Transcript
Page 1: HaoQi (Esther) Li 06/21/06 – 08/11/06

Development & Development & Optimization of a Sensitive Optimization of a Sensitive

& Specific Quantitative & Specific Quantitative Real-Time PCR Assay for Real-Time PCR Assay for

Borrelia lonestariBorrelia lonestariHaoQi (Esther) LiHaoQi (Esther) Li

06/21/06 – 08/11/0606/21/06 – 08/11/06

Page 2: HaoQi (Esther) Li 06/21/06 – 08/11/06

U.S. Naval Medical Research U.S. Naval Medical Research CenterCenter

Infectious Diseases Infectious Diseases DirectorateDirectorate

Rickettsial Diseases Rickettsial Diseases DepartmentDepartment

503 Robert Grant 503 Robert Grant AvenueAvenue

Silver Spring, MD Silver Spring, MD 2091020910

Page 3: HaoQi (Esther) Li 06/21/06 – 08/11/06

MentorsMentors Dr. Allen RichardsDr. Allen Richards Former Director of Former Director of

Rickettsial Diseases Rickettsial Diseases DepartmentDepartment

Dr. Ju JiangDr. Ju Jiang Naval Medical Naval Medical

Research Center Research Center ScientistScientist

Page 4: HaoQi (Esther) Li 06/21/06 – 08/11/06

OrganizationOrganization

My role: science My role: science researcherresearcher

Working environment:Working environment: Clean roomClean room Dirty hoodDirty hood Smart cyclersSmart cyclers SafetySafety

Page 5: HaoQi (Esther) Li 06/21/06 – 08/11/06

Problem/RationaleProblem/Rationale

Borrelia lonestariBorrelia lonestariNewly discoveredNewly discoverednot related to not related to RickettsiaRickettsia

Southern Tick-Associated Rash Illnesses Southern Tick-Associated Rash Illnesses (STARI)(STARI)Resembles Lyme diseaseResembles Lyme diseaseNot Not Borrelia burgdorferiBorrelia burgdorferiDiagnosis problemDiagnosis problem

Page 6: HaoQi (Esther) Li 06/21/06 – 08/11/06

Purpose/GoalPurpose/Goal

To find a molecular probe sensitive and To find a molecular probe sensitive and specific for specific for Borrelia lonestari Borrelia lonestari flagellin flagellin genegene

Page 7: HaoQi (Esther) Li 06/21/06 – 08/11/06

Borrelia lonestari Borrelia lonestari BacteriaBacteria

Spirochete is spiral shapedSpirochete is spiral shapedCarried by lone-star ticks Carried by lone-star ticks

http://www.health.state.ok.us/program/cdd/STARI.htm

The Borrelia burgdorferi spirochete:the agent of Lyme disease

http://www.marvistavet.com/html/body_lyme_disease.html

Page 8: HaoQi (Esther) Li 06/21/06 – 08/11/06

Infection of BacteriaInfection of Bacteria

Rash IllnessesRash IllnessesLocationLocation

http://newsletter.mydna.com/health/diseases/lyme/othertick/staritick.html

Patient with a classic erythema migrans; 1) site of tick bite, 2) red, radial, expanding edge of rash. 3) central

clearing.

Page 9: HaoQi (Esther) Li 06/21/06 – 08/11/06

Previous ResearchPrevious Research

Cultured isolationCultured isolation PCR-RFLPPCR-RFLP Deer samplesDeer samples

http://www.policlinicagipuzkoa.com/GeneticaMolecular/imagenes/PROTOMBINA2.jpg

Page 10: HaoQi (Esther) Li 06/21/06 – 08/11/06

Beacon Probe + qPCRBeacon Probe + qPCRFAM reporter and Black Hole Quencher 1FAM reporter and Black Hole Quencher 1Quantitative real-time PCRQuantitative real-time PCR

http://www.marine.usf.edu/microbiology/nasba.shtml http://bio.takara.co.jp/catalog/catalog_d.asp?C_ID=C1322

Page 11: HaoQi (Esther) Li 06/21/06 – 08/11/06

AssaysAssays

Find unique sequence of Find unique sequence of B. lonestari B. lonestari

Use full-gene primers to clone the geneUse full-gene primers to clone the gene

11F Primer 594F Primer 655 FAM 719R Primer 970R Primer

Page 12: HaoQi (Esther) Li 06/21/06 – 08/11/06

Assay MaterialsAssay Materials

NCBI GenBank – findNCBI GenBank – find Basic Local Alignment Search Tool – relateBasic Local Alignment Search Tool – relate ClustalW – alignClustalW – align GeneDoc – color unique bpGeneDoc – color unique bp

Gene Sequence (5’ – 3’) starting from 655 base pair

Borrelia species GCAGCTCCAGCTCCAGCAGCAGCTCCAGCTCAAGGTGGAGTTAA

Borrelia lonestari CCAGCTCCAGCTC AAGGTGGGATTAG

Page 13: HaoQi (Esther) Li 06/21/06 – 08/11/06

Optimization TestsOptimization Tests

PrimersPrimersProbeProbeMgClMgCl22Annealing TemperatureAnnealing Temperature

Concentration variations testing all done Concentration variations testing all done by qPCRby qPCR

Page 14: HaoQi (Esther) Li 06/21/06 – 08/11/06

Sensitivity TestsSensitivity Tests

Full gene PCRFull gene PCRConcentration calculation Concentration calculation qPCR standard testsqPCR standard tests

Page 15: HaoQi (Esther) Li 06/21/06 – 08/11/06

Specificity TestsSpecificity Tests

TypesTypes 7 related 7 related Borrelia Borrelia

spp.spp. 23 non-related 23 non-related

bacteria DNAbacteria DNA

HypothesisHypothesis qPCRqPCR

No. Borrelia Bacterial DNANon-Borrelia Bacterial

DNA 1 B. recurrentis R. prowazekii Breinl2 B. coriaceae* R. typhi Wilmington3 B. burgdorferi R. canadensis4 B. afzelii R. rickettsii VR 8915 B. hermsii R. conorii6 B. garinii R. parkeri 7 B. duttoni R. montanensis8 R . slovaca9 R. sibirica

10 R. japonica 11 R. akari12 Escherichia coli13 Proteus mirabilis OXK14 Salmonella enterica15 Legionella pneumophila16 Francisella persica17 Bartonella quintana18 Bartonella vinsonii19 Neorickettsia sennetsu20 Neorickettsia risticii21 Orientia tsutsugamushi 22 Staphylococcus aureus 23 Corynebacterium sp

Page 16: HaoQi (Esther) Li 06/21/06 – 08/11/06

Results: Initial Testing of AssayResults: Initial Testing of Assay

Page 17: HaoQi (Esther) Li 06/21/06 – 08/11/06

Results: Transformant DNA Results: Transformant DNA

Page 18: HaoQi (Esther) Li 06/21/06 – 08/11/06

Results: Assay SensitivityResults: Assay Sensitivity

Page 19: HaoQi (Esther) Li 06/21/06 – 08/11/06

Results: Assay Sensitivity LineResults: Assay Sensitivity Line

Page 20: HaoQi (Esther) Li 06/21/06 – 08/11/06

Results: Assay SpecificityResults: Assay Specificity

Negative resultsNegative results ImplicationsImplications

Page 21: HaoQi (Esther) Li 06/21/06 – 08/11/06

Conclusions Conclusions

• Primers and probe Primers and probe • create a specific and sensitive create a specific and sensitive B. lonestariB. lonestari

qPCR assay. qPCR assay. • The assayThe assay

• SensitiveSensitive• SpecificSpecific

• Future researchFuture research• clinical samplesclinical samples

Page 22: HaoQi (Esther) Li 06/21/06 – 08/11/06

ReflectionsReflectionsWonderful learning experienceWonderful learning experiencePatient, informative mentorsPatient, informative mentorsRelaxed environmentRelaxed environmentLong drive, but worth the effortLong drive, but worth the efforthttp://www.nmrc.navy.mil/nmrc_stdt_main.http://www.nmrc.navy.mil/nmrc_stdt_main.

htmhtmhttp://http://www.asee.org/SEAP/index.cfmwww.asee.org/SEAP/index.cfm

Page 23: HaoQi (Esther) Li 06/21/06 – 08/11/06

AcknowledgementsAcknowledgements

• Dr. Allen L. Richards, Director Rickettsial Diseases Dr. Allen L. Richards, Director Rickettsial Diseases DepartmentDepartment

• Dr. Ju Jiang, Navy Medical Research CenterDr. Ju Jiang, Navy Medical Research Center• Dr. Barbara Wood, Thomas Jefferson High School Dr. Barbara Wood, Thomas Jefferson High School

for Sci. & Tech.for Sci. & Tech.• Mr. Fred Lampazzi, Thomas Jefferson High School Mr. Fred Lampazzi, Thomas Jefferson High School

for Sci. & Tech.for Sci. & Tech.• Joey Flyer, University of RochesterJoey Flyer, University of Rochester• Science & Engineering Apprentice Program, NMRCScience & Engineering Apprentice Program, NMRC• TJHSST Mentorship ProgramTJHSST Mentorship Program

Page 24: HaoQi (Esther) Li 06/21/06 – 08/11/06

Literature CitedLiterature Cited Burkot, T. R., Mullen, G. R., Anderson, R., Schneider, B. S., Happ, C. M., & Zeidner, N. S. Burkot, T. R., Mullen, G. R., Anderson, R., Schneider, B. S., Happ, C. M., & Zeidner, N. S.

(2001, May/June). (2001, May/June). Borrelia lonestari Borrelia lonestari DNA in adult DNA in adult Amlyomma americanumAmlyomma americanum ticks, Alabama. ticks, Alabama. Emerging Infectious Diseases, 7Emerging Infectious Diseases, 7(3), 471-473.(3), 471-473.

Fukunaga, M., Okada, K., Nakao, M., Konishi, T., & Sato, Y. (1996, October). Phylogenetic Fukunaga, M., Okada, K., Nakao, M., Konishi, T., & Sato, Y. (1996, October). Phylogenetic analysis of Borrelia species based on flagellin gene sequences and its application for molecular analysis of Borrelia species based on flagellin gene sequences and its application for molecular typing of lyme disease Borreliae. typing of lyme disease Borreliae. International Journal of Systematic Bacteriology, 46International Journal of Systematic Bacteriology, 46(4), 898-(4), 898-905.905.

Jiang, J., Chan, T.-C., Temenak, J. J., Dasch, G. A., Ching, W.-M., & Richards, A. L. (2004). Jiang, J., Chan, T.-C., Temenak, J. J., Dasch, G. A., Ching, W.-M., & Richards, A. L. (2004). Development of a Quantitative Real-Time Polymerase Chain Reaction assay specific for Development of a Quantitative Real-Time Polymerase Chain Reaction assay specific for Orientia tsutsugamushiOrientia tsutsugamushi. . American Society of Tropical Medicine and Hygiene, 70American Society of Tropical Medicine and Hygiene, 70(4), 351-356.(4), 351-356.

Jiang, J., Temenak, J. J., & Richards, A. L. (2003). Real-time PCR duplex assay for Jiang, J., Temenak, J. J., & Richards, A. L. (2003). Real-time PCR duplex assay for Rickettsia Rickettsia prowazekiiprowazekii and and Borrelia recurrentisBorrelia recurrentis. In K. E. Hechemy, T. Avsic-Zupanc, J. E. Childs, & D. A. . In K. E. Hechemy, T. Avsic-Zupanc, J. E. Childs, & D. A. Raoult (Eds.), Raoult (Eds.), Rickettsiology present and future directionsRickettsiology present and future directions (pp. 302-310). New York: New York (pp. 302-310). New York: New York Academy of Sciences. From Academy of Sciences. From Rickettsiology Present and Future DirectionsRickettsiology Present and Future Directions..

Moore IV, V. A., Varela, A. S., Yabsley, M. J., Davidson, W. R., & Little, S. E. (2003, January). Moore IV, V. A., Varela, A. S., Yabsley, M. J., Davidson, W. R., & Little, S. E. (2003, January). Detection of Detection of Borrelia lonestariBorrelia lonestari, putative agent of southern tick-associated rash illness, in white-, putative agent of southern tick-associated rash illness, in white-tailed deer (tailed deer (Odocoileus virginianusOdocoileus virginianus) from the southeastern United States. ) from the southeastern United States. Journal of Clinical Journal of Clinical Microbiology, 41Microbiology, 41(1), 424-427.(1), 424-427.


Top Related