Accepted Manuscript
Enrichment of rainbow trout (Oncorhynchus mykiss) fingerlings diet with microbiallysozyme: Effects on growth performance, serum and skin mucus immuneparameters
Meysam Shakoori, Seyed Hossein Hoseinifar, Hamed Paknejad, Valiollah Jafari,Roghieh Safari, Hien Van Doan, Mansour Torfi Mozanzadeh
PII: S1050-4648(18)30796-4
DOI: https://doi.org/10.1016/j.fsi.2018.11.077
Reference: YFSIM 5764
To appear in: Fish and Shellfish Immunology
Received Date: 6 September 2018
Revised Date: 25 November 2018
Accepted Date: 30 November 2018
Please cite this article as: Shakoori M, Hoseinifar SH, Paknejad H, Jafari V, Safari R, Van Doan H,Mozanzadeh MT, Enrichment of rainbow trout (Oncorhynchus mykiss) fingerlings diet with microbiallysozyme: Effects on growth performance, serum and skin mucus immune parameters, Fish andShellfish Immunology (2019), doi: https://doi.org/10.1016/j.fsi.2018.11.077.
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service toour customers we are providing this early version of the manuscript. The manuscript will undergocopyediting, typesetting, and review of the resulting proof before it is published in its final form. Pleasenote that during the production process errors may be discovered which could affect the content, and alllegal disclaimers that apply to the journal pertain.
MANUSCRIP
T
ACCEPTED
ACCEPTED MANUSCRIPT
1
Enrichment of rainbow trout (Oncorhynchus mykiss) fingerlings diet with microbial 1
lysozyme: effects on growth performance, serum and skin mucus immune parameters 2
Running title: Microbial lysozyme and rainbow trout health 3
4
Meysam Shakoori1, Seyed Hossein Hoseinifar1*, Hamed Paknejad1, Valiollah Jafari1, Roghieh 5
Safari1, Hien Van Doan2*, Mansour Torfi Mozanzadeh3 6
7
1Department of Fisheries, Faculty of Fisheries and Environmental Sciences, Gorgan University 8
of Agricultural Sciences and Natural Resources, Gorgan, Iran 9
2Department of Animal and Aquatic Sciences, Faculty of Agriculture, Chiang Mai University, 10
Chiang Mai 50200, Thailand 11
3South Iran Aquaculture Research Centre, Iranian Fisheries Science Institute (IFSRI), 12
Agricultural Research Education and Extension organization (AREEO), Ahwaz, Iran 13
14
*Author for correspondence: H Van Doan, E-mail address: [email protected] 15
16
Footnotes: 17
Source of financial support: The research project was funded by Functional Food Research 18
Center for Well-being, Chiang Mai University, Thailand 19
Conflict of interest statement: There is no conflict of interest to declare 20
21
22
23
MANUSCRIP
T
ACCEPTED
ACCEPTED MANUSCRIPT
2
Abstract 24
A two-month study was conducted to determine the influence of different levels of microbial 25
lysozyme (LZ) contents (0, 0.5, 1.0, and 1.5 g kg-1 of diet) on growth performance, serum and 26
skin mucus immune parameters as well as intestinal immune-related genes expression in rainbow 27
trout Oncorhynchus mykiss fingerlings (5.5 ± 0.1 g). Growth performance and feed utilization 28
were not affected significantly by dietary LZ. Fish fed LZ-supplemented diets had higher serum 29
total immunoglobulins concentration than the control group. In addition, fish fed 1.5 g LZ kg-1 30
diet had the highest skin mucosal total protein and immunoglobulin contents compared to other 31
experimental groups. Furthermore, skin mucosal lysozyme and alkaline phosphatase activities as 32
well as intestinal tumor necrosis factor-α and interlukine-1β relative genes expression were 33
higher in fish fed 1.0 and 1.5 g LZ kg-1 diets than the other groups. Overall, the present results 34
clearly showed that LZ powder can be considered as a potential immunostimulant in O. mykiss 35
fingerlings, but in the long term period it may result in negative effects on intestinal health as a 36
consequence of inducing pro-inflammatory cytokines gene expression in the intestine. 37
Keywords: Microbial lysozyme; Rainbow trout; Skin mucosal immunity; Immune-related gene 38
expression 39
40
41
42
43
44
45
46
MANUSCRIP
T
ACCEPTED
ACCEPTED MANUSCRIPT
3
Introduction 47
Rainbow trout is among one of the most important cultured fish in several countries. Nowadays, 48
intensive and super-intensive culture systems are common for trout culture. There are increasing 49
concerns about using antibiotics in rainbow trout culture to overcome infectious diseases. Using 50
immunostumulants as bio-friendly agents is a sustainable way for reducing side effects of 51
applying antibiotics in aquaculture [1-6]. Among different kinds of immunostimulant classes 52
(e.g. probiotic, prebiotic and symbiotic), lysozyme (muramidase, EC 3.2.1.17) (LZ), which is a 53
natural endogenous antibiotic has been proven to induce specific and non-specific immune 54
responses in teleosts [7-9]. Lysozyme as a mucolytic and antibacterial enzyme is widely 55
distributed in animal body fluids (e.g. saliva, mucus, tears, serum) [10]. This enzyme has several 56
physicochemical properties including high resistant to acid digestion and proteases in 57
gastrointestinal tract, heat-resistant, low-molecular-weight, as well as non-toxic; which is makes 58
it as a promising immunostimulant in aquaculture [9, 11, 12]. In addition, LZ act as natural 59
immunostimulant with antibacterial, antiviral, antimetastatic and anti-inflammatory properties 60
suggesting this enzyme may be a potential antibiotic alternative [10]. A plethora of studies 61
available on positive effects of dietary LZ on growth enhancement [9, 13], humoral (e.g. 62
alternative complement pathway hemolysis, lysozyme and myeloperoxidase activities, total Ig) 63
and cellular (e.g. phagocytosis activity of neutrophils and macrophages, respiratory burst, 64
lymphocyte proliferation and antibody secretion) immune responses [7-9, 14], disease resistance 65
[9], oxidative stress [15], intestinal microbiome and intestinal morphology [9, 15-18], as well as 66
cytokines gene expression [15, 18] in fish, poultry and pig. However, to our best knowledge, no 67
research has been determined immunomodulatory impact of exogenous LZ on health condition 68
in aquaculture fish species. Thus, in our study we want to evaluate the influence of dietary LZ 69
MANUSCRIP
T
ACCEPTED
ACCEPTED MANUSCRIPT
4
inclusion on performance, immune response and intestinal cytokines gene expression in rainbow 70
trout Oncorhynchus mykiss fingerlings. 71
72
Materials and Methods 73
Experimental setup 74
This study was carried out in the laboratory in Gorgan University of Agricultural and Natural 75
Resources, Gorgan, Iran. One hundred and twenty O. mykiss fingerlings purchased from a 76
private farm and were transferred to the laboratory then adapted to experimental condition for 77
two weeks. Following adaptation to experimental condition, fish (initial body weight (BWi) = 5.5 78
± 0.1 g) were randomly distributed among twelve fiberglass 200-L tanks (n = 10 fish per tank) 79
supplied with filtered fresh water and continuous aeration, and 50% of water was exchanged 80
daily. The mean values of water temperature, dissolved oxygen and pH were 16.2 ± 0.9 °C, 6.1 ± 81
0.2 mg L−1 and 7.6 ± 0.2, respectively. A commercial feed (Coppens Co., Netherland; 48% crude 82
protein, 22% crude fat, 8.8% ash, 0.9% fiber; 20.7 MJ Kg-1 digestible energy) was supplemented 83
with the (Microbial lysozyme 10%, fermented lysozyme use as feed additives, Zhejiang Aegis 84
Biotech Co., Ltd) graded levels of LZ powder according to the recommended dose reported in 85
the previous studies [9, 13] including: 0 (control), 0.5, 1.0 and 1.5 g LZ kg-1 diet, respectively. In 86
this regard, the basal diet was ground in order to produce a fine powder and then supplemented 87
with the above-mentioned LZ dosages, then thoroughly mixed and water was added to produce 88
dough according to [19]. The dough was pelleted using a meat grinder to obtain pellets with size 89
of 2 mm, then pellets were dried in a convection oven at 25 °C for 24 h and stored at −20 °C 90
until used. 91
MANUSCRIP
T
ACCEPTED
ACCEPTED MANUSCRIPT
5
Fish were manually-fed three times (0800, 1200 and 1600) at rate of 3% of BWi daily for two 92
months. Feeding ratio was corrected based on biometry which was done every 10 days. Utmost 93
care was considered to avoid feed loose. 94
Immunological parameters 95
Sample collection 96
At the end of feeding trial, fish were fasted for a day and weight (BWf) were measured, 97
individually to assess growth performance and feed utilization parameters. Nine fish of each 98
experimental treatment were randomly bled from the caudal vein with syringe after 99
anaesthetizing by clove powder (500 mg L-1). Then after, blood was allowed to clot (at 4 °C for 4 100
h), centrifuged and stored at -80 °C until use. For evaluating skin-related lymphoid immune 101
system, mucus was collected according to Ross et al. [20] method. In this regard, at the end of 102
feeding trial fish (9 fish per treatment) was anaesthetized with the same anesthetic and 103
individually was transferred to a polyethylene bag containing 10 mL of 50 mM NaCl (Sigma, 104
Steinheim, Germany) and gently rubbed for approximately 1 min to mucus collection. 105
Thereafter, obtained mucus was prepared and stored at -80 °C until use according to 106
Khodadadianzou et al. [21]. 107
Immunological parameters 108
The levels of LZ in mucus was determined using a turbidimetric assay according to Ellis [22] by 109
measuring the lytic activity of O. mykiss serum against lyophilized Micrococcus luteus (Sigma, 110
St Louis, MO, USA). Serum and skin mucosal total immunoglobulin (Ig) was measured using 111
the method described by Siwicki et al. [23]. Total protein concentration was determined by using 112
a commercial kit (Zist Shimi kits, Iran) according to the manufacture instruction. Alkaline 113
MANUSCRIP
T
ACCEPTED
ACCEPTED MANUSCRIPT
6
phosphatase activity of the mucus was measured using a commercial kit (Pars Azmon Co, 114
Tehran, Iran) according to the manufacturer protocol. 115
RNA extraction and relative mRNA expression of intestinal cytokines 116
After the feeding period, 3 fish from each replicate (n = 9 fish per treatment) were randomly 117
euthanized with overdose anesthetic, and immediately eviscerated on ice surface, then intestine 118
was dissected for intestinal cytokines gene expression assays. The intestine was frozen 119
immediately in liquid nitrogen and stored at -80 oC until RNA extraction. Total RNA of samples 120
was isolated using BIOZOL RNA extraction kit (Bioflux-Bioer, China) according to the 121
manufacturer's instructions. For prohibiting contamination of samples with genomic DNA, total 122
RNA was treated with DNase I (Fermentas, Lithuania). Afterwards, the quantity and 123
concentration of RNA were measured using nanodrop spectrophotometer (Nanodrop technology, 124
Wilmington, DE, USA) at 260 and 280 nm (A260:A280 > 1.8 were selected for further 125
experiments) following electrophoresis on a 1.5% agarose gel. The reverse transcription was 126
used to synthesize the first-strand cDNA using transcription Kit (Fermentas, Lithuania) [19]. The 127
conserved regions of Cyprinus carpio Gene Bank were used for designing the primers sequences 128
by means of by Oligo7 software (Table 1). Quantitative real-time PCR assays were performed in 129
triplicate to study the effects of dietary lysozyme inclusion on the expression of intestinal 130
cytokines (TNF-α, IL-1ß) in O. mykiss as described by Miandare et al. [19]. For normalizing the 131
expression of the cytokine genes, β-actin was used as the housekeeping gene. Data was analyzed 132
using the iQ5 optical system software (Bio-Rad) and DDCt method. 133
Statistical analyses 134
Data were analyzed using SPSS version 19 (Chicago, IL, USA). One-way analysis of variance 135
was performed at a significance level of 0.05 following the confirmation of normality (Shapiro–136
MANUSCRIP
T
ACCEPTED
ACCEPTED MANUSCRIPT
7
Wilk’s test) and homogeneity (Levene’s test) of variance. Duncan’s multiple-range procedure 137
was used for multiple comparisons. 138
139
Results 140
The results the present study showed that growth performance and feed utilization were not 141
significantly affected by dietary LZ in O. mykiss (P > 0.05, Table 2). 142
Results showed that fish fed 0.5, 1.0, and 1.5 g LZ kg-1 diets had higher serum total 143
immunoglobulins concentration than the control group (P < 0.05, Fig. 1). The highest total 144
serum Ig were noticed in rainbow trout fed 1.0 and 1.5 g LZ kg-1 diets. However, no significant 145
difference in total serum Ig was found between 1.0 and 1.5 g LZ kg-1 diets (P > 0.05). 146
Regarding mucosal immune response, fish in 1.5 g LZ kg-1 diet had higher total protein (Fig. 2a) 147
and Ig (Fig. 2b) in the mucus than the control and other supplemented groups (P < 0.05). 148
Similarly, fish fed 1.0 and 1.5 g LZ kg-1 diets had higher mucosal lysozyme (Fig. 3a) and 149
alkaline phosphatase (Fig. 3b) activities than the control and 0.5 g LZ kg-1 group (P < 0.05). 150
For intestinal cytokines gene expression, fish in 1.0 and 1.5 g LZ kg-1 groups showed significant 151
higher relative TNF-α (Fig. 4a) and IL1β (Fig. 4b) gene expression compared to the control and 152
0.5 g LZ kg-1 group (P < 0.05). 153
Discussion 154
The results of present study showed that not only innate immune responses improved in fish fed 155
LZ supplemented diets, but also intestinal cytokines genes expression up-regulated by dietary 156
LZ. It has been postulated that dietary LZ can induce non-specific immune responses through 157
noticeable regulation of intestinal cytokines and antioxidant genes expression as well as 158
modulating intestinal microbiome (e.g. increasing Lactobacillus counts) [15]. In addition, it is 159
MANUSCRIP
T
ACCEPTED
ACCEPTED MANUSCRIPT
8
assumed that immuno-stimulating process of LZ associated with the LZ-digested products of 160
bacterial envelop structure that promote the innate immune reaction [24, 25], antibodies and 161
cytokines secretion [15] as well as can activate nuclear factor κB(NF-κB) pathway, which induce 162
the expression of pro-inflammatory cytokine genes [15, 26]. 163
Immunoglobulins are heterodimeric glycoproteins that play a vital role in recognizing natural 164
antigens and found in the skin, gill and gut mucus, bile as well as systemically found in the 165
plasma of fish [27]. In our study, higher serum total Ig content was noticed in fish fed 1.0 and 1.5 166
g LZ kg-1 diets that was coincided with the over-expression of intestinal inflammatory cytokines 167
(TNF-α and IL1ß), suggesting immunomodulatory effects of LZ on specific immune responses. 168
In accordance with this result, supplementing diet with immunostimulants such as date palm fruit 169
extract (DPFE) [28], white bottom mushroom powder (Agaricus bisporus) (WBMP) [21] and a 170
symbiotic (galactooligosaccharide and P. acidilactici) Modanloo et al. [29] increased serum total 171
Ig in common carp (Cyprinus carpio). 172
The fish skin mucus acts as a frontier defensive barrier to many infectious pathogens through 173
skin-associated lymphoid tissue including adaptive (e.g. B and T lymphocytes, 174
immunoglobulins) and innate (e.g. enzymes, antimicrobial peptides and glycoproteins, melanin 175
and natural killer cells) immunity Esteban [30]. Our results indicated noticeable increase in 176
mucosal total protein and Ig concentrations in O. mykiss fed diets supplemented with 1.5 g LZ 177
kg-1, which can be associated with development of fish immune competence. In this sense, 178
dietary supplementation of immunostimulants such as fermented Saccharomyces cerevisiae in 179
rainbow trout [31], xylactooligosaccharide in Caspian white fish (Rutilus frisii kutum) [32], 180
Lactobacillus acidophilus in black swordtail (Xiphophorus helleri) [33] and herbal plants [loquat 181
(Eriobotrya japonica) Hoseinifar et al. [34] and medlar (Mespilus germanica) Hoseinifar et al. 182
MANUSCRIP
T
ACCEPTED
ACCEPTED MANUSCRIPT
9
[35] or symbiotic (galactooligosaccharide (GOS) and P. acidilactici) in common carp [29] 183
increased skin mucus total protein or Ig levels. 184
Mucosal enzymatic activities have protective role against infectious organisms by destroying 185
pathogens cell envelop structure [36], prohibiting their colonization and invasion as well as 186
activating the synthesis of other innate immune components present in mucus (e.g. complements 187
and antibodies) [37]. Our results revealed significant increase in mucosal LZ and ALP activities 188
in O. mykiss fed 1.0 and 1.5 g LZ kg-1 diet in comparison with the other groups, indicating 189
improved non-specific bactericidal activity in these groups. In agreement with this result 190
supplementing diet with vitamin C in Caspian roach (Rutilus rutilus caspicus) [38], probiotic (L. 191
acidophilus) in black swordtail [33], fermented baker’s yeast [31] or Myrtle (Myrtus communis 192
L.) [39] in rainbow trout fingerlings and date palm fruit extracts in common carp [28] increased 193
skin mucosal ALP activity. Several other studies also reported the positive effects of 194
immunostimulants including GOS [19], symbiotic [40], and medicinal plants [e.g. Myrtus 195
communis [41], DPFE [28], WBMP [21], Cordyceps militaris [42] and medlar Hoseinifar et al. 196
[35] on skin mucosal LZ activities in different fish species. 197
Tumor necrosis factor-α and IL-1β are cytokines involved in the induction of inflammatory 198
responses and regulation of immune cells [27]. Our study demonstrated up-regulation of 199
intestinal cytokines genes expression in O. mykiss fingerlings fed 1.0 and 1.5 g LZ kg-1 diets, 200
suggesting dietary LZ trigger an inflammatory response in the intestine of the fish. In addition, 201
the over-expression of immune related gene expression in above-mentioned groups could be 202
associated with the modulation of intestinal microbiome [43]. In agreement with our findings, 203
Abdel-Latif et al. [15] showed the mRNA expressions of pro-inflammatory cytokines such as of 204
interferon-gamma and interleukin-18 were up-regulated in response to inclusion of 90 mg LZ kg-205
MANUSCRIP
T
ACCEPTED
ACCEPTED MANUSCRIPT
10
1 in broiler chickens. In addition, several studies proved that administration of different classes of 206
immunostimulants including probiotics (Lactobacillus sp.) [44], prebiotics (fermentable fiber 207
[45] or GOS [19]), symbiotic (GOS and P. acidilactici, Modanloo et al. [29] and herbs such as 208
WBMP (Miandare et al. 2016), Myrtle Safari et al. [41], loquat Hoseinifar et al. [34] up-209
regulated the gene expression of TNF-α or IL-1ß in different fish species. In contrast, Lee et al. 210
[11] reported that injection of hen LZ at a dose of 150 mg kg-1 of body weight attenuates 211
inflammation by down-regulation of colon gene expression of pro-inflammatory cytokines (e.g. 212
TNF-α, IL-6, IFN-γ, IL-8, and IL-17) and up-regulation of intestinal mucin (MUC1) and anti-213
inflammatory cytokines (e.g. IL-4 and Transforming growth factor-ß) in a porcine subjected to 214
dextran sodium sulfate injection. In this sense, it has been reported that pro-inflammatory 215
cytokines such as TNF-α and IL-1ß may induce intestinal epithelial barrier dysfunction by 216
increasing epithelial tight junction and permeability [46, 47]. Thus, long term feeding of O. 217
mykiss fingerlings with 1.0 and 1.5 g LZ kg-1 diet may have negative effects on intestinal health 218
as a consequence of inducing pro-inflammatory cytokines responses. 219
Many previous researches have been proved growth-promoting effect of LZ in poultry, pig as 220
well as fish species [9, 13, 15]. In addition, studies in terrestrial animals showed that dietary LZ 221
improved intestinal health due to reducing the levels of microbial challenges, which could save 222
extra energy for growth purposes [15, 48]. However, our findings indicated supplementing diet 223
with LZ did not improve growth performance and feed utilization in O. mykiss. In this case, 224
inclusion of a diet with 100 mg LZ kg-1 did not improve growth performance in broiler chickens 225
under clean conditions [49]. The authors of this study speculated that, when broilers were not 226
under an environmental stress, dietary LZ may not improve growth performance, since hygiene 227
condition could not pose a potential challenge to restrict growth or affect the health. Thus, none-228
MANUSCRIP
T
ACCEPTED
ACCEPTED MANUSCRIPT
11
stressful condition in the current study might be not trigged dietary LZ to induce growth 229
performance in O. mykiss fingerlings as also reported in broiler chickens [49]. On the other hand, 230
biotic (e.g. fish species, sex, age, size, health condition, degree of stress) and abiotic (e.g. water 231
temperature, pH, toxicants) may change LZ activities in fish and result in contradictory findings 232
among studies [10]. 233
Overall, the present results clearly showed that LZ powder has remarkable effects on humoral 234
and mucosal immune defenses and can therefore be considered as a potential immunostimulant 235
in O. mykiss fingerlings diet. However, this dietary supplement did not improved growth 236
performance and in the long term period it may result in negative effects on intestinal health as a 237
consequence of inducing pro-inflammatory cytokines gene expression in the intestine. It is 238
needed to evaluate the protective role of LZ against infectious diseases under experimental 239
challenge as well as investigate the effects of dietary LZ on intestinal anti-inflammatory 240
cytokines in further researches for increasing our knowledge regarding the mode of action and 241
optimum inclusion level. 242
243
Acknowledgements 244
The authors would like to appreciate the kind support of Zhejiang Aegis Biotech Co., Ltd for 245
providing the microbial lysozyme. Also, we would like to that’s the great helps and supports by 246
Miss Lise lee for her kind supports. The authors acknowledge the financial assistance provided 247
by the Functional Food Research Center for Well-being, Chiang Mai University, Chiang Mai, 248
Thailand. 249
250
251
MANUSCRIP
T
ACCEPTED
ACCEPTED MANUSCRIPT
12
References 252
1. Wang W, Sun J, Liu C, Xue Z. Application of immunostimulants in aquaculture: current 253
knowledge and future perspectives,. Aquaculture Research. 2017 48:1–23. 254
2. Carbone D, Faggio C. Importance of prebiotics in aquaculture as immunostimulants. Effects on 255
immune system of Sparus aurata and Dicentrarchus labrax. Fish & Shellfish Immunology. 2016 54:172-8. 256
3. Guardiola FA, Porcino C, Cerezuela R, Cuesta A, Faggio C, Esteban MA. Impact of date palm fruits 257
extracts and probiotic enriched diet on antioxidant status, innate immune response and immune-related 258
gene expression of European seabass (Dicentrarchus labrax). Fish & Shellfish Immunology. 2016 52:298-259
308. 260
4. Saiyad Musthafa M, Asgari SM, Kurian A, Elumalai P, Jawahar Ali AR, Paray BA, et al. Protective 261
efficacy of Mucuna pruriens (L.) seed meal enriched diet on growth performance, innate immunity, and 262
disease resistance in Oreochromis mossambicus against Aeromonas hydrophila. Fish & Shellfish 263
Immunology. 2018 75:374-80. 264
5. Harikrishnan R, Jawahar S, Srikanthan C, Paray BA, Al-Sadoon MK, Balasundaram C. Kaolin 265
incorporated diet on growth and immune response in Ctenopharyngodon idellus against Aeromonas 266
hydrophila. Fish & Shellfish Immunology. 2018 77:364-73. 267
6. Abdel-Tawwab M, Samir F, Abd El-Naby AS, Monier MN. Antioxidative and immunostimulatory 268
effect of dietary cinnamon nanoparticles on the performance of Nile tilapia, Oreochromis niloticus (L.) 269
and its susceptibility to hypoxia stress and Aeromonas hydrophila infection. Fish & Shellfish 270
Immunology. 2018 74:19-25. 271
7. Siwicki AK, Klein P, Morand M, Kiczka W, Studnicka M. Immunostimulatory effects of dimerized 272
lysozyme (KLP-602) on the nonspecific defense mechanisms and protection against furunculosis in 273
salmonids. Veterinary Immunology and Immunopathology. 1998 61:369–78. 274
8. Rymuszka A, Studnicka M, Siwicki AK, Sierosławska A, Bownik A. he immunomodulatory effects 275
of the dimer of lysozyme (KLP-602) in carp (Cyprinus carpio L) in vivo study. Ecotoxicology and 276
Environmental Safety. 2005 61:121-7. 277
9. Chen Y, Zhu X, Yang Y, Han D, Jin J, Xie S. Effect of dietary lysozyme on growth, immune 278
response, intestine microbiota, intestine morphology and resistance to Aeromonas hydrophilia in gibel 279
carp (Carassius auratus gibelio). . Aquaculture Nutrition. 2014 20:229-41. 280
10. Saurabh S, Sahoo P. Lysozyme: an important defence molecule of fish innate immune system 281
Aquaculture Research. 2008 39:223-39. 282
11. Lee M, Kovacs-Nolan J, Yang C, Archbold T, Fan MZ, Mine Y. Hen egg lysozyme attenuates 283
inflammation and modulates local gene expression in a porcine model of dextran sodium sulfate (dss)-284
induced colitis. ournal of Agricultural and Food Chemistry. 2009 57:2233–40. 285
12. Cerven D, DeGeorge G, Bethell D. 28-day repeated dose oral toxicity of recombinant human 286
apo-lactoferrin or recombinant human lysozyme in rats. . Regul Toxicol Pharm. 2008 51:162–7. 287
13. Deng J, Bi B, An Q, kong L, Wang; Q., Tao; L., et al. Effect of dietary inclusion of lysozyme on 288
growth performance and plasma biochemical parameters of rainbow trout (Oncorhynchus mykiss). 289
Aquaculture Nutrition. 2012 18:332-9. 290
14. Morand M, Siwicki A, Pozet F, Klein P, Vinaize J, Keck N. Effects of dimerized lysozyme (KLP-602) 291
on the cellular and humoral defence mechanisms in sheatfish (Silurus glanis): in vitro and in vivo study. 292
Veterinary Research. 1999 30:411-8. 293
15. Abdel-Latif MA, El-Far AH, Elbestawy AR, Ghanem R, Mousa SA, Abd El-Hamid HS. Exogenous 294
dietary lysozyme improves the growth performance and gut microbiota in broiler chickens targeting the 295
antioxidant and non-specific immunity mRNA expression. PLOS ONE. 2017. 296
MANUSCRIP
T
ACCEPTED
ACCEPTED MANUSCRIPT
13
16. Ma XK, Zhang S, Pan L, Piao XS. Effects of lysozyme on the growth performance, nutrient 297
digestibility, intestinal barrier and microbiota of weaned pigs fed diets containing spray-dried whole egg 298
or albumen powder. Canadian journal of animal science. 2017 97: 466-75. 299
17. Oliver WT, Wells JE. Lysozyme as an alternative to antibiotics improves growth performance and 300
small intestinal morphology in nursery pigs. American Society of Animal Science. 2013 91:3129–36. 301
18. Long Y, Lin S, Zhu J, Pang X, Fang Z, Lin Y, et al. Effects of dietary lysozyme levels on growth 302
performance, intestinal morphology, non-specific immunity and mRNA expression in weanling piglets. 303
Animal Science Journal. 2016 87:411–8. 304
19. Miandare HK, Farvardin S, Shabani A, Hoseinifar SH, Ramezanpour SS. The effects of 305
galactooligosaccharide on systemic and mucosal immune response, growth performance and appetite 306
related gene transcript in goldfish (Carassius auratus gibelio). Fish and Shellfish Immunology. 2016 307
55:479-83. 308
20. Ross NW, Firth KJ, Wang A, Burka JF, Johson SC. Changes in hydrolytic enzyme activities of naïve 309
Atlantic salmon Salmo salar skin mucus due to infection with the Salmon louse Lepeophtheirus salmons 310
and cortisol implantation. Diseases of Aquatic Organisms. 2000 41:43–51. 311
21. Khodadadianzou H, Hoseinifar SH, Miandare HK, Hajimoradloo A. Agaricus bisporus powder 312
improved cutaneous mucosal and serum immune parameters and up-regulated intestinal cytokines 313
gene expression in common carp (Cyprinus carpio) fingerlings. Fish and Shellfish Immunology. 2016 314
58:380–6. 315
22. Ellis AE. Techniques in Fish Immunology. Techniques in Fish Immunology. Fair Haven, New 316
Jersey, USA: SOS Publications; 1990, p. 95–103. 317
23. Siwicki AK, Anderson DP, Rumsey GL. Dietary intake of immunostimulants by rainbow trout 318
affects non-specific immunity and protection against furunculosis. Veterinary Immunology and 319
Immunopathology. 1994 41:125-39. 320
24. Silhavy T, Kahne D, Walker S. The bacterial cell envelope. Cold Spring Harbor Perspectives in 321
Biology. 2010. 322
25. Clarke T, Davis K, Lysenko E, Zhou A, Yu Y, Weiser J. Recognition of peptidoglycan from the 323
microbiota by Nod1 enhances systemic innate immunity. Nature Medicine. 2010 16:228-31. 324
26. Li X, Stark G. NF kappa B-dependent signaling pathways. Experimental Hematology. 2002 325
30:285–96. 326
27. Uribe C, Folch H, Enriquez R, Moran G. Innate and adaptive immunity in teleost fish: A review. 327
Vet Med. 2011 56:486–503. 328
28. Hoseinifar SH, Khalili M, Rufchaei R, Raeisi M, Attar M, Cordero, et al. Effects of date palm fruit 329
extracts on skin mucosal immunity, immune related genes expression and growth performance of 330
common carp (Cyprinus carpio) fry Running head: Palm extract and carp health. Fish and shellfish 331
Immunology. 2015 47:706-11. 332
29. Modanloo M, Soltanian S, Akhlaghi M, Hoseinifar SH. The effects of single or combined 333
administration of galactooligosaccharide and Pediococcus acidilactici on cutaneous mucus immune 334
parameters, humoral immune responses and immune related genes expression in common carp 335
(Cyprinus carpio) fingerlings. . Fish and Shellfish Immunology. 2017 70:391-7. 336
30. Esteban MA. An overview of the immunological defenses in fish skin. ISRN Immunology. 2012. 337
31. Heidarieh M, Mirvaghefi AR, Akbari M, Sheikhzadeh N, Kamyabi-Moghaddam Z, Askari H. 338
Evaluations of Hilyses™, fermented Saccharomyces cerevisiae, on rainbow trout (Oncorhynchus 339
mykiss) growth performance, enzymatic activities and gastrointestinal structure. Aquaculture 340
Nutrition. 2013 19:343-8. 341
32. Hoseinifar SH, Sharifian M, Vesaghi MJ, Khalili M, M.A. E. The effects of dietary 342
xylooligosaccharide on mucosal parameters, intestinal microbiota and morphology and growth 343
MANUSCRIP
T
ACCEPTED
ACCEPTED MANUSCRIPT
14
performance of Caspian whitefish (Rutilus frisii kutum) fry. Fish and Shellfish Immunology. 2014 39:231-344
6. 345
33. Hoseinifar S, Roosta Z, Hajimoradloo A, Vakili F. The effects of Lactobacillus acidophilus as 346
feed supplement on skin mucosal immune parameters, intestinal microbiota, stress resistance and 347
growth performance of black swordtail (Xiphophorus helleri). Fish and Shellfish Immunology. 2015 348
42:533-8. 349
34. Hoseinifar S, Khodadadianzou H, Van Doan H, Miandare HK, Hoseini SM. Evaluation of some 350
intestinal cytokines genes expression and serum innate immune parameters in common carp (Cyprinus 351
carpio) fed dietary loquat (Eriobotrya japonica) leaf extract. . Aquaculture research 2018 49:120-7. 352
35. Hoseinifar SH, Khodadadianzou H, Miandare HK, Van Doan H, Romano N, Dadar M. Enrichment 353
of common carp (Cyprinus carpio) diet with medlar (Mespilus germanica) leaf extract: Effects on skin 354
mucosal immunity and growth performance. Fish and Shellfish Immunology 2017 67:346-52. 355
36. Subramanian S, MacKinnon S, Ross N. A comparative study on innate immune parameters in the 356
epidermal mucus of variousfish species. . Comparative Biochemistry and Physioliology B Biochemistry 357
and Molecular Biology. 2007 148:256-63. 358
37. Fernandes JMO, Smith VJ. A novel antimicrobial function for a ribosomal peptide from rainbow 359
trout skin. Biochemical and Biophysical Research Communication 2002 296:167-71. 360
38. Roosta Z, Hajimoradloo A, Ghorbani R, Hoseinifar S. The effects of dietary vitamin C on mucosal 361
immune responses and growth performance in Caspian roach (Rutilus rutilus caspicus) fry. Fish 362
Physiology and Biochemistry. 2014 40:1601-7. 363
39. Mansouri Taei H, Hajimoradloo A, Hoseinifar SH, Ahmadvand H. Dietary Myrtle (Myrtus 364
communis L.) improved non-specific immune parameters and bactericidal activity of skin mucus in 365
rainbow trout (Oncorhynchus mykiss) fingerlings. Fish and Shellfish Immunology. 2017 64:320-4. 366
40. Ashouri G, Soofiani N.M., Hoseinifar SH, Jalali S.A.H, Morshedi V, Van Doan H, et al. Combined 367
effects of dietary low molecular weight sodium alginate and Pediococcus acidilactici MA18/5M on 368
growth performance, haematological and innate immune responses of Asian sea bass (Lates calcalifer) 369
juveniles. . Fish and shellfish immunology 2018 79:34–41. 370
41. Safari R, Hoseinifar SH, Van Doan H, Dadar M. The effects of dietary Myrtle (Myrtus communis) 371
on skin mucus immune parameters and mRNA levels of growth, antioxidant and immune related genes 372
in zebrafish (Danio rerio). . Fish & Shellfish Immunology 2017 66:264-9. 373
42. Van Doan H, Hoseinifar S, Tapingkae W, Chitmanat C, Mekchay S. Effects of Cordyceps militaris 374
spent mushroom substrate on mucosal and serum immune parameters, disease resistance and growth 375
performance of Nile tilapia, (Oreochromis niloticus). Fish & Shellfish Immunology. 2017 67:78-85. 376
43. Nayak S. Role of gastrointestinal microbiota in fish. Aquaculture research. 2010 41:1553-73. 377
44. Hosseini M, Miandare H, Hoseinifar S, Yarahmadi P. Dietary Lactobacillus acidophilusmodulated 378
skin mucus protein profile, immune and appetite gene expression in gold fish (Carassius auratus gibelio) 379
Fish and Shellfish Immunology. 2016 59:149-54. 380
45. Yarahmadi P, Miandare HK, Farahmand H, Mirvaghefi A, Hoseinifar SH. Dietary fermentable fiber 381
upregulated immune related genes expression, increased innate immune response and resistance of 382
rainbow trout (Oncorhynchus mykiss) against Aeromonas hydrophila. Fish & Shellfish Immunology. 383
2014 41:326-31. 384
46. Al-Sadi R, Ye D, Dokladny K, Ma TY. Mechanism of IL-ß-induced increase in intestinal epithelial 385
tight junction permeability. The journal of immunology. 2008 180:5653–61. 386
47. Wang F, Graham WV, Wang Y, Witkowski ED, Schwarz BT, Turner JR. Interferon-gamma and 387
tumor necrosis factor-α synergize to induce intestinal epithelial barrier dysfunction by upregulating 388
myosin light chain kinase expression. American journal of pathology. 2005 166:409–19. 389
MANUSCRIP
T
ACCEPTED
ACCEPTED MANUSCRIPT
15
48. Humphrey BD, Huang N, Klasing KC. Rice expressing lactoferrin and lysozyme has antibiotic-like 390
properties when fed to chicks. Journal of Nutrition. 2002 132:1214-8. 391
49. Gong M, Anderson D, Rathgeber B, MacIsaac J. The effect of dietary lysozyme with EDTA on 392
growth performance and intestinal microbiota of broiler chickens in each period of the growth cycle. 393
The Journal of Applied Poultry Research. 2017 26:1-8. 394
395
MANUSCRIP
T
ACCEPTED
ACCEPTED MANUSCRIPT
24
Table 1. Primers sequences and amplification efficiencies Gene name Sequences of primers Accession no Efficiency
ß-actin Forward:
AGACATCAGGGTGTCATGGTTGGT
M24113.1 97%
Reverse: CTCAAACATGATCTGTGTCAT
IL1ß Forward: ACCAGCTGGATTTGTCAGAAG AB010701.1 98%
Reverse: ACATACTGAATTGAACTTTG
TNF-α Forward: GGTGATGGTGTCGAGGAGGAA AJ311800.1 97%
Reverse: TGGAAAGACACCTGGCTGTA
MANUSCRIP
T
ACCEPTED
ACCEPTED MANUSCRIPT
25
Table 2. Growth performance of rainbow trout fed with different dietary lysozyme levels
(g ) for 8 weeks experimental period (means ± SD)
Index Control 0.5 g 1 g 1.5 g
BWi (g)a 5.44 ± 0.08 5.42 ± 0.05 5.50 ± 0.04 5.48 ± 0.07
BWf (g)b 27.62 ± 1.7 29.19 ± 0.3 29.58 ± 0.4 30.07 ± 0.75
WG (%)c 407.6 ± 32.2 438.6 ± 2.1 437.1 ± 8.7 441.4 ± 12.6
SGR (% day)d 2.70 ± 0.10 2.80 ± 0.06 2.80 ± 0.02 2.83 ± 0.03
FCRf 1.02 ± 0.08 0.95 ± 0.01 0.94 ± 0.01 0.93 ± 0.02
Survival (%)e 100 100 100 100
a Initial body weight
b Final body weight
c Weight gain (%) = (BWf – BWi) / BWi
d Specific growth rate (%) = ((ln BWf – ln BWi) / t) × 100, where t is 60 days
e Survival (%) = (number of fish in each group remaining at the end of each phase / initial
number of fish) × 100
f Feed conversion ratio = feed intake (g) / weight gain (g).
MANUSCRIP
T
ACCEPTED
ACCEPTED MANUSCRIPT
20
Figure 1. Serum total immunoglobulin levels of the rainbow trout fingerlings fed different levels
of dietary microbial lysozyme. Bars assigned with different superscripts are significantly
different (P < 0.05); Values are presented as the mean ± S.E.
MANUSCRIP
T
ACCEPTED
ACCEPTED MANUSCRIPT
21
Figure 2. Skin mucus total protein (a) and total Ig (b) contents in O. mykiss fingerlings fed
different levels of dietary microbial lysozyme. Bars assigned with different superscripts are
significantly different (P < 0.05); Values are presented as the mean ± S.E.
a
b
MANUSCRIP
T
ACCEPTED
ACCEPTED MANUSCRIPT
22
Figure 3. Skin mucus lysozyme (c) and alkaline phosphatase (d) activities in O. mykiss
fingerlings fed different levels of dietary microbial lysozyme. Bars assigned with different
superscripts are significantly different (P < 0.05); Values are presented as the mean ± S.E.
d
c
MANUSCRIP
T
ACCEPTED
ACCEPTED MANUSCRIPT
23
Figure. 4. The effects of different levels of dietary microbial lysozyme on the relative expression
of TNF-α (a) and IL1ß (b) genes in O. mykiss fingerlings intestine. Bars assigned with different
superscripts are significantly different (P < 0.05); Values are presented as the mean ± S.E.
a
b
MANUSCRIP
T
ACCEPTED
ACCEPTED MANUSCRIPT
Dietary administration of lysozyme boosted humoral and mucosal immune defenses of rainbow
trout
Significant increase in intestinal cytokines gene expression including TNF-α and IL1ß was found
in fish fed 1.0 and 1.5 g kg-1 lysozyme
No significant improvement growth performance and feed conversion ration were observed in
lysozyme supplemented diets