Download - SRPT - 1924-349902-1.pdf
-
8/9/2019 SRPT - 1924-349902-1.pdf
1/82
RBC Capital Markets, LLC
Simos Simeonidis, Ph.D. (Analyst)212 437 [email protected]
Sector PerformSpeculative Risk
NASDAQ: SRPT; USD 11.85
Price Target USD 15.00Scenario Analysis*
DownsideScenario
8.00
32%
CurrentPrice
11.85
PriceTarget
15.00
27%
UpsideScenario
22.00
86%
*Implied Total Returns
Key StatisticsShares O/S (MM): 46.6
Dividend: 0.00
Market Cap (MM): 5
Yield: 0.0
Avg. Daily Volume: 1,207,6
RBC EstimatesFY Dec 2013A 2014E 2015E 201
Revenue 14.2 10.2 2.0 133
EPS, Ops Diluted (3.31) (3.06) (3.34) (1.4
Revenue Q1 Q2 Q3 Q
2013 4.5A 3.0A 4.2A 2.6
2014 6.1A 2.6A 1.1A 0.
2015 0.5E 0.5E 0.5E 0.
EPS, Ops Diluted
2013 (1.32)A (0.60)A (1.24)A (0.23
2014 (0.75)A (0.85)A (0.71)A (0.75
2015 (0.80)E (0.83)E (0.85)E (0.86All values in USD unless otherwise noted.
January 22, 2015
Sarepta Therapeutics, Inc.
Initiating with Sector Perform: Near-termuncertainty keeps us on the sidelines
Our view: Sarepta recently announced 168-week data from the original
trial in 12 boys with DMD and expects to submit the eteplirsen NDA
by mid-2015. The company will conduct the fourth biopsy in 1Q15,
continue to enroll patients in new trials and will conduct an independent
assessment of its dystrophin data. Despite the recent pullback, near-term
uncertainty and potential volatility keeps us on the sidelines on SRPT.
Key points:We think eteplirsen could eventually get through the FDA, but near-term
uncertainty keeps us on the sidelines. Duchenne Muscular Dystrophy
(DMD) is a devastating disease affecting young boys and their families, and
FDA now appears very willing to work closely with companies to approve
drugs for it. We believe the agency is under significant pressure to approve
a drug for these patients soon. Given eteplirsens apparent benign safety
profile and pressure by patient advocacy groups, we believe the eteplirsen
NDA could eventually get the green light, despite a number of outstanding
questions. However, near-term uncertainty around clinical/regulatory
progress keep us on the sidelines and on our rating at Sector Perform,
Speculative Risk. We will look for entry points with these uncertainties out
of the way and once a clearer understanding of filing requirements, details
on timing, status of ongoing trials, and the AdCom have been delineated.
Sarepta vs. BioMarin: who has the better drug?BioMarins acquisition of
Sareptas direct competitor, Prosensa, is obviously a key point to consider.
Among the many similarities between the two drugs are their mechanisms
of action, both RNA-targeting drugs, and the fact that both companies
have looked at different cuts of the data where their drug looks better.
Sarepta points to drisapersens failed Phase III trial, AE profile and argue
that they dont make dystrophin. Prosensa countered by pointing to
the small size of Sarepta's most advanced trial and that the FDA recently
casted doubts on its dystrophin measurement methodology. A number of
additional issues to consider include IP, regulatory expertise, commercial
execution, first to market (US and EU), etc. In most of these, the nod
would have to go to BioMarin, given its track record and reputation as
one of the top rare disease companies. On the other hand, despite a lot
of the controversy around Sarepta, including management drawing lotsof criticism for its handling of regulatory interactions, the company has
garnered a lot of institutional expertise on DMD, especially in dealing with
FDA, since they have been at the forefront of this effort. We also believe
that they deserve a lot of the credit for bringing about a sea of change
in how the FDA is now dealing with DMD. So, we dont necessarily see a
clear winner between the two yet and believe a lot of this could play out
at the FDA AdCom, where we will get a clearer understanding of the FDAs
views on these agents and where a lot of the clinical questions will have
to be addressed.
Priced as of prior trading day's market close, EST (unless otherwise noted)For Required Conflicts Disclosures, see Page 79.
-
8/9/2019 SRPT - 1924-349902-1.pdf
2/82
Target/Upside/Downside Scenarios
Exhibit 1: Sarepta Therapeutics, Inc.
80m
60m
40m
20m
A S O N
2012
D J F M A M J J A S O N
2013
D J F M A M J J A S O N
2014
D J
UPSIDE22.00
TARGET15.00
CURRENT11.85
DOWNSIDE8.00
Jan 2016
55.5
35.5
25.5
20.5
15.5
10.5
5.50
125 Weeks 31AUG12 - 21JAN15
SRPT Rel. S&P 500 COMPOSITE MA 40 weeks
Source: Bloomberg and RBC Capital Markets estimates for Upside/Downside/Target
Target price/base caseWe use a sum-of-the-parts methodology to value Sarepta
shares, and estimate the probability adjusted NPV of the
following: 1) the eteplirsen sales DMD ($13/share), and 2) the
companys projected net cash position ($2/share).
Upside scenario
Our upside scenario of $22/share assumes that the FDA
approves eteplirsen and at the same time request more data
and thus delay the NDA submission of drisapersen, the exon
51 skipping drug from Prosensa/BioMarin. Therefore, Sarepta
could gain significantly more market share with this setback to
its main competitor. Under this scenario, we estimate that the
probability adjusted NPV of eteplirsen sales could reach $20/share.
Downside scenario
Our downside scenario of $8/share assumes that the FDA
would request more data for the NDA submission of
eteplirsen. Thus, Sarepta would have to delay its plan of NDA
submission by mid 2015 and commercial launch in 2016. This
would give drisapersen more opportunity to gain market share
and limit the market potential of eteplirsen. Our downside
estimate of the NPV value of eteplirsen sales is $6/share.
Investment summaryWe think eteplirsen could eventually get through the
FDA, but near-term uncertainty keeps us on the sidelines.
Duchenne Muscular Dystrophy (DMD) is a devastating disease
affecting young boys and their families, and FDA now appears
very willing to work closely with companies to approve
drugs for it. We believe the agency is under significant
pressure to approve a drug for these patients soon. Given
eteplirsens apparent benign safety profile and pressure by
patient advocacy groups, we believe the eteplirsen NDA
could eventually get the green light, despite a number
of outstanding questions. However, near-term uncertainty
around clinical/regulatory progress keep us on the sidelines
and on our rating at Sector Perform, Speculative Risk. We
will look for entry points with these uncertainties out of the
way and once a clearer understanding of filing requirements,
details on timing, status of ongoing trials, and the AdCom havebeen delineated.
Sarepta vs. BioMarin: who has the better drug? BioMarins
acquisition of Sareptas direct competitor, Prosensa, is
obviously a key point to consider. Among the many similarities
between the two drugs are their mechanisms of action and
the fact that both companies have looked at different cuts
of the data where their drug looks better. Sarepta points
to drisapersens failed Phase III trial, AE profile and argue
that they dont make dystrophin. Prosensa countered by
pointing to the small size of Sarepta's most advanced trial
and that the FDA recently casted doubts on its dystrophin
measurement methodology. Additional issues include IP,regulatory expertise, commercial execution, first to market,
etc. In most of these, the nod would have to go to BioMarin,
given its track record and reputation as one of the top rare
disease companies. On the other hand, despite a lot of
the controversy, Sarepta has garnered a lot of institutional
expertise on DMD, especially in dealing with FDA. So, we
dont necessarily see a clear winner between the two yet and
believe a lot of this could play out at the FDA AdCom, where
we will get a clearer understanding of the FDAs views on these
agents and where a lot of the clinical questions will have to be
addressed.
Risks: 1) Negative data from the 4thbiopsy or independentassessment of dystrophin; 2) Further setback to the plan to file
NDA by mid-15; 3) Competitors milestone in regulatory filing,
approval and launch. These risks, if they materialize, may
result in significant volatility, and given that the majority of the
value comes from a single product, lead to the Speculative Risk
qualifier on our rating.
Sarepta Therapeutics, Inc.
January 22, 2015 Simos Simeonidis 212 437 9293; [email protected] 2
-
8/9/2019 SRPT - 1924-349902-1.pdf
3/82
Key QuestionsOur View
1. Can Sarepta meet its projected
timeline in filing the NDA foreteplirsen or will we see more
delays?
There is risk in meeting the timeline to file the NDA by mid-2015, but we view it
as an achievable goal.However, we acknowledge the outstanding risks, of whichpatient enrollment and natural history data collection will be the rate-limiting
steps for the NDA submission in mid 2015. With the first patient dosed in Study
301 in November 2014, the company expects to start dosing 12-24 patients in
January 2015. Therefore, we assume patient enrollment will not become an issue.
Sarepta also has to collect natural history data from a few academic studies. We
note that Sareptas strong support from the DMD patient community and the
involvement of the FDA should help Sarepta obtain natural history data on time.
2.
How does the new 168-week data
affect the chances of eteplirsen
approval?
It definitely does not help, but it doesnt signal the end, either. Despite the
continuing decline of the 6MWT in the eteplirsen-treated cohort, we believe
eteplirsen can be approved based on its exhibited ability to maintain ambulation
in the boys treated. Investors and FDA did not expect an exon skipping drug to bea cure for DMD. The best case scenario would be a delay in this progressive
disease. Thus far, the data (albeit very small) has shown signs of eteplirsens
ability to maintain ambulatory activity in the 10 boys in this dataset. We believe
the right comparison is against a natural history cohort who are similarly aged and
with a comparable baseline 6MWT. Qualitatively, the doctors we spoke to would
all expect an average 12 year old DMD boy to have lost ambulation. Clearly, the
Study 202 dataset demonstrates that the eteplirsen cohort are still ambulatory,
which would imply a treatment benefit in delaying the loss of ambulation.
3. How far behind Prosensa/BioMarins
drisapersen is Sareptas eteplirsen?
Will there be a significant first-to-market advantage, if both therapies
are approved?
Even if drisapersen reaches the market ahead of eteplirsen, we believe that over
time, many (at least US) patients may migrate to eteplirsen treatment, due to
the eteplirsens more benign side effect profile.The two drugs remain in a head-to-head competition to receive FDA approval as the first exon 51 skipping therapy
for DMD patients. BioMarin expects to complete the drisapersen NDA submission
in 1Q15, whereas Sarepta anticipates filing in mid 2015 for its eteplirsen NDA. If
both drisapersen and eteplirsen were approved, the first-to-market advantage in
our estimates would be about half a year for the best case scenario for
Prosensa/BioMarins drisapersen. However, KOLs point out the proteinuria and
the injection site reactions seen with drisapersen as potential obstacles, especially
in a patient population who would receive treatment for many years. These issues
may provide enough ground for patients to eventually prefer eteplirsen. So, we
dont see getting to market a few months or a year after drisapersen as
Sareptas biggest issue: its if they dont get approved, or get approved a number
of years later that would be the real issue.
4. How will the IP dispute with
Prosensa/BioMarin play out?
In the EU, we do not expect Sarepta to win its appeal of the prior decision to
grant Prosensa/BioMarins patent claims on exon 51 skipping agents. Under this
scenario, we expect Sarepta to seek a licensing deal from and pay royalties to
Prosensa/BioMarin in order to launch eteplirsen in the EU. In the US, Sarepta is in
similar IP interference proceedings with Prosensa. Before a final decision from the
patent appealing process is reached, Sarepta can still market eteplirsen in the US.
However, losing the US court decision and appeal would leave it in the same IP
predicament as it is in the EU.
Sarepta Therapeutics, Inc.
January 22, 2015 Simos Simeonidis 212 437 9293; [email protected] 3
-
8/9/2019 SRPT - 1924-349902-1.pdf
4/82
Table of contents
Valuation .............................................................................................................................. 5
1) Eteplirsen sales ($13/share) ................................................................................................... 5
2) Sareptas projected net cash position ($2/share) .................................................................. 8
Price Target Impediments .......................................................................................................... 8
Company Overview .............................................................................................................. 9
Sareptas lead asset: eteplirsen (exon 51 skipping agent) ................................................... 10
What is exon skipping?............................................................................................................. 10
A Quick Look Back at Sareptas Stock Movements .................................................................. 14
What is the FDAs Position on DMD Therapeutics? ................................................................. 16
What is the data on eteplirsen? ............................................................................................... 18
Prosensas Drisapersen vs. Sareptas Eteplirsen ...................................................................... 22
A review of eteplirsens development program ...................................................................... 30A Look at Prosensas Drisapersen Clinical Data ........................................................................ 43
Intellectual property ................................................................................................................ 58
DMD: A devastating disease..................................................................................................... 60
Competitive Landscape for DMD Treatments .......................................................................... 63
Sareptas RNA-based technology ........................................................................................ 66
Sareptas infectious disease program ................................................................................. 68
Eteplirsen revenue model................................................................................................... 73
Sarepta: Income Statement and Balance Sheet .................................................................. 75
Sarepta Therapeutics, Inc.
January 22, 2015 Simos Simeonidis 212 437 9293; [email protected] 4
-
8/9/2019 SRPT - 1924-349902-1.pdf
5/82
ValuationTo value Sarepta shares, we use a sum-of-the-parts methodology, and estimate the
probability adjusted NPV of: 1) the eteplirsen sales, and 2) the companys projected net cash
position.
To make a conservative valuation, we use the total number of diluted shares in our
calculation, which is the sum of two parts: the number of common shares and the number of
potentially dilutive shares (including warranty, options, restricted stock awards, restricted
stock units, and stock appreciation rights). As of September 30, 2014, Sarepta had 41.3MM
common shares. The number of potentially dilutive shares outstanding was 5.3MM at the
end of September 2014, which mainly include 5.1MM options (weighted exercise price at
$24.67) and 0.2MM stock appreciation rights (weighted exercise price at $18.18). Therefore,
we calculate the total number of diluted shares as 46.6MM at the end of 3Q14 and we
estimate that the number of diluted shares is 47.3M at YE14.
1) Eteplirsen sales ($13/share)i) US salesWe have modeled that eteplirsen could reach peak sales of $541MM in the US in 2026 for
the treatment of DMD patients with dystrophin mutations amenable to exon 51 skipping
therapies. For the label of eteplirsen in the US, we make an assumption that FDA will be
more lenient than its counterpart in the EU and will allow eteplirsen to be prescribed to any
DMD patients eligible for exon 51 skipping without limits on age or ambulatory status.
ii) EU SalesWe have modeled that eteplirsen could reach peak sales of $231MM in the EU in 2026 for
the treatment of DMD patients with dystrophin mutations amenable to exon 51 skipping
therapies. For the label of eteplirsen in the EU, we assume that it will only be prescribed to
ambulatory DMD patients at least 5 years old. This is in line with the recent EU approval of
Translarna, a DMD therapy whose label is for ambulatory DMD patients who are at least 5years old and have nonsense mutations.
iii) Discount Rate and Probability of Success (POS)In calculating the net present value of eteplirsens free cash flows, we use a 10% discount
rate. We have assigned 50% and 40% POS that eteplirsen will be approved and reaches the
US and EU market, respectively. We assign a lower POS in the EU mainly because
Prosensa/BioMarin currently holds the patent for exon 51 skipping in the EU, which would
prevent the commercial activities of eteplirsen if Sarepta does not reach a licensing
agreement with Prosensa/BioMarin. Using these assumptions, we arrive at a probability-
adjusted NPV for eteplirsen of $13/share.
Sarepta Therapeutics, Inc.
January 22, 2015 Simos Simeonidis 212 437 9293; [email protected] 5
-
8/9/2019 SRPT - 1924-349902-1.pdf
6/82
Exhibit 2: Eteplirsen NPV AnalysisUS ($MM)
($MM) 2015E 2016E 2017E 2018E 2019E 2020E 2021E 2022E 2023E 2024E 2025E 2026E 2027E 2028E 2029E 2030
US eteplirsen sales 0.0 106.8 302.0 413.9 483.4 496.9 510.7 525.0 529.0 533.1 537.2 541.3 54.5 27.5 27.7 27.9
Total eteplirsen revenue in US 0.0 106.8 302.0 413.9 483.4 496.9 510.7 525.0 529.0 533.1 537.2 541.3 54.5 27.5 27.7 27.9
Royalties paid to Prosensa/BioMarin 0.0 0.0 0.0 41.4 48.3 49.7 51.1 52.5 52.9 53.3 53.7 54.1 0.0 0.0 0.0 0.0
COGS 0.0 21.4 60.4 82.8 91.8 89.4 86.8 89.2 84.6 80.0 80.6 81.2 8.2 4.1 4.2 4.2
R&D 22.8 23.6 24.0 8.1 4.9 1.0 0.8 0.6 0.5 0.5 0.4 0.3 0.0 0.0 0.0 0.0
G&A 22.7 23.1 23.6 24.0 24.5 25.0 25.5 26.0 25.5 25.0 24.5 19.6 9.8 7.8 6.3 5.0
Sales expense for eteplirsen 0.0 16.0 16.5 17.0 17.5 18.0 18.5 19.1 18.1 17.2 16.4 8.2 4.1 2.0 1.4 1.4Marketing expense for eteplirsen 0.0 5.0 5.1 5.2 5.3 5.4 5.5 5.6 5.3 5.1 4.8 2.4 1.2 0.6 0.4 0.4
Tax adjusted EBIT (45.5) 17.8 146.6 188.3 232.8 246.7 225.7 232.3 239.4 228.8 231.9 244.1 20.3 8.4 10.0 11.0
Tax rate 0% 0% 15% 20% 20% 20% 30% 30% 30% 35% 35% 35% 35% 35% 35% 35%
Eteplirsen sales FCF (45.5) 17.8 146.6 188.3 232.8 246.7 225.7 232.3 239.4 228.8 231.9 244.1 20.3 8.4 10.0 11.0
Discount Period 0.94 1.94 2.94 3.94 4.94 5.94 6.94 7.94 8.94 9.94 10.94 11.94 12.94 13.94 14.94 15.94
Discount Factor 0.91 0.83 0.76 0.69 0.62 0.57 0.52 0.47 0.43 0.39 0.35 0.32 0.29 0.26 0.24 0.22
PV of eteplirsen sales FCF (41.6) 14.8 110.8 129.4 145.4 140.1 116.5 109.0 102.1 88.7 81.8 78.2 5.9 2.2 2.4 2.4
Discount Rate 10%
Perpetual Growth Rate 0%
Final year FCF $0
Terminal Value $0
Discount Factor 0.22
Present Value of Terminal Value $0
Present Value of Cash Flows $1,088
Present Value of Total Cash Flows $1,088
Fully Diluted Shares Outstanding (MM) 47
NPV of eteplirsen $23.03
Probability of Success 50%
NPV of eteplirsen (probability-adjusted) $11.51
Source: RBC Capital Markets estimates
Sarepta Therapeutics, Inc
January 22, 2015 Simos Simeonidis 212 437 9293; [email protected]
-
8/9/2019 SRPT - 1924-349902-1.pdf
7/82
Exhibit 3: Eteplirsen NPV AnalysisEU ($MM)
($MM) 2014E 2015E 2016E 2017E 2018E 2019E 2020E 2021E 2022E 2023E 2024E 2025E 2026E 2027E 2028E 2029E 2030E
EU eteplirsen sales 0.0 0.0 0.0 41.0 104.7 214.0 218.8 223.6 228.6 229.1 229.6 230.1 230.6 23.1 11.6 11.6 11.6
Total eteplirsen revenue in EU 0.0 0.0 0.0 41.0 104.7 214.0 218.8 223.6 228.6 229.1 229.6 230.1 230.6 23.1 11.6 11.6 11.6
Royalties paid to Prosensa/BioMarin 0.0 0.0 0.0 4.1 10.5 21.4 21.9 22.4 22.9 22.9 23.0 23.0 23.1 0.0 0.0 0.0 0.0
COGS 0.0 0.0 0.0 8.2 20.9 40.7 39.4 38.0 38.9 36.7 34.4 34.5 34.6 3.5 1.7 1.7 1.7
R&D 16.9 22.8 23.6 24.0 8.1 4.9 1.0 0.8 0.6 0.5 0.5 0.4 0.3 0.0 0.0 0.0 0.0
G&A 23.9 22.7 23.1 23.6 24.0 24.5 25.0 25.5 26.0 25.5 25.0 24.5 19.6 9.8 7.8 6.3 5.0
Tax adjusted EBIT (40.9) (45.5) (46.7) (30.5) 19.0 83.9 90.8 83.0 85.0 88.0 84.4 85.5 94.3 3.8 (0.0) 1.4 2.3
Tax rate 0% 0% 0% 15% 20% 20% 20% 30% 30% 30% 35% 35% 35% 35% 35% 35% 35%
Eteplirsen sales FCF (40.9) (45.5) (46.7) (30.5) 19.0 83.9 90.8 83.0 85.0 88.0 84.4 85.5 94.3 3.8 (0.0) 1.4 2.3
Discount Period -0.06 0.94 1.94 2.94 3.94 4.94 5.94 6.94 7.94 8.94 9.94 10.94 11.94 12.94 13.94 14.94 15.94
Discount Factor 1.01 0.91 0.83 0.76 0.69 0.62 0.57 0.52 0.47 0.43 0.39 0.35 0.32 0.29 0.26 0.24 0.22
PV of eteplirsen sales FCF (41.1) (41.6) (38.8) (23.1) 13.1 52.4 51.5 42.8 39.9 37.5 32.7 30.2 30.2 1.1 (0.0) 0.3 0.5
Discount Rate 10%
Perpetual Growth Rate 0%
Final year FCF $0
Terminal Value $0
Discount Factor 0.22
Present Value of Terminal Value $0
Present Value of Cash Flows $229
Present Value of Total Cash Flows $229
Fully Diluted Shares Outstanding (MM) 47
NPV of eteplirsen $4.84Probability of Success 40%
NPV of eteplirsen (probability-adjusted) $1.94
Source: RBC Capital Markets estimates
Sarepta Therapeutics, Inc
January 22, 2015 Simos Simeonidis 212 437 9293; [email protected]
-
8/9/2019 SRPT - 1924-349902-1.pdf
8/82
2) Sareptas projected net cash position ($2/share)Sarepta ended 3Q14 with $236MM in cash and $6MM in debt. We will consider projected
net cash in 12 months. By adding estimated net income, subtracting any amortized revenue,
and adding back non-cash stock-based compensation, we project Sarepta to end FY2015 witharound $84MM in net cash, which is approximately $2/share.
Exhibit 4: SRPT Sum-of-the-Parts Value
Eteplirsen (DMD) NPV - US $11.51
Eteplirsen (DMD) NPV - EU $1.94
Projected Net Cash $1.72
Sum-of-the-parts value for SRPT $15.17
SRPT: Sum-of-the-parts valuation
Source: RBC Capital Markets estimates
Price Target ImpedimentsFDA continues to question the validity of dystrophin expression measurementIn October, due to concerns about the reproducibility of the dystrophin positive fibers, the
FDA requested an independent assessment, among other things. If the FDA continues to
question Sareptas dystrophin expression data, then the likelihood of accelerated approval
for eteplirsen would be greatly reduced.
Royalty cost to be paid by Sarepta is significantly higherThe licensing negotiation between Sarepta and Prosensa/BioMarin could yield a higher
royalty rate, forcing Sarepta to pay more. In addition, the patent interference proceedings
and appealing process in the US between Sarepta and Prosensa/BioMarin regarding exon 51
skipping products could end earlier, which would require Sarepta to pay royalties earlier aswell.
High manufacturing cost of eteplirsen takes a toll on financesCompany management has commented that the manufacturing cost of eteplirsen is high and
has accounted for a large proportion of overall operation expenses. Because Sarepta has
started or is going to start 5 trials (3 for eteplirsen) with more than 200 patients in those
trials, the cost for making drugs needed in the trials will significantly increase, compared to
current drug expenses. This could consume Sareptas cash reserve quickly and exert pressure
on its cash flow.
Sarepta Therapeutics, Inc.
January 22, 2015 Simos Simeonidis 212 437 9293; [email protected] 8
-
8/9/2019 SRPT - 1924-349902-1.pdf
9/82
Company OverviewSarepta is a biotech company focused on RNA-based therapeutics for the treatment of life-
threatening rare and infectious diseases. Its lead drug candidate eteplirsen, an antisense RNA
oligomer administered intravenously, enables excision of exon 51 (exon 51 skipping) of thedystrophin RNA transcript in patients with Duchenne muscular dystrophy (DMD). It is
currently in a Phase IIb extension study. A Phase III trial of eteplirsen was initiated in
September 2014. Sarepta plans to submit an NDA to the FDA for eteplirsen in mid-2015.
Besides eteplirsen, Sarepta has numerous preclinical candidates for skipping other
dystrophin exons in its DMD program. The second development program at Sarepta targets
infectious diseases and viruses, such as the Marburg and Ebola viruses. In July 2012, the
company changed its name and stock symbol from AVI BioPharma and AVII to Sarepta
Therapeutics and SRPT, respectively. Founded in 1980, Sarepta is headquartered in
Cambridge, Massachusetts and currently has approximately 146 employees.
Exhibit 5: SareptasPipeline
Drug candidate Indication Stage Comments
Eteplirsen Exon 51 skipping Phase IIIWill file an NDA in mid 2015. Three open-label trials started
or will start soon
SRP-4053 Exon 53 skipping Phase I/II Started dosing in EU in January 2015
SRP-4045 Exon 45 skipping Preclinical Expected to enter clinical trials in 1H15
SRP-4050 Exon 50 skipping Preclinical
SRP-4044 Exon 44 skipping Preclinical
SRP-4052 Exon 52 skipping Preclinical
SRP-4055 Exon 55 skipping Preclinical
SRP-4008 Exon 8 skipping Discovery
AVI-7288 Marburg virus Phase I Completed in 2014
AVI-7537 Ebola virus Phase I Halted in 2012 due to government funding constraints
AVI-7100 H1N1 Influenza virus Phase I Expected to complete in 2015
Bacterial PPMO Drug-resistant bacteria Discovery Six programs identified and are underway
Infectious diseases
Duchenne muscular dystrophy (DMD)
Source: RBC Capital Markets
Exhibit 6: Expected newsflow for Sarepta
Expected Newsflow Candidate Timing
Conduct the 4th biopsy in the Phase IIb trial (Study 202) eteplirsen Jan 2015Start eteplirsen dosing in Study 203 in patients between four and six years old eteplirsen 1Q15
Start SRP-4045 and SRP-4053 dosing in Study 4045-301 patients SRP-4045 and SRP-4053 1H15
Complete the Phase I trial of AVI-7100 AVI-7100 1H15
Submit NDA for eteplirsen to FDA eteplirsen Mid-15
Data from AVI-7100 Phase I trial for influenza AVI-7100 2015
FDA decision on eteplirsen based on priority review eteplirsen 1H16
Launch eteplirsen in the US eteplirsen 1H16
Data from eteplirsen Phase III trial eteplirsen 2016
Source: RBC Capital Markets
Sarepta Therapeutics, Inc.
January 22, 2015 Simos Simeonidis 212 437 9293; [email protected] 9
-
8/9/2019 SRPT - 1924-349902-1.pdf
10/82
Sareptas lead asset: eteplirsen (exon 51 skipping agent)As a potential treatment for Duchenne muscular dystrophy (DMD), eteplirsen (AVI-4658) is an
exon 51 skipping agent that consists of a 30-mer (CTCCAACATCAAGGAAGATGGCATTTCTAG)
PMO, or phosphorodiamidate morpholino. Its sequence from position 9 to 28 is exactly thesame with the sequence of drisapersen, a competing exon 51 skipping agent by rival company
Prosensa (recently acquired by BioMarin). By binding a splicing signal sequence in exon 51,
eteplirsen results in exon 51 skipping during splicing of dystrophin pre-mRNA. This restores the
production of a partially functional dystrophin by compensating for a previous reading frame
mutation caused by a deletion of one of the following exons: exon 45-50, 47-50, 48-50 and 49-
50, 50, 52, or 52-63. Based on a patient mutation registry, an estimated 13% of DMD patients
can benefit from exon 51 skipping therapy. Eteplirsen is administered via IV with a dose of
either 30 mg/kg or 50 mg/kg, and is currently being tested in a Phase IIb extension trial and a
Phase III trial with plans for more clinical trials in preparation for NDA submission by mid 2015
for FDA regulatory approval.
Exhibit 7: 13% of DMD patients can benefit from exon 51 skipping therapies
Source: Company presentation
In its clinical program, eteplirsen has demonstrated good efficacy and safety, albeit in small
trials thus far. In Study 28 and Study 201, treatment with eteplirsen resulted in a significant
increase of dystrophin protein expression. Eteplirsens most advanced trial, the ongoing
Phase IIb trial (Study 202), released top-line data at 168 weeks, and exhibited a treatment
benefit of 65m (p0.017) in its primary endpoint, the six minute walk test (6MWT) between
the eteplirsen and placebo/delayed treatment arms. However, the eteplirsen treatment
group exhibited a 24-week decline in the 6MWT of 45m, the largest 24-week decline since
the trial started. We believe that both the 144-week and 168-week data suggests that the
eteplirsen-treated patients are now underway in their inevitable process of loss of
ambulation.
What is exon skipping?DMD is caused by underlying mutations in the dystrophin gene that lead to loss of protein
production. Exon skipping therapy aims to correct frameshift alterations in defective
dystrophin mRNAs by introducing a compensatory frameshift through skipping an
additional exon elsewhere in the dystrophin mRNA. By masking one or more exons during
pre-mRNA splicing, the reading frame could be restored through this method of
pharmacologically-induced alternative splicing. Therefore, shorter mRNA transcripts with a
corrected reading frame are produced, resulting in truncated, yet partially functional Becker-
like dystrophin protein (similar to dystrophin proteins found in less severe Becker muscular
dystrophy, BMD, patients). It is important to note that the masked exon is not necessarily
where the original deletion or point mutation is located, but masking of that particular exon
The goal of exon skipping
therapy is to convert a
DMD patient into one with
a less severe, BMD-like
phenotype.
Sarepta Therapeutics, Inc.
January 22, 2015 Simos Simeonidis 212 437 9293; [email protected] 10
-
8/9/2019 SRPT - 1924-349902-1.pdf
11/82
just happens to coincidentally complement the frameshift incurred by the original,
underlying mutation.
To mask the exon, antisense oligonucleotides (AONs) are hybridized to complementary
sequences in or adjacent to the target exon. AONs used in exon skipping therapy cannot be asubstrate of RNase H, which is a non-specific endonucleasethat catalyzes the degradation of
RNA in a RNA-DNA duplex through a hydrolytic mechanism. Otherwise, RNase H would
eliminate the dystrophin mRNA bound by the AONs, and dystrophin protein translation
would not occur.
The intended effect of AON binding to a pre-mRNA is to modulate the splicing sequence
signals, such that the splicing machinery removes
1)the intron before the target exon,
2)the target exon itself, and
3)the intron after the target exon,
thus skippingthe target exon. This process can be thought of being similar to endogenous
mechanisms of alternative splicing, but pharmacologically-induced to become exon
skipping.
Exhibit 8: An example of exon deletion and how exon skipping helps restore reading frame
Source: Company presentation, RBC Capital Markets
The caveat is that the function or stability of the resulting in-frame dystrophin protein is
uncertain. Ideally, the goal of exon skipping is to restore the reading frame such that it will
result in the production of a Becker-like, partially functioning dystrophin. (In Becker muscular
dystrophy patients, dystrophin is also mutated with shorter in-frame deletions; however, the
resultant dystrophin protein, though truncated, still demonstrates enough function to result
in a less severe muscular dystrophy phenotype.) In addition, patients with multiple deletions
may require multiple exonsto be skipped in order to restore the mRNA to a correct reading
frame, i.e. a combination of different AONs is required in some cases. However, in theory, a
cocktail approach enabling multiple exon skipping is poss ible.
Currently, there are two types of exon skipping AONs in clinical trials:
Sarepta Therapeutics, Inc.
January 22, 2015 Simos Simeonidis 212 437 9293; [email protected] 11
-
8/9/2019 SRPT - 1924-349902-1.pdf
12/82
1) phosphorodiamidate morpholino oligomers (PMOs, which include Sareptas eteplirsen)
and
2)2-O-methyl-phosphorothioate (2OMePS, which include rival Prosensas drisapersen).
Both eteplirsen and drisapersen enable exon 51 skipping by binding the same region on exon
51. The main difference between these two types of AONs is that PMOs do not carry charges
and 2OMePS are negatively charged.
Exon skipping is primarily different from many other antisense applications, such as RNAi or
RNAse H-dependent antisense applications, in that the target mRNA is not cleaved. In most
RNAi applications, siRNA is separated into two single strands of RNA, one of which is
integrated with an activated RNA-induced silencing complex (RISC). After the single-stranded
RNA in the RISC binds the target mRNA through standard base pairing, the active component
of RISC, Argonaute protein, will cleave the mRNA thus preventing translation, or silencing
the gene. For RNase H-dependent antisense applications, a special type of AON is used to
bind target mRNA and recruit RNase H to cleave the target mRNA. For example, AONs that
contain at least five consecutive deoxynucleotides are substrates for human RNase H and canbe considered in those applications.
What is so special about skipping exon 51 in particular?To date, exon skipping therapies for treating DMD has mainly focused on targeting exon 51.
These exon 51 skipping therapies include Sareptas eteplirsen and Prosensas drisapersen. A
number of reasons support the skipping of exon 51, in particular, for DMD therapeutic use.
1) Exon 51 skipping therapy alone is estimated to treat up to 13% of all DMD patients,
representing the largest patient population that a single-skip therapy can address. Exon 51
resides in a main hot spot for dystrophin deletion mutations, located between exons 45 and
55 and accounting for >60% of DMD patients with deletion mutations. As another reminder,
skipping of exon 51 is not meant to treat dystrophin mutations in exon 51. Instead, examples
of deletions amenable to exon 51 skipping for therapy includes deletions of exons 48-50, 45-50, 49-50, 50-52, 47-50, 43-50, and 52-63.
2)By itself, loss of the protein region encoded by exon 51 should not introduce deleterious
effects to dystrophin protein function. Exons 50 and 51 code for the hinge 3 (H3) region of
the dystrophin protein, which has a total of 4 hinge regions. Evidence that loss of exon 51
can still result in a functional dystrophin protein is provided by the identification of Becker
patients who harbor corresponding in-frame exon 51 deletions. In the following exhibit, we
show the domain structure of the normal dystrophin protein (fully functional), dystrophin
missing exon 50 (non-functional), and dystrophin without exon 50 and 51 (partially
functional).
Exon 51 skipping therapy
can treat an estimated 13%
of DMD patients, the
largest patient pool for any
single exon skipping
therapy.
Sarepta Therapeutics, Inc.
January 22, 2015 Simos Simeonidis 212 437 9293; [email protected] 12
-
8/9/2019 SRPT - 1924-349902-1.pdf
13/82
Exhibit 9: The domain structure of normal dystrophin, dystrophin missing exon 50, and
dystrophin with exon 51 skipping
ABD: 2 actin binding domains, H1-H4: 4 hinge d omains, R1-R24: 24 spectrin-like repeats, CRD: cysteine-rich domain, c-term: C-terminal domain
Source: RBC Capital Markets
3) In addition, exon 51 contains ESEs (exonic splicing enhancers) that, when targeted by
therapeutics, may increase the efficiency of skipping.Targeting exons that contain ESEs may
result in better targeting of the normal splicing process, as compared to targeting exons that
do not have these ESEs.
Sarepta Therapeutics, Inc.
January 22, 2015 Simos Simeonidis 212 437 9293; [email protected] 13
-
8/9/2019 SRPT - 1924-349902-1.pdf
14/82
A Quick Look Back at Sareptas Stock MovementsAs we show in the following exhibit, a number of events have resulted in large impacts on
Sareptas stock price. Mostly, these events have stemmed from feedback with the FDA,
which has demonstrated multiple changes of opinion towards eteplirsen. In September 2013,the FDA considered an NDA submission for Sareptas eteplirsen to be premature. However,
the FDA started having a change of heart. First in April 2014, it considered an NDA for
eteplirsen as fileable with additional data. Then in June, it outlined an accelerated approval
pathway for Prosensas drisapersen, the direct competitor of Sareptas eteplirsen. At that
time, both Sarepta and Prosensa planned to file their NDA by YE14. Another unanticipated
move came in October 2014 when it subsequently requested for additional data from
Sarepta. However, the FDA later took an unusual step to post a statement online to explain
that its stance has been consistent and its willingness to work with Sarepta.
Exhibit 10: Much of Sareptas stockprice volatility is based off of data releases and FDA interactions
$0.00
$10.00
$20.00
$30.00
$40.00
$50.00
$60.00
2012/06/01 2012/10/01 2013/02/01 2013/06/01 2013/10/01 2014/02/01 2014/06/01 2014/10/01
SRPT
1) 7/24/2012
2) 10/3/2012
3) 4/16/2013
4) 7/24/2013
5) 9/20/2013
6) 11/12/2013
7) 1/16/2014
8) 4/21/2014
9) 10/27/2014
10) 1/12/2015
Source: RBC Capital Markets, Factset
1) 7/24/2012 (+146%): Sarepta first entered the collective minds of investors with their
announcement of positive data from an interim 36 week open-label extension of their
Phase IIb clinical trial of eteplirsen in 12 DMD patients. The news was accompanied by a
146% increase over the previous days closing price.
2) 10/3/2012 (+200%): Sarepta witnessed a nearly 200% jump, to ~$45/share, upon news
of their announcement of the Phase IIb extension trial meeting its primary endpoint
(6MWT) at 48 weeks.
3)
4/16/2013 (-13%): After an end-of-Phase II meeting with the FDA, Sarepta indicated that
the FDA requested a comprehensive summary to support dystrophin as a surrogate
endpoint that would reasonably predict clinical benefit in DMD patients, as well as a
detailed discussion of all clinical outcomes in the eteplirsen study. This marked the first
indication that the FDA had reservations of using dystrophin expression, which had been
the focus of Sareptas regulatory plan for eteplirsen treatment, as a biomarker for
regulatory approval. Sarepta closed 13% down to ~$34/share with this news.
4) 7/24/2013 (-19%): Sentiment from the FDA hinted at their continued worry of using
dystrophin expression solely as a regulatory endpoint to grant eteplirsen regulatory
Sarepta Therapeutics, Inc.
January 22, 2015 Simos Simeonidis 212 437 9293; [email protected] 14
-
8/9/2019 SRPT - 1924-349902-1.pdf
15/82
approval. According to Sarepta, the FDA would not commit to declaring dystrophin an
acceptable surrogate endpoint for accelerated approval. Sarepta released its plans to
submit an NDA to the FDA in 1H14 based on continued Phase IIb data. This negative
news sent Sarepta down nearly ~19% to $37.68/share.
5) 9/20/2013 (+18%): In September 2013, Prosensa (Sareptas closest competitor who is
also developing exon 51 skipping therapies for DMD treatment) announced that their
clinical trial for drisapersen had failed to meet the primary endpoint of 6MWT for its
Phase III trial. The surmised fall of Sareptas closest competitor for DMD sent shares
rising by 18% to close at $43.30.
6) 11/12/2013 (-64%): However, the windfall from Prosensas failure was shortlived. In
November, Sarepta released details of its continued discussions with the FDA, which
now considered an NDA submission for Sareptas eteplirsen to be premature.
According to Sarepta, the FDA said that it had considerable doubt about the use of
dystrophin as a surrogate endpoint as well as the 6MWT data from Sareptas open -label
Phase IIb trial of eteplirsen. The agency said it questions using dystrophin in light of the
recent failed Phase III trial of drisapersen that did not significantly improve 6MWT
results vs. placebo, despite increased expression of dystrophin. Moreover, the FDA
recommended that Sarepta conduct a placebo-controlled confirmatory trial in DMD
patients and consider endpoints that measure a broader range of function and
subpopulations. This sudden increased FDA stringency for DMD drugs sent Sarepta down
64% to close at $13.16/share.
7) 1/16/2014 (+40%): Sarepta released more data from its ongoing Phase IIb extension trial
supporting the efficacy of continued eteplirsen treatment in DMD boys. Sareptas stock
closed at $28, up 40% from the previous close.
8) 4/21/2014 (+39%): After a Duchenne patient organization meeting in the preceding
December, Sarepta released details of their latest dialogue with the FDA. The new
guidance revealed a turnaround in FDA sentiment towards eteplirsens hope for
regulatory submission. In its guidance letter, the agency stated that with additional
data to support the efficacy and safety of eteplirsen for the treatment of DMD, an NDAshould be fileable. Based on the letter, Sarepta announced its plan to submit an NDA by
YE14. The news sent its stock up ~39%, closing around ~$34.
9) 10/27/2014 (-32%): Sarepta released a surprising regulatory update that the FDA
requested more data as part of eteplirsens NDA, which we will discuss more in detail
below. Accordingly, Sarepta changed its NDA submission timeline from YE14 to mid
2015. FDA also indicated that further discussion with Sarepta will be necessary to
determine what would constitute a complete NDA. After the news, Sareptas stock took
a big hit and closed at $15.91, a 32% drop from its previous close.
10) 1/12/2015 (-15%): Sarepta released week 168 data from its ongoing extension trial in 12
DMD patients. The latest data indicated a continuing decline in 6MWT for the patients
receiving eteplirsen treatment. The results did not meet investor expectations and sent
shares down ~15% to close at $11.91.
Sarepta Therapeutics, Inc.
January 22, 2015 Simos Simeonidis 212 437 9293; [email protected] 15
-
8/9/2019 SRPT - 1924-349902-1.pdf
16/82
What is the FDAs Position on DMD Therapeutics?As shown with its stock movements, a good understanding of the regulatory environment is
necessary to gauge the potential of eteplirsen. However, over the past two years, the
regulatory landscape for DMD therapeutic development has been in a flux, especiallyregarding exon skipping therapies.
In September 2014, the FDA moved to finalize regulatory order through the release of a draft
guidance for the development of therapeutics for the treatment of DMD. The unique aspect
was that for the first time a disease community had major input into the industry guidance.
Currently, the FDA shows flexibility in its draft guidance. For example, it asks trial sponsors to
incorporate patient/family preference to treatments into trial design and FDA submission. It
would not require placebo-controlled trials in DMD studies as long as there is a well-matched
natural history study.
In order to receive accelerated approval, two pathways can be undertaken for DMD
therapeutics. First, the FDA can consider an accelerated approval based on the use of a
surrogate biomarker if the biomarker is reasonably likely to predict clinical benefit. Second,the FDA can consider an intermediate clinical endpoint for support of accelerated approval.
Most DMD companies, including Sarepta, have approached these pathways by using
dystrophin expression as a surrogate biomarker or 6MWT as an intermediate clinical
endpoint. However, the FDA also encourages sponsors to explore new endpoints in addition
to dystrophin and 6MWT.
New FDA dialogue asks for additional patient dataFollowing a meeting with the FDA in April 2014, Sarepta originally planned to submit an NDA
seeking accelerated approval for eteplirsen by the end of 2014. However, on October 27th
,
2014, Sarepta released excerpts from its FDA meeting minutes that shattered that plan.
Sarepta now aims to submit an NDA by mid-2015. In the minutes, the FDA requested the
following data to be included in the submission:
1) 3-month [safety] data from at least 12 to 24 newly exposed patients at the time the
NDA is submitted;
2) Available data from the other patients enrolled in the new eteplirsen studies (studies
301, 203, 204) should also be included at the time the NDA is submitted, even if
exposure is less than 3 months in duration;
3) Additional data from later time points and from newly enrolled patients should be
submitted in the 120-Day Safety Update;
4)
FDA strongly advises the sponsor to obtain and submit patient-level natural history
data. FDA is prepared to appeal to academic groups holding the data to allow the
sponsor a means to acquire the data;
5) The lack of robust dystrophin measurement during the [study 201/202] site visit
necessitates including the independent assessment of dystrophin-positive fibers and168-week efficacy data from study 201/202 in the NDA;
6) FDA strongly urged the sponsor to submit the MRI data with appropriate natural history
controls;
7)
And the FDA also stated that [a]dditional discussion between the sponsor and the FDA
will be necessary to determine what would constitute a complete NDA.
Although the FDA did not ask for more patient muscle biopsy data, Sarepta still plans to
conduct a fourth biopsy in Study 202 patients, which management believes to be important
for the advisory committee panel and beneficial for future package insert.
Sareptas plan for NDA
filing receives a major
setback, which will delay
its timeline by at least 6
months.
Sarepta Therapeutics, Inc.
January 22, 2015 Simos Simeonidis 212 437 9293; [email protected] 16
-
8/9/2019 SRPT - 1924-349902-1.pdf
17/82
The request from the FDA to re-analyze DPF data is unusual and seems to be driven by its
inspection of the clinical site where dystrophin analyses were conducted. The FDA has
concerns that the method used to quantify DPFs was not robust enough to support an NDA
submission. In previous studies of eteplirsen, DPF data were measured as follows. First,
investigators applied immunohistochemical staining to biopsy tissues. Then tissues wereevaluated by expert muscle pathologists to manually count the number of DPFs, and the
percentage of on-treatment DPFs was calculated. The detection threshold of DPF for each
patient was adjusted such that only revertant fibers were detected in the pre-treatment
biopsy. Revertant fibers are those muscle fibers that become dystrophin-positive. DMD
patients even without treatment might have a low frequency of DPFs because endogenous
alternative splicing or somatic mutations could restore reading frame of the dystrophin gene
in a small number of muscle cells.
This new guidance from the FDA poses a significant hurdle for Sarepta, as its main
competitor Prosensa has already commenced its rolling NDA submission for its exon 51
skipping agent, drisapersen. If drisapersen gets approval under accelerated approval
pathway, it could be launched in 2H15. Sarepta disclosed that under a best case scenario, it
would commercially launch eteplirsen in 1H16.
Sarepta likely to accelerate its clinical programsIn response to the new guidance by the FDA, Sarepta is likely to accelerate the progress on
its confirmatory Phase III trial with an expected enrollment of 120-160 patients, of which half
will be eligible for exon 51 skipping treatment and the other half not. The patients who are
eligible for exon 51 skipping would receive eteplirsen 30 mg/kg weekly. The patients who are
not eligible for exon 51 skipping therapies would serve as natural history controls. Patient
dosing in this trial started in November 2014.
FDAs statement regarding its guidance: A positive signalOn October 30
th, 2014, probably in response to inquiries from DMD patient communities,
FDA released a statement explaining its position regarding Sareptas NDA filing. In thestatement, the FDA considers it has consistently advised Sarepta that data from additional
patients, beyond the patients included in Study 202, would be critical to our assessment of
the safety and efficacy of eteplirsen. The FDA also highlighted that it did not find any
evidence of fraudat the site (The Nationwide Children's Hospital in Ohio) where dystrophin
expression analysis was conducted; on the other hand, it is concerned with the methods
used to measure dystrophin expression. Finally, in the statement, FDA expresses its
willingness to conduct a rolling review of Sareptas NDA and expects the NDA to qualify for
priority review. The FDA plans to present the NDA at a public advisory committee meeting
before making a decision on eteplirsen. We view the statement as a positive signal that the
FDA wants to continue to work with Sarepta and other parties to accelerate DMD drug
development.
Sarepta Therapeutics, Inc.
January 22, 2015 Simos Simeonidis 212 437 9293; [email protected] 17
-
8/9/2019 SRPT - 1924-349902-1.pdf
18/82
What is the data on eteplirsen?In the following exhibit, we summarize the main results of four eteplirsen trials, with the
change of dystrophin expression and 6MWT being key endpoints. Although the sizes of those
trials have been small, eteplirsen has shown statistically significant increases in dystrophinexpression and delays in the decline of 6MWT.
Exhibit 11: Eteplirsen has shown good efficacy and safety in small trials
Trial name Study 33 Study 28 Study 201 Study 202
Study designSingle-blinded, placebo-
controlled, dose escalationOpen-label, dose-escalation
Double-blinded, placebo-
controlled
Open-label, extension
of study 201
Development stage Phase I/II Phase I/II Phase II Phase IIb
Number of Patients 7 19 12 12
Patient age at baseline (years) 10-17 6-13 7-13 7-13
Number of arms 2 6 3 2
Doses in the trial (mg/kg/week)0.09 (n=2) and
0.9 mg (n=5)
0.5 (n=4),1 (n=2),
2 (n=2),
4 (n=3),
10 (n=4), and
20 (n=4)
30 (n=4),
50 (n=4), and
placebo (n=4)
30 (n=6) and
50 (n=6)
Treatment duration (weeks) One injection 12 24 Ongoing (>144 weeks)
Treatment difference on 6MWT (m) NA NA 67.3 (week 48) 65.4 (week 168)
p-value NA NA p0.001 p0.017
Treatment improvement on dystrophin
expression over baseline *0.9 mg: 17% 10 and 20 mg/kg: 5.5% 30 mg/kg: 22.9% NA
p-value p=0.002 p=0.04 p0.002 NA
* In Study 33 and 28, the change of dystrophin signal intensity was shown. In Study 201, the change of percentage of dystrophin positive fibers was shown. Source: RBC Capital Markets
Sareptas potential filing strategyWe believe that Sarepta will likely pursue accelerated approval for eteplirsen based on
6MWT as an intermediate clinical endpoint. We argue that there are at least four reasons
why Sarepta would choose this option over the other alternative of regulatory approval
based on dystrophin expression. First, the FDA has repeatedly expressed its concerns over
using dystrophin expression as a surrogate biomarker endpoint due to questions on the
reproducibility of dystrophin data and the previously failed trials of other drugs that intended
to increase dystrophin expression. The concerns of the FDA should motivate Sarepta to
consider a filing strategy not solely dependent on dystrophin expression. Second, the
unknown results of the independent assessment of dystrophin positive fiber data and the 4th
biopsy bring many risks to a filing strategy focusing on dystrophin expression. Third, the
6MWT data at 168 weeks showed a larger than expected decline. Even if the 4th
biopsymanaged to show that the dystrophin expression level is high, it may be difficult to reconcile
the link between positive dystrophin expression data and the continuing decline of 6MWT
results at week 168. On the other hand, the decline at 6MWT can be more easily attributed
to the plateau of eteplirsen benefit and the inevitable disease progression faced by DMD
patients. Fourth, the 6MWT has served as the basis of approval for other drugs, including the
EU conditional approval of ataluren. Similarly, Sareptas competitor Prosensa/BioMarin will
likely seek accelerated approval by also using 6MWT as an intermediate clinical endpoint.
Therefore, 6MWT represents a known regulatory pathway that has been previously
undertaken, and thus weaknesses surrounding the data can be better argued due to its more
extensive history of use for registration purposes.
Sarepta Therapeutics, Inc.
January 22, 2015 Simos Simeonidis 212 437 9293; [email protected] 18
-
8/9/2019 SRPT - 1924-349902-1.pdf
19/82
We expect accelerated approval for eteplirsen, but not without any concerns with
the eteplirsen datasetWe believe the safety data surrounding eteplirsen is not a concern, unless a new,
unanticipated signal arises from the newly dosed patients. Although we still have some
reservations about the current eteplirsen dataset, we still believe accelerated approval can
be achieved based on the positive 6MWT data and dystrophin expression as a supportive
biomarker. We believe the pressures invoked by the DMD patient communities on the FDA
will lead to less stringency in the review process. The DMD communities have been anxious
for novel therapies to treat the underlying causes of the disease and have much faith with
Sareptas eteplirsen therapy. The FDA ultimately remains cautious, based on the limited size
of the efficacy data, but may be willing to grant conditional approval due to eteplirsens
relatively benign safety profile. However, we still acknowledge the following issues about
6MWT data and dystrophin expression that need to be adequately addressed with
eteplirsens regulatory submission.
The foremost issue is that patients in the treatment group are now exhibiting a rapid
decline in 6MWT from week 144 to week 168 (see the exhibit below). Considering that thesame group of patients experienced a larger 144-week to 168-week decline (45m) than from
120-week to 144-week (17m), we expect those patients to continue an accelerated rate of
decline in 6MWT, now that they are more than three years into the trial. Natural history
studies suggest that the 6MWT normally declines by 40-60m in a general DMD population.
In a natural history study of DMD, patients with the similar age and 6MWT at baseline as the
patients in the Study 201/202 had a 6MWT decline of 52 meters during the third year of the
study, resulting in 115 meters of difference from baseline. In contrast, patients in the
treatment group of the Study 202 only showed a decline of only 76 meters after more than
three years, suggesting treatment benefits with eteplirsen. The most compelling argument
for eteplirsens efficacy data can be made by highlighting this treatment benefit over a
natural history cohort of a similar age and background. This could potentially suggest
eteplirsens ability to delay the progression of ambulation loss by 1-2 years.
Exhibit 12: Week 168 6MWT demonstrated largest decline thus far in the extension study
Source: Company presentation
The second issue is that two patients enrolled in the study 201/202 had quickly progressed
in their disease.Their 6MWT decline significantly around week 24 and both of them were
non-ambulatory at week 48. Therefore, their 6MWT values were excluded from mITT
(modified Intent-to-treat) analysis, which showed statistical significance. When the intent-to-
treat (ITT) population was considered, which included those two patients, the results were
not significant. Overall, this confirms that exon 51 skipping will not be able to reverse loss of
ambulation in patients, and may only be used to delay the inevitable decline. Moreover, this
Sarepta Therapeutics, Inc.
January 22, 2015 Simos Simeonidis 212 437 9293; [email protected] 19
-
8/9/2019 SRPT - 1924-349902-1.pdf
20/82
shows that the selection of patients, based by their baseline function, will play a crucial role
in dictating trial outcomes.
The third issue is that the FDA has concerns over the reproducibility of dystrophin positive
fiber (DPF) data and has asked for independent assessment. Unlike other dystrophinexpression measurements, such as dystrophin signal intensity from immunohistochemistry
and Western blotting results, counting dystrophin positive fibers involves more subjective
judgment based on the individual reviewer. A recent study has successfully shown that
quantitative immunohistochemistry and Western blotting are reliable measurements of
dystrophin expression, and the measurements from different labs are actually comparable.
However, no similar conclusion has been made about DPF measurement. The outcome of
the independent assessment will either lend support or raise serious issues about the
reproducibility of the methodology used thus far by Sareptas trials to assess dystrophin
expression.
The best case scenario for the new DPF reassessment will of course be findings consistent
with Sareptas previous disclosures. However, the worse scenarios include the inconsistent
findings amongst the three independent reviewers (suggesting lack of reliability with the
methodology in scoring DPFs as a measurement for dystrophin expression) or consistent
findings amongst the three independent reviewers that are, however, inconsistent with
Sareptas previous analysis.Besides DPF data, as we show in the following exhibit, Sarepta
also has multiple measurements, such as RT-PCR, western blot, and immunofluorescence, to
support the increase of dystrophin expression after eteplirsen treatment. Therefore, we do
not expect the FDA-requested independent assessment of DPF data to completely negate
previous conclusions made by eteplirsen trial investigators.
Exhibit 13: Eteplirsen treatment effects measured by other approaches
Source: Company presentation
A fourth issue is the unknown outcome of the 4th
biopsy around week 168. With the 3rd
biopsy performed at week 48, more than 2 years have passed since that last measurement.
Although the 6MWT of the boys seem to have stabilized for the most part, the 45m decline
of 6MWT in a period of 24 weeks at week 168 was the largest seen in the long-term
extension, and was much larger than the 17m decline in the previous 24 weeks. This suggests
that some boys in the treatment group are experiencing deteriorating conditions and couldlose walking ability quickly. Management has indicated that the biopsy will only be
performed in up to 8 boys in the extension trial, due to scheduling and consent issues.
Therefore, it is unclear if the boys who had the largest 6MWT decline will have the 4th
biopsy.
However, based on the 6MWT data at week 168, it would be reasonable to expect that the
dystrophin expression level from the 4th
biopsy to be lower in comparison with that from the
3rd biopsy. Therefore, we expect little positive surprise arising from the biopsy data.
Fifth, all biopsy samples in eteplirsen trials were taken from upper arms, versus a decision
to extract from other locations, such as the legs. We believe this protocol created both
advantages and disadvantages. One of the advantages is eteplirsens treatment effect on
Sarepta Therapeutics, Inc.
January 22, 2015 Simos Simeonidis 212 437 9293; [email protected] 20
-
8/9/2019 SRPT - 1924-349902-1.pdf
21/82
upper arms could be potentially included in its label, and support its adoption by non-
ambulatory patients. In addition, biopsies at upper arms would not introduce leg injuries that
may affect patients 6MWT performance. A disadvantage is the less clear connection
between dystrophin expression in the upper limbs (as seen with the arm biopsies) and leg
muscle function that is needed for 6MWT. In DMD patients, the functions of leg musclesdeteriorate faster than those of muscles in the upper limbs, hence the loss of ambulation
preceding loss of upper limb function. Management suggests that animal studies showed
consistent dystrophin expression across different muscle groups after eteplirsen treatment.
We acknowledge that positive induction of dystrophin expression may occur with systematic
administration of eteplirsen, but that does not guarantee that dystrophin expression would
be restored in the lower limbs, where significant muscle loss may have already occurred.
Therefore, the significant increase of dystrophin expression in upper limb muscles might not
be directly translated to a similar increase in leg muscles, or may even be less significant as
would have been demonstrated by leg muscles.
Finally, there is some inconsistency of dystrophin expression at 12 weeks, as measured in
Study 201 vs. previous eteplirsen study.In a previous dose-finding study of eteplirsen (Study
28), after 12 weeks of treatment, 8 patients in 10 and 20 mg/kg groups saw increases in
dystrophin expression based on dystrophin positive fiber (DPF) measurement. Four patients
in 10 mg/kg group and 20 mg/kg group have an average of 7% and 15.3% of DPF increase
from baseline, respectively. However, in study 201, after 12 weeks of treatment, four
patients in the 50 mg/kg groups had an average of only 0.8% of DPF increase from baseline
based on the same measurement. The discrepancy in the DPF outcomes of the DPF
measurement lends some concern as either to the consistency of the treatment effect of
eteplirsen on DPF or the reliability of DPF measurements. We note that patient
characteristics such as age and 6MWT at baseline are comparable in two studies.
Sarepta Therapeutics, Inc.
January 22, 2015 Simos Simeonidis 212 437 9293; [email protected] 21
-
8/9/2019 SRPT - 1924-349902-1.pdf
22/82
Prosensas Drisapersen vs. Sareptas EteplirsenBoth Prosensa (recently acquired by BioMarin) and Sarepta are developing exon 51 skipping
antisense oligonucleotides (AONs) for the treatment of DMD patients. Because of a similar
mechanism of action, the two drugs (drisapersen and eteplirsen) target the samesubpopulation of DMD patients who have dystrophin mutations that are amenable to exon
51 skipping. The head-to-head comparison between the two drugs is detailed in the
following section.
Exhibit 14: Comparison between Sareptas eteplirsen and Prosensas drisapersen
Drug Eteplirsen Drisapersen
Company Sarepta Prosensa/BioMarin
Drug target
MOA
Sequence length 30 bp 20 bp
Backbone chemistryPhosphorodiamidate morpholino
oligo (PMO)
2'-O-methyl phosphorothioate
(2'OMePS)
Electric charge Neutral Negative
Serum protein binding No Yes
Off-target interactions Fewer in theory Could interact with other proteins
Transport Limited nuclear uptakeBetter nuclear uptake but harder to
cross cell membrane
Mode of administration IV SC
Half-life in humans 1.6-3.6 hrs ~29 days
Dose 30 mg/kg/week 6 mg/kg/week
Development stagePhase III
(enrollment started 4Q14)
Phase III
(completed in 2013)
Number of (expected) patients in
Phase III trial120-160 186
Number of patients dosed with the
drug~40 >300
IPOwns US patents for
exon 51 and 53
Owns EU patent for exon 51 and US
patents application for exon 51 and 53
IP dispute: EU
IP dispute: US
FDA desgination Orphan drugBreakthrough therapy
Orphan drug
Potential FDA approval pathPotential pathway for accelerated
approval
FilingRegular submission
to FDA by mid-2015
Rolling submission
to FDA in 1Q15
6MWT as an intermediate clinical outcome
Accelerated approval
Exon 51 of human dystrophin gene
Binding to exon splicing enhancer on exon 51
to induce exon skipping
SRPT appealing for exon 51 patent (owned by RNA)
Patent interference proceeding for exon 51 and 53
(SRPT is junior party)
Source: RBC Capital Markets
Sarepta Therapeutics, Inc.
January 22, 2015 Simos Simeonidis 212 437 9293; [email protected] 22
-
8/9/2019 SRPT - 1924-349902-1.pdf
23/82
AON structure: As we mentioned before, both eteplirsen and drisapersen are AONs targeting
exon 51 for skipping. Eteplirsen is a 30-mer (CTCCAACATCAAGGAAGATGGCATTTCTAG) DNA-
analog, whereas drisapersen is a 20-mer (UCAAGGAAGAUGGCAUUUCU) RNA-analog.
Position 9 to 28 of the eteplirsen sequence is also present in the drisapersen sequence, thus
both therapies likely target the exact same region of exon 51.
AON chemistry: Eteplirsen and drisapersen are composed of different chemical backbones.
Eteplirsen is a PMO whereas drisapersen is based on a 2OMePS structure. The main
difference between PMO and 2OMePS is that PMOs do not carry charges and 2OMePS are
negatively charged. One implication of different backbones are concerns that the
phosphorothioate (PS) backbone modification present in 2OMePS, such as Prosensas
drisapersen, may be involved in unspecific protein binding and off-target effects on the
apoptosis pathway, thus lending concerns to long-term toxicity.
Being charge neutral, PMOs have their own pros and cons. On one hand, PMOs may have
fewer off-target interactions with proteins in the body that could lead to immune
stimulation. For example, a preclinical study in monkeys showed that PMOs did not activate
toll-like receptors, the nuclear factor (NF)-B-mediated inflammatory response, or the
interferon system. On the other hand, neutrally charged PMOs have shown difficulty in
transport in established cell culture. However, they showed higher tissue concentrations in
primary cell culture, which might be due to the lack of nonspecific interactions with cellular
components. In one study conducted in the mdxmouse model, PMOs were more efficient in
inducing mouse exon 23 skipping than 2OMePS. However, in another study in the hDMD
mouse model (carrying human dystrophin exons) where AONs were given through
intramuscular injection, PMOs showed significantly better efficiency than 2OMePS for exon
46 skipping only. For AONs targeting exons 44, 45, and 51, PMOs showed better efficiency
but the differences were not statistically significant. Therefore, it is still unclear whether
PMO-based eteplirsen would have better exon skipping efficacy compared to 2OMePS -
based drisapersen.
In addition, PMO-based therapeutic drugs come with significant downsides of higher costs
and more complex manufacturing due to the relatively new chemistry of PMOs. Sarepta
management indicates that COGS could be as high as 20% of sales for eteplirsen. So far,
Sarepta can only make mid-scale batches of eteplirsen and its current contracts with third
parties cannot provide sufficient drugs for multiple large clinical trials. In contrast, BioMarin
management indicates that COGS of drisapersen would be around 10% of sales and there is
no manufacturing capacity constraint for drisapersen.
Drug administration: In clinical trials, eteplirsen was administered via IV over 1h at 30 or 50
mg/kg/week. In its Phase III trial, drisapersen was given through SC at 6 mg/kg/week. High
doses of eteplirsen might result in better efficacy but its IV route is more time consuming
and costly compared to SC route of drisapersen. Drisapersen has demonstrated a longer half-
life of ~29 days, versus 1.6-3.6 hours seen with eteplirsen.
Efficacy on dystrophin expression: In the following exhibit, we compare the effect of
eteplirsen and drisapersen on dystrophin expression in their dose escalation studies. Both
studies were small with only three to four patients enrolled in each dose group. We also note
that the treatment duration is different in two studies: 12 weeks for eteplirsen and 5 weeks
for drisapersen. In addition, in the eteplirsen study, biopsy samples were taken from upper
arms while samples were taken from lower legs in the drisapersen study. In terms of the
percent of dystrophin positive fibers (DPF), drisapersen seems to achieve much higher post-
treatment DPF percentage compared to eteplirsen. In one patient treated by drisapersen,
the percent of DPF even reached 100%. However, its dystrophin signal intensity was lower
Sarepta Therapeutics, Inc.
January 22, 2015 Simos Simeonidis 212 437 9293; [email protected] 23
-
8/9/2019 SRPT - 1924-349902-1.pdf
24/82
than that of eteplirsen. The discrepancy between two measurements of drisapersen put a
question mark on the reliability of measurement. In addition, no baseline DPF was measured
in the drisapersen study, which makes it more difficult to choose an appropriate threshold to
determine if a fiber is dystrophin positive or negative.
Exhibit 15: Comparison of change of dystrophin expression in dose escalation studies
Trial name
Treatment
Development stage
Dose 10 mg/kg 20 mg/kg 4 mg/kg 6 mg/kg
# of patients 4 4 3 3
Age range at baseline 6-12 7-10 5-11 9-11
Treatment duration (wks) 12 12 5 5
Biopsy muscle
% DPF at baseline 1.5% 3.5% NA NA
% DPF after treatment 8.5% 18.8% 73.7% 56.7%
7.0% 15.3% NA NA
Mean dystrophin signal intensity at baseline (% of control) 9.8% 9.8% NA NA
Mean dystrophin signal intensity after treatment (% of control) 16.8% 13.8% 5.8% 7.5%
7.0% 5.0% NA NA
# of patients (%) whose dystrophin confirmed by RNA and IF 3 (75%) 3 (75%) 2 (67%) 3 (100%)
DPF: dystrophin positive fiber, IF: immunofluorescence
Biceps brachii muscle Tibial is anterior muscle (leg)
Study 28 CLIN-02
Eteplirsen Drisapersen
Phase II Phase I/IIa
Source: RBC Capital Markets
In the Phase II studies of eteplirsen (Study 201) and drisapersen (DEMAND II), dystrophin
expression was measured by DPF percentage and signal intensity, respectively. At 24 weeks,
all four patients receiving 30 mg/kg/week eteplirsen had an increase of DPF percentagecompared to baseline. Nine of 15 patients receiving 6 mg/kg/week drisapersen showed an
increase of dystrophin expression by comparing dystrophin signal intensity of pre-treatment
and post-treatment. We show these results in the following exhibit. However, the FDA has
requested an independent assessment of DPF results in Study 201 of eteplirsen. It remains to
be seen how the new assessment would correspond to previously reported values.
Sarepta Therapeutics, Inc.
January 22, 2015 Simos Simeonidis 212 437 9293; [email protected] 24
-
8/9/2019 SRPT - 1924-349902-1.pdf
25/82
Exhibit 16: Comparison of dystrophin expression in Phase II studies
Trial Name DEMAND II
Treatment Drisapersen
Development stage Phase II
Dose 30 mg/kg 50 mg/kg 6 mg/kg
# of patients 4 4 18
Mean age at baseline 9.3 8.5 7.2
Treatment duration (wks) 48 48 48
Biopsy muscleTibialis anterior
muscle (leg)
# of patients (%) with increased
dystrophin at week 244 (100%)
NA 9 (60%)*
Based on DPF; *Based on signal intensity with 15 patients assessed
Eteplirsen
Phase II
Biceps muscle (1st and 2nd biopsy), left
deltoid (3rd biopsy)
Study 201
Source: RBC Capital Markets
Efficacy on 6MWT: So far, eteplirsen has been tested in approximately 40 patients in four
clinical trials. Backed by GSK from 2009 to 2014, drisapersen was tested in a much larger
DMD patient population (more than 300 patients) across seven trials, including one Phase III
study. The disadvantage of eteplirsen is its small tested patient population. However, all of
its trials have yielded satisfactory results so far. At week 168 of the ongoing Phase II
eteplirsen extension trial (Study 202, mITT=10, modified intention-to-treat population),
patients in the eteplirsen group demonstrated significant improvement of 65m (p0.017) in
the 6-minute walk test (6MWT) over patients in the placebo/delayed group.
For drisapersen, its failed Phase III trial has continued to dampen complete optimism for
future approval. In that Phase III trial (n=186), the difference in 6MWT between thedrisapersen and placebo groups was 10.3m and not statistically significant (p=0.415).
Although a pre-specified analysis revealed that the difference doubled to 21m when patients
7 years old were considered, final results in that subgroup were still not significant
(p=0.131). Nevertheless, drisapersen does show quite positive results in a few Phase II trials.
For example, in DEMAND II and DEMAND V, 6 mg/kg drisapersen exhibited improvements in
6MWT at week 24 over placebo with p-value equal to 0.014 and 0.051, respectively. We
summarize the clinical results of eteplirsen and drisapersen in short-term and long-term
studies in the following two tables, respectively.
Sarepta Therapeutics, Inc.
January 22, 2015 Simos Simeonidis 212 437 9293; [email protected] 25
-
8/9/2019 SRPT - 1924-349902-1.pdf
26/82
Exhibit 17: Summary of clinical data of eteplirsen and drisapersen in short-term studies
Sarepta's eteplirsenTrial name Study 201 DEMAND II DEMAND V DEMAND III
Study designDouble-blind, placebo-
controlled
Double-blind,
placebo-controlled
Double-blind,
placebo-controlled
Double-blind,
placebo-controlled
Stage Phase II Phase II Phase II Phase III
Number of Patients 12 53 51 186
Mean age at baseline (years) 8.8 7.3 7.8 8.2
Number of arms 3 3 3 2
Doses in the trial
30 mg/kg (n=4),
50 mg/kg (n=4),
placebo (n=4)
6 mg/kg cont. (n=18),
intermittent* (n=17),
placebo (n=18)
3 mg/kg (n=17),
6 mg/kg (n=18),
placebo (n=16)
6 mg/kg (n=125),
placebo (n=61)
Treatment duration (weeks) 24 48 weeks 24 weeks 48 weeks
on mean 6MWT vs. placeboat week 24 (m)
25.5 (50 mg/kg) 35.1 27.1 NA
p-value Not significant p=0.014 p=0.051 NA
on mean 6MWT vs. placebo
at week 48 (m)87.4 (50 mg/kg) 35.8 27.9 10.3
p-value p0.001 p=0.051 p=0.177 p=0.415
*patients received 6 mg/kg drisapersen, either continuously or intermittently
Prosensa/BioMarin's drisapersen
Source: RBC Capital Markets
In addition, we compared the long-term studies of eteplirsen and drisapersen in the
following table. Study 202 is the extension trial of eteplirsens Study 201 in 12 ambulant
DMD boys.
Sarepta Therapeutics, Inc.
January 22, 2015 Simos Simeonidis 212 437 9293; [email protected] 26
-
8/9/2019 SRPT - 1924-349902-1.pdf
27/82
Exhibit 18: Summary of clinical data of eteplirsen and drisapersen in long-term studies
Drug Sarepta's eteplirsen
Trial name Study 202 CLIN-02 extension DEMAND IV
Study designOpen-label, Phase II
extension
Open label, Phase I/II
extension
Open-label, Phase
II/III extension
Number of patients in the treatment group8 (6 ambulant,
2 non-amubulant)
10 (8 ambulant,
2 non-ambulant)69
Number of patients in the placebo/delayed
group4 0 44
Total number of patients 12 10 113
Mean patient age at baseline (yrs) 9.2 9.5 8.8
6MWT at baseline (m) 382 385 363
Doses in the trial30 mg/kg (n=6)
50 mg/kg (n=6)6 mg/kg 6 mg/kg
Treatment duration (weeks) > 168 177 48
6MWT (m), from baseline for treatment
group-76.7 (168 weeks) +33 (177 weeks) -66.8 (96 weeks)
6MWT (m), treatment group vs.
placebo/delayed+65.4 (168 weeks) NA +46 (96 weeks)
p-value p0.017 NA NA
Prosensa/BioMarin's Drisapersen
Source: RBC Capital Markets
Eteplirsens Study 201/202 and the extension phase of drisapersens CLIN-02 are comparable
to each other in terms of treatment period and study size. Based on these factors, BioMarin
management compared the two studies 6MWT change from baseline (shown below). In the
following two exhibits, 6MWT in the Study 201/201 until 144 weeks is compared against the
6MWT of all 10 patients and 8 ambulatory patients, respectively, treated in the extension
phase of CLIN-02. Although it seems that drisapersen favors comparably in delaying the
decline in 6MWT versus eteplirsen in the Study 201/202, we note that there are many
differences between the two studies. Sarepta in its response highlighted that Study 201 was
a randomized, placebo-controlled study while the extension of CLIN-02 is an open-label
study.
Sarepta Therapeutics, Inc.
January 22, 2015 Simos Simeonidis 212 437 9293; [email protected] 27
-
8/9/2019 SRPT - 1924-349902-1.pdf
28/82
Exhibit 19: Comparison of treatment effect of eteplirsen and drisapersen (including the 2
patients who lost ambulation during the trial) in long-term studies
Source: BioMarin presentation
Considering that the average age of patients at the end of the extension phase of CLIN-02
was more than 12 years old, the increase of average 6MWT by 33 meters at week 177 versus
baseline in the 8 ambulatory patients (see below) is a surprising result. If this can be
confirmed by another long-term study, it would suggest drisapersen ahead of eteplirsen in
regards to efficacy. We do note the caveats of comparing small studies against other small
studies.
Exhibit 20: Comparison of treatment effect of eteplirsen and drisapersen (excluding the 2
patients who lost ambulation during the trial) in long-term studies
Source: BioMarin presentation
Sarepta Therapeutics, Inc.
January 22, 2015 Simos Simeonidis 212 437 9293; [email protected] 28
-
8/9/2019 SRPT - 1924-349902-1.pdf
29/82
Safety: In the long-term eteplirsen extension study, no treatment-emergent serious AEs have
been reported. Procedural pain (75%) and proteinuria (62%) were the most frequent AEs at
week 168. Since the extension study is open-label, there is no safety data for the placebo
group. In the Phase II and Phase III trials of drisapersen, patients in the drisapersen group
experienced injection site reactions (72%-78% across Phase II and III trials) and renalabnormalities (64% in Phase III trial, including proteinuria and red blood cells in urine) at a
rate almost twice of the patients in the placebo group. Moderate to severe
thrombocytopenia have been reported in drisapersen trials as well. Considering the Phase III
trial of drisapersen was for 48 weeks, we believe that the percentage of patients
experiencing adverse events could go even higher in a long-term study of drisapersen.
Investigators also kept a close watch of the uptake of drisapersen by the proximal tubules in
the kidney. However, since PMOs are a relatively new class of agents compared to 2OMePS,
limited preclinical and clinical safety data have been accumulated about PMOs.
IP: Sarepta and Prosensa have been in a number of patent disputes (see the section IP
dispute between Sarepta and Prosensa for more details). Currently, we believe Prosensa has
the advantage, especially in the EU where it holds an EU patent protecting its exon 51
skipping technology, which could potentially block eteplirsens sales in the EU unless Sarepta
can work out a patent licensing deal. In the US, Sarepta is in three patent interference
proceedings with Prosensa. In all proceedings, Prosensa is the senior party and Sarepta is the
junior party that bears the responsibility to prove its invention was conceived earlier.
Regulatory path: Prosensa currently holds an advantage with regard to its path to regulatory
approval. It has initiated rolling submission to the FDA with plans to finish submission in
1Q15. It plans to use 6MWT data as a clinical outcome for filing purposes. Sarepta originally
also planned to finish submitting for regulatory approval by YE14. However, correspondence
with the FDA determined that the agency would require more data from Sarepta as part of
its accelerated approval program. These include 3-month safety data from 12-24 new
patients dosed with eteplirsen. The addition of these requirements have pushed back
Sareptas timeline, and it now expects completion of regulatory filing by mid-2015, givingProsensa perhaps an advantage to market access and penetration. In the EU,
Prosensa/BioMarin plans to file the MAA for drisapersen with the EMA in 2Q15. In a
December 2014 meeting, EMA provided preliminary guidance to Sarepta that additional data
would be needed for conditional approval of eteplirsen.
Exhibit 21: Another glance at eteplirsen vs. Drisapersen
Eteplirsen Drisapersen
Support from patient
advocacy groups++ +
Safety ++ +
Proof of efficacy No Phase III dataMore patients tested, but
failed Phase III
Commercial support ++
Strength of IP ++
Source: RBC Capital Markets
Sarepta Therapeutics, Inc.
January 22, 2015 Simos Simeonidis 212 437 9293; [email protected] 29
-
8/9/2019 SRPT - 1924-349902-1.pdf
30/82
A review of eteplirsens development program
1) Study 33: Phase I/II trial of eteplirsen in 7 non-ambulantDMD patients
Trial started: October 2007 Top-line data released: January 21, 2009
Article published in Lancet Neurol. in 2009
DMD literature suggests dystrophin-positive revertant fibers to occur sporadically in up to
50% of DMD patients. These fibers arise from the endogenous alternative processing of DMD
pre-mRNA that skips some exons and leads to restoration of the open reading frame. This
endogenous phenomenon underlies the rationale for treating DMD patients with exon-
skipping therapies: to induce pharmacologically what happens spontaneously in some
patients.
Following the promising results from the two preclinical studies, eteplirsen entered its first
clinical trial in DMD patients in the UK in late 2007. The purpose of the study besides safety
was to assess the restoration of dystrophin expression in a muscle injected with eteplirsen.
Study Design: This was a single-blind, placebo-controlled, dose-escalation study in 7 non-
ambulant DMD patients. Two patients received 0.09 mg eteplirsen in 900 L saline and five
patients received 0.9 mg eteplirsen in 900 L saline. Each treatment was injected into the
contralateral extensor digitorum brevis (EDB) muscle at the back of the foot. The
contralateral EDB muscle was injected with 900 Lnormal saline. Between 3 and 4 weeks
after injection, an open biopsy of both EDB was performed in all patients. Standard-of-care
treatment, including glucocorticoids and cardioprotective drugs, was maintained in all
patients.
Patient Population: Patients were aged between 10 and 17 years (inclusive) and were not
ambulant. All of them had eligible deletions that can be rescued by skipping exon 51, fewer
than 5% revertant (dystrophin-positive) fibers, FVC (forced vital capacity) 25%, and
sufficiently preserved EDB muscle.
Primary Endpoint: The primary endpoint was safety.
Secondary Endpoints: Secondary endpoints included efficacy of induced exon 51 skipping in
the treated EDB muscle and restoration of dystrophin expression, as assayed by
immunohistochemistry and western blot.
Dystrophin Expression: The hig