N5893), phloretin (Sigma, Cat. No. P7912), phloridzin
(Sigma, Cat. No. P3449) and quercetin (Sigma, Cat. No. Q0125) were prepared as
50mM stock solution in DMSO and were used at a final concentration of 50µM unless
indicated otherwise. The vaseline-based phloretin-containing creams were
professionally formulated (Pharmacy Hoengg Ltd., Zurich, Switzerland) and
contained 25, 12.5, 6.25 and 3.125% (wt/wt) of phloretin. 200!l skin lotion were
topically applied per mouse and treatment which corresponds to a respective total
phloretin amount per dose of 42, 21, 10.5 and 5.25mg.
In order to quantify phloretin in cell culture medium, the samples were added
to 5x104 CHO-PEACE8 and incubated for 48h prior to SEAP quantification. Phloretin
levels were calculated by comparing SEAP production with a calibration curve (Fig.
3A), established using the same parameters and defined phloretin concentrations.
Similarly, the half-live of phloretin was estimated based on the degradation dynamics
observed in cell culture (61, 62).
Chapter II ___________________________________________________________________________
76
Acknowledgements. We thank Martine Gilet for skilled technical assistance,
Sabine Werner (Swiss Federal Institute of Technology Zurich, Zurich, Switzerland)
for providing primary human fibroblasts and keratinocytes and Marcia Schoenberg,
Marcel Tigges and William Bacchus for critical comments on the manuscript. This
work was supported by the Swiss National Science Foundation (grant no. 3100A0-
112549) and in part by the EC Framework Program 7 (PERSIST).
Chapter II ___________________________________________________________________________
77
References 1. Baumgartel K, et al. (2008) Control of the establishment of aversive memory by
calcineurin and Zif268. Nat Neurosci 11(5):572-578.
2. Sharpless NE, Depinho RA (2006) The mighty mouse: genetically engineered mouse
models in cancer drug development. Nat Rev Drug Discov 5(9):741-754.
3. Weber W, et al. (2008) A synthetic mammalian gene circuit reveals antituberculosis
compounds. Proc Natl Acad Sci USA 105(29):9994-9998.
4. Weber W, Fussenegger M (2007) Inducible product gene expression technology
tailored to bioprocess engineering. Curr Opin Biotechnol 18(5):399-410.
5. Ulmer JB, Valley U, Rappuoli R (2006) Vaccine manufacturing: challenges and
solutions. Nat Biotechnol 24(11):1377-1383.
6. Kramer BP, Fussenegger M (2005) Hysteresis in a synthetic mammalian gene
network. Proc Natl Acad Sci USA 102(27):9517-9522.
7. Deans TL, Cantor CR, Collins JJ (2007) A tunable genetic switch based on RNAi and
repressor proteins for regulating gene expression in mammalian cells. Cell
130(2):363-372.
8. Weber W, Daoud-El Baba M, Fussenegger M (2007) Synthetic ecosystems based on
airborne inter- and intrakingdom communication. Proc Natl Acad Sci USA
104(25):10435-10440.
9. Tigges M, Marquez-Lago TT, Stelling J, Fussenegger M (2009) A tunable synthetic
mammalian oscillator. Nature 457(7227):309-312.
10. Gersbach CA, Le Doux JM, Guldberg RE, Garcia AJ (2006) Inducible regulation of
Runx2-stimulated osteogenesis. Gene Ther 13(11):873-882.
11. McLoughlin JM, et al. (2005) TNFerade, an adenovector carrying the transgene for
human tumor necrosis factor alpha, for patients with advanced solid tumors: surgical
experience and long-term follow-up. Ann Surg Oncol 12(10):825-830.
12. Weber W, Fussenegger M (2006) Pharmacologic transgene control systems for gene
therapy. J Gene Med 8(5):535-556.
13. Fussenegger M, et al. (2000) Streptogramin-based gene regulation systems for
mammalian cells. Nat Biotechnol 18(11):1203-1208.
14. Gossen M, et al. (1995) Transcriptional activation by tetracyclines in mammalian
cells. Science 268(5218):1766-1769.
Chapter II ___________________________________________________________________________
78
15. Urlinger S, et al. (2000) The p65 domain from NF-kappaB is an efficient human
activator in the tetracycline-regulatable gene expression system. Gene 247(1-2):103-
110.
16. Weber W, et al. (2004) Gas-inducible transgene expression in mammalian cells and
mice. Nat Biotechnol 22(11):1440-1444.
17. Weber W, et al. (2002) Macrolide-based transgene control in mammalian cells and
mice. Nat Biotechnol 20(9):901-907.
18. Nordstrom JL (2002) Antiprogestin-controllable transgene regulation in vivo. Curr
Opin Biotechnol 13(5):453-458.
19. Palli SR, Kapitskaya MZ, Potter DW (2005) The influence of heterodimer partner
ultraspiracle/retinoid X receptor on the function of ecdysone receptor. Febs J
272(23):5979-5990.
20. Neddermann P, et al. (2003) A novel, inducible, eukaryotic gene expression system
based on the quorum-sensing transcription factor TraR. EMBO Rep 4(2):159-165.
21. Weber W, Link N, Fussenegger M (2006) A genetic redox sensor for mammalian
cells. Metab Eng 8(3):273-280.
22. Pollock R, Clackson T (2002) Dimerizer-regulated gene expression. Curr Opin
Biotechnol 13(5):459-467.
23. Rollins CT, et al. (2000) A ligand-reversible dimerization system for controlling
protein-protein interactions. Proc Natl Acad Sci USA 97(13):7096-7101.
24. Weber W, Bacchus W, Daoud-El Baba M, Fussenegger M (2007) Vitamin H-
regulated transgene expression in mammalian cells. Nucleic Acids Res 35(17):e116.
25. Hartenbach S, Daoud-El Baba M, Weber W, Fussenegger M (2007) An engineered L-
arginine sensor of Chlamydia pneumoniae enables arginine-adjustable transcription
control in mammalian cells and mice. Nucleic Acids Res 35(20):e136.
26. Teran W, Krell T, Ramos JL, Gallegos MT (2006) Effector-repressor interactions,
binding of a single effector molecule to the operator-bound TtgR homodimer
mediates derepression. J Biol Chem 281(11):7102-7109.
27. Akimoto T, Kawahara K, Nagase Y, Aoyagi T (2001) Polymeric transdermal drug
penetration enhancer. The enhancing effect of oligodimethylsiloxane containing a
glucopyranosyl end group. J Control Release 77(1-2):49-57.
28. Auner BG, Valenta C, Hadgraft J (2003) Influence of phloretin and 6-ketocholestanol
on the skin permeation of sodium-fluorescein. J Control Release 89(2):321-328.
Chapter II ___________________________________________________________________________
79
29. Auner BG, Valenta C, Hadgraft J (2003) Influence of lipophilic counter-ions in
combination with phloretin and 6-ketocholestanol on the skin permeation of 5-
aminolevulinic acid. Int J Pharm 255(1-2):109-116.
30. Valenta C, Cladera J, O'Shea P, Hadgraft J (2001) Effect of phloretin on the
percutaneous absorption of lignocaine across human skin. J Pharm Sci 90(4):485-492.
31. Valenta C, Nowak M, Hadgraft J (2001) Influence of phloretin and 6-ketocholestanol
on the permeation of progesterone through porcine skin. Int J Pharm 217(1-2):79-86.
32. Blazso G, Gabor M (1995) Effects of prostaglandin antagonist phloretin derivatives
on mouse ear edema induced with different skin irritants. Prostaglandins 50(3):161-
168.
33. Auner BG, Wirth M, Valenta C (2005) Antioxidative activity and cytotoxicity of four
different flavonoids for dermal applications. Journal of Drug Delivery Science and
Technology 15(3):227-232.
34. Oresajo C, et al. (2008) Protective effects of a topical antioxidant mixture containing
vitamin C, ferulic acid, and phloretin against ultraviolet-induced photodamage in
human skin. J Cosmet Dermatol 7(4):290-297.
35. Wu CH, et al. (2009) In vitro and in vivo study of phloretin-induced apoptosis in
human liver cancer cells involving inhibition of type II glucose transporter. Int J
Cancer 124(9):2210-2219.
36. Teran W, et al. (2003) Antibiotic-dependent induction of Pseudomonas putida DOT-
T1E TtgABC efflux pump is mediated by the drug binding repressor TtgR.
Antimicrob Agents Chemother 47(10):3067-3072.
37. Ramos JL, Duque E, Huertas MJ, Haidour A (1995) Isolation and expansion of the
catabolic potential of a Pseudomonas putida strain able to grow in the presence of
high concentrations of aromatic hydrocarbons. J Bacteriol 177(14):3911-3916.
38. Rojas A, et al. (2001) Three efflux pumps are required to provide efficient tolerance
to toluene in Pseudomonas putida DOT-T1E. J Bacteriol 183(13):3967-3973.
39. Triezenberg SJ, Kingsbury RC, McKnight SL (1988) Functional dissection of VP16,
the trans-activator of herpes simplex virus immediate early gene expression. Genes
Dev 2(6):718-729.
40. Becskei A, Kaufmann BB, van Oudenaarden A (2005) Contributions of low molecule
number and chromosomal positioning to stochastic gene expression. Nat Genet
37(9):937-944.
Chapter II ___________________________________________________________________________
80
41. Wurm FM (2004) Production of recombinant protein therapeutics in cultivated
mammalian cells. Nat Biotechnol 22(11):1393-1398
42. Weber W, et al. (2007) A synthetic time-delay circuit in mammalian cells and mice.
Proc Natl Acad Sci USA 104(8):2643-2648.
43. Boorsma M, et al. (2000) A temperature-regulated replicon-based DNA expression
system. Nat Biotechnol 18(4):429-432.
44. Fussenegger M, Schlatter S, Datwyler D, Mazur X, Bailey JE (1998) Controlled
proliferation by multigene metabolic engineering enhances the productivity of
Chinese hamster ovary cells. Nat Biotechnol 16(5):468-472.
45. Middleton E, Jr., Kandaswami C, Theoharides TC (2000) The effects of plant
flavonoids on mammalian cells: implications for inflammation, heart disease, and
cancer. Pharmacol Rev 52(4):673-751.
46. Kobori M, Iwashita K, Shinmoto H, Tsushida T (1999) Phloretin-induced apoptosis in
B16 melanoma 4A5 cells and HL60 human leukemia cells. Biosci Biotechnol
Biochem 63(4):719-725.
47. Hollman PC, Katan MB (1999) Dietary flavonoids: intake, health effects and
bioavailability. Food Chem Toxicol 37(9-10):937-942.
48. Crespy V, et al. (2001) Bioavailability of phloretin and phloridzin in rats. J Nutr
131(12):3227-3230.
49. Edelstein ML, Abedi MR, Wixon J (2007) Gene therapy clinical trials worldwide to
2007--an update. J Gene Med 9(10):833-842
50. Drury JL, Mooney DJ (2003) Hydrogels for tissue engineering: scaffold design
variables and applications. Biomaterials 24(24):4337-4351.
51. Ehrbar M, Schoenmakers R, Christen EH, Fussenegger M, Weber W (2008) Drug-
sensing hydrogels for the inducible release of biopharmaceuticals. Nat Mater
7(10):800-804.
52. Kelm JM, Fussenegger M (2004) Microscale tissue engineering using gravity-
enforced cell assembly. Trends Biotechnol 22(4):195-202.
53. Tsao R, Yang R, Young JC, Zhu H (2003) Polyphenolic profiles in eight apple
cultivars using high-performance liquid chromatography (HPLC). J Agric Food Chem
51(21):6347-6353.
54. Mullick A, et al. (2006) The cumate gene-switch: a system for regulated expression in
mammalian cells. BMC Biotechnol 6:43.
Chapter II ___________________________________________________________________________
81
55. Weber W, Fussenegger M (2009) Engineering of synthetic mammalian gene
networks. Chem Biol 16(3):287-297.
56. Mitta B, et al. (2002) Advanced modular self-inactivating lentiviral expression
vectors for multigene interventions in mammalian cells and in vivo transduction.
Nucleic Acids Res 30(21):e113.
57. Boukamp P, et al. (1988) Normal keratinization in a spontaneously immortalized
aneuploid human keratinocyte cell line. J Cell Biol 106(3):761-771.
58. Greber D, Fussenegger M (2007) Multi-gene engineering: simultaneous expression
and knockdown of six genes off a single platform. Biotechnol Bioeng 96(5):821-834.
59. Schlatter S, Rimann M, Kelm J, Fussenegger M (2002) SAMY, a novel mammalian
reporter gene derived from Bacillus stearothermophilus alpha-amylase. Gene 282(1-
2):19-31.
60. Fluri DA, Kemmer C, Daoud-El Baba M, Fussenegger M (2008) A novel system for
trigger-controlled drug release from polymer capsules. J Control Release 131(3):211-
219.
61. Aubel D, et al. (2001) Design of a novel mammalian screening system for the
detection of bioavailable, non-cytotoxic streptogramin antibiotics. J Antibiot (Tokyo)
54(1):44-55.
62. Weber CC, et al. (2005) Broad-spectrum protein biosensors for class-specific
detection of antibiotics. Biotechnol Bioeng 89(1):9-17.
Chapter II ___________________________________________________________________________
82
Supporting Information: Results
Stability and impact of phloretin on mammalian cell cultures. To evaluate
the stability of phloretin in culture medium and assess its impact on mammalian cells,
we have supplemented standard ChoMaster® HTS medium with increasing
concentrations of phloretin (0, 25, 50, 75, 100µM) and incubated this medium in the
presence and absence of CHO-K1 engineered for constitutive SEAP expression
(pSEAP2-Control; PSV40-SEAP-pA, Clontech). The SEAP levels in samples taken
from the cultures after 48h indicated that phloretin had no negative impact on
heterologous protein production which is an indicator for metabolic integrity and
viability (1). Parallel scoring of viable cell density confirmed that the apple flavonoid
did not compromise CHO-K1 proliferation up to 100µM (Fig. S1). Phloretin levels
determined over a period of 64h in cell-free culture medium established a functional
half-live of 70h for this flavonoid.
Fig. S1. Impact of phloretin on cell proliferation and protein production. CHO-K1 engineered for constitutive SEAP expression were cultivated in culture medium supplemented with different phloretin concentrations (0-100 µM) and SEAP production (bars) as well as maximum cell density were assessed after 48h (line).
Engineering and validation of different phloretin-dependent
transactivator variants. Previous studies have suggested that transactivators
equipped with different transactivation domains can influence the overall regulation
0
2
4
6
8
10
12
14
0
5
10
15
20
25
30
0 25 50 75 100
Cel
l Den
sity
(106
/mL)
SE
AP
Pro
duct
ion
(U/L
)
Phloretin (µM)
Chapter II ___________________________________________________________________________
83
performance (inducer range, leakiness, maximum expression levels) of a particular
transgene control system in specific cell types (2). We have therefore designed three
different transactivators harboring either the VP16 (TtgA1; pMG11, TtgR-VP16) (3),
the p65 (TtgA2; pMG18, TtgR-p65) (4) or the human E2F4 (TtgA3; pMG19, TtgR-
E2F4) (5) transactivation domains. pMG11, pMG18 or pMG19 were co-transfected
with pMG10 (PTtgR1-SEAP-pA) into CHO-K1, HEK-293 as well as primary human
fibroblasts and keratinocytes, and SEAP expression was profiled after 48h of
cultivation in the presence or absence of 50µM phloretin. The maximum levels of
transgene production varied significantly among different transactivators: TtgA1
enabled the highest transactivation in all cell lines, TtgA2 showed the best
performance in human primary cells and TtgA3 activity was inferior in all situations
(Table S1).
Table S1: Combinatorial profiling of different PEACE transactivators and promoters in various cell types SEAP Production (U/L) pMG10/pMG11 pMG10/pMG18 pMG10/pMG19 Phloretin (50!M)
- + - + - +
CHO-K1 23.6 ± 3.1 0.2 ± 0.02 15.1 ± 0.1
0.8 ± 0.05
6.7 ± 0.3 0.26 ± 0.08
HEK-293 27.3 ± 0.8 0.2 ± 0.04 29.4 ± 1.6
1.9 ± 0.1 5.5 ± 0.4 0.2 ± 0.016
HaCaT 0.9 ± 0.03 * 0.6 ± 0.1 0.5 ± 0.05
0.7 ± 0.07 0.5 ± 0.05
Primary human fibroblasts
1.0 ± 0.04 * 2.6 ± 0.1 0.2 ± 0.02
0.1 ± 0.01 *
Primary human keratinocytes
1.5 ± 0.05 * 11.9 ± 1.3
0.3 ± 0.02
0.5 ± 0.01 *
SEAP production was quantified 48 h after transient co-transfection of pMG10 (PTtgR1-SEAP-pA) and either pMG11 (PSV40-TtgA1-pA; TtgR-VP16), pMG18 (PSV40-TtgA2-pA; TtgR-p65) or pMG19 (PSV40-TtgA3-pA; TtgR-E2F4). *Undetectable All transactivators mediated similar basal expression levels when phloretin was
present in the medium, but due to their cell-type specificity and graded maximum
Chapter II ___________________________________________________________________________
84
transcription-initiation capacities, the three transactivators offer a selection of defined
expression windows.
Phloretin-responsive promoter variants that differ in the distance between
OTtgR and minimal promoter. The torsion angle and the distance between operator-
bound transactivator and minimal promoter play central roles in the efficient assembly
of the transcription-initiation machinery (6, 7). With the goal of achieving the optimal
design for PTtgR configurations we engineered linkers of 2bp increments, ranging from
0 to 10bp, between OTtgR and PhCMVmin and generated SEAP expression vectors which
are isogenic to pMG10 (PTtgR1, pMG10, OTtgR-0bp-PhCMVmin; PTtgR2, pMG20, OTtgR-
2bp-PhCMVmin; PTtgR3, pMG21, OTtgR-4bp-PhCMVmin; PTtgR4, pMG22, OTtgR-6bp-PhCMVmin;
PTtgR5, pMG23, OTtgR-8bp-PhCMVmin; PTtgR6, pMG24, OTtgR-10bp-PhCMVmin) (see Table
S3). Each of the SEAP expression vectors harboring phloretin-responsive promoter
variants were co-transfected with pMG11 (PSV40-TtgA1-pA), pMG18 (PSV40-TtgA2-
pA) or pMG19 (PSV40-TtgA3-pA) into CHO-K1 and SEAP production was profiled
after cultivation for 48h in medium containing 0$%25 and 50µM phloretin (Fig. S2A-
C). PTtgR1 harboring 0bp between OTtgR and PhCMVmin drove maximum SEAP
expression and showed the tightest repression. pMG20, pMG21 and pMG24, with
increments of 2, 4 and 10bp exhibited similar regulation performance. However, 6 and
8bp increments (pMG22 and pMG23) had a strong negative effect on maximum
transgene expression and repression. All promoter variants showed similar TtgA-
specific expression profiles indicating that performance of transactivators and
chimeric promoters can independently be optimized (Fig. S2A-C).
A
0
5
10
15
20
25
30
SE
AP
Pro
duct
ion
(U/L
)
Promoter/TtgA1
0 µM 25 µM 50 µM
PTtgR1 PTtgR2 PTtgR3 PTtgR4 PTtgR5 PTtgR6
B
Chapter II ___________________________________________________________________________
85
Fig. S2. Design and combinatorial characterization of different PEACE transactivator and promoter configurations. PEACE transactivators harboring different transactivation domains (A, TtgA1, VP16; pMG11) (B, TtgA2, p65; pMG18) (C, TtgA3, E2F4; pMG19) were co-transfected with SEAP-driving PEACE promoter variants containing 0 (PTtgR1; pMG10), 2 (PTtgR2; pMG20), 4 (PTtgR3; pMG21), 6 (PTtgR4; pMG22), 8 (PTtgR5; pMG23) and 10 (PTtgR6; pMG24) base pair linkers between the TtgR operator and the minimal promoter into CHO-K1 and SEAP expression was profiled after 48h of cultivation in medium supplemented with different phloretin concentrations. Autoregulated phloretin-inducible transgene expression. In addition to the
classical two-vector design (transactivator and responsive promoter encoded on
separate plasmids) we constructed an autoregulated version of the synthetic phloretin
control system, which enables simultaneous PTtgR1-driven expression of the
transactivator (TtgA1) and the transgene (SEAP) in a single-vector format. This set-up
has been shown to overcome undesirable variation in the expression of transient
transfectionsx and is suitable for the design of noise-resistant gene networks (8).
B
0
2
4
6
8
10
12
14
16
18
SE
AP
Pro
duct
ion
(U/L
)
Promoter/TtgA2
0 µM 25 µM 50 µM
PTtgR1 PTtgR2 PTtgR3 PTtgR4 PTtgR5 PTtgR6
C
0
1
2
3
4
5
6
7
8
SE
AP
Pro
duct
ion
(U/L
)
Promoter/TtgA3
0 µM 25 µM 50 µM
PTtgR1 PTtgR2 PTtgR3 PTtgR4 PTtgR5 PTtgR6
Chapter II ___________________________________________________________________________
86
Following transfection of pMG13 (PTtgR1-SEAP-IRESPV-TtgA1-pA) in CHO-K1,
leaky PTtgR1-driven transcripts lead to cap-independent translation of initial TtgA1,
mediated by the polioviral internal ribosome entry site (IRESPV), which triggers, in an
auto-regulated positive feedback loop, full expression of TtgA1 along with co-
cistronically encoded SEAP. In the presence of 50µM phloretin the positive feedback
loop is interrupted as TtgA1 no longer binds PTtgR1 and SEAP is completely repressed
(Fig. S3). The maximum SEAP production achieved by the auto-regulated PEACE
configuration is comparable to levels reached by the binary sytem with constitutive
transactivator expression (Fig. 1C) indicating that both arrangements produce
sufficient transactivator to fully saturate the inducible promoter.
Fig. S3. Autoregulated PEACE-controlled SEAP expression in CHO-K1. pMG13 encoding a PTtgR1-driven dicistronic expression unit harboring SEAP in the first and TtgA1 in the second cistron was transfected into CHO-K1 and SEAP expression was assessed 48h after cultivation in the presence (50!M) and absence of phloretin.
Compatibility of PEACE control with other transgene regulation systems.
The design of complex synthetic mammalian transgene networks such as the recently
reported mammalian oscillator requires availability of several control modalities
which are compatible and co-operate in an interference-free manner (9-12). To
evaluate the functional compatibility of PEACE with the established tetracycline-
!TETOFF; (13)" and macrolide- !EOFF; (14)" responsive expression systems, we
transiently transfected CHO-PEACE8, transgenic for phloretin-responsive SEAP
expression, with either the TETOFF- (pSAM200, PSV40-tTA-pA; pBP99, PhCMV*-1-
0
5
10
15
20
25
30
SE
AP
Pro
duct
ion
(U/L
) - Phloretin + Phloretin
Chapter II ___________________________________________________________________________
87
SAMY-pA) or the EOFF- (pWW35, PSV40-ET1-pA; pBP100, PETR3-SAMY-pA) system
set to control the Bacillus stearothermophilus-derived secreted &-amylase (SAMY) in
response to tetracycline and erythromycin, respectively. SEAP and SAMY expression
were scored 48h after cultivation of the transfected populations in the presence
(50#M; 2#g/mL) or absence of the inducer molecules (phloretin, tetracycline,
erythromycin). Analysis of cross-regulation showed no interference between PEACE,
TETOFF, and EOFF systems (Table S2 A and B).
Table S2: Compatibility of phloretin-, erythromycin- and tetracycline-responsive transgene control systems A: CHO-PEACE8 transiently transfected with the tetracycline-responsive control system Inducer - Tet / - Phl - Tet / + Phl + Tet / - Phl + Tet / + Phl
Relative SEAP Production (%)
100 ± 4.3 2.2 ± 0.2 93.2 ± 3.8 1.4 ± 0.2
Relative SAMY Production (%)
100 ± 5.2 98.1 ± 2.8 3.0 ± 0.4 4.0 ± 1.0
B: CHO-PEACE8 transiently transfected with macrolide-responsive control system Inducer - EM / - Phl - EM / + Phl + EM / - Phl + EM / + Phl
Relative SEAP Production (%)
100 ± 6.0 2.0 ± 1.2 102.7 ± 5.3 1.6 ± 0.9
Relative SAMY Production (%)
100 ± 5.2 100.6 ± 7.0 1.5 ± 1.8 1.7 ± 2.0
CHO-PEACE8 were co-transfected with (A) pSAM200 (PSV40-tTA-pA) and pBP99 (PhCMV*-1-SAMY-pA) or (B) pWW35 (PSV40-ET1-pA) and pBP100 (PETR3-SAMY-pA) and grown for 48h in the presence and absence of phloretin (Phl, 50!M), erythromycin (EM, 2#g/mL) or tetracycline (Tet, 2#g/mL) before SEAP and SAMY production was assessed.
Chapter II ___________________________________________________________________________
88
Fig. S4. Design and characterization of stable CHO-PEACE cell lines transgenic for phloretin-responsive SEAP expression. CHO-K1 was stably co-transfected with pMG11 (PSV40-TtgA1-pA) and pMG10 (PTtgR1-SEAP-pA) and individual clones were assessed for phloretin-modulated SEAP expression after a cultivation period of 48h.
Material and Methods
Expression vector design. Table S3 lists all plasmids used in this study and
provides detailed information about their construction.
Table S3. Expression vectors and oligonucleotides designed and used in this study
Plasmid Description Reference or Source
pBP10 Vector encoding a PETR5-driven SEAP expression unit (PETR5-SEAP-pA; PETR5, ETR-2bp-PhCMVmin)
(18)
pBP11 Vector encoding a PETR6-driven SEAP expression unit (PETR6-SEAP-pA; PETR6, ETR-4bp-PhCMVmin)
(18)
pBP12 Vector encoding a PETR7-driven SEAP expression unit (PETR7-SEAP-pA; PETR7, ETR-6bp-PhCMVmin)
(18)
pBP13 Vector encoding a PETR8-driven SEAP expression unit (PETR8-SEAP-pA; PETR8, ETR-8bp-PhCMVmin)
(18)
pBP14 Vector encoding a PETR9-driven SEAP expression unit (PETR9-SEAP-pA; PETR9, ETR-10bp-PhCMVmin)
(18)
pBP99 Vector encoding a tetracycline-responsive SAMY expression unit (PhCMV*-1-SAMY-pA). pCF59 was restricted with BprPI/EcoRV and religated.
unpublished
pBP100 Vector encoding an erythromycin-responsive SAMY expression unit (PETR3-SAMY-pA)
(14)
pCF59 Vector encoding PPIR-driven SAMY expression (PhCMV*-1-pA-IRES-PPIR-SAMY-pA). SAMY was excised from pSS158 using SpeI/BglII and ligated into pMF187 (SpeI/BglII).
unpublished
pMF111 Vector encoding a PhCMV*-1-driven SEAP expression unit (PhCMV*-1-SEAP-pA)
(16)
0
20
40
60
80
100
120
140
160
SE
AP
Pro
duct
ion
(U/L
)
- Phloretin + Phloretin
CHO-PEACE4
CHO-PEACE7
CHO-PEACE8
CHO-PEACE12
CHO-PEACE19
Chapter II ___________________________________________________________________________
89
pMF187 Dual-regulated expression vector (PhCMV*-1-MCSI-IRES-MCSII-pAI-PPIR-MCSIII-pAII)
(17)
pMG9 Vector encoding OTtgR-0bp-PhCMVmin-ET1-pA, OTtgR-0bp-PhCMVmin was PCR-amplified from pRevTRE using OMG21: 5’- gatcaagcttgacgtcCAGTA TTTACAAACAACCATGAATGTAAGTATATTCcctgcaggTCGAGCTCGGTACCCGGGTC-3’ and OWW22: 5’-gctagaattcCGCGGAGGCTGGA TCGG-3’ (upper case, annealing sequence; lower case italics, restriction sites; upper case italics, OTtgR), digested with AatII/EcoRI and ligated into pWW35 (AatII/EcoRI).
This work
pMG10 Vector encoding a PTtgR1-driven SEAP expression unit (PTtgR1-SEAP-pA; PTtgR1, OTtgR-0bp-PhCMVmin). OTtgR-0bp-PhCMVmin was excised from pMG9 (SspI/EcoRI) and ligated into pMF111 (SspI/EcoRI).
This work
pMG11 Constitutive TtgA1 expression vector (PSV40-TtgA1-pA). TtgR was excised from pUC19-TtgR (EcoRI/BssHII) and ligated into pWW35 (EcoRI/BssHII).
This work
pMG13 Autoregulated phloretin-controlled SEAP expression vector (PTtgR1-SEAP-IRESPV-TtgA1-pA).TtgA1 was excised from pMG11 (SspI/NotI) and ligated into pMG10 (SspI/NotI).
This work
pMG18 Constitutive TtgA2 expression vector (PSV40-TtgA2-pA). p65 was excised from pWW42 (BssHII/BamHI) and ligated into pMG11 (BssHII/BamHI).
This work
pMG19 Constitutive TtgA3 expression vector (PSV40-TtgA3-pA). The E2F4 transactivation domain was excised from pWW64 (BssHII/BamHI) and ligated into pMG11 (BssHII/BamHI).
This work
pMG20 Vector encoding a PTtgR2-driven SEAP expression unit (PTtgR2-SEAP-pA; PTtgR2, OTtgR-2bp-PhCMVmin). 2bp-PhCMVmin-SEAP was excised from pBP10 (SspI/EcoRI) and ligated into pMG10 (SspI/EcoRI).
This work
pMG21 Vector encoding a PTtgR3-driven SEAP expression unit (PTtgR3-SEAP-pA; PTtgR3, OTtgR-4bp-PhCMVmin). 4bp-PhCMVmin-SEAP was excised from pBP11 (SspI/EcoRI) and ligated into pMG10 (SspI/EcoRI).
This work
pMG22 Vector encoding a PTtgR4-driven SEAP expression unit (PTtgR4-SEAP-pA; PTtgR4, OTtgR-6bp-PhCMVmin). 6bp-PhCMVmin-SEAP was excised from pBP12 (SspI/EcoRI) and ligated into pMG10 (SspI/EcoRI).
This work
pMG23 Vector encoding a PTtgR5-driven SEAP expression unit (PTtgR5-SEAP-pA; PTtgR5, OTtgR-8bp-PhCMVmin). 8bp-PhCMVmin-SEAP was excised from pBP13 (SspI/EcoRI) and ligated into pMG10 (SspI/EcoRI).
This work
pMG24 Vector encoding a PTtgR6-driven expression unit (PTtgR6-SEAP-pA; PTtgR6, OTtgR-10bp-PhCMVmin). 10bp-PhCMVmin-SEAP was excised from pBP14 (SspI/EcoRI) and ligated into pMG10 (SspI/EcoRI).
This work
pPur Selection vector conferring puromycin resistance Clontech, Palo Alto, CA, USA
Chapter II ___________________________________________________________________________
90
pRevTRE
Oncoretroviral expression vector containing a tetracycline-responsive expression unit
Clontech, Palo Alto, CA, USA
pSAM200
Constitutive tTA expression vector (PSV40-tTA-pA) (16)
pSEAP2-Control
Constitutive SEAP expression vector (PSV40-SEAP-pA) Clontech, Palo Alto, CA, USA
pSS158 PhCMV-driven SAMY expression vector (PhCMV-SAMY-pA) (15) pSV2neo Selection vector conferring neomycin resistance Clontech,
Palo Alto, CA, USA
pUC19-TtgR
Cloning vector containing the TtgR (EcoRI-TtgR-BssHII) Picoscript, Houston, TX, USA
pWW35 Constitutive ET1 expression vector (PSV40-ET1-pA) (14) pWW42 Constitutive ET2 expression vector (PSV40-ET2-pA) (14) pWW64 Constitutive ET3 expression vector (PSV40-ET3-pA) (18)
Abbreviations: E2F4, transactivation domain of the human E2F transcription factor 4; ET1, macrolide-dependent transactivator (E-VP16); ET2, macrolide-dependent transactivator (E-p65); ET3, macrolide-dependent transactivator (E-E2F4); ETR, operator specific for macrolide-dependent transactivators; IRESPV, polioviral internal ribosome entry site; NF-!!B, human transcription factor; OTtgR, TtgR-specific operator; p65, transactivation domain of NF-!B; pA, polyadenylation site; PETR3-9, macrolide-responsive promoters containing different spacers between ETR and PhCMVmin; PhCMV, human cytomegalovirus immediate early promoter; PhCMVmin, minimal PhCMV; PhCMV*-1, tetracycline-responsive promoter; PPIR3, streptogramin-responsive promoter; PSV40, simian virus 40 promoter; PTtgR1-6, phloretin-responsive promoters containing different spacers between OTtgR and PhCMVmin; SEAP, human placental secreted alkaline phosphatase; SAMY, Bacillus stearothermophilus-derived secreted #-amylase; TtgR, repressor of the Pseudomonas putida DOT-T1E ABC multi-drug efflux pump; TtgA1, phloretin dependant transactivator (TtgR-VP16); TtgA2, phloretin dependant transactivator (TtgR-p65); TtgA3, phloretin dependant transactivator (TtgR-E2F4); VP16, Herpes simplex virus-derived transactivation domain.
Quantification of reporter protein production. Bacillus stearothermophilus-
derived secreted !-amylase (SAMY) levels were assessed using the blue starch
Phadebas® assay (Pharmacia Upjohn, Peapack, NJ, USA; Cat. No. 10-5380-32) (15).
Inducer compounds. Tetracycline (Sigma, Cat. No. T7660) was prepared as a
1mg/mL stock solution in H2O and erythromycin (Fluka, Buchs, Switzerland, Cat. No.
45673) as a stock solution of 1mg/mL in ethanol. Both antibiotics were used at a final
concentration of 2µg/mL.
Chapter II ___________________________________________________________________________
91
SI References 1. Weber W, et al. (2008) A synthetic mammalian gene circuit reveals antituberculosis
compounds. Proc Natl Acad Sci USA 105(29):9994-9998.
2. Weber W, Fussenegger M (2002) Artificial mammalian gene regulation networks-
novel approaches for gene therapy and bioengineering. J Biotechnol 98(2-3):161-187.
3. Triezenberg SJ, Kingsbury RC, McKnight SL (1988) Functional dissection of VP16,
the trans-activator of herpes simplex virus immediate early gene expression. Genes
Dev 2(6):718-729.
4. Urlinger S, et al. (2000) The p65 domain from NF-kappaB is an efficient human
activator in the tetracycline-regulatable gene expression system. Gene 247(1-2):103-
110.
5. Akagi K, Kanai M, Saya H, Kozu T, Berns A (2001) A novel tetracycline-dependent
transactivator with E2F4 transcriptional activation domain. Nucleic Acids Res
29(4):e23.
6. Muller J, Oehler S, Muller-Hill B (1996) Repression of lac promoter as a function of
distance, phase and quality of an auxiliary lac operator. J Mol Biol 257(1):21-29.
7. Sathya G, et al. (1997) Effects of multiple estrogen responsive elements, their
spacing, and location on estrogen response of reporter genes. Mol Endocrinol
11(13):1994-2003.
8. Becskei A, Kaufmann BB, van Oudenaarden A (2005) Contributions of low molecule
number and chromosomal positioning to stochastic gene expression. Nat Genet
37(9):937-944.
9. Kramer BP, Fischer M, Fussenegger M (2005) Semi-synthetic mammalian gene
regulatory networks. Metab Eng 7(4):241-250.
10. Kramer BP Fussenegger M (2005) Hysteresis in a synthetic mammalian gene
network. Proc Natl Acad Sci USA 102(27):9517-9522.
11. Kramer BP, et al. (2004) An engineered epigenetic transgene switch in mammalian
cells. Nat Biotechnol 22(7):867-870.
12. Tigges M, Marquez-Lago TT, Stelling J, Fussenegger M (2009) A tunable synthetic
mammalian oscillator. Nature 457(7227):309-312.
13. Gossen M, Bujard H (1992) Tight control of gene expression in mammalian cells by
tetracycline-responsive promoters. Proc Natl Acad Sci USA 89(12):5547-5551.
Chapter II ___________________________________________________________________________
92
14. Weber W, et al. (2002) Macrolide-based transgene control in mammalian cells and
mice. Nat Biotechnol 20(9):901-907.
15. Schlatter S, Rimann M, Kelm J, Fussenegger M (2002) SAMY, a novel mammalian
reporter gene derived from Bacillus stearothermophilus alpha-amylase. Gene 282(1-
2):19-31.
16. Fussenegger M, Moser S, Mazur X, Bailey JE (1997) Autoregulated multicistronic
expression vectors provide one-step cloning of regulated product gene expression in
mammalian cells. Biotechnol Prog 13(6):733-740.
17. Moser S, et al. (2001) Dual-regulated expression technology: a new era in the
adjustment of heterologous gene expression in mammalian cells. J Gene Med
3(6):529-549.
18. Weber W, Kramer BP, Fux C, Keller B, Fussenegger M (2002) Novel
promoter/transactivator configurations for macrolide- and streptogramin-responsive
transgene expression in mammalian cells. J Gene Med 4(6):676-686.
Chapter III ___________________________________________________________________________
93
Chapter III
Transcription Control In Mammalian Cells and Mice Via The Food
Additive Vanillic Acid
Marc Gitzinger, Christian Kemmer, David A. Fluri, Marie Daoud El-Baba,
Wilfried Weber and Martin Fussenegger
Submitted
Chapter III ___________________________________________________________________________
94
Abstract Heterologous transgene expression systems in mammalian cells are essential
tools for successfully studying metabolic pathways, producing difficult-to-express
proteins and, most importantly, they constitute a toolbox for mammalian synthetic
biology and novel gene therapy approaches. To exploit the full potential of such
synthetic regulation assemblies, the access to response regulators that become
activated by either (i) physiologically inert and ideally already licensed inducers such
as food additives and cosmetics or, (ii) which directly respond to mammalian-derived
metabolites is crucial. Living in oligotrophic freshwater habitats, the Gram-negative
bacterium Caulobacter crescentus adapted to metabolize vanillic acid, a phenolic acid
that results from lignin degradation in plant decay. The VanR-response regulator of
Caulobacter crescentus regulates the metabolic pathway enabling the usage of vanillic
acid as a carbon source. Employing the VanR-operon, we engineered a synthetic
mammalian gene regulation system responsive to vanillic acid (VAC), which is a
licensed food additive regularly consumed by humans via vegetables and fruits and
thus can be considered as safe at physiological concentrations. The VAC system was
distinguished by its unprecedented specificity towards its inducer and by enabling
adjustable and reversible gene expression control in several mammalian cell lines and
in mice with high maximum expression levels. The VAC system has the potential to
endorse advances in building complex synthetic networks and in gene- and cell-based
therapies.
Introduction
Fine-tuning of gene expression via synthetic mammalian transgene regulation
systems has been playing a pivotal role in functional genomics research (1), the
biopharmaceutical manufacturing of complex proteins, even across species (2-4), drug
discovery (5,6), tissue engineering (7-9), the design of complex synthetic networks
(10-13), gene therapy (9,14,15) and the design of functional materials (16). The sheer
amount of basic and applied research areas directly relying on the adjustability and
reversibility of gene activity explains the high demand for ever-improving synthetic
transgene control systems, which enable intricate regulation of a single gene of
Chapter III ___________________________________________________________________________
95
interest up to complex synthetic networks. The majority of currently available
mammalian transgene control systems benefit from a generic design principle
comprising a prokaryotic DNA-binding response regulator fused to a mammalian
transactivation (transrepression) domain, thus forming a synthetic transactivator
(transrepressor) with the ability to activate (or repress) a hybrid promoter engineered
from a specific operator in close proximity to a eukaryotic minimal (constitutive)
promoter (17-19). Employing these modular building blocks offers the possibility of
creating two output functions depending on the ability of an inducer molecule to either
(i) activate (ON-type system) (20-23) or (ii) repress (OFF-type system) (20,24) gene
expression upon binding to the transactivator (transrepressor) protein. The first wave
of mammalian transcription control systems resulted in an array of various inducer
molecules enabling gene regulation, ranging from antibiotics (18,20,21), to steroid
hormones and their analogues (25,26), quorum sensing molecules (22,27) and
immunosuppressive and anti-diabetic drugs (28,29). Most of these established gene
regulation systems display reliable regulatory behaviours with a low level of leakage
and high maximum transgene expression levels in vitro and in animals. However,
recent advances in the field of synthetic biology demand physiologically inert and
traceless inducer molecules in order to minimize potential side effects when applied in
sophisticated gene therapy approaches (15,16), and no interference with host
organisms within complex synthetic networks (12,13,30) or drug screening
approaches (6). Therefore, the second generation of synthetic mammalian transgene
regulation systems strives for inducer molecules that are directly derived from
endogenous metabolites, such as amino acids (31), vitamins (32,33), gaseous
acetaldehyde (23), pathologic signals, such as urate (15), or which are already licensed
as cosmetic and food additives (6,34). Utilizing these trigger molecules in the most
recent synthetic biology networks resulted in unprecedented advances in the field and
could result, in the not too distant future, in the first human gene therapy trials
capitalizing on synthetic biology (35-37).
Vanillic acid (or vanillate) is a naturally occurring compound which belongs
to the class of phenolic acids and is primarily found in vanilla beans (38,39). As a
flavouring and scent agent that produces a pleasant, creamy odour, vanillic acid is
Chapter III ___________________________________________________________________________
96
registered by the Joint Food and Agriculture Organization (FAO) as a food additive
(FAO/WHO Expert Committee on Food Additives, JECFA no. 959). In the chemical
synthesis of vanillin, vanillic acid is an intermediate between ferulic acid and vanillin
(40). Furthermore, it is also a metabolic by-product of several natural compounds
regularly consumed by humans, such as caffeic acid, and therefore often occurs in
human urine (41). Vanillic acid has also been evaluated as a pharmacophore for
several applications and was shown to act as a specific inhibitor of the snake venom
5’-nucleotidase, which targets 5’-AMP (42,43), and of carcinogenesis (44), where it
suppressed cell apoptosis induced by methylglyoxal in Neuro-2A cells (45,46).
Vanillic acid also exhibits a hepatoprotective effect by suppressing immune-mediated
liver inflammation in mice (47). Therefore, vanillic acid would be a desirable,
physiologically inert inducer molecule for expanding the portfolio of available
second-generation gene regulation systems.
Caulobacter crescentus is a Gram-negative, oligotrophic freshwater bacterium
that plays an important role in the carbon cycle by disposing of the soluble phenolic
intermediates that are released from the fungal oxidative cleavage of lignin, derived
from decaying vascular plant material (48-50). Vanillic acid is a predominant
component of these phenolic intermediates. Caulobacter crescentus has the ability to
utilize vanillic acid as its sole carbon source, which implies it has the capability of
converting vanillic acid into protocatechuate in order to cleave the aromatic ring to
finally yield succinyl-CoA and acetyl-CoA, which can directly enter the citric acid
cycle (51,52). In many bacteria, O-demethylation in the first step of the
aforementioned metabolic pathway is carried out by a two-component
monooxygenase encoded by the VanAB gene cluster, which is regulated by a
transcriptional repressor, VanR (51,53-56).
Capitalizing on the vanillic acid-responsive transcriptional repressor VanR
derived from C. crescentus, we engineered a synthetic vanillic acid-responsive
mammalian expression system (VAC) which exhibits excellent regulation
performance in mammalian cell cultures and when implanted in mice.
Chapter III ___________________________________________________________________________
97
Methods
Plasmid construction. Table 1 lists all the plasmids used in this study and
provides detailed information about their construction.
Table 1. Expression vectors and oligonucleotides designed and used in this study
Plasmid Description Reference or Source
pBP99 Vector encoding a tetracycline-responsive SAMY expression unit (PhCMV*-1-SAMY-pA). pCF59 was restricted with BprPI/EcoRV and religated.
unpublished
pBP100 Vector encoding an erythromycin-responsive SAMY expression unit (PETR3-SAMY-pA)
Weber et al. 2002b
pCF59 Vector encoding a PPIR-driven SAMY expression unit (PhCMV*-
1-pA-IRES-PPIR-SAMY-pA). SAMY was excised from pSS158 using SpeI/BglII and ligated into pMF187 (SpeI/BglII).
unpublished
pMF187 Dual-regulated expression vector (PhCMV*-1-MCSI-IRES-MCSII-pAI-PPIR-MCSIII-pAII)
Moser et al. 2001
pMG10 Vector encoding a PTtgR1-driven SEAP expression unit (PTtgR1-SEAP-pA; PTtgR1, OTtgR-0bp-PhCMVmin).
Gitzinger et al. 2009
pMG18 Constitutive TtgA2 expression vector (PSV40-TtgA2-pA). Gitzinger et al. 2009
pMG19 Constitutive TtgA3 expression vector (PSV40-TtgA3-pA). Gitzinger et al. 2009
pMG20 Vector encoding a PTtgR2-driven SEAP expression unit (PTtgR2-SEAP-pA; PTtgR2, OTtgR-2bp-PhCMVmin).
Gitzinger et al. 2009
pMG21 Vector encoding a PTtgR3-driven SEAP expression unit (PTtgR3-SEAP-pA; PTtgR3, OTtgR-4bp-PhCMVmin).
Gitzinger et al. 2009
pMG22 Vector encoding a PTtgR4-driven SEAP expression unit (PTtgR4-SEAP-pA; PTtgR4, OTtgR-6bp-PhCMVmin).
Gitzinger et al. 2009
pMG23 Vector encoding a PTtgR5-driven SEAP expression unit (PTtgR5-SEAP-pA; PTtgR5, OTtgR-8bp-PhCMVmin).
Gitzinger et al. 2009
pMG24 Vector encoding a PTtgR6-driven expression unit (PTtgR6-SEAP-pA; PTtgR6, OTtgR-10bp-PhCMVmin).
Gitzinger et al. 2009
pMG250 Constitutive VanA1 expression vector (PSV40-VanA1-pA). VanR was PCR-amplified from Caulobacter crescentus genomic DNA using ODF150: 5’-cggaattccaccATGGACATGCCGCGCATAAAGCCGGGC-3’ and ODF151: 5’- gtacgacgcgtggctgtacgcggaGTCGGCGCGAATGCT CCACGCCGCGC-3’ (lower case italics, restriction sites; upper case italics, annealing), digested with EcoRI/MluI and ligated into pWW35 (EcoRI/BssHII).
This work
pMG252 Vector encoding a P1VanO2-driven SEAP expression unit (P1VanO2-SEAP-pA; P1VanO2, VanO2-0bp-PhCMVmin). VanO2 was created by annealing Oligos OMG65 (5’-phosphate-
This work
Chapter III ___________________________________________________________________________
98
tcgacgtcaattcgcgaATTGGATCCAATagc gctATTGGATCCAATgatatcggacctgca-3’; lower case italics, restriction sites; upper case italics, VanO) and OMG66 (5’-phosphate-gcagttaagc gctTAACCTAGGTTAtcgcgaTAACCTAGGTTActatagcctgg-3’; lower case italics, restriction sites; upper case italics, VanO), and was directly ligated into SalI/SbfI-digested pWW1088 thereby resulting in P1VanO2.
pMG256 Constitutive VanA2 expression vector (PSV40-VanA2-pA). VanR was PCR-amplified from Caulobacter crescentus genomic DNA using ODF150: 5’-cggaattccaccATGGACATGCCGCGCATAAAGCCGGGC-3’ and ODF151: 5’- gtacgacgcgtggctgtacgcggaGTCGGCGCGAATGCT CCACGCCGCGC-3’ (lower case italics, restriction sites; upper case italics, annealing), digested with EcoRI/MluI and ligated into pMG18 (EcoRI/BssHII).
This work
pMG257 Constitutive VanA3 expression vector (PSV40-VanA3-pA). VanR was PCR-amplified from Caulobacter crescentus genomic DNA using ODF150: 5’-cggaattccaccATGGACATGCCGCGCATAAAGCCGGGC-3’ and ODF151: 5’- gtacgacgcgtggctgtacgcggaGTCGGCGCGAATGCT CCACGCCGCGC-3’ (lower case italics, restriction sites; upper case italics, annealing), digested with EcoRI/MluI and ligated into pMG19 (EcoRI/BssHII).
This work
pMG262 Vector encoding a P1VanO1-driven SEAP expression unit (P1VanO1-SEAP-pA; P1VanO1, VanO1-0bp-PhCMVmin). pMG252 was digested using either NruI/HindIII or Eco47III/HindIII. The resulting fragments were ligated to result in pMG262 harboring one VanO-operator element.
This work
pMG263 Vector encoding a P1VanO3-driven SEAP expression unit (P1VanO3-SEAP-pA; P1VanO3, VanO3-0bp-PhCMVmin). pMG252 was digested using either EcoRV/HindIII or Eco47III/HindIII. The resulting fragments were ligated to result in pMG263 harboring three VanO-operator elements.
This work
pMG264 Vector encoding a P1VanO4-driven SEAP expression unit (P1VanO4-SEAP-pA; P1VanO4, VanO4-0bp-PhCMVmin). pMG252 was digested using either EcoRV/HindIII or NruI/HindIII. The resulting fragments were ligated to result in pMG264 harboring four VanO-operator elements.
This work
pMG265 Vector encoding a P2VanO2-driven SEAP expression unit (P2VanO2-SEAP-pA; P2VanO2, VanO2-2bp-PhCMVmin). 2bp-PhCMVmin-SEAP was excised from pMG20 (SbfI/XhoI) and ligated into pMG252 (SbfI/XhoI)
This work
pMG266 Vector encoding a P3VanO2-driven SEAP expression unit (P3VanO2-SEAP-pA; P3VanO2, VanO2-4bp-PhCMVmin). 4bp-PhCMVmin-SEAP was excised from pMG21 (SbfI/XhoI) and ligated into pMG252 (SbfI/XhoI)
This work
Chapter III ___________________________________________________________________________
99
pMG267 Vector encoding a P4VanO2-driven SEAP expression unit (P4VanO2-SEAP-pA; P4VanO2, VanO2-6bp-PhCMVmin). 6bp-PhCMVmin-SEAP was excised from pMG22 (SbfI/XhoI) and ligated into pMG252 (SbfI/XhoI)
This work
pMG268 Vector encoding a P5VanO2-driven SEAP expression unit (P5VanO2-SEAP-pA; P5VanO2, VanO2-8bp-PhCMVmin). 8bp-PhCMVmin-SEAP was excised from pMG23 (SbfI/XhoI) and ligated into pMG252 (SbfI/XhoI)
This work
pMG269 Vector encoding a P6VanO2-driven SEAP expression unit (P6VanO2-SEAP-pA; P6VanO2, VanO2-10bp-PhCMVmin). 10bp-PhCMVmin-SEAP was excised from pMG24 (SbfI/XhoI) and ligated into pMG252 (SbfI/XhoI)
This work
pMG270 Autoregulated vanillic acid-controlled SEAP expression vector (P1VanO2-SEAP-IRESPV-VanA1-pA). VanA1 was excised from pMG250 (SspI/NotI) and ligated into pMG252 (SspI/NotI).
This work
pPur Selection vector conferring puromycin resistance Clontech, Palo Alto, CA, USA
pSAM200 Constitutive tTA expression vector (PSV40-tTA-pA) Fussenegger et al. 1997
pSEAP2-Control
Constitutive SEAP expression vector (PSV40-SEAP-pA) Clontech, Palo Alto, CA, USA
pSS158
PhCMV-driven SAMY expression vector (PhCMV-SAMY-pA) Schlatter et al. 2002
pSV2neo Selection vector conferring neomycin resistance Clontech, Palo Alto, CA, USA
pWW35 Constitutive ET1 expression vector (PSV40-ET1-pA) Weber et al. 2002b
Abbreviations: E2F4, transactivation domain of the human E2F transcription factor 4; ET1, macrolide-dependent transactivator (E-VP16); ETR, operator specific for macrolide-dependent transactivators; IRESPV, polioviral internal ribosome entry site; NF-!!B, human transcription factor; OTtgR, TtgR-specific operator; p65, transactivation domain of NF-!B; pA, polyadenylation site; PETR3, macrolide-responsive promoter; PhCMV, human cytomegalovirus immediate early promoter; PhCMVmin, minimal PhCMV; PhCMV*-1, tetracycline-responsive promoter; PSV40, simian virus 40 promoter; PTtgR1-6, phloretin-responsive promoters containing different spacers between OTtgR and PhCMVmin; P1-6VanO2, vanillic acid-responsive promoters containing different spacers between VanO and PhCMVmin; P1VanO1-4, vanillic acid-responsive promoters harboring 1, 2, 3 or 4 VanO-operator repeats in front of PhCMVmin; SEAP, human placental secreted alkaline phosphatase; SAMY, Bacillus stearothermophilus-derived secreted #-amylase; TtgR, repressor of the Pseudomonas putida DOT-T1E ABC multi-drug efflux pump; TtgA2, phloretin-dependent transactivator (TtgR-p65); TtgA3, phloretin-dependent transactivator (TtgR-E2F4); VanAB, gene cluster within Caulobacter crescentus that plays a role within the vanillic acid metabolism; VanO, VanR specific operator; VanR, repressor of the Caulobacter crescentus VanAB gene cluster; VP16, Herpes simplex virus-derived transactivation domain.
Chapter III ___________________________________________________________________________
100
Cell culture. Wild-type Chinese hamster ovary cells (CHO-K1, ATCC: CCL-
61) and their derivatives were cultivated in standard medium: ChoMaster® HTS (Cell
Culture Technologies, Gravesano, Switzerland) supplemented with 5% (v/v) foetal
calf serum (FCS, PAN Biotech GmbH, Aidenbach, Germany, Cat. No. 3302, Lot No.
P251110) and 1% (v/v) penicillin/streptomycin solution (Biowest, Nuaillé, France,
Cat. No. L0022-100, Lot No. S07497L0022). Human embryonic kidney cells,
transgenic for the Simian virus 40 (SV40) large T-antigen [(HEK-293T, (57)], human
cervical carcinoma cells (HeLa, ATCC: CCL-2), African green monkey kidney cells
(COS-7, ATCC: CRL-1651), baby hamster kidney cells (BHK-21, ATCC: CCL10),
human fibrosarcoma cells (HT-1080, ATCC: CCL-121) and mouse fibroblasts
(NIH/3T3, ATCC CRL-1658) were cultivated in Dulbecco’s modified Eagle’s
medium (DMEM) supplemented with 10% FCS and 1% penicillin/streptomycin
solution. All cell lines were cultivated at 37 °C in a humidified atmosphere containing
5% CO2.
Transfection. The CHO-K1 cells were transiently transfected using 0.5 µg of
total plasmid DNA (an equal amount of each plasmid was used for co-transfections)
according to an optimized calcium phosphate-based protocol which resulted in typical
transfection efficiencies of 35% ± 5% (58). In brief, 50,000 CHO-K1 cells were
seeded into each well of a 24-well plate and cultured overnight. The plasmid DNA
was then diluted to a total volume of 25 µl with 0.5 M CaCl2 solution, which was
mixed with 25 µl 2 % HBS solution (50 mM HEPES/280 mM NaCl/1.5 mM
Na2HPO4, pH 7.1). This mixture was incubated for 15 min at room temperature before
the precipitates were directly added into the well and centrifuged onto the cells (5 min
at 1200 % g). After 3 h, the cells were treated with 0.5 ml glycerol solution
(ChoMaster® HTS medium containing 15% glycerol) for 60 s. After washing once
with phosphate-buffered saline (PBS, Dulbecco’s phosphate-buffered saline;
Invitrogen, Basel, Switzerland, Cat. No. 21600-0069), the cells were cultivated in 0.5
ml standard ChoMaster® HTS medium in the presence or absence of different
concentrations of the inducer molecule (vanillic acid). For the transient transfection of
BHK-21, COS-7 and HEK293-T cells, a plasmid DNA-Ca2PO4 precipitate was
Chapter III ___________________________________________________________________________
101
prepared and applied to the 50,000 cells cultivated per well of a 24-well plate, as
described above. The HEK293-T and COS-7 cells were washed once with PBS after 3
h incubation with the DNA-Ca2PO4 precipitate and subsequently cultivated in
standard DMEM, while BHK-21 and HeLa cells were incubated overnight with the
precipitates and then cultivated in DMEM medium after being washed once with PBS.
The HT-1080 and NIH/3T3 cell lines were transfected with Fugene" 6 (Roche
Diagnostics AG, Basel, Switzerland, Cat. No. 11814443001) according to the
manufacturer’s protocol and cultivated in the cell culture medium specified above.
After transfection, all cells were cultivated in DMEM supplemented with different
concentrations of vanillic acid and reporter protein levels were profiled 48 h after
transfection, unless otherwise indicated.
Construction and characterization of the stable cell line CHO-VAC. The
CHO-VAC12 cell line, transgenic for vanillic acid-controlled SEAP expression, was
constructed by sequential co-transfection and clonal selection of (i) pMG250 (PSV40-
VanA1-pA) and pSV2neo (Clontech, Cat. No. 6172-1) at a ratio of 20:1 to result in the
cell line CHO-VanA; (ii) CHO VanA was subsequently co-transfected with pMG252
(P1VanO2-SEAP-pA) and pPur (Clontech, Cat. No. 6156-1) (ratio of 20:1), and the
resulting double-transgenic cell line CHO-VAC12, showing vanillic acid-responsive
SEAP production, was chosen after clonal selection. To assess the vanillic acid-
mediated transgene regulation characteristics, 100,000 cells/ml of CHO-VAC12 were
cultivated for 48 h in standard ChoMaster® HTS medium supplemented with
increasing concentrations of vanillic acid, ranging from 0 – 1000 µM. Reversibility of
the vanillic acid-mediated SEAP production was assessed by culturing CHO-VAC12
(100,000 cells/ml) for 144 h while alternating vanillic acid concentrations from 0 to
500 µM every 48 h.
Quantification of reporter gene expression. Production of the human
placental secreted alkaline phosphatase (SEAP) was quantified using a p-
nitrophenylphosphate-based light absorbance time course (59,60).
Inducer compounds: vanillic acid and its derivatives. The following were
prepared as 50 mM stock solutions in 70% (v/v) EtOH and the pH level was adjusted
using 2.5 M NaOH when required: 2-vanillic acid (2-hydroxy-3-methoxybenzoic acid,
Chapter III ___________________________________________________________________________
102
ABCR, Karlsruhe, Germany, Cat. No. AB177480), 2-vanillin (2-hydroxy-3-
methoxybenzaldehyde, ABCR, Cat. No. AB117268), acetovanillone (4’-hydroxy-3’-
methoxyacetophenone, ABCR, Cat. No. AB125832), benzaldehyde (Acros, Geel,
Belgium, Cat. No. 378361000), benzoic acid (ABCR, Cat. No. AB113879), benzyl
acetate (ABCR, Cat. No. AB131641), benzyl alcohol (ABCR, Cat. No. AB171491),
ethyl-vanillate (ABCR, Cat. No. AB178082), ethyl-vanillin (3-ethoxy-4-
hydroxybenzaldehyde, ABCR, Cat. No. AB126381), eugenol (ABCR, Cat. No.
AB111881), homovanillic acid (Sigma, St Louis, MO, USA, Cat. No. H1252-1G),
isovanillic acid (3-hydroxy-4-methoxybenzoic acid, ABCR, Cat. No. AB117271),
isovanillin (3-hydroxy-4-methoxybenzaldehyde, ABCR, Cat. No. AB117270),
methyl-vanillate (ABCR, Cat. No. AB132603), protocatechualdehyde (3,4-
dihydroxybenzaldehyde, ABCR, Cat. No. AB110948) and vanillin (ABCR, Cat. No.
AB117415). Vanillic acid (Fluka, Buchs, Switzerland, Cat. No. 94770-10G) was
prepared as a 50 mM stock solution in water and the pH level was adjusted with 2.5 M
NaOH. All solutions were used at a final concentration of 250 µM unless indicated
otherwise. Tetracycline (Sigma, Cat. No. T7660) was prepared as a 1 mg/ml stock
solution in H2O, and erythromycin (Fluka, Cat. No. 45673) as a stock solution of 1
mg/ml in ethanol. Both antibiotics were used at a final concentration of 2 µg/ml.
In vivo methods. The CHO-K1 cells, engineered for vanillic acid-controlled
SEAP expression (CHO-VAC12) and for constitutive SEAP expression [(CHO-
SEAP18 (61)], were encapsulated into 400 µm alginate-poly-(L-lysine)-alginate beads
(400 cells/capsule) using an Inotech Encapsulator Research IE-50R
(EncapBioSystems Inc., Greifensee, Switzerland) according to the manufacturer’s
instructions and the following parameters: 0.2 mm nozzle, 20 ml syringe at a flow rate
of 405 units, nozzle vibration frequency of 1116 Hz and 950 V for bead dispersion.
Female OF1 mice (oncins France souche 1, Charles River Laboratories, France) were
injected intraperitoneally with 700 µl of FCS-free ChoMaster® HTS containing 4 %
106 encapsulated CHO-VAC12 cells. Control mice were injected with
microencapsulated CHO-K1 or CHO-SEAP18. One hour after implantation, vanillic
acid was administered at doses ranging from 0 to 500 mg/kg. The injections of vanillic
acid were repeated twice daily during the next three days. For in vivo administration
Chapter III ___________________________________________________________________________
103
of vanillic acid, a stock solution was prepared at 50 mg/ml in PBS and adjusted to pH
7.0 using a 2.5 M NaOH solution. The vanillic acid stock solution was diluted in PBS,
accordingly. After 72 h, the mice were sacrificed, blood samples were collected and
SEAP levels were quantified in the serum which was isolated using a microtainer SST
tube according to the manufacturer’s instructions (Beckton Dickinson, Plymouth,
UK). All the experiments involving mice were performed according to the directives
of the European Community Council (86/609/EEC), approved by the French Republic
(No. 69266310) and performed by Marie Daoud El-Baba at the Université Claude
Bernard-Lyon 1, F-69622 Villeurbanne, France.
Results
Design of a vanillic acid (VAC)-responsive mammalian expression system.
We designed a mammalian synthetic gene regulation circuit, which is induced by a
well-tolerated food additive, vanillic acid (vanillate). This system capitalizes on the
Caulobacter crescentus-derived VanR repressor that binds a distinct perfect inverted
repeat operator (VanO; ATTGGATCCAAT) upstream of the vanAB promoter region
and regulates the vanAB genes which play a key role in vanillic acid metabolism (51).
The design of this mammalian vanillic acid-responsive system (VAC) is built on two
components, (i) a synthetic mammalian transactivator (VanA1), created by fusing
VanR to the Herpes simplex-derived transactivation domain VP16 (62), and (ii) by a
chimeric promoter (P1VanO2) harbouring two VanO-operator sequences, separated only
by an Eco47III restriction site (VanO2, 5’-
ATTGGATCCAATagcgctATTGGATCCAAT-3’, predicted VanO-boxes upper case)
at the 5’-end of a minimal version of the human cytomegalovirus immediate-early
promoter (PhCMVmin) (Figure 1A and B). Co-transfection of pMG250 (PSV40-VanA1-
pA), constitutively expressing VanA1, and pMG252 (P1VanO2-SEAP-pA), encoding the
mammalian reporter gene SEAP (human placental alkaline phosphatase) under the
control of a VanA1-responsive promoter (P2VanO2), resulted in high-level reporter
protein expression of 20.3 ± 0.5 units per liter (U/l), which was comparable to the
constitutively expressing SEAP control vector (pSEAP2-Control; PSV40-SEAP-pA)
(33.9 ± 0.2 U/l). Upon adding increasing concentrations of vanillic acid (0 – 250 µM)
Chapter III ___________________________________________________________________________
104
to the cultures of CHO-K1 cells transiently co-transfected with pMG250 and
pMG252, a dose-dependent reduction of SEAP expression, up to complete repression,
was observed, suggesting that vanillic acid is able to regulate VanA1-binding to its
cognate operator site VanO2 (Figure 1C).
Figure 1. Diagram and functionality of the VAC system. The bacterial transrepressor
VanR from Caulobacter crescentus was fused to the VP16 transactivation domain of the Herpes simplex virus resulting in VanA1 (VanR-VP16), which was expressed by the constitutive Simian virus 40 promoter (PSV40) (pMG250). The vanillic acid-responsive promoter P1VanO2 contains two VanO operator sites (ATTGGATCCAATAGCGCTATTGGATCCAAT; VanR binding sites in italics) immediately 5’ of a minimal human cytomegalovirus immediate-early promoter (PhCMVmin), which was set to drive the human placental secreted alkaline phosphatase (SEAP) (pMG252). (A) ON status: VanA1 is constitutively expressed and, in the absence of vanillic acid, binds to P1VanO2 and activates SEAP expression. (B) OFF status: in the presence of vanillic acid, VanA1 is released from P1VanO2 and thus SEAP expression is repressed.
PSV40 VanR VP16 pA
VanA1
pMG250
pMG252 PhCMVmin SEAP pA
P1VanO2
VanO
ON: (no vanillic acid) VanA1
VanA1 SEAP
A
PhCMVmin SEAP pA VanO pMG252
Vanillic acid
VanA1 OFF: (vanillic acid)
PSV40 VanR VP16 pA
VanA1
pMG250
P1VanO2
SEAP
B
Chapter III ___________________________________________________________________________
105
Fig. 1. (C) CHO-K1 cells were transiently transfected with pMG250 (PSV40-VanA1-pA) and pMG252 (P1VanO2-SEAP-pA) and SEAP-expression profiles were assessed 48 h after cultivation of the cells in different concentrations of vanillic acid (0 – 250 µM).
Assessing the impact of vanillic acid on mammalian cell cultures. To assess
the impact of a broad concentration range of vanillic acid on reporter gene production,
viability and cell proliferation of mammalian cell cultures, we exposed CHO-K1 cells,
transfected with pSEAP2-control (PSV40-(SEAP)-pA), to increasing concentrations of
vanillic acid (0, 25, 50, 100, 150, 200, 250, 500 and 1000 µM). The SEAP levels and
cell numbers were scored 48 h after transfection. It was observed that even the highest
concentration of vanillic acid (1000 µM) had no impacts on heterologous protein
production or cell proliferation, both indicators of metabolic integrity and viability (6)
(Figure 2). Thus, the licensed food additive vanillic acid does not impair mammalian
cells up to a concentration of 1000 µM.
VAC-regulated transgene expression in various mammalian cell lines.
Versatility of the VAC-system was assessed by co-transfection of pMG250 (PSV40-
VanA1-pA) and pMG252 (P1VanO2-SEAP-pA) into different immortalized mammalian
cell lines (BHK-21, COS-7, HEK293-T, HeLa, HT-1080 and NIH/3T3) and
cultivation for 48 h in the presence and absence of 250 µM vanillic acid. The samples
were analysed for SEAP production levels (Table 2), which indicated that VAC-
controlled transgene regulation was functional in all tested cell lines, revealing a broad
applicability of this technology.
0
5
10
15
20
25
0 10 20 30 40 50 60 70 80 90 100 150 200 250
SE
AP
Pro
duct
ion
(U/L
)
Vanillic acid (µM)
C
Chapter III ___________________________________________________________________________
106
Figure 2. Impact of vanillic acid on cell proliferation and protein production. CHO-K1 cells were transiently transfected with pSEAP2-control (PSV40-SEAP-pA) and exposed to vanillic acid concentrations ranging from 0 to 1000 µM. SEAP production (bars) and maximum cell densities (line) were assessed after 48 h.
Table 2: Vanillic acid-controlled transgene expression in different mammalian cells
Cell Line 0 µµM Vanillic acid 250 µµM Vanillic acid BHK-21 0.52 ± 0.02 U/l 0.05 ± 0.01 U/l COS-7 17.95 ± 0.55 U/l 0.45 ± 0.02 U/l HEK-293T 484.96 ± 54.24 U/l 20.85 ± 1.24 U/l HeLa 7.89 ± 0.99 U/l 1.38 ± 0.11 U/l HT-1080 0.65 ± 0.11 U/l 0.07 ± 0.01 U/l NIH/3T3 7.41 ± 0.16 U/l 0.28 ± 0.12 U/l
SEAP production was quantified 48h after co-transfection pMG250 (PSV40-VanA1-pA) and pMG252 (P1VanO2-SEAP-pA) into indicated cell lines.
Optimizing the VAC-responsive system I – assessment of promoter
variants containing varying numbers of VAC operator modules. Altering the
number of operator modules in front of an inducible promoter impacts the regulation
performance regarding (i) maximal expression levels, as an increasing number of
operator sequences can recruit more transactivators, and (ii) basal expression of the
system’s repressed state (33,63). To evaluate the optimal number of VanO-operator
sites for VAC-responsive gene regulation, we constructed VanA1-responsive promoter
variants harbouring either one (pMG262, P1VanO1-SEAP-pA; P1VanO1, NruI-VanO-0bp-
PhCMVmin), two (pMG252, P1VanO2-SEAP-pA; P1VanO2, NruI-VanO-Eco47III-VanO-
0bp-PhCMVmin), three (pMG263, P1VanO3-SEAP-pA; P1VanO3, NruI-VanO-Eco47III-
0
2
4
6
8
10
12
0
5
10
15
20
25
30
35
40
45
0 25 50 100 150 250 350 500 1000
SE
AP
Pro
duct
ion
(U/L
)
Vanillic acid (µM)
Chapter III ___________________________________________________________________________
107
VanO-6bp-VanO-0bp-PhCMVmin) or four (pMG264, P1VanO4-SEAP-pA; P1VanO4, NruI-
VanO-Eco47III-VanO-6bp-VanO-Eco47III-VanO-0bp-PhCMVmin) operators immedia-
tely 5’ of the minimal promoter and consequently co-transfected them with pMG250
(PSV40-VanA1-pA) in CHO-K1, HEK293-T and BHK-21 cells to assess their
transcriptional performances. The expression of SEAP was profiled after 48 h of
cultivation in the presence or absence of 250 µM vanillic acid. In all cell lines, it was
observed that an increasing number of operator modules resulted in higher maximum
expression levels but also in higher basal expression of the repressed status of the
VAC-system. The dimeric configuration (pMG252, P1VanO2-SEAP-pA) resulted in the
best regulation performance with a regulation factor of 72-fold in CHO-KI cells and
23-fold in HEK293-T cells, while the trimeric configuration showed the best
performance in BHK-21 cells with a regulation factor of 11 (Figure 3A-C).
A
B
P1VanO1 P1VanO2 P1VanO3 P1VanO4
0
5
10
15
20
25
30
35
40
SE
AP
Pro
duct
ion
(U/L
)
Operator modules
0 µM 250 µM
CHO-K1
0
100
200
300
400
500
600
SE
AP
Pro
duct
ion
(U/L
)
Operator modules
0 µM 250 µM
P1VanO1 P1VanO2 P1VanO3 P1VanO4
HEK-293T
Chapter III ___________________________________________________________________________
108
Figure 3. Validation of vanillic acid-responsive promoter variants containing different numbers of VanO operator modules. Vectors encoding SEAP expression driven by a vanillic acid-responsive promoter harbouring monomeric (pMG262), dimeric (pMG252), trimeric (pMG263) or tetrameric (pMG264) operator modules were co-transfected with pMG250 (PSV40-VanA1-pA) into (A) CHO-K1, (B) HEK-293T and (C) BHK-21 cells and SEAP production was scored after 48 h.
Optimizing the VAC-responsive system II – engineering of different
vanillic acid-dependent transactivator variants. It has been previously shown that
the performance of synthetic mammalian gene regulation systems is influenced by the
kind of mammalian transactivator domain, which is fused to the bacterial DNA
binding protein, in terms of leakiness and maximum expression (19,64). We therefore
characterized different transactivation domains by designing vectors containing VanR
fused to the Herpes simplex-derived VP16 domain (pMG250, PSV40-VanA1-pA;
VanA1, VanR-VP16), the human nuclear factor ‘kappa light chain enhancer’ of
activated B-cells- (NF-!B) derived transactivation domain p65 (pMG256, PSV40-
VanA2-pA; VanA2, VanR-p65) or the transactivation domain of the human E2F
transcription factor (E2F4) (pMG257, PSV40-VanA3-pA; VanA3, VanR-E2F4), and
consequently co-transfected them with pMG252 into CHO-K1, HEK293-T, BHK-21,
HT-1080 and HeLa cells. After 48 h of cultivation in the presence or absence of 250
µM vanillic acid, SEAP production was profiled. The maximum expression levels
varied considerably amongst the different transactivation domains, but also the basal
expression level of the repressed status showed altering performances depending on
C
0.0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
0.9
1.0
SE
AP
Pro
duct
ion
(U/L
)
Operator modules
0 µM 250 µM
P1VanO1 P1VanO2 P1VanO3 P1VanO4
BHK-21
Chapter III ___________________________________________________________________________
109
the transactivator chosen. In general, E2F4 showed the weakest maximum expression
levels within all tested cell lines and could therefore not compete with the best-in-
class regulation performance of VP16 and p65. In CHO-K1, VP16 exhibited the
highest maximum expression paired with the lowest leakiness, making it the
transactivator of choice for this cell line (Figure 4 and Table 3). Peak expression in
HEK293-T cells was achieved by p65, although the high basal expression again
rendered VP16 the best choice in terms of the regulation factor. In HeLa cells, only
VP16 provided a significant transactivation capacity, while in BHK-21 and HT-1080
cells p65 gave the best performance (Table 3). Due to their cell-type specificity, their
graded maximum transcription-initiation capacities and their basal expressions in the
repressed status, the three transactivators offered a selection of different expression
windows and regulation factors depending on the cell line and application chosen.
Table 3: Combinatorial profiling of different VAC transactivators and promoters in various cell types SEAP Production (U/l) pMG252/pMG250 pMG252/pMG256 pMG252/pMG257 Vanillic Acid (250!M)
- + - + - +
BHK-21 0.52 ± 0.02 0.05 ± 0.01 1.22 ± 0.05 0.08 ± 0.01 0.24 ± 0.05 0.04 ± 0.01
CHO-K1 27.06 ± 0.16 0.59 ± 0.01 26.31 ± 1.38
2.13 ± 0.17 15.02 ± 0.44
1.35 ± 0.13
HEK-293T
484.96 ± 54.24
20.85 ± 1.24
1032.46 ± 63.34
54.2 ± 4.00 203.79 ± 36.96
12.79 ± 2.12
HeLa 7.89 ± 0.99 1.38 ± 0.11 1.37 ± 0.06 1.49 ± 0.08 1.49 ± 0.12 1.44 ± 0.07
HT-1080 0.65 ± 0.11 0.07 ± 0.01 1.28 ± 0.15 0.13 ± 0.02 0.13 ± 0.03 0.02 ± 0.00
SEAP production was quantified 48 h after transient co-transfection of pMG252 (P1VanO2-SEAP-pA) and either pMG250 (PSV40-VanA1-pA; VanR-VP16), pMG256 (PSV40-VanA2-pA; VanR-p65) or pMG257 (PSV40-VanA3-pA; VanR-E2F4).
Chapter III ___________________________________________________________________________
110
Optimizing the VAC-responsive system III – promoter variants that differ
in the distance between VAC operator modules and the minimal promoter.
Maximum transcription levels and minimum leakiness are not only influenced by the
number of operator modules recruiting the transactivator molecules, but also by the
relative spacing of the operator modules to the minimal promoter and the resulting
torsion angle of the operator-bound transactivator (65,66). To further assess the
optimal design of PVanO configurations, we engineered spacers of 2 bp increments
between the two VanO modules (VanO2) and PhCMVmin, resulting in SEAP expression
vectors, isogenic to pMG252 (P1VanO2-SEAP-pA) which harbours the default 18 bp
between VanO2 and PhCMVmin, while pMG265 (P2VanO2, VanO2-2bp-PhCMVmin),
pMG266 (P3VanO2, VanO2-4bp-PhCMVmin), pMG267 (P4VanO2, VanO2-6bp-PhCMVmin),
pMG268 (P5VanO2, VanO2-8bp-PhCMVmin) and pMG269 (P6VanO2, VanO2-10bp-PhCMVmin)
contain an additional 2, 4, 6, 8 or 10 bp between VanO2 and PhCMVmin. Any of the
vectors comprising the vanillic acid-responsive promoter variants were co-transfected
with pMG250 (PSV40-VanA1-pA), pMG256 (PSV40-VanA2-pA) or pMG257 (PSV40-
VanA3-pA) into CHO-K1 cells to evaluate the optimal promoter configuration
independently of the transactivator variant. The expression of SEAP was scored 48 h
after cultivation of the transfected cells in media containing 0, 50 or 250 µM of
vanillic acid (Figure 4 A-C). Generally, P1VanO2 exhibited the best regulation
performance in terms of maximal expression and minimal leakiness. The promoter
variants with 2, 4 and 10 bp spacers (pMG265, pMG266 and pMG269) showed
expression performances, which were comparable to the best-in-class configuration
harbouring no spacer (pMG252). However, pMG267 and pMG268 (6 and 8 bp
increments) resulted in a much lower maximal expression. All promoter variants
displayed similar expression profiles for all VanA transactivator variants, implying hat
chimeric promoters and transactivators can be independently optimized.
Chapter III ___________________________________________________________________________
111
Figure 4. Combinatorial validation of the VAC-system in different transactivator and promoter configurations. VAC transactivators employing different transactivation domains (A: VanA1, VanR-VP16; pMG250) (B: VanA2, VanR-p65; pMG256) (C: VanA3, VanR-
A
B
C
0
5
10
15
20
25
30
SE
AP
Pro
duct
ion
(U/L
)
Promoter/VanA1
0 µM 50 µM 250 µM
P1VanO2 P2VanO2 P3VanO2 P4VanO2 P5VanO2 P6VanO2
0
5
10
15
20
25
30
35
SE
AP
Pro
duct
ion
(U/L
)
Promoter/VanA2
0 µM 50 µM 250 µM
P1VanO2 P2VanO2 P3VanO2 P4VanO2 P5VanO2 P6VanO2
0
2
4
6
8
10
12
14
16
18
SE
AP
Pro
duct
ion
(U/L
)
Promoter/VanA3
0 µM 50 µM 250 µM
P1VanO2 P2VanO2 P3VanO2 P4VanO2 P5VanO2 P6VanO2
Chapter III ___________________________________________________________________________
112
E2F4; pMG257) were co-transfected with different vanillic acid-responsive promoter variants containing 0 (P1VanO2; pMG252), 2 (P2VanO2; pMG265), 4 (P3VanO2; pMG266), 6 (P4VanO2; pMG267), 8 (P5VanO2; pMG268) and 10 (P6VanO2; pMG269) base-pair linkers between VanO and the minimal promoter into CHO-K1 cells. All promoter variants drove SEAP expression and the production was profiled 48 h after cultivation of the cells in media containing different concentrations of vanillic acid (0, 50 and 250 µM).
Design of an autoregulated version of the VAC-responsive transgene
expression system. Besides the conventional two-vector design, employing a vector
for constitutive expression of a transactivator and a second vector encoding the
responsive promoter element followed by a gene of interest, we also designed an
autoregulated single vector setup for vanillic acid-inducible gene regulation.
Capitalizing on the polioviral internal ribosome entry site (IRESPV), the configuration
mediates the simultaneous, cap-independent expression of transactivator and reporter
proteins, both driven by the inducible P1VanO2-promoter. Such an autoregulated design
is convenient for overcoming undesired expression variations in transient transfections
and is beneficial for the design of noise-resistant gene networks (67). Transfection of
pMG270 (P1VanO2-SEAP-IRESPV-VanA1-pA) in CHO-K1 cells resulted in a leaky
expression of VanA1, which then in an autoregulated feedback initiated full activation
of the VanA-responsive promoter P1VanO2 to reach maximum levels of SEAP
production and co-cistronic production of VanA1. When 250 µM vanillic acid was
added to the culture, the autoregulated induction was interrupted and SEAP
expression remained in the fully repressed state (0 µM vanillic acid: 9.58 ± 0.29 U/l;
250 µM vanillic acid: 0.30 ± 0.04 U/l). The SEAP levels for this experiment were
scored after 48 h.
Expression kinetics, adjustability and reversibility of VAC-controlled
transgene expression in a stably transgenic CHO-K1 cell line. A detailed
characterization regarding long-term expression, adjustability and reversibility of the
VAC-system requires the creation of a stable cell line. We therefore established stable
CHO-K1-derived VAC-expressing cell lines (CHO-VAC) by sequential transfection
of pMG250 (PSV40-VanA1-pA) and pMG252 (P1VanO2-SEAP-pA) and subsequent
clonal selection. The expression of SEAP was profiled after 48 h for five single clones
from cultures grown in the absence and presence of 500 µM vanillic acid. All clones
Chapter III ___________________________________________________________________________
113
showed similar basal expression levels, but varied substantially in maximum
expression allowing for clonal variation (Figure 5A). Out of the five single clones,
CHO-VAC12 showed the best performance in terms of maximum transgene expression
levels and a regulation factor of 92-fold repression. Furthermore, CHO-VAC12
revealed precise adjustability according to the level of vanillic acid administered to
the medium (Figure 5B) and displayed unchanged maximal expression and repression
levels in long-term cultures of up to 90 days (day 0, ON: 109.13 ± 3.80 U/l, OFF: 1.19
± 0.04 U/l; day 90, ON: 104.36 ± 5.75 U/l, OFF: 1.45 ± 0.09 U/l). Besides excellent
adjustability, rapid response kinetics and reversibility are indispensible for
mammalian gene regulation systems. When cultivating CHO-VAC12 for 72 h, the
system displayed exponential SEAP expression kinetics without vanillic acid in the
medium, whereas upon addition of 500 µM of the inducer, SEAP expression levels
did not significantly exceed the background levels (Figure 5C). Full reversibility of
the VAC-system was monitored when cultivating CHO-VAC12 for 144 h while
alternating the vanillic acid concentration every 48 h between 0 and 500 µM (Figure
5D).
Figure 5. Characterization of a stably transgenic vanillic acid-responsive CHO-K1 cell line. CHO-K1 was stably co-transfected with pMG250 (PSV40-VanA1-pA) and pMG252 (P1VanO2-SEAP-pA) and the resulting CHO-VAC cell lines transgenic for vanillic acid-responsive SEAP expression were characterized. (A) After clonal expansion, individual clones were assessed for their vanillic acid-responsive regulation performance. SEAP levels were profiled after 48 h of cultivation.
A
0
20
40
60
80
100
120
SE
AP
Pro
duct
ion
(U/L
)
- Vac + Vac
CHO-VAC1 CHO-VAC9 CHO-VAC11 CHO-VAC12 CHO-VAC18
Chapter III ___________________________________________________________________________
114
Figure 5. (B) The dose-response profile of CHO-VAC12 was profiled after 48 h of cultivation with increasing concentrations of vanillic acid (0 – 500µM). (C) SEAP expression kinetics of CHO-VAC12 cultivated for 72 h in the presence and absence of 250 µM vanillic acid. (D)
B
0
20
40
60
80
100
120
0 10 20 30 40 50 60 70 80 90 100 150 200 250 500
SE
AP
Pro
duct
ion
(U/L
)
Vanillic acid (µM)
C
D
0
20
40
60
80
100
120
140
160
180
200
0 10 20 30 40 50 60 70 80
SE
AP
Pro
duct
ion
(U/L
)
Time (h)
- +
-
+ Vac Vac
0
20
40
60
80
100
120
140
0 20 40 60 80 100 120 140
SE
AP
Pro
duct
ion
(U/L
)
Time (h)
- +
+ - Vac Vac - Vac - + Vac Vac + Vac
Chapter III ___________________________________________________________________________
115
Reversibility of vanillic acid-mediated transgene expression following periodic addition and removal of the inducer. CHO-VAC12 (80,000 cells/ml) were cultivated for 144 h in the presence and absence of 250 µM vanillic acid. Every 48 h, the cell density was re-adjusted to 80,000 cells/ml and the cells were cultivated in fresh medium with reversed vanillic acid concentrations.
Compatibility of the VAC-system with other transgene regulation systems.
The broad applicability of mammalian transgene regulation systems within complex
synthetic networks is also determined by their ability to function interference-free
alongside other regulation systems that capitalize on different inducers (11,12,36,68).
To assess this important requirement, we transiently transfected CHO-VAC12 with the
established components of the tetracycline- (TETOFF) (24) or the erythromycin- (EOFF)
(18) responsive expression systems. Both, the TETOFF (pSAM200, PSV40-tTA-pA;
pBP99, PhCMV*-1-SAMY-pA) and the EOFF (pWW35, PSV40-ET1-pA; pBP100, PETR3-
SAMY-pA) systems drove the expression of the heat-stable Bacillus
stearothermophilus-derived secreted #-amylase [SAMY, (60)] under a tetracycline, an
erythromycin-responsive promoter. The levels of SEAP and SAMY were scored 48 h
after cultivation of the transiently transfected CHO-VAC12 cell line in the presence
(500 µM; 2 µg/ml) or absence of the different inducers (vanillic
acid/tetracycline/erythromycin) and an interference-free and fully functional
regulation performance was demonstrated for the VAC, TETOFF and EOFF systems
(Table 4A and B). Table 4: Compatibility of vanillic acid-, erythromycin- and tetracycline-responsive transgene control systems A: CHO-VAC12 transfected with the tetracycline-responsive regulation system Inducer - Tet / - Vac - Tet / + Vac + Tet / - Vac + Tet / + Vac
Relative SEAP Production (%)
100 ± 5.62 2.18 ± 0.31 101.04 ± 6.21 2.07 ± 0.29
Relative SAMY Production (%)
100 ± 5.03 99.06 ± 4.53 4.53 ± 0.52 5.01 ± 1.61
Chapter III ___________________________________________________________________________
116
B: CHO-VAC12 transfected with macrolide-responsive regulation system Inducer - EM / - Vac - EM / + Vac + EM / - Vac + EM/ + Vac
Relative SEAP Production (%)
100 ± 6.31 2.56 ± 0.09 102.19 ± 7.08 1.95 ± 0.59
Relative SAMY Production (%)
100 ± 5.67 98.97 ± 7.73 5.20 ± 0.68 4.83 ± 1.22
CHO-VAC12 were co-transfected with pSAM200 (PSV40-tTA-pA) and pBP99 (PhCMV*-1-SAMY-pA) (A) or pWW35 (PSV40-ET1-pA) and pBP100 (PETR3-SAMY-pA) and grown for 48h in the presence and absence of vanillic acid (Vac, 250!M), erythromycin (EM, 2!g/mL) or tetracycline (Tet, 2!g/mL) before SEAP and SAMY production was assessed.
Specificity of the VAC system. VanR plays a key role in the lignin
biodegradation of Caulobacter crescentus. One of the commonly produced
compounds in this pathway is vanillic acid, but closely related compounds, such as
vanillin, were also suggested as being able to directly interact with VanR (51). To
assess the specificity of the VAC system and the capability of isomeric compounds of
vanillic acid to interact with the synthetic mammalian-adapted VanA1 transactivator,
we cultivated CHO-VAC12 for 48 h in media containing 0, 250 and 500 µM of a
comprehensive set of compounds closely related to vanillic acid (2-vanillic acid, 2-
vanillin, acetovanillone, benzaldehyde, benzoic acid, benzyl acetate, benzyl alcohol,
ethyl-vanillate, ethyl-vanillin, eugenol, homovanillic acid, isovanillic acid, isovanillin,
methyl-vanillate, protocatechualdehyde and vanillin). In parallel, we assessed the
toxicity of these compounds on a stable CHO-K1-derived cell line constitutively
expressing SEAP (CHO-SEAP18). Some of the compounds were toxic when
administered to CHO cells at concentrations of 500 µM (2-vanillin, eugenol,
isovanillin, methyl-vanillate and protocatechualdehyde), but none of the 16-tested
structures had the ability to regulate the VAC system, which implies an extraordinary
inducer specificity of this mammalian transgene expression system (Table 5).
Chapter III ___________________________________________________________________________
117
Table 5: Responsiveness of the VAC-system to a variety of molecules chemically closely related to vanillic acid SEAP Production (U/l) CHO-VAC12 CHO-SEAP18
Name Formula 0µM 250µM 500µM 0µM 250µM 500µM
2-vanillic acid
132.23 ± 14.45
129.83 ± 10.69
116.39 ± 8.75
109.45 ± 9.91
110.32 ± 5.57
105.78 ± 6.65
2-vanillin
126.27 ± 10.22
60.35 ± 5.38
19.33 ± 2.89
111.31 ± 6.67
70.02 ± 5.71
19.38 ± 1.21
Aceto-vanillone
130.96 ± 7.61
117.31 ± 0.86
74.73 ± 6.51
115.89 ± 4.32
112.04 ± 3.63
108.01 ± 2.12
Benz-aldehyde
124.08 ± 13.11
125.74 ± 7.21
124.55 ± 7.05
104.90 ± 5.46
105.73 ± 8.32
99.84 ± 4.49
Benzoic acid
131.83 ± 11.36
127.29 ± 7.04
133.41 ± 5.00
100.13 ± 6.92
103.21 ± 7.49
98.01 ± 9.04
Benzyl acetate
126.72 ± 5.96
122.42 ± 7.17
128.65 ± 8.32
105.33 ± 9.26
110.43 ± 9.11
112.76 ± 9.91
Benzyl alcohol
129.11 ± 11.95
134.79 ± 3.76
132.51 ± 4.72
114.54 ± 10.01
107.51 ± 3.96
109.77 ± 5.58
Ethyl-vanillate
130.68 ± 1.86
131.39 ± 8.19
105.82 ± 4.84
112.04 ± 9.83
110.32 ± 4.96
96.21 ± 3.98
Ethyl-vanilline
124.86 ± 4.84
123.87 ± 5.15
110.68 ± 2.75
115.73 ± 11.70
114.68 ± 5.92
115.91 ± 6.56
Chapter III ___________________________________________________________________________
118
Eugenol
132.91 ± 6.82
117.14 ± 3.94
102.47 ± 6.77
110.70 ± 9.08
96.95 ± 5.50
79.66 ± 7.33
Homo-vanillic acid
123.44 ± 3.27
126.34 ± 10.25
130.21 ± 7.74
109.01 ± 4.41
111.07 ± 3.72
108.79 ± 4.58
Iso-vanillic acid
126.62 ± 16.10
124.08 ± 11.04
125.88 ± 9.50
103.54 ± 5.77
100.89 ± 7.55
105.37 ± 6.90
Iso-vanillin
124.72 ± 9.22
105.67 ± 4.08
90.87 ± 5.05
103.61 ± 7.06
95.94 ± 6.81
81.72 ± 5.32
Methyl-vanillate
131.05 ± 2.74
111.13 ± 4.95
91.59 ± 3.14
107.37 ± 5.67
93.88 ± 6.04
77.48 ± 3.31
Proto-catechu-aldehyde
130.50 ± 7.49
32.63 ± 1.41
15.41 ± 0.51
106.63 ± 8.90
62.04 ± 2.01
31.84 ± 1.09
Vanillin
131.45 ± 8.94
129.64 ± 9.22
125.65 ± 6.32
102.95 ± 1.97
104.68 ± 4.00
100.35 ± 6.02
CHO-VAC12 and CHO-SEAP18 were cultivated in medium with and without different derivatives of vanillic acid. SEAP production was quantified 48 h after addition of the chemicals.
Vanillic acid - transgene expression in mice is mediated by a food additive.
For subsequent applications in functional genomics research or future gene therapy
settings, it is essential that state-of-the-art gene regulation systems are functional
within entire organisms. To validate the vanillic acid-induced gene regulation system
in vivo, we injected microencapsulated CHO-VAC12-containing cell implants
intraperitoneally into mice. The treated mice were given a dose of vanillic acid within
the range of 0 – 500 mg/kg twice daily. The SEAP levels were quantified 72 h after
implantation and showed comparable vanillic acid-dependant dose response
Chapter III ___________________________________________________________________________
119
characteristics to the control experiment using the same batch of microencapsulated
CHO-VAC12 cells exposed to vanillic acid in an in vitro setting (Figure 6A and B).
The serum SEAP levels of control mice, encapsulated with constitutively expressing
CHO-SEAP18, were unresponsive to vanillic acid treatment of a twice-daily dose of
500 mg/kg and thus showed similar expression levels as untreated mice (0 mg/kg
vanillic acid: 15.37 ± 1.57 U/l; 500 mg/kg vanillic acid: 16.61 ± 1.33 U/l).
Figure 6. Vanillic acid-controlled SEAP expression in mice. (A) CHO-VAC12 cells were microencapsulated in alginate-poly-(L-lysine)-alginate beads and implanted intraperitoneally into female OF1 mice (4 % 106 cells per mouse). The implanted mice were injected twice daily with different concentrations of vanillic acid. Seventy-two hours after implantation, the level of SEAP in the serum of the mice was determined. (B) SEAP expression profiles of the microencapsulated CHO-VAC12 implant batch were cultivated in vitro for 72 h at different vanillic acid concentrations.
A
B
0
5
10
15
20
25
0 0.5 5 50 500
SE
AP
Pro
duct
ion
(U/L
)
Vanillic acid (mg/kg)
0
20
40
60
80
100
120
140
160
180
200
0 50 100 250 500 1000
SE
AP
Pro
duct
ion
(U/L
)
Vanillic acid (µM)
Chapter III ___________________________________________________________________________
120
Discussion
Heterologous transgene expression control by non-toxic small molecule
inducers remains one of the major challenges for gene therapy scenarios and
biopharmaceutical manufacturing of difficult-to-produce protein therapeutics. The
employed inducers must meet high medical standards and also need to be
physiologically inert for long-term applications in humans. Antibiotics, steroid
hormones, immunosuppressive drugs and a multitude of other regulating molecules
fail to meet these requirements due to their high levels of side-effects, particularly
when given over a long period of time (69-71).
Phenolic acids are a class of compounds that are naturally produced by many
plants, such as vegetables and fruits, and thus are widely distributed throughout
human dietary products, like coffee, wine, beer and vanilla (72). In general, phenolic
acids are said to possess many physiological and pharmacological functions (73) and
vanillic acid, in particular, was successfully evaluated as a suppressor of a potent
snake venom (42), cell apoptosis in Neuro-2A cells (45,46), immune-mediated liver
inflammation in mice (47) and carcinogenesis (44). Being a licensed food additive
with a very agreeable smell (which also enables vanillic acid to be used in fragrances),
this specific phenolic acid combines the ideal properties for functioning as a
physiologically inert inducer molecule in future gene regulation systems. This
judgment is supported by the reported LD50 value of 5.02 g/kg, which was tested
intraperitoneally in rats (74).
Combining the elements of the Caulobacter crescentus VanR-regulated
VanAB gene cluster and mammalian transactivation domains, we created a novel
mammalian heterologous transgene regulation system which responds to the licensed
food additive vanillic acid. The generic design of the VAC system allows for several
configurations using (i) a varying numbers of operators, (ii) different mammalian
transactivation domains and (iii) varying the distance between the specific operator
site and the minimal promoter, to provide ideal setups for different applications within
several mammalian cell lines. Due to the high modularity of the VAC system, we
were able to provide a specific configuration for all of the tested cell types, which
exhibited an optimal regulation performance with high maximal expression and full
Chapter III ___________________________________________________________________________
121
reversibility. Furthermore, the VAC system demonstrated interference-free regulation
characteristics when employed in parallel settings with the TETOFF (24) and the EOFF
systems (18). Owing to its unprecedented specificity (VanA is only responsive to
vanillic acid) the presented regulation unit is likely to be an ideal building block for
complex synthetic networks operating with various inducer inputs. The fact that
vanillic acid is a natural plant component which is licensed as food additive may
facilitate its approval by governmental agencies for applications in the
biopharmaceutical production of difficult-to-express proteins and in gene therapy
approaches, driving the VAC system to the forefront of second generation gene
regulation systems.
Acknowledgments
We thank Beat Kramer and Cornelia Fux for providing pBP99 and pCF59,
respectively; Ghislaine Charpin-El Hamri for technical assistance and Marcel Tigges
for critical comments on the manuscript.
Funding
This work was supported by the Swiss National Science Foundation (grant no.
31003A0-126022) and in part by the EC Framework 7 (Persist).
Chapter III ___________________________________________________________________________
122
References 1. Baumgartel, K., Genoux, D., Welzl, H., Tweedie-Cullen, R.Y., Koshibu, K.,
Livingstone-Zatchej, M., Mamie, C. and Mansuy, I.M. (2008) Control of the
establishment of aversive memory by calcineurin and Zif268. Nat Neurosci, 11, 572-
578.
2. Gitzinger, M., Parsons, J., Reski, R. and Fussenegger, M. (2009) Functional cross-
kingdom conservation of mammalian and moss (Physcomitrella patens) transcription,
translation and secretion machineries. Plant Biotechnol J, 7, 73-86.
3. Ulmer, J.B., Valley, U. and Rappuoli, R. (2006) Vaccine manufacturing: challenges
and solutions. Nat Biotechnol, 24, 1377-1383.
4. Weber, W. and Fussenegger, M. (2007) Inducible product gene expression technology
tailored to bioprocess engineering. Curr Opin Biotechnol, 18, 399-410.
5. Sharpless, N.E. and Depinho, R.A. (2006) The mighty mouse: genetically engineered
mouse models in cancer drug development. Nat Rev Drug Discov, 5, 741-754.
6. Weber, W., Schoenmakers, R., Keller, B., Gitzinger, M., Grau, T., Daoud-El Baba,
M., Sander, P. and Fussenegger, M. (2008) A synthetic mammalian gene circuit
reveals antituberculosis compounds. Proc Natl Acad Sci U S A, 105, 9994-9998.
7. Greber, D. and Fussenegger, M. (2007) Mammalian synthetic biology: engineering of
sophisticated gene networks. J Biotechnol, 130, 329-345.
8. Sanchez-Bustamante, C.D., Kelm, J.M., Mitta, B. and Fussenegger, M. (2006)
Heterologous protein production capacity of mammalian cells cultivated as
monolayers and microtissues. Biotechnol Bioeng, 93, 169-180.
9. Weber, W. and Fussenegger, M. (2006) Pharmacologic transgene control systems for
gene therapy. J Gene Med, 8, 535-556.
10. Deans, T.L., Cantor, C.R. and Collins, J.J. (2007) A tunable genetic switch based on
RNAi and repressor proteins for regulating gene expression in mammalian cells. Cell,
130, 363-372.
11. Kramer, B.P. and Fussenegger, M. (2005) Hysteresis in a synthetic mammalian gene
network. Proc Natl Acad Sci U S A, 102, 9517-9522.
12. Tigges, M., Denervaud, N., Greber, D., Stelling, J. and Fussenegger, M. (2010) A
synthetic low-frequency mammalian oscillator. Nucleic Acids Res, 38, 2702-2711.
13. Tigges, M., Marquez-Lago, T.T., Stelling, J. and Fussenegger, M. (2009) A tunable
synthetic mammalian oscillator. Nature, 457, 309-312.
Chapter III ___________________________________________________________________________
123
14. Gersbach, C.A., Le Doux, J.M., Guldberg, R.E. and Garcia, A.J. (2006) Inducible
regulation of Runx2-stimulated osteogenesis. Gene Ther, 13, 873-882.
15. Kemmer, C., Gitzinger, M., Daoud-El Baba, M., Djonov, V., Stelling, J. and
Fussenegger, M. (2010) Self-sufficient control of urate homeostasis in mice by a
synthetic circuit. Nat Biotechnol, 28, 355-360.
16. Ehrbar, M., Schoenmakers, R., Christen, E.H., Fussenegger, M. and Weber, W.
(2008) Drug-sensing hydrogels for the inducible release of biopharmaceuticals. Nat
Mater, 7, 800-804.
17. Urlinger, S., Helbl, V., Guthmann, J., Pook, E., Grimm, S. and Hillen, W. (2000) The
p65 domain from NF-kappaB is an efficient human activator in the tetracycline-
regulatable gene expression system. Gene, 247, 103-110.
18. Weber, W., Fux, C., Daoud-el Baba, M., Keller, B., Weber, C.C., Kramer, B.P.,
Heinzen, C., Aubel, D., Bailey, J.E. and Fussenegger, M. (2002) Macrolide-based
transgene control in mammalian cells and mice. Nat Biotechnol, 20, 901-907.
19. Weber, W., Kramer, B.P., Fux, C., Keller, B. and Fussenegger, M. (2002) Novel
promoter/transactivator configurations for macrolide- and streptogramin-responsive
transgene expression in mammalian cells. J Gene Med, 4, 676-686.
20. Fussenegger, M., Morris, R.P., Fux, C., Rimann, M., von Stockar, B., Thompson, C.J.
and Bailey, J.E. (2000) Streptogramin-based gene regulation systems for mammalian
cells. Nat Biotechnol, 18, 1203-1208.
21. Gossen, M., Freundlieb, S., Bender, G., Muller, G., Hillen, W. and Bujard, H. (1995)
Transcriptional activation by tetracyclines in mammalian cells. Science, 268, 1766-
1769.
22. Neddermann, P., Gargioli, C., Muraglia, E., Sambucini, S., Bonelli, F., De Francesco,
R. and Cortese, R. (2003) A novel, inducible, eukaryotic gene expression system
based on the quorum-sensing transcription factor TraR. EMBO Rep, 4, 159-165.
23. Weber, W., Rimann, M., Spielmann, M., Keller, B., Daoud-El Baba, M., Aubel, D.,
Weber, C.C. and Fussenegger, M. (2004) Gas-inducible transgene expression in
mammalian cells and mice. Nat Biotechnol, 22, 1440-1444.
24. Gossen, M. and Bujard, H. (1992) Tight control of gene expression in mammalian
cells by tetracycline-responsive promoters. Proc Natl Acad Sci U S A, 89, 5547-5551.
25. Nordstrom, J.L. (2002) Antiprogestin-controllable transgene regulation in vivo. Curr
Opin Biotechnol, 13, 453-458.
Chapter III ___________________________________________________________________________
124
26. Palli, S.R., Kapitskaya, M.Z. and Potter, D.W. (2005) The influence of heterodimer
partner ultraspiracle/retinoid X receptor on the function of ecdysone receptor. Febs J,
272, 5979-5990.
27. Weber, W., Link, N. and Fussenegger, M. (2006) A genetic redox sensor for
mammalian cells. Metab Eng, 8, 273-280.
28. Pollock, R. and Clackson, T. (2002) Dimerizer-regulated gene expression. Curr Opin
Biotechnol, 13, 459-467.
29. Rollins, C.T., Rivera, V.M., Woolfson, D.N., Keenan, T., Hatada, M., Adams, S.E.,
Andrade, L.J., Yaeger, D., van Schravendijk, M.R., Holt, D.A. et al. (2000) A ligand-
reversible dimerization system for controlling protein-protein interactions. Proc Natl
Acad Sci U S A, 97, 7096-7101.
30. Kramer, B.P., Fischer, C. and Fussenegger, M. (2004) BioLogic gates enable logical
transcription control in mammalian cells. Biotechnol Bioeng, 87, 478-484.
31. Hartenbach, S., Daoud-El Baba, M., Weber, W. and Fussenegger, M. (2007) An
engineered L-arginine sensor of Chlamydia pneumoniae enables arginine-adjustable
transcription control in mammalian cells and mice. Nucleic Acids Res, 35, e136.
32. Weber, W., Bacchus, W., Daoud-El Baba, M. and Fussenegger, M. (2007) Vitamin
H-regulated transgene expression in mammalian cells. Nucleic Acids Res, 35, e116.
33. Weber, W., Lienhart, C., Daoud-El Baba, M. and Fussenegger, M. (2009) A Biotin-
triggered Genetic Switch in Mammalian Cells and Mice. Metab Eng.
34. Gitzinger, M., Kemmer, C., El-Baba, M.D., Weber, W. and Fussenegger, M. (2009)
Controlling transgene expression in subcutaneous implants using a skin lotion
containing the apple metabolite phloretin. Proc Natl Acad Sci U S A, 106, 10638-
10643.
35. Aubel, D. and Fussenegger, M. (2010) Mammalian synthetic biology--from tools to
therapies. Bioessays, 32, 332-345.
36. Tigges, M. and Fussenegger, M. (2009) Recent advances in mammalian synthetic
biology-design of synthetic transgene control networks. Curr Opin Biotechnol, 20,
449-460.
37. Weber, W. and Fussenegger, M. (2009) Engineering of synthetic mammalian gene
networks. Chem Biol, 16, 287-297.
38. Sinha, A.K., Sharma, U.K. and Sharma, N. (2008) A comprehensive review on vanilla
flavor: extraction, isolation and quantification of vanillin and others constituents. Int J
Food Sci Nutr, 59, 299-326.
Chapter III ___________________________________________________________________________
125
39. Sostaric, T., Boyce, M.C. and Spickett, E.E. (2000) Analysis of the volatile
components in vanilla extracts and flavorings by solid-phase microextraction and gas
chromatography. J Agric Food Chem, 48, 5802-5807.
40. Lesage-Meessen, L., Delattre, M., Haon, M., Thibault, J.F., Ceccaldi, B.C., Brunerie,
P. and Asther, M. (1996) A two-step bioconversion process for vanillin production
from ferulic acid combining Aspergillus niger and Pycnoporus cinnabarinus. J
Biotechnol, 50, 107-113.
41. Muskiet, F.A. and Groen, A. (1979) Urinary excretion of conjugated homovanillic
acid, 3,4-dihydroxyphenylacetic acid, p-hydroxyphenylacetic acid, and vanillic acid
by persons on their usual diet and patients with neuroblastoma. Clin Chem, 25, 1281-
1284.
42. Dhananjaya, B.L., Nataraju, A., Rajesh, R., Raghavendra Gowda, C.D., Sharath,
B.K., Vishwanath, B.S. and D'Souza, C.J. (2006) Anticoagulant effect of Naja naja
venom 5'nucleotidase: demonstration through the use of novel specific inhibitor,
vanillic acid. Toxicon, 48, 411-421.
43. Dhananjaya, B.L., Nataraju, A., Raghavendra Gowda, C.D., Sharath, B.K. and
D'Souza, C.J. (2009) Vanillic acid as a novel specific inhibitor of snake venom 5'-
nucleotidase: a pharmacological tool in evaluating the role of the enzyme in snake
envenomation. Biochemistry (Mosc), 74, 1315-1319.
44. Vetrano, A.M., Heck, D.E., Mariano, T.M., Mishin, V., Laskin, D.L. and Laskin, J.D.
(2005) Characterization of the oxidase activity in mammalian catalase. J Biol Chem,
280, 35372-35381.
45. Huang, S.M., Hsu, C.L., Chuang, H.C., Shih, P.H., Wu, C.H. and Yen, G.C. (2008)
Inhibitory effect of vanillic acid on methylglyoxal-mediated glycation in apoptotic
Neuro-2A cells. Neurotoxicology, 29, 1016-1022.
46. Huang, S.M., Chuang, H.C., Wu, C.H. and Yen, G.C. (2008) Cytoprotective effects of
phenolic acids on methylglyoxal-induced apoptosis in Neuro-2A cells. Mol Nutr Food
Res, 52, 940-949.
47. Itoh, A., Isoda, K., Kondoh, M., Kawase, M., Kobayashi, M., Tamesada, M. and
Yagi, K. (2009) Hepatoprotective effect of syringic acid and vanillic acid on
concanavalin a-induced liver injury. Biol Pharm Bull, 32, 1215-1219.
48. Poindexter, J.S. (1964) Biological Properties and Classification of the Caulobacter
Group. Bacteriol Rev, 28, 231-295.
Chapter III ___________________________________________________________________________
126
49. Boerjan, W., Ralph, J. and Baucher, M. (2003) Lignin biosynthesis. Annu Rev Plant
Biol, 54, 519-546.
50. Martinez, A.T., Speranza, M., Ruiz-Duenas, F.J., Ferreira, P., Camarero, S., Guillen,
F., Martinez, M.J., Gutierrez, A. and del Rio, J.C. (2005) Biodegradation of
lignocellulosics: microbial, chemical, and enzymatic aspects of the fungal attack of
lignin. Int Microbiol, 8, 195-204.
51. Thanbichler, M., Iniesta, A.A. and Shapiro, L. (2007) A comprehensive set of
plasmids for vanillate- and xylose-inducible gene expression in Caulobacter
crescentus. Nucleic Acids Res, 35, e137.
52. Harwood, C.S. and Parales, R.E. (1996) The beta-ketoadipate pathway and the
biology of self-identity. Annu Rev Microbiol, 50, 553-590.
53. Segura, A., Bunz, P.V., D'Argenio, D.A. and Ornston, L.N. (1999) Genetic analysis
of a chromosomal region containing vanA and vanB, genes required for conversion of
either ferulate or vanillate to protocatechuate in Acinetobacter. J Bacteriol, 181,
3494-3504.
54. Brunel, F. and Davison, J. (1988) Cloning and sequencing of Pseudomonas genes
encoding vanillate demethylase. J Bacteriol, 170, 4924-4930.
55. Merkens, H., Beckers, G., Wirtz, A. and Burkovski, A. (2005) Vanillate metabolism
in Corynebacterium glutamicum. Curr Microbiol, 51, 59-65.
56. Nishimura, M., Ishiyama, D. and Davies, J. (2006) Molecular cloning of streptomyces
genes encoding vanillate demethylase. Biosci Biotechnol Biochem, 70, 2316-2319.
57. Mitta, B., Rimann, M., Ehrengruber, M.U., Ehrbar, M., Djonov, V., Kelm, J. and
Fussenegger, M. (2002) Advanced modular self-inactivating lentiviral expression
vectors for multigene interventions in mammalian cells and in vivo transduction.
Nucleic Acids Res, 30, e113.
58. Greber, D. and Fussenegger, M. (2007) Multi-gene engineering: simultaneous
expression and knockdown of six genes off a single platform. Biotechnol Bioeng, 96,
821-834.
59. Berger, J., Hauber, J., Hauber, R., Geiger, R. and Cullen, B.R. (1988) Secreted
placental alkaline phosphatase: a powerful new quantitative indicator of gene
expression in eukaryotic cells. Gene, 66, 1-10.
60. Schlatter, S., Rimann, M., Kelm, J. and Fussenegger, M. (2002) SAMY, a novel
mammalian reporter gene derived from Bacillus stearothermophilus alpha-amylase.
Gene, 282, 19-31.
Chapter III ___________________________________________________________________________
127
61. Fluri, D.A., Kemmer, C., Daoud-El Baba, M. and Fussenegger, M. (2008) A novel
system for trigger-controlled drug release from polymer capsules. J Control Release,
131, 211-219.
62. Triezenberg, S.J., Kingsbury, R.C. and McKnight, S.L. (1988) Functional dissection
of VP16, the trans-activator of herpes simplex virus immediate early gene expression.
Genes Dev, 2, 718-729.
63. Malphettes, L., Weber, C.C., El-Baba, M.D., Schoenmakers, R.G., Aubel, D., Weber,
W. and Fussenegger, M. (2005) A novel mammalian expression system derived from
components coordinating nicotine degradation in arthrobacter nicotinovorans pAO1.
Nucleic Acids Res, 33, e107.
64. Weber, W. and Fussenegger, M. (2002) Artificial mammalian gene regulation
networks-novel approaches for gene therapy and bioengineering. J Biotechnol, 98,
161-187.
65. Muller, J., Oehler, S. and Muller-Hill, B. (1996) Repression of lac promoter as a
function of distance, phase and quality of an auxiliary lac operator. J Mol Biol, 257,
21-29.
66. Sathya, G., Li, W., Klinge, C.M., Anolik, J.H., Hilf, R. and Bambara, R.A. (1997)
Effects of multiple estrogen responsive elements, their spacing, and location on
estrogen response of reporter genes. Mol Endocrinol, 11, 1994-2003.
67. Becskei, A., Kaufmann, B.B. and van Oudenaarden, A. (2005) Contributions of low
molecule number and chromosomal positioning to stochastic gene expression. Nat
Genet, 37, 937-944.
68. Kramer, B.P., Viretta, A.U., Daoud-El-Baba, M., Aubel, D., Weber, W. and
Fussenegger, M. (2004) An engineered epigenetic transgene switch in mammalian
cells. Nat Biotechnol, 22, 867-870.
69. Kuypers, D.R. (2005) Benefit-risk assessment of sirolimus in renal transplantation.
Drug Saf, 28, 153-181.
70. Sanchez, A.R., Rogers, R.S., 3rd and Sheridan, P.J. (2004) Tetracycline and other
tetracycline-derivative staining of the teeth and oral cavity. Int J Dermatol, 43, 709-
715.
71. Wurm, F.M. (2004) Production of recombinant protein therapeutics in cultivated
mammalian cells. Nat Biotechnol, 22, 1393-1398.
72. Stalikas, C.D. (2008), Vol. 610, pp. 65-90.
Chapter III ___________________________________________________________________________
128
73. Nardini, M., Pisu, P., Gentili, V., Natella, F., Di Felice, M., Piccolella, E. and
Scaccini, C. (1998) Effect of caffeic acid on tert-butyl hydroperoxide-induced
oxidative stress in U937. Free Radic Biol Med, 25, 1098-1105.
74. Comptes Rendus Hebdomadaires des Seances. (1956) Academie des Sciences, Vol.
243, 609.
Conclusion ___________________________________________________________________________
129
Conclusion
Latest advances in the control of synthetic mammalian gene expression have led to a
multitude of unprecedented advances in the field of synthetic biology. Meanwhile
applications of synthetically engineered circuits within gene therapy approaches and
biopharmaceutical production come closer to reality. Although extensive research was
performed on the optimization of protein production levels within mammalian cells,
the increasing demand for biopharmaceuticals sets the challenge for industry to
overcome the current bottleneck within biopharmaceutical production of difficult-to-
produce proteins by mammalian cells. One potential alternative to handle this
bottleneck could be the introduction of alternative production organisms. We have
shown here the potential of the moss Physcomitrella patens to function as an
alternative production organism, being able to grow in fully contained and controlled
environments of bioreactors and most importantly being able to functionally employ a
whole set of ready to use mammalian synthetic molecular tools without any additional
modifications. We were able to show the cross kingdom conservation of the
mammalian and moss transcription, translation and secretion machineries giving way
to a whole set of constitutive, conditional and autoregulated expression possibilities
for the production any genes of interest. Still there are hurdles to be taken, before the
moss can function as a full alternative to mammalian cell culture production, one of
them being the relatively low yield of moss heterologous protein production.
However, the synthetic biology toolbox we provided in this work, taken together with
the prototype biopharmaceutical production in microencapsulated protoplasts will
help researchers to overcome these hurdles and potentially enable the high quality and
yield production at low cost of complex to produce biopharmaceuticals within a moss.
Besides the transfer of a synthetic biology toolbox to the moss Physcomitrella
patens, we were able to establish two novel gene regulations systems, which are
responsive to second-generation inducer molecules (phloretin and vanillic acid),
which are physiological inert and provide interference free, precise product gene
adjustability. The described PEACE-system is the first ever regulation system, which
enables expression control via the skin. We have tested this system in a prototype
Conclusion ___________________________________________________________________________
130
study using a phloretin containing skin lotion, which we applied to the shaved skin of
mice that carried microencapsulated cells engineered with the PEACE-system under
their skin. The system shows excellent regulation performance and could potentially
become a valid gene therapy application for in the treatment of patients with growth
hormones or other therapeutic proteins. The next steps would include the long-term
fine-tuning of a therapeutic protein to treat mice containing a corresponding disease
model. The VAC-system provides similar potential for future gene therapy
approaches, being responsive to a licensed food additive and thus not expecting any
pleiotropic side effects from the inducer molecule. To add to the patient compliance,
vanillic acid has pleasant smell and taste for potential oral applications. Similar to the
PEACE-system, the next step would be to test the system together with an industry
partner for the applicability in an animal disease model. Other than for gene
therapeutic applications, both systems will add to the versatility of the available
synthetic biology building blocks to construct complex synthetic networks, enable
biopharmaceutical production of complex-to-produce proteins and be employed in
drug discovery, as both systems equally have excellent regulation capabilities with
high maximal expression, very low leakage and fast reaction times.
Acknowledgments ___________________________________________________________________________
131
Acknowledgements
I would like to thank everyone participating in my projects, either by providing
critical input, a helping hand or sharing funny moments at work.
Prof. Dr. Martin Fussenegger for the opportunity to conduct my research work in his
laboratory, the continuous support during my PhD-studies and the opportunity to
create a promising ETH Spin Off company.
Prof. Dr. Sven Panke for his work as co-examiner, Prof. Dr. Ralf Reski and his lab for
the collaboration and support on the P.patens project.
Prof. Dr. Wilfried Weber for his support throughout my PhD studies.
A special “thanks” goes to Dr. Marcel Tigges for his friendship, guidance and the
shared passion and belief in our Start-Up company BioVersys.
Dr. Christian Kemmer, Dr. David Fluri, Marius Müller and the Fussi-lab gang for the
great times during work, the breaks and leisure time.
All my friends, especially Florian, Manuel, Katrin and Christian, Marcel and Mark for
their mental support and the great times outside the lab.
My girlfriend Sylwia Wojtas for her support, patience and love.
My very special thanks are addressed to my parents, Christa and Constant Gitzinger,
my grandparents and my Family for their permanent support, their help and love
during all situations of life.
Curriculum Vitae ____________________________________________________________________________
132
Marc Gitzinger
Bottmingerstrasse 5 D.O.B: 6th April 1981 CH-4102, Binningen P.O.B: Saarbruecken/Germany Switzerland Nationality: Luxembourg Mobile: + 41 79 822 5716 E-mail: [email protected] Gender: Male EDUCATION
June 2005 – Sept. 2010 Swiss Federal Institute of Technology Zurich (ETH Zürich) / Switzerland Doctoral studies in Applied Biotechnology, Title: “Engineering of Synthetic Mammalian Gene Networks and their cross kingdom conservation”
April 2003 – April 2004 University of Queensland, Brisbane / Australia
Master Thesis, Title: “Functional Characterization of the Heterotrimeric G-Protein " subunits in Plants”
Oct. 1999 – May 2004 Albert Ludwigs University Freiburg i. Br. / Germany
Diploma in Biology (M.Sc.), Studies of Biology, focus: Plant Biotechnology, Cell Biology, Molecular Genetics and Business Administration
Sept. 1989 – June 1999 European School, European Baccalaureate, Luxembourg Finished in 1997 the “Latinum” Sept. 1986 – June 1989 Primary School “Hochtaunuskreis” Usingen / Germany
WORK EXPERIENCE
Sep. 2008 – ongoing BioVersys AG, Innovative Antibacterial Drugs Co-Founder and CEO; ETHZ Spin-Off that focuses on the R&D of new antibacterial drugs; www.bioversys.com
Nov. 2004 – Feb. 2005 Internship at McKinsey & Company
Associate Intern; Project within the Pharma/ Healthcare Sector: “Market Penetration and Business Strategy for a new medical device”
Jan. 2001 – March 2003 Assistant at the Socrates / Erasmus – exchange office, Faculty of
Biology at the Albert Ludwigs University Freiburg i. Br. “Managing of exchange agreements with the European Partner Universities; Counseling of incoming foreign- and the outgoing- students”
Aug. 2002 – Oct. 2002 Internship at the patent agency Joachim Stürken GmbH,
Freiburg i. Br. “Structuring patents; Writing patent applications; Counseling and 0 recruiting of a new client; Trade Mark Right”
Curriculum Vitae ____________________________________________________________________________
133
August 2001 Internship at the patent agency Ernest Freylinger S.A. Luxembourg “Translation of patents from English to French and German; Learning the basics of patent structuring; Writing a patent application”
GRANTS AND AWARDS
2009 3 years personal coaching of Genilem; www.genilem-suisse.ch 2008 Part of the Suisse Venture Leaders 2008; www.venturelab.ch 2003 Scholar of the “Landesstiftung Baden-Württemberg” as part of the UNIVERSITAS 21 exchange program
LANGUAGES AND COMPUTER SKILLS
Languages: German (mother tongue) French (fluent) English (fluent) Luxembourgish (fluent) Computer Skills: General Office Applications (Word, Excel, Power Point); Specialized
Biological Software (microarray analysis, cloning, FACS) EXTRA CURRICULAR ACTIVITIES
• Working for Promotions for several agencies and companies in Germany and Australia • Snowboard teacher at the “Skischule Hochschwarzwald, Feldberg” • Member of the committee of Luxembourg’s student association in Freiburg i. Br. • Member of the cycling club “RV Schwalbe Trier” (former youth representative)
Publications and patents ___________________________________________________________________________
134
Publications Marc Gitzinger, Christian Kemmer, David A. Fluri, Marie Daoud El-Baba, Wilfried Weber, Martin Fussenegger (2010). Transcriptional control in mammalian cells and mice via the food additive vanillic acid. Submitted Christian Kemmer, Marc Gitzinger, Marie Daoud El-Baba, Valentin Djonov, Jörg Stelling, Martin Fussenegger (2010). Self-sufficient control of urate homeostasis in mice by a synthetic circuit. Nat. Biotechnol. 28 (4): 355-360. Marc Gitzinger, Christian Kemmer, Marie Daoud El-Baba, Wilfried Weber, and Martin Fussenegger (2009). Controlling transgene expression in subcutaneous implants using a skin lotion containing the apple metabolite phloretin. Proc. Natl. Acad. Sci. USA,106: 10638-10643. Marc Gitzinger, Juliana Parsons, Ralf Reski, and Martin Fussenegger (2009). Functional cross-kingdom conservation of mammalian and moss (Physcomitrella patens) transcription, translation and secretion machineries. Plant Biotechnol. J. 7: 73-86. Wilfried Weber, Ronald Schoenmakers, Bettina Keller, Marc Gitzinger, Thomas Grau, Peter Sander, and Martin Fussenegger (2008). A synthetic mammalian gene circuit reveals antituberculosis compounds. Proc. Natl. Acad. Sci. USA, 105: 9994-9998. Patent applications Gitzinger M. and Fussenegger M. (2009). Controlling transgene expression across the skin. (EP09005216) Ronald Schoenmakers, Wilfried Weber, Marc Gitzinger, Marcel Tigges, Martin Fussenegger, Peter Schneider (2009). Composition for treatment of Tuberculosis. (EP09163765)