srpt - 1924-349902-1.pdf

8/9/2019 SRPT - 1924-349902-1.pdf

1/82

RBC Capital Markets, LLC

Simos Simeonidis, Ph.D. (Analyst)212 437 [email protected]

Sector PerformSpeculative Risk

NASDAQ: SRPT; USD 11.85

Price Target USD 15.00Scenario Analysis*

DownsideScenario

8.00

32%

CurrentPrice

11.85

PriceTarget

15.00

27%

UpsideScenario

22.00

86%

*Implied Total Returns

Key StatisticsShares O/S (MM): 46.6

Dividend: 0.00

Market Cap (MM): 5

Yield: 0.0

Avg. Daily Volume: 1,207,6

RBC EstimatesFY Dec 2013A 2014E 2015E 201

Revenue 14.2 10.2 2.0 133

EPS, Ops Diluted (3.31) (3.06) (3.34) (1.4

Revenue Q1 Q2 Q3 Q

2013 4.5A 3.0A 4.2A 2.6

2014 6.1A 2.6A 1.1A 0.

2015 0.5E 0.5E 0.5E 0.

EPS, Ops Diluted

2013 (1.32)A (0.60)A (1.24)A (0.23

2014 (0.75)A (0.85)A (0.71)A (0.75

2015 (0.80)E (0.83)E (0.85)E (0.86All values in USD unless otherwise noted.

January 22, 2015

Sarepta Therapeutics, Inc.

Initiating with Sector Perform: Near-termuncertainty keeps us on the sidelines

Our view: Sarepta recently announced 168-week data from the original

trial in 12 boys with DMD and expects to submit the eteplirsen NDA

by mid-2015. The company will conduct the fourth biopsy in 1Q15,

continue to enroll patients in new trials and will conduct an independent

assessment of its dystrophin data. Despite the recent pullback, near-term

uncertainty and potential volatility keeps us on the sidelines on SRPT.

Key points:We think eteplirsen could eventually get through the FDA, but near-term

uncertainty keeps us on the sidelines. Duchenne Muscular Dystrophy

(DMD) is a devastating disease affecting young boys and their families, and

FDA now appears very willing to work closely with companies to approve

drugs for it. We believe the agency is under significant pressure to approve

a drug for these patients soon. Given eteplirsens apparent benign safety

profile and pressure by patient advocacy groups, we believe the eteplirsen

NDA could eventually get the green light, despite a number of outstanding

questions. However, near-term uncertainty around clinical/regulatory

progress keep us on the sidelines and on our rating at Sector Perform,

Speculative Risk. We will look for entry points with these uncertainties out

of the way and once a clearer understanding of filing requirements, details

on timing, status of ongoing trials, and the AdCom have been delineated.

Sarepta vs. BioMarin: who has the better drug?BioMarins acquisition of

Sareptas direct competitor, Prosensa, is obviously a key point to consider.

Among the many similarities between the two drugs are their mechanisms

of action, both RNA-targeting drugs, and the fact that both companies

have looked at different cuts of the data where their drug looks better.

Sarepta points to drisapersens failed Phase III trial, AE profile and argue

that they dont make dystrophin. Prosensa countered by pointing to

the small size of Sarepta's most advanced trial and that the FDA recently

casted doubts on its dystrophin measurement methodology. A number of

additional issues to consider include IP, regulatory expertise, commercial

execution, first to market (US and EU), etc. In most of these, the nod

would have to go to BioMarin, given its track record and reputation as

one of the top rare disease companies. On the other hand, despite a lot

of the controversy around Sarepta, including management drawing lotsof criticism for its handling of regulatory interactions, the company has

garnered a lot of institutional expertise on DMD, especially in dealing with

FDA, since they have been at the forefront of this effort. We also believe

that they deserve a lot of the credit for bringing about a sea of change

in how the FDA is now dealing with DMD. So, we dont necessarily see a

clear winner between the two yet and believe a lot of this could play out

at the FDA AdCom, where we will get a clearer understanding of the FDAs

views on these agents and where a lot of the clinical questions will have

to be addressed.

Priced as of prior trading day's market close, EST (unless otherwise noted)For Required Conflicts Disclosures, see Page 79.

8/9/2019 SRPT - 1924-349902-1.pdf

2/82

Target/Upside/Downside Scenarios

Exhibit 1: Sarepta Therapeutics, Inc.

80m

60m

40m

20m

A S O N

2012

D J F M A M J J A S O N

2013

D J F M A M J J A S O N

2014

D J

UPSIDE22.00

TARGET15.00

CURRENT11.85

DOWNSIDE8.00

Jan 2016

55.5

35.5

25.5

20.5

15.5

10.5

5.50

125 Weeks 31AUG12 - 21JAN15

SRPT Rel. S&P 500 COMPOSITE MA 40 weeks

Source: Bloomberg and RBC Capital Markets estimates for Upside/Downside/Target

Target price/base caseWe use a sum-of-the-parts methodology to value Sarepta

shares, and estimate the probability adjusted NPV of the

following: 1) the eteplirsen sales DMD ($13/share), and 2) the

companys projected net cash position ($2/share).

Upside scenario

Our upside scenario of $22/share assumes that the FDA

approves eteplirsen and at the same time request more data

and thus delay the NDA submission of drisapersen, the exon

51 skipping drug from Prosensa/BioMarin. Therefore, Sarepta

could gain significantly more market share with this setback to

its main competitor. Under this scenario, we estimate that the

probability adjusted NPV of eteplirsen sales could reach $20/share.

Downside scenario

Our downside scenario of $8/share assumes that the FDA

would request more data for the NDA submission of

eteplirsen. Thus, Sarepta would have to delay its plan of NDA

submission by mid 2015 and commercial launch in 2016. This

would give drisapersen more opportunity to gain market share

and limit the market potential of eteplirsen. Our downside

estimate of the NPV value of eteplirsen sales is $6/share.

Investment summaryWe think eteplirsen could eventually get through the

FDA, but near-term uncertainty keeps us on the sidelines.

Duchenne Muscular Dystrophy (DMD) is a devastating disease

affecting young boys and their families, and FDA now appears

very willing to work closely with companies to approve

drugs for it. We believe the agency is under significant

pressure to approve a drug for these patients soon. Given

eteplirsens apparent benign safety profile and pressure by

patient advocacy groups, we believe the eteplirsen NDA

could eventually get the green light, despite a number

of outstanding questions. However, near-term uncertainty

around clinical/regulatory progress keep us on the sidelines

and on our rating at Sector Perform, Speculative Risk. We

will look for entry points with these uncertainties out of the

way and once a clearer understanding of filing requirements,

details on timing, status of ongoing trials, and the AdCom havebeen delineated.

Sarepta vs. BioMarin: who has the better drug? BioMarins

acquisition of Sareptas direct competitor, Prosensa, is

obviously a key point to consider. Among the many similarities

between the two drugs are their mechanisms of action and

the fact that both companies have looked at different cuts

of the data where their drug looks better. Sarepta points

to drisapersens failed Phase III trial, AE profile and argue

that they dont make dystrophin. Prosensa countered by

pointing to the small size of Sarepta's most advanced trial

and that the FDA recently casted doubts on its dystrophin

measurement methodology. Additional issues include IP,regulatory expertise, commercial execution, first to market,

etc. In most of these, the nod would have to go to BioMarin,

given its track record and reputation as one of the top rare

disease companies. On the other hand, despite a lot of

the controversy, Sarepta has garnered a lot of institutional

expertise on DMD, especially in dealing with FDA. So, we

dont necessarily see a clear winner between the two yet and

believe a lot of this could play out at the FDA AdCom, where

we will get a clearer understanding of the FDAs views on these

agents and where a lot of the clinical questions will have to be

addressed.

Risks: 1) Negative data from the 4thbiopsy or independentassessment of dystrophin; 2) Further setback to the plan to file

NDA by mid-15; 3) Competitors milestone in regulatory filing,

approval and launch. These risks, if they materialize, may

result in significant volatility, and given that the majority of the

value comes from a single product, lead to the Speculative Risk

qualifier on our rating.


January 22, 2015 Simos Simeonidis 212 437 9293; [email protected] 2

8/9/2019 SRPT - 1924-349902-1.pdf

3/82

Key QuestionsOur View

1. Can Sarepta meet its projected

timeline in filing the NDA foreteplirsen or will we see more

delays?

There is risk in meeting the timeline to file the NDA by mid-2015, but we view it

as an achievable goal.However, we acknowledge the outstanding risks, of whichpatient enrollment and natural history data collection will be the rate-limiting

steps for the NDA submission in mid 2015. With the first patient dosed in Study

301 in November 2014, the company expects to start dosing 12-24 patients in

January 2015. Therefore, we assume patient enrollment will not become an issue.

Sarepta also has to collect natural history data from a few academic studies. We

note that Sareptas strong support from the DMD patient community and the

involvement of the FDA should help Sarepta obtain natural history data on time.

2.

How does the new 168-week data

affect the chances of eteplirsen

approval?

It definitely does not help, but it doesnt signal the end, either. Despite the

continuing decline of the 6MWT in the eteplirsen-treated cohort, we believe

eteplirsen can be approved based on its exhibited ability to maintain ambulation

in the boys treated. Investors and FDA did not expect an exon skipping drug to bea cure for DMD. The best case scenario would be a delay in this progressive

disease. Thus far, the data (albeit very small) has shown signs of eteplirsens

ability to maintain ambulatory activity in the 10 boys in this dataset. We believe

the right comparison is against a natural history cohort who are similarly aged and

with a comparable baseline 6MWT. Qualitatively, the doctors we spoke to would

all expect an average 12 year old DMD boy to have lost ambulation. Clearly, the

Study 202 dataset demonstrates that the eteplirsen cohort are still ambulatory,

which would imply a treatment benefit in delaying the loss of ambulation.

3. How far behind Prosensa/BioMarins

drisapersen is Sareptas eteplirsen?

Will there be a significant first-to-market advantage, if both therapies

are approved?

Even if drisapersen reaches the market ahead of eteplirsen, we believe that over

time, many (at least US) patients may migrate to eteplirsen treatment, due to

the eteplirsens more benign side effect profile.The two drugs remain in a head-to-head competition to receive FDA approval as the first exon 51 skipping therapy

for DMD patients. BioMarin expects to complete the drisapersen NDA submission

in 1Q15, whereas Sarepta anticipates filing in mid 2015 for its eteplirsen NDA. If

both drisapersen and eteplirsen were approved, the first-to-market advantage in

our estimates would be about half a year for the best case scenario for

Prosensa/BioMarins drisapersen. However, KOLs point out the proteinuria and

the injection site reactions seen with drisapersen as potential obstacles, especially

in a patient population who would receive treatment for many years. These issues

may provide enough ground for patients to eventually prefer eteplirsen. So, we

dont see getting to market a few months or a year after drisapersen as

Sareptas biggest issue: its if they dont get approved, or get approved a number

of years later that would be the real issue.

4. How will the IP dispute with

Prosensa/BioMarin play out?

In the EU, we do not expect Sarepta to win its appeal of the prior decision to

grant Prosensa/BioMarins patent claims on exon 51 skipping agents. Under this

scenario, we expect Sarepta to seek a licensing deal from and pay royalties to

Prosensa/BioMarin in order to launch eteplirsen in the EU. In the US, Sarepta is in

similar IP interference proceedings with Prosensa. Before a final decision from the

patent appealing process is reached, Sarepta can still market eteplirsen in the US.

However, losing the US court decision and appeal would leave it in the same IP

predicament as it is in the EU.



8/9/2019 SRPT - 1924-349902-1.pdf

4/82

Table of contents

Valuation .............................................................................................................................. 5

1) Eteplirsen sales ($13/share) ................................................................................................... 5

2) Sareptas projected net cash position ($2/share) .................................................................. 8

Price Target Impediments .......................................................................................................... 8

Company Overview .............................................................................................................. 9

Sareptas lead asset: eteplirsen (exon 51 skipping agent) ................................................... 10

What is exon skipping?............................................................................................................. 10

A Quick Look Back at Sareptas Stock Movements .................................................................. 14

What is the FDAs Position on DMD Therapeutics? ................................................................. 16

What is the data on eteplirsen? ............................................................................................... 18

Prosensas Drisapersen vs. Sareptas Eteplirsen ...................................................................... 22

A review of eteplirsens development program ...................................................................... 30A Look at Prosensas Drisapersen Clinical Data ........................................................................ 43

Intellectual property ................................................................................................................ 58

DMD: A devastating disease..................................................................................................... 60

Competitive Landscape for DMD Treatments .......................................................................... 63

Sareptas RNA-based technology ........................................................................................ 66

Sareptas infectious disease program ................................................................................. 68

Eteplirsen revenue model................................................................................................... 73

Sarepta: Income Statement and Balance Sheet .................................................................. 75



8/9/2019 SRPT - 1924-349902-1.pdf

5/82

ValuationTo value Sarepta shares, we use a sum-of-the-parts methodology, and estimate the

probability adjusted NPV of: 1) the eteplirsen sales, and 2) the companys projected net cash

position.

To make a conservative valuation, we use the total number of diluted shares in our

calculation, which is the sum of two parts: the number of common shares and the number of

potentially dilutive shares (including warranty, options, restricted stock awards, restricted

stock units, and stock appreciation rights). As of September 30, 2014, Sarepta had 41.3MM

common shares. The number of potentially dilutive shares outstanding was 5.3MM at the

end of September 2014, which mainly include 5.1MM options (weighted exercise price at

$24.67) and 0.2MM stock appreciation rights (weighted exercise price at $18.18). Therefore,

we calculate the total number of diluted shares as 46.6MM at the end of 3Q14 and we

estimate that the number of diluted shares is 47.3M at YE14.

1) Eteplirsen sales ($13/share)i) US salesWe have modeled that eteplirsen could reach peak sales of $541MM in the US in 2026 for

the treatment of DMD patients with dystrophin mutations amenable to exon 51 skipping

therapies. For the label of eteplirsen in the US, we make an assumption that FDA will be

more lenient than its counterpart in the EU and will allow eteplirsen to be prescribed to any

DMD patients eligible for exon 51 skipping without limits on age or ambulatory status.

ii) EU SalesWe have modeled that eteplirsen could reach peak sales of $231MM in the EU in 2026 for

the treatment of DMD patients with dystrophin mutations amenable to exon 51 skipping

therapies. For the label of eteplirsen in the EU, we assume that it will only be prescribed to

ambulatory DMD patients at least 5 years old. This is in line with the recent EU approval of

Translarna, a DMD therapy whose label is for ambulatory DMD patients who are at least 5years old and have nonsense mutations.

iii) Discount Rate and Probability of Success (POS)In calculating the net present value of eteplirsens free cash flows, we use a 10% discount

rate. We have assigned 50% and 40% POS that eteplirsen will be approved and reaches the

US and EU market, respectively. We assign a lower POS in the EU mainly because

Prosensa/BioMarin currently holds the patent for exon 51 skipping in the EU, which would

prevent the commercial activities of eteplirsen if Sarepta does not reach a licensing

agreement with Prosensa/BioMarin. Using these assumptions, we arrive at a probability-

adjusted NPV for eteplirsen of $13/share.



8/9/2019 SRPT - 1924-349902-1.pdf

6/82

Exhibit 2: Eteplirsen NPV AnalysisUS ($MM)

($MM) 2015E 2016E 2017E 2018E 2019E 2020E 2021E 2022E 2023E 2024E 2025E 2026E 2027E 2028E 2029E 2030

US eteplirsen sales 0.0 106.8 302.0 413.9 483.4 496.9 510.7 525.0 529.0 533.1 537.2 541.3 54.5 27.5 27.7 27.9

Total eteplirsen revenue in US 0.0 106.8 302.0 413.9 483.4 496.9 510.7 525.0 529.0 533.1 537.2 541.3 54.5 27.5 27.7 27.9

Royalties paid to Prosensa/BioMarin 0.0 0.0 0.0 41.4 48.3 49.7 51.1 52.5 52.9 53.3 53.7 54.1 0.0 0.0 0.0 0.0

COGS 0.0 21.4 60.4 82.8 91.8 89.4 86.8 89.2 84.6 80.0 80.6 81.2 8.2 4.1 4.2 4.2

R&D 22.8 23.6 24.0 8.1 4.9 1.0 0.8 0.6 0.5 0.5 0.4 0.3 0.0 0.0 0.0 0.0

G&A 22.7 23.1 23.6 24.0 24.5 25.0 25.5 26.0 25.5 25.0 24.5 19.6 9.8 7.8 6.3 5.0

Sales expense for eteplirsen 0.0 16.0 16.5 17.0 17.5 18.0 18.5 19.1 18.1 17.2 16.4 8.2 4.1 2.0 1.4 1.4Marketing expense for eteplirsen 0.0 5.0 5.1 5.2 5.3 5.4 5.5 5.6 5.3 5.1 4.8 2.4 1.2 0.6 0.4 0.4

Tax adjusted EBIT (45.5) 17.8 146.6 188.3 232.8 246.7 225.7 232.3 239.4 228.8 231.9 244.1 20.3 8.4 10.0 11.0

Tax rate 0% 0% 15% 20% 20% 20% 30% 30% 30% 35% 35% 35% 35% 35% 35% 35%

Eteplirsen sales FCF (45.5) 17.8 146.6 188.3 232.8 246.7 225.7 232.3 239.4 228.8 231.9 244.1 20.3 8.4 10.0 11.0

Discount Period 0.94 1.94 2.94 3.94 4.94 5.94 6.94 7.94 8.94 9.94 10.94 11.94 12.94 13.94 14.94 15.94

Discount Factor 0.91 0.83 0.76 0.69 0.62 0.57 0.52 0.47 0.43 0.39 0.35 0.32 0.29 0.26 0.24 0.22

PV of eteplirsen sales FCF (41.6) 14.8 110.8 129.4 145.4 140.1 116.5 109.0 102.1 88.7 81.8 78.2 5.9 2.2 2.4 2.4

Discount Rate 10%

Perpetual Growth Rate 0%

Final year FCF $0

Terminal Value $0

Discount Factor 0.22

Present Value of Terminal Value $0

Present Value of Cash Flows $1,088

Present Value of Total Cash Flows $1,088

Fully Diluted Shares Outstanding (MM) 47

NPV of eteplirsen $23.03

Probability of Success 50%

NPV of eteplirsen (probability-adjusted) $11.51

Source: RBC Capital Markets estimates

Sarepta Therapeutics, Inc

January 22, 2015 Simos Simeonidis 212 437 9293; [email protected]

8/9/2019 SRPT - 1924-349902-1.pdf

7/82

Exhibit 3: Eteplirsen NPV AnalysisEU ($MM)

($MM) 2014E 2015E 2016E 2017E 2018E 2019E 2020E 2021E 2022E 2023E 2024E 2025E 2026E 2027E 2028E 2029E 2030E

EU eteplirsen sales 0.0 0.0 0.0 41.0 104.7 214.0 218.8 223.6 228.6 229.1 229.6 230.1 230.6 23.1 11.6 11.6 11.6

Total eteplirsen revenue in EU 0.0 0.0 0.0 41.0 104.7 214.0 218.8 223.6 228.6 229.1 229.6 230.1 230.6 23.1 11.6 11.6 11.6

Royalties paid to Prosensa/BioMarin 0.0 0.0 0.0 4.1 10.5 21.4 21.9 22.4 22.9 22.9 23.0 23.0 23.1 0.0 0.0 0.0 0.0

COGS 0.0 0.0 0.0 8.2 20.9 40.7 39.4 38.0 38.9 36.7 34.4 34.5 34.6 3.5 1.7 1.7 1.7

R&D 16.9 22.8 23.6 24.0 8.1 4.9 1.0 0.8 0.6 0.5 0.5 0.4 0.3 0.0 0.0 0.0 0.0

G&A 23.9 22.7 23.1 23.6 24.0 24.5 25.0 25.5 26.0 25.5 25.0 24.5 19.6 9.8 7.8 6.3 5.0

Tax adjusted EBIT (40.9) (45.5) (46.7) (30.5) 19.0 83.9 90.8 83.0 85.0 88.0 84.4 85.5 94.3 3.8 (0.0) 1.4 2.3

Tax rate 0% 0% 0% 15% 20% 20% 20% 30% 30% 30% 35% 35% 35% 35% 35% 35% 35%

Eteplirsen sales FCF (40.9) (45.5) (46.7) (30.5) 19.0 83.9 90.8 83.0 85.0 88.0 84.4 85.5 94.3 3.8 (0.0) 1.4 2.3

Discount Period -0.06 0.94 1.94 2.94 3.94 4.94 5.94 6.94 7.94 8.94 9.94 10.94 11.94 12.94 13.94 14.94 15.94

Discount Factor 1.01 0.91 0.83 0.76 0.69 0.62 0.57 0.52 0.47 0.43 0.39 0.35 0.32 0.29 0.26 0.24 0.22

PV of eteplirsen sales FCF (41.1) (41.6) (38.8) (23.1) 13.1 52.4 51.5 42.8 39.9 37.5 32.7 30.2 30.2 1.1 (0.0) 0.3 0.5

Discount Rate 10%

Perpetual Growth Rate 0%

Final year FCF $0

Terminal Value $0

Discount Factor 0.22

Present Value of Terminal Value $0

Present Value of Cash Flows $229

Present Value of Total Cash Flows $229

Fully Diluted Shares Outstanding (MM) 47

NPV of eteplirsen $4.84Probability of Success 40%

NPV of eteplirsen (probability-adjusted) $1.94


Sarepta Therapeutics, Inc

January 22, 2015 Simos Simeonidis 212 437 9293; [email protected]

8/9/2019 SRPT - 1924-349902-1.pdf

8/82

2) Sareptas projected net cash position ($2/share)Sarepta ended 3Q14 with $236MM in cash and $6MM in debt. We will consider projected

net cash in 12 months. By adding estimated net income, subtracting any amortized revenue,

and adding back non-cash stock-based compensation, we project Sarepta to end FY2015 witharound $84MM in net cash, which is approximately $2/share.

Exhibit 4: SRPT Sum-of-the-Parts Value

Eteplirsen (DMD) NPV - US $11.51

Eteplirsen (DMD) NPV - EU $1.94

Projected Net Cash $1.72

Sum-of-the-parts value for SRPT $15.17

SRPT: Sum-of-the-parts valuation


Price Target ImpedimentsFDA continues to question the validity of dystrophin expression measurementIn October, due to concerns about the reproducibility of the dystrophin positive fibers, the

FDA requested an independent assessment, among other things. If the FDA continues to

question Sareptas dystrophin expression data, then the likelihood of accelerated approval

for eteplirsen would be greatly reduced.

Royalty cost to be paid by Sarepta is significantly higherThe licensing negotiation between Sarepta and Prosensa/BioMarin could yield a higher

royalty rate, forcing Sarepta to pay more. In addition, the patent interference proceedings

and appealing process in the US between Sarepta and Prosensa/BioMarin regarding exon 51

skipping products could end earlier, which would require Sarepta to pay royalties earlier aswell.

High manufacturing cost of eteplirsen takes a toll on financesCompany management has commented that the manufacturing cost of eteplirsen is high and

has accounted for a large proportion of overall operation expenses. Because Sarepta has

started or is going to start 5 trials (3 for eteplirsen) with more than 200 patients in those

trials, the cost for making drugs needed in the trials will significantly increase, compared to

current drug expenses. This could consume Sareptas cash reserve quickly and exert pressure

on its cash flow.



8/9/2019 SRPT - 1924-349902-1.pdf

9/82

Company OverviewSarepta is a biotech company focused on RNA-based therapeutics for the treatment of life-

threatening rare and infectious diseases. Its lead drug candidate eteplirsen, an antisense RNA

oligomer administered intravenously, enables excision of exon 51 (exon 51 skipping) of thedystrophin RNA transcript in patients with Duchenne muscular dystrophy (DMD). It is

currently in a Phase IIb extension study. A Phase III trial of eteplirsen was initiated in

September 2014. Sarepta plans to submit an NDA to the FDA for eteplirsen in mid-2015.

Besides eteplirsen, Sarepta has numerous preclinical candidates for skipping other

dystrophin exons in its DMD program. The second development program at Sarepta targets

infectious diseases and viruses, such as the Marburg and Ebola viruses. In July 2012, the

company changed its name and stock symbol from AVI BioPharma and AVII to Sarepta

Therapeutics and SRPT, respectively. Founded in 1980, Sarepta is headquartered in

Cambridge, Massachusetts and currently has approximately 146 employees.

Exhibit 5: SareptasPipeline

Drug candidate Indication Stage Comments

Eteplirsen Exon 51 skipping Phase IIIWill file an NDA in mid 2015. Three open-label trials started

or will start soon

SRP-4053 Exon 53 skipping Phase I/II Started dosing in EU in January 2015

SRP-4045 Exon 45 skipping Preclinical Expected to enter clinical trials in 1H15

SRP-4050 Exon 50 skipping Preclinical




SRP-4008 Exon 8 skipping Discovery

AVI-7288 Marburg virus Phase I Completed in 2014

AVI-7537 Ebola virus Phase I Halted in 2012 due to government funding constraints

AVI-7100 H1N1 Influenza virus Phase I Expected to complete in 2015

Bacterial PPMO Drug-resistant bacteria Discovery Six programs identified and are underway

Infectious diseases

Duchenne muscular dystrophy (DMD)

Source: RBC Capital Markets

Exhibit 6: Expected newsflow for Sarepta

Expected Newsflow Candidate Timing

Conduct the 4th biopsy in the Phase IIb trial (Study 202) eteplirsen Jan 2015Start eteplirsen dosing in Study 203 in patients between four and six years old eteplirsen 1Q15

Start SRP-4045 and SRP-4053 dosing in Study 4045-301 patients SRP-4045 and SRP-4053 1H15

Complete the Phase I trial of AVI-7100 AVI-7100 1H15

Submit NDA for eteplirsen to FDA eteplirsen Mid-15

Data from AVI-7100 Phase I trial for influenza AVI-7100 2015

FDA decision on eteplirsen based on priority review eteplirsen 1H16

Launch eteplirsen in the US eteplirsen 1H16

Data from eteplirsen Phase III trial eteplirsen 2016




8/9/2019 SRPT - 1924-349902-1.pdf

10/82

Sareptas lead asset: eteplirsen (exon 51 skipping agent)As a potential treatment for Duchenne muscular dystrophy (DMD), eteplirsen (AVI-4658) is an

exon 51 skipping agent that consists of a 30-mer (CTCCAACATCAAGGAAGATGGCATTTCTAG)

PMO, or phosphorodiamidate morpholino. Its sequence from position 9 to 28 is exactly thesame with the sequence of drisapersen, a competing exon 51 skipping agent by rival company

Prosensa (recently acquired by BioMarin). By binding a splicing signal sequence in exon 51,

eteplirsen results in exon 51 skipping during splicing of dystrophin pre-mRNA. This restores the

production of a partially functional dystrophin by compensating for a previous reading frame

mutation caused by a deletion of one of the following exons: exon 45-50, 47-50, 48-50 and 49-

50, 50, 52, or 52-63. Based on a patient mutation registry, an estimated 13% of DMD patients

can benefit from exon 51 skipping therapy. Eteplirsen is administered via IV with a dose of

either 30 mg/kg or 50 mg/kg, and is currently being tested in a Phase IIb extension trial and a

Phase III trial with plans for more clinical trials in preparation for NDA submission by mid 2015

for FDA regulatory approval.

Exhibit 7: 13% of DMD patients can benefit from exon 51 skipping therapies

Source: Company presentation

In its clinical program, eteplirsen has demonstrated good efficacy and safety, albeit in small

trials thus far. In Study 28 and Study 201, treatment with eteplirsen resulted in a significant

increase of dystrophin protein expression. Eteplirsens most advanced trial, the ongoing

Phase IIb trial (Study 202), released top-line data at 168 weeks, and exhibited a treatment

benefit of 65m (p0.017) in its primary endpoint, the six minute walk test (6MWT) between

the eteplirsen and placebo/delayed treatment arms. However, the eteplirsen treatment

group exhibited a 24-week decline in the 6MWT of 45m, the largest 24-week decline since

the trial started. We believe that both the 144-week and 168-week data suggests that the

eteplirsen-treated patients are now underway in their inevitable process of loss of

ambulation.

What is exon skipping?DMD is caused by underlying mutations in the dystrophin gene that lead to loss of protein

production. Exon skipping therapy aims to correct frameshift alterations in defective

dystrophin mRNAs by introducing a compensatory frameshift through skipping an

additional exon elsewhere in the dystrophin mRNA. By masking one or more exons during

pre-mRNA splicing, the reading frame could be restored through this method of

pharmacologically-induced alternative splicing. Therefore, shorter mRNA transcripts with a

corrected reading frame are produced, resulting in truncated, yet partially functional Becker-

like dystrophin protein (similar to dystrophin proteins found in less severe Becker muscular

dystrophy, BMD, patients). It is important to note that the masked exon is not necessarily

where the original deletion or point mutation is located, but masking of that particular exon

The goal of exon skipping

therapy is to convert a

DMD patient into one with

a less severe, BMD-like

phenotype.



8/9/2019 SRPT - 1924-349902-1.pdf

11/82

just happens to coincidentally complement the frameshift incurred by the original,

underlying mutation.

To mask the exon, antisense oligonucleotides (AONs) are hybridized to complementary

sequences in or adjacent to the target exon. AONs used in exon skipping therapy cannot be asubstrate of RNase H, which is a non-specific endonucleasethat catalyzes the degradation of

RNA in a RNA-DNA duplex through a hydrolytic mechanism. Otherwise, RNase H would

eliminate the dystrophin mRNA bound by the AONs, and dystrophin protein translation

would not occur.

The intended effect of AON binding to a pre-mRNA is to modulate the splicing sequence

signals, such that the splicing machinery removes

1)the intron before the target exon,

2)the target exon itself, and

3)the intron after the target exon,

thus skippingthe target exon. This process can be thought of being similar to endogenous

mechanisms of alternative splicing, but pharmacologically-induced to become exon

skipping.

Exhibit 8: An example of exon deletion and how exon skipping helps restore reading frame

Source: Company presentation, RBC Capital Markets

The caveat is that the function or stability of the resulting in-frame dystrophin protein is

uncertain. Ideally, the goal of exon skipping is to restore the reading frame such that it will

result in the production of a Becker-like, partially functioning dystrophin. (In Becker muscular

dystrophy patients, dystrophin is also mutated with shorter in-frame deletions; however, the

resultant dystrophin protein, though truncated, still demonstrates enough function to result

in a less severe muscular dystrophy phenotype.) In addition, patients with multiple deletions

may require multiple exonsto be skipped in order to restore the mRNA to a correct reading

frame, i.e. a combination of different AONs is required in some cases. However, in theory, a

cocktail approach enabling multiple exon skipping is poss ible.

Currently, there are two types of exon skipping AONs in clinical trials:



8/9/2019 SRPT - 1924-349902-1.pdf

12/82

1) phosphorodiamidate morpholino oligomers (PMOs, which include Sareptas eteplirsen)

and

2)2-O-methyl-phosphorothioate (2OMePS, which include rival Prosensas drisapersen).

Both eteplirsen and drisapersen enable exon 51 skipping by binding the same region on exon

51. The main difference between these two types of AONs is that PMOs do not carry charges

and 2OMePS are negatively charged.

Exon skipping is primarily different from many other antisense applications, such as RNAi or

RNAse H-dependent antisense applications, in that the target mRNA is not cleaved. In most

RNAi applications, siRNA is separated into two single strands of RNA, one of which is

integrated with an activated RNA-induced silencing complex (RISC). After the single-stranded

RNA in the RISC binds the target mRNA through standard base pairing, the active component

of RISC, Argonaute protein, will cleave the mRNA thus preventing translation, or silencing

the gene. For RNase H-dependent antisense applications, a special type of AON is used to

bind target mRNA and recruit RNase H to cleave the target mRNA. For example, AONs that

contain at least five consecutive deoxynucleotides are substrates for human RNase H and canbe considered in those applications.

What is so special about skipping exon 51 in particular?To date, exon skipping therapies for treating DMD has mainly focused on targeting exon 51.

These exon 51 skipping therapies include Sareptas eteplirsen and Prosensas drisapersen. A

number of reasons support the skipping of exon 51, in particular, for DMD therapeutic use.

1) Exon 51 skipping therapy alone is estimated to treat up to 13% of all DMD patients,

representing the largest patient population that a single-skip therapy can address. Exon 51

resides in a main hot spot for dystrophin deletion mutations, located between exons 45 and

55 and accounting for >60% of DMD patients with deletion mutations. As another reminder,

skipping of exon 51 is not meant to treat dystrophin mutations in exon 51. Instead, examples

of deletions amenable to exon 51 skipping for therapy includes deletions of exons 48-50, 45-50, 49-50, 50-52, 47-50, 43-50, and 52-63.

2)By itself, loss of the protein region encoded by exon 51 should not introduce deleterious

effects to dystrophin protein function. Exons 50 and 51 code for the hinge 3 (H3) region of

the dystrophin protein, which has a total of 4 hinge regions. Evidence that loss of exon 51

can still result in a functional dystrophin protein is provided by the identification of Becker

patients who harbor corresponding in-frame exon 51 deletions. In the following exhibit, we

show the domain structure of the normal dystrophin protein (fully functional), dystrophin

missing exon 50 (non-functional), and dystrophin without exon 50 and 51 (partially

functional).

Exon 51 skipping therapy

can treat an estimated 13%

of DMD patients, the

largest patient pool for any

single exon skipping

therapy.



8/9/2019 SRPT - 1924-349902-1.pdf

13/82

Exhibit 9: The domain structure of normal dystrophin, dystrophin missing exon 50, and

dystrophin with exon 51 skipping

ABD: 2 actin binding domains, H1-H4: 4 hinge d omains, R1-R24: 24 spectrin-like repeats, CRD: cysteine-rich domain, c-term: C-terminal domain


3) In addition, exon 51 contains ESEs (exonic splicing enhancers) that, when targeted by

therapeutics, may increase the efficiency of skipping.Targeting exons that contain ESEs may

result in better targeting of the normal splicing process, as compared to targeting exons that

do not have these ESEs.



8/9/2019 SRPT - 1924-349902-1.pdf

14/82

A Quick Look Back at Sareptas Stock MovementsAs we show in the following exhibit, a number of events have resulted in large impacts on

Sareptas stock price. Mostly, these events have stemmed from feedback with the FDA,

which has demonstrated multiple changes of opinion towards eteplirsen. In September 2013,the FDA considered an NDA submission for Sareptas eteplirsen to be premature. However,

the FDA started having a change of heart. First in April 2014, it considered an NDA for

eteplirsen as fileable with additional data. Then in June, it outlined an accelerated approval

pathway for Prosensas drisapersen, the direct competitor of Sareptas eteplirsen. At that

time, both Sarepta and Prosensa planned to file their NDA by YE14. Another unanticipated

move came in October 2014 when it subsequently requested for additional data from

Sarepta. However, the FDA later took an unusual step to post a statement online to explain

that its stance has been consistent and its willingness to work with Sarepta.

Exhibit 10: Much of Sareptas stockprice volatility is based off of data releases and FDA interactions

$0.00

$10.00

$20.00

$30.00

$40.00

$50.00

$60.00

2012/06/01 2012/10/01 2013/02/01 2013/06/01 2013/10/01 2014/02/01 2014/06/01 2014/10/01

SRPT

1) 7/24/2012

2) 10/3/2012

3) 4/16/2013

4) 7/24/2013

5) 9/20/2013

6) 11/12/2013

7) 1/16/2014

8) 4/21/2014

9) 10/27/2014

10) 1/12/2015

Source: RBC Capital Markets, Factset

1) 7/24/2012 (+146%): Sarepta first entered the collective minds of investors with their

announcement of positive data from an interim 36 week open-label extension of their

Phase IIb clinical trial of eteplirsen in 12 DMD patients. The news was accompanied by a

146% increase over the previous days closing price.

2) 10/3/2012 (+200%): Sarepta witnessed a nearly 200% jump, to ~$45/share, upon news

of their announcement of the Phase IIb extension trial meeting its primary endpoint

(6MWT) at 48 weeks.

3)

4/16/2013 (-13%): After an end-of-Phase II meeting with the FDA, Sarepta indicated that

the FDA requested a comprehensive summary to support dystrophin as a surrogate

endpoint that would reasonably predict clinical benefit in DMD patients, as well as a

detailed discussion of all clinical outcomes in the eteplirsen study. This marked the first

indication that the FDA had reservations of using dystrophin expression, which had been

the focus of Sareptas regulatory plan for eteplirsen treatment, as a biomarker for

regulatory approval. Sarepta closed 13% down to ~$34/share with this news.

4) 7/24/2013 (-19%): Sentiment from the FDA hinted at their continued worry of using

dystrophin expression solely as a regulatory endpoint to grant eteplirsen regulatory



8/9/2019 SRPT - 1924-349902-1.pdf

15/82

approval. According to Sarepta, the FDA would not commit to declaring dystrophin an

acceptable surrogate endpoint for accelerated approval. Sarepta released its plans to

submit an NDA to the FDA in 1H14 based on continued Phase IIb data. This negative

news sent Sarepta down nearly ~19% to $37.68/share.

5) 9/20/2013 (+18%): In September 2013, Prosensa (Sareptas closest competitor who is

also developing exon 51 skipping therapies for DMD treatment) announced that their

clinical trial for drisapersen had failed to meet the primary endpoint of 6MWT for its

Phase III trial. The surmised fall of Sareptas closest competitor for DMD sent shares

rising by 18% to close at $43.30.

6) 11/12/2013 (-64%): However, the windfall from Prosensas failure was shortlived. In

November, Sarepta released details of its continued discussions with the FDA, which

now considered an NDA submission for Sareptas eteplirsen to be premature.

According to Sarepta, the FDA said that it had considerable doubt about the use of

dystrophin as a surrogate endpoint as well as the 6MWT data from Sareptas open -label

Phase IIb trial of eteplirsen. The agency said it questions using dystrophin in light of the

recent failed Phase III trial of drisapersen that did not significantly improve 6MWT

results vs. placebo, despite increased expression of dystrophin. Moreover, the FDA

recommended that Sarepta conduct a placebo-controlled confirmatory trial in DMD

patients and consider endpoints that measure a broader range of function and

subpopulations. This sudden increased FDA stringency for DMD drugs sent Sarepta down

64% to close at $13.16/share.

7) 1/16/2014 (+40%): Sarepta released more data from its ongoing Phase IIb extension trial

supporting the efficacy of continued eteplirsen treatment in DMD boys. Sareptas stock

closed at $28, up 40% from the previous close.

8) 4/21/2014 (+39%): After a Duchenne patient organization meeting in the preceding

December, Sarepta released details of their latest dialogue with the FDA. The new

guidance revealed a turnaround in FDA sentiment towards eteplirsens hope for

regulatory submission. In its guidance letter, the agency stated that with additional

data to support the efficacy and safety of eteplirsen for the treatment of DMD, an NDAshould be fileable. Based on the letter, Sarepta announced its plan to submit an NDA by

YE14. The news sent its stock up ~39%, closing around ~$34.

9) 10/27/2014 (-32%): Sarepta released a surprising regulatory update that the FDA

requested more data as part of eteplirsens NDA, which we will discuss more in detail

below. Accordingly, Sarepta changed its NDA submission timeline from YE14 to mid

2015. FDA also indicated that further discussion with Sarepta will be necessary to

determine what would constitute a complete NDA. After the news, Sareptas stock took

a big hit and closed at $15.91, a 32% drop from its previous close.

10) 1/12/2015 (-15%): Sarepta released week 168 data from its ongoing extension trial in 12

DMD patients. The latest data indicated a continuing decline in 6MWT for the patients

receiving eteplirsen treatment. The results did not meet investor expectations and sent

shares down ~15% to close at $11.91.



8/9/2019 SRPT - 1924-349902-1.pdf

16/82

What is the FDAs Position on DMD Therapeutics?As shown with its stock movements, a good understanding of the regulatory environment is

necessary to gauge the potential of eteplirsen. However, over the past two years, the

regulatory landscape for DMD therapeutic development has been in a flux, especiallyregarding exon skipping therapies.

In September 2014, the FDA moved to finalize regulatory order through the release of a draft

guidance for the development of therapeutics for the treatment of DMD. The unique aspect

was that for the first time a disease community had major input into the industry guidance.

Currently, the FDA shows flexibility in its draft guidance. For example, it asks trial sponsors to

incorporate patient/family preference to treatments into trial design and FDA submission. It

would not require placebo-controlled trials in DMD studies as long as there is a well-matched

natural history study.

In order to receive accelerated approval, two pathways can be undertaken for DMD

therapeutics. First, the FDA can consider an accelerated approval based on the use of a

surrogate biomarker if the biomarker is reasonably likely to predict clinical benefit. Second,the FDA can consider an intermediate clinical endpoint for support of accelerated approval.

Most DMD companies, including Sarepta, have approached these pathways by using

dystrophin expression as a surrogate biomarker or 6MWT as an intermediate clinical

endpoint. However, the FDA also encourages sponsors to explore new endpoints in addition

to dystrophin and 6MWT.

New FDA dialogue asks for additional patient dataFollowing a meeting with the FDA in April 2014, Sarepta originally planned to submit an NDA

seeking accelerated approval for eteplirsen by the end of 2014. However, on October 27th

,

2014, Sarepta released excerpts from its FDA meeting minutes that shattered that plan.

Sarepta now aims to submit an NDA by mid-2015. In the minutes, the FDA requested the

following data to be included in the submission:

1) 3-month [safety] data from at least 12 to 24 newly exposed patients at the time the

NDA is submitted;

2) Available data from the other patients enrolled in the new eteplirsen studies (studies

301, 203, 204) should also be included at the time the NDA is submitted, even if

exposure is less than 3 months in duration;

3) Additional data from later time points and from newly enrolled patients should be

submitted in the 120-Day Safety Update;

4)

FDA strongly advises the sponsor to obtain and submit patient-level natural history

data. FDA is prepared to appeal to academic groups holding the data to allow the

sponsor a means to acquire the data;

5) The lack of robust dystrophin measurement during the [study 201/202] site visit

necessitates including the independent assessment of dystrophin-positive fibers and168-week efficacy data from study 201/202 in the NDA;

6) FDA strongly urged the sponsor to submit the MRI data with appropriate natural history

controls;

7)

And the FDA also stated that [a]dditional discussion between the sponsor and the FDA

will be necessary to determine what would constitute a complete NDA.

Although the FDA did not ask for more patient muscle biopsy data, Sarepta still plans to

conduct a fourth biopsy in Study 202 patients, which management believes to be important

for the advisory committee panel and beneficial for future package insert.

Sareptas plan for NDA

filing receives a major

setback, which will delay

its timeline by at least 6

months.



8/9/2019 SRPT - 1924-349902-1.pdf

17/82

The request from the FDA to re-analyze DPF data is unusual and seems to be driven by its

inspection of the clinical site where dystrophin analyses were conducted. The FDA has

concerns that the method used to quantify DPFs was not robust enough to support an NDA

submission. In previous studies of eteplirsen, DPF data were measured as follows. First,

investigators applied immunohistochemical staining to biopsy tissues. Then tissues wereevaluated by expert muscle pathologists to manually count the number of DPFs, and the

percentage of on-treatment DPFs was calculated. The detection threshold of DPF for each

patient was adjusted such that only revertant fibers were detected in the pre-treatment

biopsy. Revertant fibers are those muscle fibers that become dystrophin-positive. DMD

patients even without treatment might have a low frequency of DPFs because endogenous

alternative splicing or somatic mutations could restore reading frame of the dystrophin gene

in a small number of muscle cells.

This new guidance from the FDA poses a significant hurdle for Sarepta, as its main

competitor Prosensa has already commenced its rolling NDA submission for its exon 51

skipping agent, drisapersen. If drisapersen gets approval under accelerated approval

pathway, it could be launched in 2H15. Sarepta disclosed that under a best case scenario, it

would commercially launch eteplirsen in 1H16.

Sarepta likely to accelerate its clinical programsIn response to the new guidance by the FDA, Sarepta is likely to accelerate the progress on

its confirmatory Phase III trial with an expected enrollment of 120-160 patients, of which half

will be eligible for exon 51 skipping treatment and the other half not. The patients who are

eligible for exon 51 skipping would receive eteplirsen 30 mg/kg weekly. The patients who are

not eligible for exon 51 skipping therapies would serve as natural history controls. Patient

dosing in this trial started in November 2014.

FDAs statement regarding its guidance: A positive signalOn October 30

th, 2014, probably in response to inquiries from DMD patient communities,

FDA released a statement explaining its position regarding Sareptas NDA filing. In thestatement, the FDA considers it has consistently advised Sarepta that data from additional

patients, beyond the patients included in Study 202, would be critical to our assessment of

the safety and efficacy of eteplirsen. The FDA also highlighted that it did not find any

evidence of fraudat the site (The Nationwide Children's Hospital in Ohio) where dystrophin

expression analysis was conducted; on the other hand, it is concerned with the methods

used to measure dystrophin expression. Finally, in the statement, FDA expresses its

willingness to conduct a rolling review of Sareptas NDA and expects the NDA to qualify for

priority review. The FDA plans to present the NDA at a public advisory committee meeting

before making a decision on eteplirsen. We view the statement as a positive signal that the

FDA wants to continue to work with Sarepta and other parties to accelerate DMD drug

development.



8/9/2019 SRPT - 1924-349902-1.pdf

18/82

What is the data on eteplirsen?In the following exhibit, we summarize the main results of four eteplirsen trials, with the

change of dystrophin expression and 6MWT being key endpoints. Although the sizes of those

trials have been small, eteplirsen has shown statistically significant increases in dystrophinexpression and delays in the decline of 6MWT.

Exhibit 11: Eteplirsen has shown good efficacy and safety in small trials

Trial name Study 33 Study 28 Study 201 Study 202

Study designSingle-blinded, placebo-

controlled, dose escalationOpen-label, dose-escalation

Double-blinded, placebo-

controlled

Open-label, extension

of study 201

Development stage Phase I/II Phase I/II Phase II Phase IIb

Number of Patients 7 19 12 12

Patient age at baseline (years) 10-17 6-13 7-13 7-13

Number of arms 2 6 3 2

Doses in the trial (mg/kg/week)0.09 (n=2) and

0.9 mg (n=5)

0.5 (n=4),1 (n=2),

2 (n=2),

4 (n=3),

10 (n=4), and

20 (n=4)

30 (n=4),

50 (n=4), and

placebo (n=4)

30 (n=6) and

50 (n=6)

Treatment duration (weeks) One injection 12 24 Ongoing (>144 weeks)

Treatment difference on 6MWT (m) NA NA 67.3 (week 48) 65.4 (week 168)

p-value NA NA p0.001 p0.017

Treatment improvement on dystrophin

expression over baseline *0.9 mg: 17% 10 and 20 mg/kg: 5.5% 30 mg/kg: 22.9% NA

p-value p=0.002 p=0.04 p0.002 NA

* In Study 33 and 28, the change of dystrophin signal intensity was shown. In Study 201, the change of percentage of dystrophin positive fibers was shown. Source: RBC Capital Markets

Sareptas potential filing strategyWe believe that Sarepta will likely pursue accelerated approval for eteplirsen based on

6MWT as an intermediate clinical endpoint. We argue that there are at least four reasons

why Sarepta would choose this option over the other alternative of regulatory approval

based on dystrophin expression. First, the FDA has repeatedly expressed its concerns over

using dystrophin expression as a surrogate biomarker endpoint due to questions on the

reproducibility of dystrophin data and the previously failed trials of other drugs that intended

to increase dystrophin expression. The concerns of the FDA should motivate Sarepta to

consider a filing strategy not solely dependent on dystrophin expression. Second, the

unknown results of the independent assessment of dystrophin positive fiber data and the 4th

biopsy bring many risks to a filing strategy focusing on dystrophin expression. Third, the

6MWT data at 168 weeks showed a larger than expected decline. Even if the 4th

biopsymanaged to show that the dystrophin expression level is high, it may be difficult to reconcile

the link between positive dystrophin expression data and the continuing decline of 6MWT

results at week 168. On the other hand, the decline at 6MWT can be more easily attributed

to the plateau of eteplirsen benefit and the inevitable disease progression faced by DMD

patients. Fourth, the 6MWT has served as the basis of approval for other drugs, including the

EU conditional approval of ataluren. Similarly, Sareptas competitor Prosensa/BioMarin will

likely seek accelerated approval by also using 6MWT as an intermediate clinical endpoint.

Therefore, 6MWT represents a known regulatory pathway that has been previously

undertaken, and thus weaknesses surrounding the data can be better argued due to its more

extensive history of use for registration purposes.



8/9/2019 SRPT - 1924-349902-1.pdf

19/82

We expect accelerated approval for eteplirsen, but not without any concerns with

the eteplirsen datasetWe believe the safety data surrounding eteplirsen is not a concern, unless a new,

unanticipated signal arises from the newly dosed patients. Although we still have some

reservations about the current eteplirsen dataset, we still believe accelerated approval can

be achieved based on the positive 6MWT data and dystrophin expression as a supportive

biomarker. We believe the pressures invoked by the DMD patient communities on the FDA

will lead to less stringency in the review process. The DMD communities have been anxious

for novel therapies to treat the underlying causes of the disease and have much faith with

Sareptas eteplirsen therapy. The FDA ultimately remains cautious, based on the limited size

of the efficacy data, but may be willing to grant conditional approval due to eteplirsens

relatively benign safety profile. However, we still acknowledge the following issues about

6MWT data and dystrophin expression that need to be adequately addressed with

eteplirsens regulatory submission.

The foremost issue is that patients in the treatment group are now exhibiting a rapid

decline in 6MWT from week 144 to week 168 (see the exhibit below). Considering that thesame group of patients experienced a larger 144-week to 168-week decline (45m) than from

120-week to 144-week (17m), we expect those patients to continue an accelerated rate of

decline in 6MWT, now that they are more than three years into the trial. Natural history

studies suggest that the 6MWT normally declines by 40-60m in a general DMD population.

In a natural history study of DMD, patients with the similar age and 6MWT at baseline as the

patients in the Study 201/202 had a 6MWT decline of 52 meters during the third year of the

study, resulting in 115 meters of difference from baseline. In contrast, patients in the

treatment group of the Study 202 only showed a decline of only 76 meters after more than

three years, suggesting treatment benefits with eteplirsen. The most compelling argument

for eteplirsens efficacy data can be made by highlighting this treatment benefit over a

natural history cohort of a similar age and background. This could potentially suggest

eteplirsens ability to delay the progression of ambulation loss by 1-2 years.

Exhibit 12: Week 168 6MWT demonstrated largest decline thus far in the extension study


The second issue is that two patients enrolled in the study 201/202 had quickly progressed

in their disease.Their 6MWT decline significantly around week 24 and both of them were

non-ambulatory at week 48. Therefore, their 6MWT values were excluded from mITT

(modified Intent-to-treat) analysis, which showed statistical significance. When the intent-to-

treat (ITT) population was considered, which included those two patients, the results were

not significant. Overall, this confirms that exon 51 skipping will not be able to reverse loss of

ambulation in patients, and may only be used to delay the inevitable decline. Moreover, this



8/9/2019 SRPT - 1924-349902-1.pdf

20/82

shows that the selection of patients, based by their baseline function, will play a crucial role

in dictating trial outcomes.

The third issue is that the FDA has concerns over the reproducibility of dystrophin positive

fiber (DPF) data and has asked for independent assessment. Unlike other dystrophinexpression measurements, such as dystrophin signal intensity from immunohistochemistry

and Western blotting results, counting dystrophin positive fibers involves more subjective

judgment based on the individual reviewer. A recent study has successfully shown that

quantitative immunohistochemistry and Western blotting are reliable measurements of

dystrophin expression, and the measurements from different labs are actually comparable.

However, no similar conclusion has been made about DPF measurement. The outcome of

the independent assessment will either lend support or raise serious issues about the

reproducibility of the methodology used thus far by Sareptas trials to assess dystrophin

expression.

The best case scenario for the new DPF reassessment will of course be findings consistent

with Sareptas previous disclosures. However, the worse scenarios include the inconsistent

findings amongst the three independent reviewers (suggesting lack of reliability with the

methodology in scoring DPFs as a measurement for dystrophin expression) or consistent

findings amongst the three independent reviewers that are, however, inconsistent with

Sareptas previous analysis.Besides DPF data, as we show in the following exhibit, Sarepta

also has multiple measurements, such as RT-PCR, western blot, and immunofluorescence, to

support the increase of dystrophin expression after eteplirsen treatment. Therefore, we do

not expect the FDA-requested independent assessment of DPF data to completely negate

previous conclusions made by eteplirsen trial investigators.

Exhibit 13: Eteplirsen treatment effects measured by other approaches


A fourth issue is the unknown outcome of the 4th

biopsy around week 168. With the 3rd

biopsy performed at week 48, more than 2 years have passed since that last measurement.

Although the 6MWT of the boys seem to have stabilized for the most part, the 45m decline

of 6MWT in a period of 24 weeks at week 168 was the largest seen in the long-term

extension, and was much larger than the 17m decline in the previous 24 weeks. This suggests

that some boys in the treatment group are experiencing deteriorating conditions and couldlose walking ability quickly. Management has indicated that the biopsy will only be

performed in up to 8 boys in the extension trial, due to scheduling and consent issues.

Therefore, it is unclear if the boys who had the largest 6MWT decline will have the 4th

biopsy.

However, based on the 6MWT data at week 168, it would be reasonable to expect that the

dystrophin expression level from the 4th

biopsy to be lower in comparison with that from the

3rd biopsy. Therefore, we expect little positive surprise arising from the biopsy data.

Fifth, all biopsy samples in eteplirsen trials were taken from upper arms, versus a decision

to extract from other locations, such as the legs. We believe this protocol created both

advantages and disadvantages. One of the advantages is eteplirsens treatment effect on



8/9/2019 SRPT - 1924-349902-1.pdf

21/82

upper arms could be potentially included in its label, and support its adoption by non-

ambulatory patients. In addition, biopsies at upper arms would not introduce leg injuries that

may affect patients 6MWT performance. A disadvantage is the less clear connection

between dystrophin expression in the upper limbs (as seen with the arm biopsies) and leg

muscle function that is needed for 6MWT. In DMD patients, the functions of leg musclesdeteriorate faster than those of muscles in the upper limbs, hence the loss of ambulation

preceding loss of upper limb function. Management suggests that animal studies showed

consistent dystrophin expression across different muscle groups after eteplirsen treatment.

We acknowledge that positive induction of dystrophin expression may occur with systematic

administration of eteplirsen, but that does not guarantee that dystrophin expression would

be restored in the lower limbs, where significant muscle loss may have already occurred.

Therefore, the significant increase of dystrophin expression in upper limb muscles might not

be directly translated to a similar increase in leg muscles, or may even be less significant as

would have been demonstrated by leg muscles.

Finally, there is some inconsistency of dystrophin expression at 12 weeks, as measured in

Study 201 vs. previous eteplirsen study.In a previous dose-finding study of eteplirsen (Study

28), after 12 weeks of treatment, 8 patients in 10 and 20 mg/kg groups saw increases in

dystrophin expression based on dystrophin positive fiber (DPF) measurement. Four patients

in 10 mg/kg group and 20 mg/kg group have an average of 7% and 15.3% of DPF increase

from baseline, respectively. However, in study 201, after 12 weeks of treatment, four

patients in the 50 mg/kg groups had an average of only 0.8% of DPF increase from baseline

based on the same measurement. The discrepancy in the DPF outcomes of the DPF

measurement lends some concern as either to the consistency of the treatment effect of

eteplirsen on DPF or the reliability of DPF measurements. We note that patient

characteristics such as age and 6MWT at baseline are comparable in two studies.



8/9/2019 SRPT - 1924-349902-1.pdf

22/82

Prosensas Drisapersen vs. Sareptas EteplirsenBoth Prosensa (recently acquired by BioMarin) and Sarepta are developing exon 51 skipping

antisense oligonucleotides (AONs) for the treatment of DMD patients. Because of a similar

mechanism of action, the two drugs (drisapersen and eteplirsen) target the samesubpopulation of DMD patients who have dystrophin mutations that are amenable to exon

51 skipping. The head-to-head comparison between the two drugs is detailed in the

following section.

Exhibit 14: Comparison between Sareptas eteplirsen and Prosensas drisapersen

Drug Eteplirsen Drisapersen

Company Sarepta Prosensa/BioMarin

Drug target

MOA

Sequence length 30 bp 20 bp

Backbone chemistryPhosphorodiamidate morpholino

oligo (PMO)

2'-O-methyl phosphorothioate

(2'OMePS)

Electric charge Neutral Negative

Serum protein binding No Yes

Off-target interactions Fewer in theory Could interact with other proteins

Transport Limited nuclear uptakeBetter nuclear uptake but harder to

cross cell membrane

Mode of administration IV SC

Half-life in humans 1.6-3.6 hrs ~29 days

Dose 30 mg/kg/week 6 mg/kg/week

Development stagePhase III

(enrollment started 4Q14)

Phase III

(completed in 2013)

Number of (expected) patients in

Phase III trial120-160 186

Number of patients dosed with the

drug~40 >300

IPOwns US patents for

exon 51 and 53

Owns EU patent for exon 51 and US

patents application for exon 51 and 53

IP dispute: EU

IP dispute: US

FDA desgination Orphan drugBreakthrough therapy

Orphan drug

Potential FDA approval pathPotential pathway for accelerated

approval

FilingRegular submission

to FDA by mid-2015

Rolling submission

to FDA in 1Q15

6MWT as an intermediate clinical outcome

Accelerated approval

Exon 51 of human dystrophin gene

Binding to exon splicing enhancer on exon 51

to induce exon skipping

SRPT appealing for exon 51 patent (owned by RNA)

Patent interference proceeding for exon 51 and 53

(SRPT is junior party)




8/9/2019 SRPT - 1924-349902-1.pdf

23/82

AON structure: As we mentioned before, both eteplirsen and drisapersen are AONs targeting

exon 51 for skipping. Eteplirsen is a 30-mer (CTCCAACATCAAGGAAGATGGCATTTCTAG) DNA-

analog, whereas drisapersen is a 20-mer (UCAAGGAAGAUGGCAUUUCU) RNA-analog.

Position 9 to 28 of the eteplirsen sequence is also present in the drisapersen sequence, thus

both therapies likely target the exact same region of exon 51.

AON chemistry: Eteplirsen and drisapersen are composed of different chemical backbones.

Eteplirsen is a PMO whereas drisapersen is based on a 2OMePS structure. The main

difference between PMO and 2OMePS is that PMOs do not carry charges and 2OMePS are

negatively charged. One implication of different backbones are concerns that the

phosphorothioate (PS) backbone modification present in 2OMePS, such as Prosensas

drisapersen, may be involved in unspecific protein binding and off-target effects on the

apoptosis pathway, thus lending concerns to long-term toxicity.

Being charge neutral, PMOs have their own pros and cons. On one hand, PMOs may have

fewer off-target interactions with proteins in the body that could lead to immune

stimulation. For example, a preclinical study in monkeys showed that PMOs did not activate

toll-like receptors, the nuclear factor (NF)-B-mediated inflammatory response, or the

interferon system. On the other hand, neutrally charged PMOs have shown difficulty in

transport in established cell culture. However, they showed higher tissue concentrations in

primary cell culture, which might be due to the lack of nonspecific interactions with cellular

components. In one study conducted in the mdxmouse model, PMOs were more efficient in

inducing mouse exon 23 skipping than 2OMePS. However, in another study in the hDMD

mouse model (carrying human dystrophin exons) where AONs were given through

intramuscular injection, PMOs showed significantly better efficiency than 2OMePS for exon

46 skipping only. For AONs targeting exons 44, 45, and 51, PMOs showed better efficiency

but the differences were not statistically significant. Therefore, it is still unclear whether

PMO-based eteplirsen would have better exon skipping efficacy compared to 2OMePS -

based drisapersen.

In addition, PMO-based therapeutic drugs come with significant downsides of higher costs

and more complex manufacturing due to the relatively new chemistry of PMOs. Sarepta

management indicates that COGS could be as high as 20% of sales for eteplirsen. So far,

Sarepta can only make mid-scale batches of eteplirsen and its current contracts with third

parties cannot provide sufficient drugs for multiple large clinical trials. In contrast, BioMarin

management indicates that COGS of drisapersen would be around 10% of sales and there is

no manufacturing capacity constraint for drisapersen.

Drug administration: In clinical trials, eteplirsen was administered via IV over 1h at 30 or 50

mg/kg/week. In its Phase III trial, drisapersen was given through SC at 6 mg/kg/week. High

doses of eteplirsen might result in better efficacy but its IV route is more time consuming

and costly compared to SC route of drisapersen. Drisapersen has demonstrated a longer half-

life of ~29 days, versus 1.6-3.6 hours seen with eteplirsen.

Efficacy on dystrophin expression: In the following exhibit, we compare the effect of

eteplirsen and drisapersen on dystrophin expression in their dose escalation studies. Both

studies were small with only three to four patients enrolled in each dose group. We also note

that the treatment duration is different in two studies: 12 weeks for eteplirsen and 5 weeks

for drisapersen. In addition, in the eteplirsen study, biopsy samples were taken from upper

arms while samples were taken from lower legs in the drisapersen study. In terms of the

percent of dystrophin positive fibers (DPF), drisapersen seems to achieve much higher post-

treatment DPF percentage compared to eteplirsen. In one patient treated by drisapersen,

the percent of DPF even reached 100%. However, its dystrophin signal intensity was lower



8/9/2019 SRPT - 1924-349902-1.pdf

24/82

than that of eteplirsen. The discrepancy between two measurements of drisapersen put a

question mark on the reliability of measurement. In addition, no baseline DPF was measured

in the drisapersen study, which makes it more difficult to choose an appropriate threshold to

determine if a fiber is dystrophin positive or negative.

Exhibit 15: Comparison of change of dystrophin expression in dose escalation studies

Trial name

Treatment

Development stage

Dose 10 mg/kg 20 mg/kg 4 mg/kg 6 mg/kg

# of patients 4 4 3 3

Age range at baseline 6-12 7-10 5-11 9-11

Treatment duration (wks) 12 12 5 5

Biopsy muscle

% DPF at baseline 1.5% 3.5% NA NA

% DPF after treatment 8.5% 18.8% 73.7% 56.7%

7.0% 15.3% NA NA

Mean dystrophin signal intensity at baseline (% of control) 9.8% 9.8% NA NA

Mean dystrophin signal intensity after treatment (% of control) 16.8% 13.8% 5.8% 7.5%

7.0% 5.0% NA NA

# of patients (%) whose dystrophin confirmed by RNA and IF 3 (75%) 3 (75%) 2 (67%) 3 (100%)

DPF: dystrophin positive fiber, IF: immunofluorescence

Biceps brachii muscle Tibial is anterior muscle (leg)

Study 28 CLIN-02

Eteplirsen Drisapersen

Phase II Phase I/IIa


In the Phase II studies of eteplirsen (Study 201) and drisapersen (DEMAND II), dystrophin

expression was measured by DPF percentage and signal intensity, respectively. At 24 weeks,

all four patients receiving 30 mg/kg/week eteplirsen had an increase of DPF percentagecompared to baseline. Nine of 15 patients receiving 6 mg/kg/week drisapersen showed an

increase of dystrophin expression by comparing dystrophin signal intensity of pre-treatment

and post-treatment. We show these results in the following exhibit. However, the FDA has

requested an independent assessment of DPF results in Study 201 of eteplirsen. It remains to

be seen how the new assessment would correspond to previously reported values.



8/9/2019 SRPT - 1924-349902-1.pdf

25/82

Exhibit 16: Comparison of dystrophin expression in Phase II studies

Trial Name DEMAND II

Treatment Drisapersen

Development stage Phase II

Dose 30 mg/kg 50 mg/kg 6 mg/kg

# of patients 4 4 18

Mean age at baseline 9.3 8.5 7.2

Treatment duration (wks) 48 48 48

Biopsy muscleTibialis anterior

muscle (leg)

# of patients (%) with increased

dystrophin at week 244 (100%)

NA 9 (60%)*

Based on DPF; *Based on signal intensity with 15 patients assessed

Eteplirsen

Phase II

Biceps muscle (1st and 2nd biopsy), left

deltoid (3rd biopsy)

Study 201


Efficacy on 6MWT: So far, eteplirsen has been tested in approximately 40 patients in four

clinical trials. Backed by GSK from 2009 to 2014, drisapersen was tested in a much larger

DMD patient population (more than 300 patients) across seven trials, including one Phase III

study. The disadvantage of eteplirsen is its small tested patient population. However, all of

its trials have yielded satisfactory results so far. At week 168 of the ongoing Phase II

eteplirsen extension trial (Study 202, mITT=10, modified intention-to-treat population),

patients in the eteplirsen group demonstrated significant improvement of 65m (p0.017) in

the 6-minute walk test (6MWT) over patients in the placebo/delayed group.

For drisapersen, its failed Phase III trial has continued to dampen complete optimism for

future approval. In that Phase III trial (n=186), the difference in 6MWT between thedrisapersen and placebo groups was 10.3m and not statistically significant (p=0.415).

Although a pre-specified analysis revealed that the difference doubled to 21m when patients

7 years old were considered, final results in that subgroup were still not significant

(p=0.131). Nevertheless, drisapersen does show quite positive results in a few Phase II trials.

For example, in DEMAND II and DEMAND V, 6 mg/kg drisapersen exhibited improvements in

6MWT at week 24 over placebo with p-value equal to 0.014 and 0.051, respectively. We

summarize the clinical results of eteplirsen and drisapersen in short-term and long-term

studies in the following two tables, respectively.



8/9/2019 SRPT - 1924-349902-1.pdf

26/82

Exhibit 17: Summary of clinical data of eteplirsen and drisapersen in short-term studies

Sarepta's eteplirsenTrial name Study 201 DEMAND II DEMAND V DEMAND III

Study designDouble-blind, placebo-

controlled

Double-blind,

placebo-controlled

Double-blind,

placebo-controlled

Double-blind,

placebo-controlled

Stage Phase II Phase II Phase II Phase III

Number of Patients 12 53 51 186

Mean age at baseline (years) 8.8 7.3 7.8 8.2

Number of arms 3 3 3 2

Doses in the trial

30 mg/kg (n=4),

50 mg/kg (n=4),

placebo (n=4)

6 mg/kg cont. (n=18),

intermittent* (n=17),

placebo (n=18)

3 mg/kg (n=17),

6 mg/kg (n=18),

placebo (n=16)

6 mg/kg (n=125),

placebo (n=61)

Treatment duration (weeks) 24 48 weeks 24 weeks 48 weeks

on mean 6MWT vs. placeboat week 24 (m)

25.5 (50 mg/kg) 35.1 27.1 NA

p-value Not significant p=0.014 p=0.051 NA

on mean 6MWT vs. placebo

at week 48 (m)87.4 (50 mg/kg) 35.8 27.9 10.3

p-value p0.001 p=0.051 p=0.177 p=0.415

*patients received 6 mg/kg drisapersen, either continuously or intermittently

Prosensa/BioMarin's drisapersen


In addition, we compared the long-term studies of eteplirsen and drisapersen in the

following table. Study 202 is the extension trial of eteplirsens Study 201 in 12 ambulant

DMD boys.



8/9/2019 SRPT - 1924-349902-1.pdf

27/82

Exhibit 18: Summary of clinical data of eteplirsen and drisapersen in long-term studies

Drug Sarepta's eteplirsen

Trial name Study 202 CLIN-02 extension DEMAND IV

Study designOpen-label, Phase II

extension

Open label, Phase I/II

extension

Open-label, Phase

II/III extension

Number of patients in the treatment group8 (6 ambulant,

2 non-amubulant)

10 (8 ambulant,

2 non-ambulant)69

Number of patients in the placebo/delayed

group4 0 44

Total number of patients 12 10 113

Mean patient age at baseline (yrs) 9.2 9.5 8.8

6MWT at baseline (m) 382 385 363

Doses in the trial30 mg/kg (n=6)

50 mg/kg (n=6)6 mg/kg 6 mg/kg

Treatment duration (weeks) > 168 177 48

6MWT (m), from baseline for treatment

group-76.7 (168 weeks) +33 (177 weeks) -66.8 (96 weeks)

6MWT (m), treatment group vs.

placebo/delayed+65.4 (168 weeks) NA +46 (96 weeks)

p-value p0.017 NA NA

Prosensa/BioMarin's Drisapersen


Eteplirsens Study 201/202 and the extension phase of drisapersens CLIN-02 are comparable

to each other in terms of treatment period and study size. Based on these factors, BioMarin

management compared the two studies 6MWT change from baseline (shown below). In the

following two exhibits, 6MWT in the Study 201/201 until 144 weeks is compared against the

6MWT of all 10 patients and 8 ambulatory patients, respectively, treated in the extension

phase of CLIN-02. Although it seems that drisapersen favors comparably in delaying the

decline in 6MWT versus eteplirsen in the Study 201/202, we note that there are many

differences between the two studies. Sarepta in its response highlighted that Study 201 was

a randomized, placebo-controlled study while the extension of CLIN-02 is an open-label

study.



8/9/2019 SRPT - 1924-349902-1.pdf

28/82

Exhibit 19: Comparison of treatment effect of eteplirsen and drisapersen (including the 2

patients who lost ambulation during the trial) in long-term studies

Source: BioMarin presentation

Considering that the average age of patients at the end of the extension phase of CLIN-02

was more than 12 years old, the increase of average 6MWT by 33 meters at week 177 versus

baseline in the 8 ambulatory patients (see below) is a surprising result. If this can be

confirmed by another long-term study, it would suggest drisapersen ahead of eteplirsen in

regards to efficacy. We do note the caveats of comparing small studies against other small

studies.

Exhibit 20: Comparison of treatment effect of eteplirsen and drisapersen (excluding the 2

patients who lost ambulation during the trial) in long-term studies

Source: BioMarin presentation



8/9/2019 SRPT - 1924-349902-1.pdf

29/82

Safety: In the long-term eteplirsen extension study, no treatment-emergent serious AEs have

been reported. Procedural pain (75%) and proteinuria (62%) were the most frequent AEs at

week 168. Since the extension study is open-label, there is no safety data for the placebo

group. In the Phase II and Phase III trials of drisapersen, patients in the drisapersen group

experienced injection site reactions (72%-78% across Phase II and III trials) and renalabnormalities (64% in Phase III trial, including proteinuria and red blood cells in urine) at a

rate almost twice of the patients in the placebo group. Moderate to severe

thrombocytopenia have been reported in drisapersen trials as well. Considering the Phase III

trial of drisapersen was for 48 weeks, we believe that the percentage of patients

experiencing adverse events could go even higher in a long-term study of drisapersen.

Investigators also kept a close watch of the uptake of drisapersen by the proximal tubules in

the kidney. However, since PMOs are a relatively new class of agents compared to 2OMePS,

limited preclinical and clinical safety data have been accumulated about PMOs.

IP: Sarepta and Prosensa have been in a number of patent disputes (see the section IP

dispute between Sarepta and Prosensa for more details). Currently, we believe Prosensa has

the advantage, especially in the EU where it holds an EU patent protecting its exon 51

skipping technology, which could potentially block eteplirsens sales in the EU unless Sarepta

can work out a patent licensing deal. In the US, Sarepta is in three patent interference

proceedings with Prosensa. In all proceedings, Prosensa is the senior party and Sarepta is the

junior party that bears the responsibility to prove its invention was conceived earlier.

Regulatory path: Prosensa currently holds an advantage with regard to its path to regulatory

approval. It has initiated rolling submission to the FDA with plans to finish submission in

1Q15. It plans to use 6MWT data as a clinical outcome for filing purposes. Sarepta originally

also planned to finish submitting for regulatory approval by YE14. However, correspondence

with the FDA determined that the agency would require more data from Sarepta as part of

its accelerated approval program. These include 3-month safety data from 12-24 new

patients dosed with eteplirsen. The addition of these requirements have pushed back

Sareptas timeline, and it now expects completion of regulatory filing by mid-2015, givingProsensa perhaps an advantage to market access and penetration. In the EU,

Prosensa/BioMarin plans to file the MAA for drisapersen with the EMA in 2Q15. In a

December 2014 meeting, EMA provided preliminary guidance to Sarepta that additional data

would be needed for conditional approval of eteplirsen.

Exhibit 21: Another glance at eteplirsen vs. Drisapersen

Eteplirsen Drisapersen

Support from patient

advocacy groups++ +

Safety ++ +

Proof of efficacy No Phase III dataMore patients tested, but

failed Phase III

Commercial support ++

Strength of IP ++




8/9/2019 SRPT - 1924-349902-1.pdf

30/82

A review of eteplirsens development program

1) Study 33: Phase I/II trial of eteplirsen in 7 non-ambulantDMD patients

Trial started: October 2007 Top-line data released: January 21, 2009

Article published in Lancet Neurol. in 2009

DMD literature suggests dystrophin-positive revertant fibers to occur sporadically in up to

50% of DMD patients. These fibers arise from the endogenous alternative processing of DMD

pre-mRNA that skips some exons and leads to restoration of the open reading frame. This

endogenous phenomenon underlies the rationale for treating DMD patients with exon-

skipping therapies: to induce pharmacologically what happens spontaneously in some

patients.

Following the promising results from the two preclinical studies, eteplirsen entered its first

clinical trial in DMD patients in the UK in late 2007. The purpose of the study besides safety

was to assess the restoration of dystrophin expression in a muscle injected with eteplirsen.

Study Design: This was a single-blind, placebo-controlled, dose-escalation study in 7 non-

ambulant DMD patients. Two patients received 0.09 mg eteplirsen in 900 L saline and five

patients received 0.9 mg eteplirsen in 900 L saline. Each treatment was injected into the

contralateral extensor digitorum brevis (EDB) muscle at the back of the foot. The

contralateral EDB muscle was injected with 900 Lnormal saline. Between 3 and 4 weeks

after injection, an open biopsy of both EDB was performed in all patients. Standard-of-care

treatment, including glucocorticoids and cardioprotective drugs, was maintained in all

patients.

Patient Population: Patients were aged between 10 and 17 years (inclusive) and were not

ambulant. All of them had eligible deletions that can be rescued by skipping exon 51, fewer

than 5% revertant (dystrophin-positive) fibers, FVC (forced vital capacity) 25%, and

sufficiently preserved EDB muscle.

Primary Endpoint: The primary endpoint was safety.

Secondary Endpoints: Secondary endpoints included efficacy of induced exon 51 skipping in

the treated EDB muscle and restoration of dystrophin expression, as assayed by

immunohistochemistry and western blot.

Dystrophin Expression: The hig

srpt - 1924-349902-1.pdf

Documents