Accepted Manuscript

Enrichment of rainbow trout (Oncorhynchus mykiss) fingerlings diet with microbiallysozyme: Effects on growth performance, serum and skin mucus immuneparameters

Meysam Shakoori, Seyed Hossein Hoseinifar, Hamed Paknejad, Valiollah Jafari,Roghieh Safari, Hien Van Doan, Mansour Torfi Mozanzadeh

PII: S1050-4648(18)30796-4

DOI: https://doi.org/10.1016/j.fsi.2018.11.077

Reference: YFSIM 5764

To appear in: Fish and Shellfish Immunology

Received Date: 6 September 2018

Revised Date: 25 November 2018

Accepted Date: 30 November 2018

Please cite this article as: Shakoori M, Hoseinifar SH, Paknejad H, Jafari V, Safari R, Van Doan H,Mozanzadeh MT, Enrichment of rainbow trout (Oncorhynchus mykiss) fingerlings diet with microbiallysozyme: Effects on growth performance, serum and skin mucus immune parameters, Fish andShellfish Immunology (2019), doi: https://doi.org/10.1016/j.fsi.2018.11.077.

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service toour customers we are providing this early version of the manuscript. The manuscript will undergocopyediting, typesetting, and review of the resulting proof before it is published in its final form. Pleasenote that during the production process errors may be discovered which could affect the content, and alllegal disclaimers that apply to the journal pertain.

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

1

Enrichment of rainbow trout (Oncorhynchus mykiss) fingerlings diet with microbial 1

lysozyme: effects on growth performance, serum and skin mucus immune parameters 2

Running title: Microbial lysozyme and rainbow trout health 3

4

Meysam Shakoori1, Seyed Hossein Hoseinifar1*, Hamed Paknejad1, Valiollah Jafari1, Roghieh 5

Safari1, Hien Van Doan2*, Mansour Torfi Mozanzadeh3 6

7

1Department of Fisheries, Faculty of Fisheries and Environmental Sciences, Gorgan University 8

of Agricultural Sciences and Natural Resources, Gorgan, Iran 9

2Department of Animal and Aquatic Sciences, Faculty of Agriculture, Chiang Mai University, 10

Chiang Mai 50200, Thailand 11

3South Iran Aquaculture Research Centre, Iranian Fisheries Science Institute (IFSRI), 12

Agricultural Research Education and Extension organization (AREEO), Ahwaz, Iran 13

14

*Author for correspondence: H Van Doan, E-mail address: hien.d@cmu.ac.th- 15

16

Footnotes: 17

Source of financial support: The research project was funded by Functional Food Research 18

Center for Well-being, Chiang Mai University, Thailand 19

Conflict of interest statement: There is no conflict of interest to declare 20

21

22

23

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

2

Abstract 24

A two-month study was conducted to determine the influence of different levels of microbial 25

lysozyme (LZ) contents (0, 0.5, 1.0, and 1.5 g kg-1 of diet) on growth performance, serum and 26

skin mucus immune parameters as well as intestinal immune-related genes expression in rainbow 27

trout Oncorhynchus mykiss fingerlings (5.5 ± 0.1 g). Growth performance and feed utilization 28

were not affected significantly by dietary LZ. Fish fed LZ-supplemented diets had higher serum 29

total immunoglobulins concentration than the control group. In addition, fish fed 1.5 g LZ kg-1 30

diet had the highest skin mucosal total protein and immunoglobulin contents compared to other 31

experimental groups. Furthermore, skin mucosal lysozyme and alkaline phosphatase activities as 32

well as intestinal tumor necrosis factor-α and interlukine-1β relative genes expression were 33

higher in fish fed 1.0 and 1.5 g LZ kg-1 diets than the other groups. Overall, the present results 34

clearly showed that LZ powder can be considered as a potential immunostimulant in O. mykiss 35

fingerlings, but in the long term period it may result in negative effects on intestinal health as a 36

consequence of inducing pro-inflammatory cytokines gene expression in the intestine. 37

Keywords: Microbial lysozyme; Rainbow trout; Skin mucosal immunity; Immune-related gene 38

expression 39

40

41

42

43

44

45

46

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

3

Introduction 47

Rainbow trout is among one of the most important cultured fish in several countries. Nowadays, 48

intensive and super-intensive culture systems are common for trout culture. There are increasing 49

concerns about using antibiotics in rainbow trout culture to overcome infectious diseases. Using 50

immunostumulants as bio-friendly agents is a sustainable way for reducing side effects of 51

applying antibiotics in aquaculture [1-6]. Among different kinds of immunostimulant classes 52

(e.g. probiotic, prebiotic and symbiotic), lysozyme (muramidase, EC 3.2.1.17) (LZ), which is a 53

natural endogenous antibiotic has been proven to induce specific and non-specific immune 54

responses in teleosts [7-9]. Lysozyme as a mucolytic and antibacterial enzyme is widely 55

distributed in animal body fluids (e.g. saliva, mucus, tears, serum) [10]. This enzyme has several 56

physicochemical properties including high resistant to acid digestion and proteases in 57

gastrointestinal tract, heat-resistant, low-molecular-weight, as well as non-toxic; which is makes 58

it as a promising immunostimulant in aquaculture [9, 11, 12]. In addition, LZ act as natural 59

immunostimulant with antibacterial, antiviral, antimetastatic and anti-inflammatory properties 60

suggesting this enzyme may be a potential antibiotic alternative [10]. A plethora of studies 61

available on positive effects of dietary LZ on growth enhancement [9, 13], humoral (e.g. 62

alternative complement pathway hemolysis, lysozyme and myeloperoxidase activities, total Ig) 63

and cellular (e.g. phagocytosis activity of neutrophils and macrophages, respiratory burst, 64

lymphocyte proliferation and antibody secretion) immune responses [7-9, 14], disease resistance 65

[9], oxidative stress [15], intestinal microbiome and intestinal morphology [9, 15-18], as well as 66

cytokines gene expression [15, 18] in fish, poultry and pig. However, to our best knowledge, no 67

research has been determined immunomodulatory impact of exogenous LZ on health condition 68

in aquaculture fish species. Thus, in our study we want to evaluate the influence of dietary LZ 69

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

4

inclusion on performance, immune response and intestinal cytokines gene expression in rainbow 70

trout Oncorhynchus mykiss fingerlings. 71

72

Materials and Methods 73

Experimental setup 74

This study was carried out in the laboratory in Gorgan University of Agricultural and Natural 75

Resources, Gorgan, Iran. One hundred and twenty O. mykiss fingerlings purchased from a 76

private farm and were transferred to the laboratory then adapted to experimental condition for 77

two weeks. Following adaptation to experimental condition, fish (initial body weight (BWi) = 5.5 78

± 0.1 g) were randomly distributed among twelve fiberglass 200-L tanks (n = 10 fish per tank) 79

supplied with filtered fresh water and continuous aeration, and 50% of water was exchanged 80

daily. The mean values of water temperature, dissolved oxygen and pH were 16.2 ± 0.9 °C, 6.1 ± 81

0.2 mg L−1 and 7.6 ± 0.2, respectively. A commercial feed (Coppens Co., Netherland; 48% crude 82

protein, 22% crude fat, 8.8% ash, 0.9% fiber; 20.7 MJ Kg-1 digestible energy) was supplemented 83

with the (Microbial lysozyme 10%, fermented lysozyme use as feed additives, Zhejiang Aegis 84

Biotech Co., Ltd) graded levels of LZ powder according to the recommended dose reported in 85

the previous studies [9, 13] including: 0 (control), 0.5, 1.0 and 1.5 g LZ kg-1 diet, respectively. In 86

this regard, the basal diet was ground in order to produce a fine powder and then supplemented 87

with the above-mentioned LZ dosages, then thoroughly mixed and water was added to produce 88

dough according to [19]. The dough was pelleted using a meat grinder to obtain pellets with size 89

of 2 mm, then pellets were dried in a convection oven at 25 °C for 24 h and stored at −20 °C 90

until used. 91

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

5

Fish were manually-fed three times (0800, 1200 and 1600) at rate of 3% of BWi daily for two 92

months. Feeding ratio was corrected based on biometry which was done every 10 days. Utmost 93

care was considered to avoid feed loose. 94

Immunological parameters 95

Sample collection 96

At the end of feeding trial, fish were fasted for a day and weight (BWf) were measured, 97

individually to assess growth performance and feed utilization parameters. Nine fish of each 98

experimental treatment were randomly bled from the caudal vein with syringe after 99

anaesthetizing by clove powder (500 mg L-1). Then after, blood was allowed to clot (at 4 °C for 4 100

h), centrifuged and stored at -80 °C until use. For evaluating skin-related lymphoid immune 101

system, mucus was collected according to Ross et al. [20] method. In this regard, at the end of 102

feeding trial fish (9 fish per treatment) was anaesthetized with the same anesthetic and 103

individually was transferred to a polyethylene bag containing 10 mL of 50 mM NaCl (Sigma, 104

Steinheim, Germany) and gently rubbed for approximately 1 min to mucus collection. 105

Thereafter, obtained mucus was prepared and stored at -80 °C until use according to 106

Khodadadianzou et al. [21]. 107

Immunological parameters 108

The levels of LZ in mucus was determined using a turbidimetric assay according to Ellis [22] by 109

measuring the lytic activity of O. mykiss serum against lyophilized Micrococcus luteus (Sigma, 110

St Louis, MO, USA). Serum and skin mucosal total immunoglobulin (Ig) was measured using 111

the method described by Siwicki et al. [23]. Total protein concentration was determined by using 112

a commercial kit (Zist Shimi kits, Iran) according to the manufacture instruction. Alkaline 113

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

6

phosphatase activity of the mucus was measured using a commercial kit (Pars Azmon Co, 114

Tehran, Iran) according to the manufacturer protocol. 115

RNA extraction and relative mRNA expression of intestinal cytokines 116

After the feeding period, 3 fish from each replicate (n = 9 fish per treatment) were randomly 117

euthanized with overdose anesthetic, and immediately eviscerated on ice surface, then intestine 118

was dissected for intestinal cytokines gene expression assays. The intestine was frozen 119

immediately in liquid nitrogen and stored at -80 oC until RNA extraction. Total RNA of samples 120

was isolated using BIOZOL RNA extraction kit (Bioflux-Bioer, China) according to the 121

manufacturer's instructions. For prohibiting contamination of samples with genomic DNA, total 122

RNA was treated with DNase I (Fermentas, Lithuania). Afterwards, the quantity and 123

concentration of RNA were measured using nanodrop spectrophotometer (Nanodrop technology, 124

Wilmington, DE, USA) at 260 and 280 nm (A260:A280 > 1.8 were selected for further 125

experiments) following electrophoresis on a 1.5% agarose gel. The reverse transcription was 126

used to synthesize the first-strand cDNA using transcription Kit (Fermentas, Lithuania) [19]. The 127

conserved regions of Cyprinus carpio Gene Bank were used for designing the primers sequences 128

by means of by Oligo7 software (Table 1). Quantitative real-time PCR assays were performed in 129

triplicate to study the effects of dietary lysozyme inclusion on the expression of intestinal 130

cytokines (TNF-α, IL-1ß) in O. mykiss as described by Miandare et al. [19]. For normalizing the 131

expression of the cytokine genes, β-actin was used as the housekeeping gene. Data was analyzed 132

using the iQ5 optical system software (Bio-Rad) and DDCt method. 133

Statistical analyses 134

Data were analyzed using SPSS version 19 (Chicago, IL, USA). One-way analysis of variance 135

was performed at a significance level of 0.05 following the confirmation of normality (Shapiro–136

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

7

Wilk’s test) and homogeneity (Levene’s test) of variance. Duncan’s multiple-range procedure 137

was used for multiple comparisons. 138

139

Results 140

The results the present study showed that growth performance and feed utilization were not 141

significantly affected by dietary LZ in O. mykiss (P > 0.05, Table 2). 142

Results showed that fish fed 0.5, 1.0, and 1.5 g LZ kg-1 diets had higher serum total 143

immunoglobulins concentration than the control group (P < 0.05, Fig. 1). The highest total 144

serum Ig were noticed in rainbow trout fed 1.0 and 1.5 g LZ kg-1 diets. However, no significant 145

difference in total serum Ig was found between 1.0 and 1.5 g LZ kg-1 diets (P > 0.05). 146

Regarding mucosal immune response, fish in 1.5 g LZ kg-1 diet had higher total protein (Fig. 2a) 147

and Ig (Fig. 2b) in the mucus than the control and other supplemented groups (P < 0.05). 148

Similarly, fish fed 1.0 and 1.5 g LZ kg-1 diets had higher mucosal lysozyme (Fig. 3a) and 149

alkaline phosphatase (Fig. 3b) activities than the control and 0.5 g LZ kg-1 group (P < 0.05). 150

For intestinal cytokines gene expression, fish in 1.0 and 1.5 g LZ kg-1 groups showed significant 151

higher relative TNF-α (Fig. 4a) and IL1β (Fig. 4b) gene expression compared to the control and 152

0.5 g LZ kg-1 group (P < 0.05). 153

Discussion 154

The results of present study showed that not only innate immune responses improved in fish fed 155

LZ supplemented diets, but also intestinal cytokines genes expression up-regulated by dietary 156

LZ. It has been postulated that dietary LZ can induce non-specific immune responses through 157

noticeable regulation of intestinal cytokines and antioxidant genes expression as well as 158

modulating intestinal microbiome (e.g. increasing Lactobacillus counts) [15]. In addition, it is 159

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

8

assumed that immuno-stimulating process of LZ associated with the LZ-digested products of 160

bacterial envelop structure that promote the innate immune reaction [24, 25], antibodies and 161

cytokines secretion [15] as well as can activate nuclear factor κB(NF-κB) pathway, which induce 162

the expression of pro-inflammatory cytokine genes [15, 26]. 163

Immunoglobulins are heterodimeric glycoproteins that play a vital role in recognizing natural 164

antigens and found in the skin, gill and gut mucus, bile as well as systemically found in the 165

plasma of fish [27]. In our study, higher serum total Ig content was noticed in fish fed 1.0 and 1.5 166

g LZ kg-1 diets that was coincided with the over-expression of intestinal inflammatory cytokines 167

(TNF-α and IL1ß), suggesting immunomodulatory effects of LZ on specific immune responses. 168

In accordance with this result, supplementing diet with immunostimulants such as date palm fruit 169

extract (DPFE) [28], white bottom mushroom powder (Agaricus bisporus) (WBMP) [21] and a 170

symbiotic (galactooligosaccharide and P. acidilactici) Modanloo et al. [29] increased serum total 171

Ig in common carp (Cyprinus carpio). 172

The fish skin mucus acts as a frontier defensive barrier to many infectious pathogens through 173

skin-associated lymphoid tissue including adaptive (e.g. B and T lymphocytes, 174

immunoglobulins) and innate (e.g. enzymes, antimicrobial peptides and glycoproteins, melanin 175

and natural killer cells) immunity Esteban [30]. Our results indicated noticeable increase in 176

mucosal total protein and Ig concentrations in O. mykiss fed diets supplemented with 1.5 g LZ 177

kg-1, which can be associated with development of fish immune competence. In this sense, 178

dietary supplementation of immunostimulants such as fermented Saccharomyces cerevisiae in 179

rainbow trout [31], xylactooligosaccharide in Caspian white fish (Rutilus frisii kutum) [32], 180

Lactobacillus acidophilus in black swordtail (Xiphophorus helleri) [33] and herbal plants [loquat 181

(Eriobotrya japonica) Hoseinifar et al. [34] and medlar (Mespilus germanica) Hoseinifar et al. 182

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

9

[35] or symbiotic (galactooligosaccharide (GOS) and P. acidilactici) in common carp [29] 183

increased skin mucus total protein or Ig levels. 184

Mucosal enzymatic activities have protective role against infectious organisms by destroying 185

pathogens cell envelop structure [36], prohibiting their colonization and invasion as well as 186

activating the synthesis of other innate immune components present in mucus (e.g. complements 187

and antibodies) [37]. Our results revealed significant increase in mucosal LZ and ALP activities 188

in O. mykiss fed 1.0 and 1.5 g LZ kg-1 diet in comparison with the other groups, indicating 189

improved non-specific bactericidal activity in these groups. In agreement with this result 190

supplementing diet with vitamin C in Caspian roach (Rutilus rutilus caspicus) [38], probiotic (L. 191

acidophilus) in black swordtail [33], fermented baker’s yeast [31] or Myrtle (Myrtus communis 192

L.) [39] in rainbow trout fingerlings and date palm fruit extracts in common carp [28] increased 193

skin mucosal ALP activity. Several other studies also reported the positive effects of 194

immunostimulants including GOS [19], symbiotic [40], and medicinal plants [e.g. Myrtus 195

communis [41], DPFE [28], WBMP [21], Cordyceps militaris [42] and medlar Hoseinifar et al. 196

[35] on skin mucosal LZ activities in different fish species. 197

Tumor necrosis factor-α and IL-1β are cytokines involved in the induction of inflammatory 198

responses and regulation of immune cells [27]. Our study demonstrated up-regulation of 199

intestinal cytokines genes expression in O. mykiss fingerlings fed 1.0 and 1.5 g LZ kg-1 diets, 200

suggesting dietary LZ trigger an inflammatory response in the intestine of the fish. In addition, 201

the over-expression of immune related gene expression in above-mentioned groups could be 202

associated with the modulation of intestinal microbiome [43]. In agreement with our findings, 203

Abdel-Latif et al. [15] showed the mRNA expressions of pro-inflammatory cytokines such as of 204

interferon-gamma and interleukin-18 were up-regulated in response to inclusion of 90 mg LZ kg-205

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

10

1 in broiler chickens. In addition, several studies proved that administration of different classes of 206

immunostimulants including probiotics (Lactobacillus sp.) [44], prebiotics (fermentable fiber 207

[45] or GOS [19]), symbiotic (GOS and P. acidilactici, Modanloo et al. [29] and herbs such as 208

WBMP (Miandare et al. 2016), Myrtle Safari et al. [41], loquat Hoseinifar et al. [34] up-209

regulated the gene expression of TNF-α or IL-1ß in different fish species. In contrast, Lee et al. 210

[11] reported that injection of hen LZ at a dose of 150 mg kg-1 of body weight attenuates 211

inflammation by down-regulation of colon gene expression of pro-inflammatory cytokines (e.g. 212

TNF-α, IL-6, IFN-γ, IL-8, and IL-17) and up-regulation of intestinal mucin (MUC1) and anti-213

inflammatory cytokines (e.g. IL-4 and Transforming growth factor-ß) in a porcine subjected to 214

dextran sodium sulfate injection. In this sense, it has been reported that pro-inflammatory 215

cytokines such as TNF-α and IL-1ß may induce intestinal epithelial barrier dysfunction by 216

increasing epithelial tight junction and permeability [46, 47]. Thus, long term feeding of O. 217

mykiss fingerlings with 1.0 and 1.5 g LZ kg-1 diet may have negative effects on intestinal health 218

as a consequence of inducing pro-inflammatory cytokines responses. 219

Many previous researches have been proved growth-promoting effect of LZ in poultry, pig as 220

well as fish species [9, 13, 15]. In addition, studies in terrestrial animals showed that dietary LZ 221

improved intestinal health due to reducing the levels of microbial challenges, which could save 222

extra energy for growth purposes [15, 48]. However, our findings indicated supplementing diet 223

with LZ did not improve growth performance and feed utilization in O. mykiss. In this case, 224

inclusion of a diet with 100 mg LZ kg-1 did not improve growth performance in broiler chickens 225

under clean conditions [49]. The authors of this study speculated that, when broilers were not 226

under an environmental stress, dietary LZ may not improve growth performance, since hygiene 227

condition could not pose a potential challenge to restrict growth or affect the health. Thus, none-228

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

11

stressful condition in the current study might be not trigged dietary LZ to induce growth 229

performance in O. mykiss fingerlings as also reported in broiler chickens [49]. On the other hand, 230

biotic (e.g. fish species, sex, age, size, health condition, degree of stress) and abiotic (e.g. water 231

temperature, pH, toxicants) may change LZ activities in fish and result in contradictory findings 232

among studies [10]. 233

Overall, the present results clearly showed that LZ powder has remarkable effects on humoral 234

and mucosal immune defenses and can therefore be considered as a potential immunostimulant 235

in O. mykiss fingerlings diet. However, this dietary supplement did not improved growth 236

performance and in the long term period it may result in negative effects on intestinal health as a 237

consequence of inducing pro-inflammatory cytokines gene expression in the intestine. It is 238

needed to evaluate the protective role of LZ against infectious diseases under experimental 239

challenge as well as investigate the effects of dietary LZ on intestinal anti-inflammatory 240

cytokines in further researches for increasing our knowledge regarding the mode of action and 241

optimum inclusion level. 242

243

Acknowledgements 244

The authors would like to appreciate the kind support of Zhejiang Aegis Biotech Co., Ltd for 245

providing the microbial lysozyme. Also, we would like to that’s the great helps and supports by 246

Miss Lise lee for her kind supports. The authors acknowledge the financial assistance provided 247

by the Functional Food Research Center for Well-being, Chiang Mai University, Chiang Mai, 248

Thailand. 249

250

251

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

12

References 252

1. Wang W, Sun J, Liu C, Xue Z. Application of immunostimulants in aquaculture: current 253

knowledge and future perspectives,. Aquaculture Research. 2017 48:1–23. 254

2. Carbone D, Faggio C. Importance of prebiotics in aquaculture as immunostimulants. Effects on 255

immune system of Sparus aurata and Dicentrarchus labrax. Fish & Shellfish Immunology. 2016 54:172-8. 256

3. Guardiola FA, Porcino C, Cerezuela R, Cuesta A, Faggio C, Esteban MA. Impact of date palm fruits 257

extracts and probiotic enriched diet on antioxidant status, innate immune response and immune-related 258

gene expression of European seabass (Dicentrarchus labrax). Fish & Shellfish Immunology. 2016 52:298-259

308. 260

4. Saiyad Musthafa M, Asgari SM, Kurian A, Elumalai P, Jawahar Ali AR, Paray BA, et al. Protective 261

efficacy of Mucuna pruriens (L.) seed meal enriched diet on growth performance, innate immunity, and 262

disease resistance in Oreochromis mossambicus against Aeromonas hydrophila. Fish & Shellfish 263

Immunology. 2018 75:374-80. 264

5. Harikrishnan R, Jawahar S, Srikanthan C, Paray BA, Al-Sadoon MK, Balasundaram C. Kaolin 265

incorporated diet on growth and immune response in Ctenopharyngodon idellus against Aeromonas 266

hydrophila. Fish & Shellfish Immunology. 2018 77:364-73. 267

6. Abdel-Tawwab M, Samir F, Abd El-Naby AS, Monier MN. Antioxidative and immunostimulatory 268

effect of dietary cinnamon nanoparticles on the performance of Nile tilapia, Oreochromis niloticus (L.) 269

and its susceptibility to hypoxia stress and Aeromonas hydrophila infection. Fish & Shellfish 270

Immunology. 2018 74:19-25. 271

7. Siwicki AK, Klein P, Morand M, Kiczka W, Studnicka M. Immunostimulatory effects of dimerized 272

lysozyme (KLP-602) on the nonspecific defense mechanisms and protection against furunculosis in 273

salmonids. Veterinary Immunology and Immunopathology. 1998 61:369–78. 274

8. Rymuszka A, Studnicka M, Siwicki AK, Sierosławska A, Bownik A. he immunomodulatory effects 275

of the dimer of lysozyme (KLP-602) in carp (Cyprinus carpio L) in vivo study. Ecotoxicology and 276

Environmental Safety. 2005 61:121-7. 277

9. Chen Y, Zhu X, Yang Y, Han D, Jin J, Xie S. Effect of dietary lysozyme on growth, immune 278

response, intestine microbiota, intestine morphology and resistance to Aeromonas hydrophilia in gibel 279

carp (Carassius auratus gibelio). . Aquaculture Nutrition. 2014 20:229-41. 280

10. Saurabh S, Sahoo P. Lysozyme: an important defence molecule of fish innate immune system 281

Aquaculture Research. 2008 39:223-39. 282

11. Lee M, Kovacs-Nolan J, Yang C, Archbold T, Fan MZ, Mine Y. Hen egg lysozyme attenuates 283

inflammation and modulates local gene expression in a porcine model of dextran sodium sulfate (dss)-284

induced colitis. ournal of Agricultural and Food Chemistry. 2009 57:2233–40. 285

12. Cerven D, DeGeorge G, Bethell D. 28-day repeated dose oral toxicity of recombinant human 286

apo-lactoferrin or recombinant human lysozyme in rats. . Regul Toxicol Pharm. 2008 51:162–7. 287

13. Deng J, Bi B, An Q, kong L, Wang; Q., Tao; L., et al. Effect of dietary inclusion of lysozyme on 288

growth performance and plasma biochemical parameters of rainbow trout (Oncorhynchus mykiss). 289

Aquaculture Nutrition. 2012 18:332-9. 290

14. Morand M, Siwicki A, Pozet F, Klein P, Vinaize J, Keck N. Effects of dimerized lysozyme (KLP-602) 291

on the cellular and humoral defence mechanisms in sheatfish (Silurus glanis): in vitro and in vivo study. 292

Veterinary Research. 1999 30:411-8. 293

15. Abdel-Latif MA, El-Far AH, Elbestawy AR, Ghanem R, Mousa SA, Abd El-Hamid HS. Exogenous 294

dietary lysozyme improves the growth performance and gut microbiota in broiler chickens targeting the 295

antioxidant and non-specific immunity mRNA expression. PLOS ONE. 2017. 296

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

13

16. Ma XK, Zhang S, Pan L, Piao XS. Effects of lysozyme on the growth performance, nutrient 297

digestibility, intestinal barrier and microbiota of weaned pigs fed diets containing spray-dried whole egg 298

or albumen powder. Canadian journal of animal science. 2017 97: 466-75. 299

17. Oliver WT, Wells JE. Lysozyme as an alternative to antibiotics improves growth performance and 300

small intestinal morphology in nursery pigs. American Society of Animal Science. 2013 91:3129–36. 301

18. Long Y, Lin S, Zhu J, Pang X, Fang Z, Lin Y, et al. Effects of dietary lysozyme levels on growth 302

performance, intestinal morphology, non-specific immunity and mRNA expression in weanling piglets. 303

Animal Science Journal. 2016 87:411–8. 304

19. Miandare HK, Farvardin S, Shabani A, Hoseinifar SH, Ramezanpour SS. The effects of 305

galactooligosaccharide on systemic and mucosal immune response, growth performance and appetite 306

related gene transcript in goldfish (Carassius auratus gibelio). Fish and Shellfish Immunology. 2016 307

55:479-83. 308

20. Ross NW, Firth KJ, Wang A, Burka JF, Johson SC. Changes in hydrolytic enzyme activities of naïve 309

Atlantic salmon Salmo salar skin mucus due to infection with the Salmon louse Lepeophtheirus salmons 310

and cortisol implantation. Diseases of Aquatic Organisms. 2000 41:43–51. 311

21. Khodadadianzou H, Hoseinifar SH, Miandare HK, Hajimoradloo A. Agaricus bisporus powder 312

improved cutaneous mucosal and serum immune parameters and up-regulated intestinal cytokines 313

gene expression in common carp (Cyprinus carpio) fingerlings. Fish and Shellfish Immunology. 2016 314

58:380–6. 315

22. Ellis AE. Techniques in Fish Immunology. Techniques in Fish Immunology. Fair Haven, New 316

Jersey, USA: SOS Publications; 1990, p. 95–103. 317

23. Siwicki AK, Anderson DP, Rumsey GL. Dietary intake of immunostimulants by rainbow trout 318

affects non-specific immunity and protection against furunculosis. Veterinary Immunology and 319

Immunopathology. 1994 41:125-39. 320

24. Silhavy T, Kahne D, Walker S. The bacterial cell envelope. Cold Spring Harbor Perspectives in 321

Biology. 2010. 322

25. Clarke T, Davis K, Lysenko E, Zhou A, Yu Y, Weiser J. Recognition of peptidoglycan from the 323

microbiota by Nod1 enhances systemic innate immunity. Nature Medicine. 2010 16:228-31. 324

26. Li X, Stark G. NF kappa B-dependent signaling pathways. Experimental Hematology. 2002 325

30:285–96. 326

27. Uribe C, Folch H, Enriquez R, Moran G. Innate and adaptive immunity in teleost fish: A review. 327

Vet Med. 2011 56:486–503. 328

28. Hoseinifar SH, Khalili M, Rufchaei R, Raeisi M, Attar M, Cordero, et al. Effects of date palm fruit 329

extracts on skin mucosal immunity, immune related genes expression and growth performance of 330

common carp (Cyprinus carpio) fry Running head: Palm extract and carp health. Fish and shellfish 331

Immunology. 2015 47:706-11. 332

29. Modanloo M, Soltanian S, Akhlaghi M, Hoseinifar SH. The effects of single or combined 333

administration of galactooligosaccharide and Pediococcus acidilactici on cutaneous mucus immune 334

parameters, humoral immune responses and immune related genes expression in common carp 335

(Cyprinus carpio) fingerlings. . Fish and Shellfish Immunology. 2017 70:391-7. 336

30. Esteban MA. An overview of the immunological defenses in fish skin. ISRN Immunology. 2012. 337

31. Heidarieh M, Mirvaghefi AR, Akbari M, Sheikhzadeh N, Kamyabi-Moghaddam Z, Askari H. 338

Evaluations of Hilyses™, fermented Saccharomyces cerevisiae, on rainbow trout (Oncorhynchus 339

mykiss) growth performance, enzymatic activities and gastrointestinal structure. Aquaculture 340

Nutrition. 2013 19:343-8. 341

32. Hoseinifar SH, Sharifian M, Vesaghi MJ, Khalili M, M.A. E. The effects of dietary 342

xylooligosaccharide on mucosal parameters, intestinal microbiota and morphology and growth 343

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

14

performance of Caspian whitefish (Rutilus frisii kutum) fry. Fish and Shellfish Immunology. 2014 39:231-344

6. 345

33. Hoseinifar S, Roosta Z, Hajimoradloo A, Vakili F. The effects of Lactobacillus acidophilus as 346

feed supplement on skin mucosal immune parameters, intestinal microbiota, stress resistance and 347

growth performance of black swordtail (Xiphophorus helleri). Fish and Shellfish Immunology. 2015 348

42:533-8. 349

34. Hoseinifar S, Khodadadianzou H, Van Doan H, Miandare HK, Hoseini SM. Evaluation of some 350

intestinal cytokines genes expression and serum innate immune parameters in common carp (Cyprinus 351

carpio) fed dietary loquat (Eriobotrya japonica) leaf extract. . Aquaculture research 2018 49:120-7. 352

35. Hoseinifar SH, Khodadadianzou H, Miandare HK, Van Doan H, Romano N, Dadar M. Enrichment 353

of common carp (Cyprinus carpio) diet with medlar (Mespilus germanica) leaf extract: Effects on skin 354

mucosal immunity and growth performance. Fish and Shellfish Immunology 2017 67:346-52. 355

36. Subramanian S, MacKinnon S, Ross N. A comparative study on innate immune parameters in the 356

epidermal mucus of variousfish species. . Comparative Biochemistry and Physioliology B Biochemistry 357

and Molecular Biology. 2007 148:256-63. 358

37. Fernandes JMO, Smith VJ. A novel antimicrobial function for a ribosomal peptide from rainbow 359

trout skin. Biochemical and Biophysical Research Communication 2002 296:167-71. 360

38. Roosta Z, Hajimoradloo A, Ghorbani R, Hoseinifar S. The effects of dietary vitamin C on mucosal 361

immune responses and growth performance in Caspian roach (Rutilus rutilus caspicus) fry. Fish 362

Physiology and Biochemistry. 2014 40:1601-7. 363

39. Mansouri Taei H, Hajimoradloo A, Hoseinifar SH, Ahmadvand H. Dietary Myrtle (Myrtus 364

communis L.) improved non-specific immune parameters and bactericidal activity of skin mucus in 365

rainbow trout (Oncorhynchus mykiss) fingerlings. Fish and Shellfish Immunology. 2017 64:320-4. 366

40. Ashouri G, Soofiani N.M., Hoseinifar SH, Jalali S.A.H, Morshedi V, Van Doan H, et al. Combined 367

effects of dietary low molecular weight sodium alginate and Pediococcus acidilactici MA18/5M on 368

growth performance, haematological and innate immune responses of Asian sea bass (Lates calcalifer) 369

juveniles. . Fish and shellfish immunology 2018 79:34–41. 370

41. Safari R, Hoseinifar SH, Van Doan H, Dadar M. The effects of dietary Myrtle (Myrtus communis) 371

on skin mucus immune parameters and mRNA levels of growth, antioxidant and immune related genes 372

in zebrafish (Danio rerio). . Fish & Shellfish Immunology 2017 66:264-9. 373

42. Van Doan H, Hoseinifar S, Tapingkae W, Chitmanat C, Mekchay S. Effects of Cordyceps militaris 374

spent mushroom substrate on mucosal and serum immune parameters, disease resistance and growth 375

performance of Nile tilapia, (Oreochromis niloticus). Fish & Shellfish Immunology. 2017 67:78-85. 376

43. Nayak S. Role of gastrointestinal microbiota in fish. Aquaculture research. 2010 41:1553-73. 377

44. Hosseini M, Miandare H, Hoseinifar S, Yarahmadi P. Dietary Lactobacillus acidophilusmodulated 378

skin mucus protein profile, immune and appetite gene expression in gold fish (Carassius auratus gibelio) 379

Fish and Shellfish Immunology. 2016 59:149-54. 380

45. Yarahmadi P, Miandare HK, Farahmand H, Mirvaghefi A, Hoseinifar SH. Dietary fermentable fiber 381

upregulated immune related genes expression, increased innate immune response and resistance of 382

rainbow trout (Oncorhynchus mykiss) against Aeromonas hydrophila. Fish & Shellfish Immunology. 383

2014 41:326-31. 384

46. Al-Sadi R, Ye D, Dokladny K, Ma TY. Mechanism of IL-ß-induced increase in intestinal epithelial 385

tight junction permeability. The journal of immunology. 2008 180:5653–61. 386

47. Wang F, Graham WV, Wang Y, Witkowski ED, Schwarz BT, Turner JR. Interferon-gamma and 387

tumor necrosis factor-α synergize to induce intestinal epithelial barrier dysfunction by upregulating 388

myosin light chain kinase expression. American journal of pathology. 2005 166:409–19. 389

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

15

48. Humphrey BD, Huang N, Klasing KC. Rice expressing lactoferrin and lysozyme has antibiotic-like 390

properties when fed to chicks. Journal of Nutrition. 2002 132:1214-8. 391

49. Gong M, Anderson D, Rathgeber B, MacIsaac J. The effect of dietary lysozyme with EDTA on 392

growth performance and intestinal microbiota of broiler chickens in each period of the growth cycle. 393

The Journal of Applied Poultry Research. 2017 26:1-8. 394

395

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

24

Table 1. Primers sequences and amplification efficiencies Gene name Sequences of primers Accession no Efficiency

ß-actin Forward:

AGACATCAGGGTGTCATGGTTGGT

M24113.1 97%

Reverse: CTCAAACATGATCTGTGTCAT

IL1ß Forward: ACCAGCTGGATTTGTCAGAAG AB010701.1 98%

Reverse: ACATACTGAATTGAACTTTG

TNF-α Forward: GGTGATGGTGTCGAGGAGGAA AJ311800.1 97%

Reverse: TGGAAAGACACCTGGCTGTA

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

25

Table 2. Growth performance of rainbow trout fed with different dietary lysozyme levels

(g ) for 8 weeks experimental period (means ± SD)

Index Control 0.5 g 1 g 1.5 g

BWi (g)a 5.44 ± 0.08 5.42 ± 0.05 5.50 ± 0.04 5.48 ± 0.07

BWf (g)b 27.62 ± 1.7 29.19 ± 0.3 29.58 ± 0.4 30.07 ± 0.75

WG (%)c 407.6 ± 32.2 438.6 ± 2.1 437.1 ± 8.7 441.4 ± 12.6

SGR (% day)d 2.70 ± 0.10 2.80 ± 0.06 2.80 ± 0.02 2.83 ± 0.03

FCRf 1.02 ± 0.08 0.95 ± 0.01 0.94 ± 0.01 0.93 ± 0.02

Survival (%)e 100 100 100 100

a Initial body weight

b Final body weight

c Weight gain (%) = (BWf – BWi) / BWi

d Specific growth rate (%) = ((ln BWf – ln BWi) / t) × 100, where t is 60 days

e Survival (%) = (number of fish in each group remaining at the end of each phase / initial

number of fish) × 100

f Feed conversion ratio = feed intake (g) / weight gain (g).

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

20

Figure 1. Serum total immunoglobulin levels of the rainbow trout fingerlings fed different levels

of dietary microbial lysozyme. Bars assigned with different superscripts are significantly

different (P < 0.05); Values are presented as the mean ± S.E.

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

21

Figure 2. Skin mucus total protein (a) and total Ig (b) contents in O. mykiss fingerlings fed

different levels of dietary microbial lysozyme. Bars assigned with different superscripts are

significantly different (P < 0.05); Values are presented as the mean ± S.E.

a

b

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

22

Figure 3. Skin mucus lysozyme (c) and alkaline phosphatase (d) activities in O. mykiss

fingerlings fed different levels of dietary microbial lysozyme. Bars assigned with different

superscripts are significantly different (P < 0.05); Values are presented as the mean ± S.E.

d

c

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

23

Figure. 4. The effects of different levels of dietary microbial lysozyme on the relative expression

of TNF-α (a) and IL1ß (b) genes in O. mykiss fingerlings intestine. Bars assigned with different

superscripts are significantly different (P < 0.05); Values are presented as the mean ± S.E.

a

b

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

Dietary administration of lysozyme boosted humoral and mucosal immune defenses of rainbow

trout

Significant increase in intestinal cytokines gene expression including TNF-α and IL1ß was found

in fish fed 1.0 and 1.5 g kg-1 lysozyme

No significant improvement growth performance and feed conversion ration were observed in

lysozyme supplemented diets