University of Geneva
Master’s in Proteomics and Bioinformatics
2009
Analysis of c-Src kinase mutants for understanding conformational plasticity
Emilio E. Espínola
Master’s thesis director: Prof. Leonardo Scapozza, Ralitza Boubeva
LCT – Biochimie Pharmaceutique, Section des Sciences Pharmaceutiques
2
Table of contents
Abstract............................................................................................................................. 3
Introduction ...................................................................................................................... 4
Protein tyrosine kinases ............................................................................................... 4
Discovery and oncogenicity of c-Src ............................................................................ 6
Structural domains of c-Src.......................................................................................... 6
Conformational plasticity ............................................................................................. 8
Aim of the work........................................................................................................... 10
Materials and Methods ................................................................................................... 11
Plasmid ....................................................................................................................... 11
Design of mutations .................................................................................................... 11
Site directed mutagenesis ........................................................................................... 13
Transformation of Escherichia coli competent cells .................................................. 14
DNA sequencing and analysis .................................................................................... 14
Co-transformation in Escherichia coli BL21DE3 strain............................................ 15
Protein expression ......................................................................................................15
Protein purification .................................................................................................... 15
Verification of absence of post-translational modifications ...................................... 17
Western blot................................................................................................................ 17
Kinase assay and inhibition of protein activity by imatinib ....................................... 18
Results ............................................................................................................................ 20
Discussion....................................................................................................................... 29
Concluding remarks........................................................................................................ 33
References ...................................................................................................................... 34
3
Abstract
Protein tyrosine kinases are enzymes that play critical roles in eukaryotic cells. They are
involved in the regulation of intracellular signal-transduction pathways that mediates
development and intracellular communication. They all catalyze the same reaction, the
transfer of γ-phosphate from ATP to a protein substrate. These enzymes can adopt two
extreme conformations: an inactive state, which has no enzymatic activity, and an active
state, which shows maximal activity. The structure of the inactive state is more
divergent than the active state. The aim of this work was to identify important amino
acids involved in the switch between the active and inactive conformations of c-Src.
Our strategy consisted in mutating some amino acids located at a hydrophobic interface
of c-Src kinase domain, and assessing how these mutations influence the binding of
imatinib, a drug developed to target the inactive conformation of c-Abl, a related
tyrosine kinase. Seven c-Src mutant proteins were expressed, purified, and analyzed.
We found that: 1) three out of five mutants (i.e. G318, L317I-V377L, and G318-
V378L) showed an increase in relative affinity towards imatinib at the micromolar
range, compared to the wild type; and 2) the c-Src mutants L322I and L317I-L322I
showed similar affinity values with respect to the wild type, showing that L322I can
reverts completely the influence of L317I, which is a reported c-Src mutant that
increases the affinity of imatinib to the nanomolar range. The identification of amino
acids that govern the kinase plasticity is an important step toward the understanding of
inhibitor specificity.
4
Introduction
Protein tyrosine kinases
Protein tyrosine kinases (PTKs) are enzymes that play critical roles in eukaryotic cells.
They are involved in the regulation of intracellular signal-transduction pathways that
mediate development, immune system function, and intracellular communication [1].
These functions are achieved by phosphorylation of tyrosine residues of specific protein
substrates, using adenosine triphosphate (ATP) as phosphate donor [2]. In normal cells,
the activity of PTKs is tightly regulated. In some cases, however, their deregulation
results in uncontrolled phosphorylation activity. The consequences of the deregulation
of PTKs can be disordered cell growth, cell division, and apoptosis, which ultimately
can lead to cancer [3]. Therefore, PTKs are important candidates for the development of
new drugs [4].
Protein tyrosine kinases can be divided in two main groups, according to their
localization within the cell: the receptor tyrosine kinases (RTKs), and the non-receptor
tyrosine kinases (NRTKs) [1]. To date, there are 90 tyrosine kinases described for the
human genome. From these, 58 are RTKs which show a transmembrane domain, and 32
are NRTKs which are “free” within the cell [5]. The receptor and non-receptor tyrosine
kinases are further classified into 20 and 10 families, respectively, according to the
sequence similarity of the kinase domain.
Receptor tyrosine kinases are transmembrane proteins usually found as monomers,
which are structurally divided in: 1) an extracellular region carrying one or more ligand
binding domains; 2) a transmembrane helix, that cross the plasma membrane; and 3) an
intracellular region that posses tyrosine kinase activity (Figure 1 on next page). Upon
ligand binding at the extracellular region, a dimerization occurs, which triggers the
autophosphorylation of the kinase domain and allows the binding of other proteins
carrying phosphotyrosine binding domains.
Non-receptor tyrosine kinases are found in the cytoplasm and nucleus of cells, and some
of them can bind to cell membranes via an N-terminal lipid [6]. In general, they contain:
1) two regulatory domains, named SH2 and SH3; and 2) a tyrosine kinase domain,
which is also named SH1 (Figure 2 on next page). Among the 10 described NRTK
families, the first characterized and most studied was the Src family [6]. There are nine
5
members of Src family, which are expressed in different tissues (Src, Yes, Fgr, Yrk, and
Fyn) or only in hematopoietic cells (Lyn, Hck, Lck, and Blk,) [7].
Figure 1. Example of RTKs. The extracellular region is shown at the top, and the intracellular region at
the bottom. The picture was obtained from Hubbard et al. [1].
Figure 2. Examples of NRTKs, showing different domain structures for the 10 families. On the right,
some members of each family are cited. The picture was obtained from Blume-Jensen and Hunter [3].
6
Discovery and oncogenicity of c-Src
In 1911, Peyton Rous discovered a new virus as a cause of an avian cancer called
sarcoma [8]. This virus, called Rous sarcoma virus (RSV) in honor to its discoverer,
was the first oncovirus to be described. The RSV is a member of the Retroviridae
family, and has a genome composed by a single strand RNA that codifies four genes. In
1970, the gene responsible for the transforming properties of RSV was found. It was
called v-src (or viral-src) [9, 10], and was the first oncogene to be described [11]. In
1976, Bishop and Varmus discovered that a homologous gene to v-src was present in
the genomic DNA of chicken cells and this cellular precursor or proto-oncogene was
called c-src (or cellular-src) [12]. The idea that we all have proto-oncogenes that can
lead (if altered) to human cancers was a great discovery [11].
c-Src is ubiquitously expressed in tissues and is highly conserved through evolution. It
is an enzyme that interacts with numerous substrates involved in the regulation of the
three main cellular functions such as adhesion, invasion and motility [13]. Therefore,
alterations in c-Src activity might also contribute to tumor progression and metastasis.
c-Src is the member of Src kinase family the most often implicated in cancer growth.
The oncogenic effect of c-Src has an impact on several cell signaling pathways and
results in the increase of motility and invasiveness of cancer cells [7]. As an example of
its function, c-Src promotes the loss of cell-cell adhesion by disrupting the adherens
junctions. Adherens junctions are protein complexes composed of cadherins and
catenins that occur at junctions in epithelial tissues. The activation of c-Src affects both
protein families that build up the adherens junctions. It stimulates the E-cadherin
inhibition on adjacent cells through ubiquitylation, and phosphorylates β-cathenin
which prevents its binding to E-cadherin [13].
Structural domains of c-Src
All the members of Src kinase family share a common structure. In order from the N- to
C-terminus, they contain: 1) a short membrane anchor or SH4 domain; 2) a poorly-
conserved “unique” region; 3) an SH3 domain of 50 residues, which can bind to specific
proline-rich sequences; 4) an SH2 domain of 100 residues, which can bind to specific
sites of tyrosine phosphorylation; 5) a catalytic (tyrosine kinase) domain of 250
residues, also named SH1 domain; and 6) a short C-terminal tail containing a conserved
tyrosine residue (Tyr527) [14, 6] (Figure 3 on next page).
7
(a) (b)
Figure 3. (a) Representation of the primary amino acid sequence of c-Src. The numeration of amino acids
can change with other members of the Src family. (b) Three dimensional structure of c-Src, obtained from
Xu et al. [15].
The N-terminal membrane anchor or SH4 domain is myristylated in order to be attached
to the membrane. The “unique” region has no particular similarity to other Src family
members, and appears to be important for mediating interactions with receptors or
proteins which are specific to each member [14].
The SH2 and SH3 domains are highly conserved. They are required for the regulation of
the kinase activity, and mediate protein-protein interactions in cellular signaling
cascades. Both domains are connected to the kinase domain by a linker of about 14
amino acids. Interestingly, SH2 and SH3 domains are found also in many proteins
outside the Src family [16].
The kinase domain is divided in two lobes: a small N-terminal lobe, and a large C-
terminal lobe. They are connected by a flexible “hinge” region. The structural
determinants of the N-terminal lobe are: 1) a five stranded antiparallel β-sheet; 2) a
nucleotide binding loop (P-loop or G-rich loop), where the phosphotransfer reaction
takes place through a conserved glycine rich sequence that allows the interaction with
the γ-phosphate of an ATP molecule; and 3) one α-helix (αC helix) [14]. The C-terminal
lobe is mostly α-helical, and includes: 1) the catalytic loop; and 2) the activation loop,
or A-loop. The A-loop is an important segment in the kinase domain, which can
interferes with the binding of either ATP or substrate or both. The regulatory tyrosine
residue located on the A-loop (Tyr416 in chicken Src, or Try419 in human Src) is
important for the stabilization of its conformation. Upstream of the A-loop is located the
highly conserved DFG motif (Aspartate-Phenylalanine-Glycine) [17].
8
Conformational plasticity
As member of the PTK family, c-Src adopts at least two extreme conformations: an
“on” state that is maximally active, and an “off” state that has no enzymatic activity
(Figure 4). PTKs catalyze the same reaction: the transfer of the γ-phosphate of ATP to
the hydroxyl group of tyrosine. Thus, upon activation c-Src adopts a catalytically active
“on” conformation that is structurally similar to the active state through all tyrosine
kinases. The inactive “off” state, however, is not subject to the chemical constraints that
the active state must satisfy, and so we have distinct inactive conformations for PTKs in
general [18].
Figure 4. Representation of the two extreme conformations that c-Src adopts, detailing the arrangements
of the activation loop (showed with arrows) and the helix αC (in purple). The picture was obtained from
Yaffe [2]. On the right, a summary of the main structural arrangements between the active and inactive
conformations that determine the kinase plasticity.
The transition between the active and inactive states in c-Src is highly regulated at the
intramolecular level, and implies the precise arrangements of several catalytic residues
and domains [18]. To achieve the active state, the following is necessary: 1) the
dephosphorylation of Tyr527 at the C-terminal “tail” [19], with the release of the SH2
domain that was bound to the phosphorylated Tyr527; 2) the autophosphorylation of
Tyr416 on the activation loop, which stabilizes it in an “open” conformation and
facilitates the substrate binding [19]; 3) the orientation of helix αC towards the active
site; this helix contains a conserved Glutamate residue (Glu310) which forms a salt
bridge with another conserved Lysine (Lys295). This salt bridge serves to position the
Lys295 side chain in order to coordinate the α- and β-phosphate of ATP molecule; 4)
the correct position of the DFG motif (which is situated at the beginning of the
Structural element Inactive Active
DFG motif out in
Glu310 out in
A-loop closed openP-loop closed open
9
activation loop), specially the position of the Aspartate towards the active site in order
to coordinate the interaction between a Magnesium cation and the phosphate groups of
ATP; at the same time, the Phenylalanine should point out of the active site; and 5) the
positioning of the P-loop in an open conformation, which facilitates the ATP binding
[18].
In the inactive state, the Tyr416 is not phosphorylated and Tyr527 is phosphorylated by
a specific c-Src kinase (Csk). This phosphorylation inhibits c-Src activity by engaging
SH2 in an intramolecular interaction with the phosphotyrosine, and at the same time
inducing an interaction between the SH3 domain and the SH3-kinase linker [2] (Figure
4). The inactive conformation differs also from the active conformation by the
orientation of the helix αC, which is displaced following the interaction between the
SH3 domain and the SH3-kinase linker. This displacement moves out the Glu310,
breaking the salt bridge between G310 and Lys295 and inhibiting the ATP binding [19].
The phosphotransfer to protein substrates is also inhibited by the closed conformation of
the P-loop and the “out” conformation of the DFG motif. Strikingly, c-Src adopts an
inactive conformation similar to the one of Cdk, a serine/threonine kinase but differs
from the one of related tyrosine kinases like c-Kit or Abl [20]. In summary, a wealth of
information is available about the structure and function of c-Src. Nevertheless, one
issue remains to be solved: it is still unknown whether there are amino acids dictating
the transition between the active and inactive states at the kinase domain.
10
Aim of the work
The aim of this work was to identify important amino acids involved in the switch
between the active and inactive conformations of c-Src. Four observations have guided
our study:
1) There is more difference in structure of tyrosine kinases in their inactive state.
2) A new drug called imatinib (Gleevec®, Novartis) was developed to target
specifically the inactive conformation of the fusion protein BCR-Abl, c-Abl, c-Kit, and
the platelet-derived growth factor receptor (PDGFR) with high affinity.
3) There is a resistance of c-Src toward imatinib, even though: a) the residues
interacting with imatinib in c-Abl and c-Kit are conserved in c-Src; and b) the crystal
structure of c-Src in complex with imatinib closely resembles the one of Abl-imatinb,
but differs significantly from the inactive apo-form of Src family kinases [21].
4) Amino acids located at a hydrophobic interface between the N- and C-lobes (H1 for
the hydrophobic region at N-lobe, and H2 for the one at C-lobe) were described as
having a concerted movement between the active and inactive conformations (more
than the rest of the protein), indicating a possible role in the transition between both
states [22].
Our strategy to achieve the aim consisted in using mutagenesis to mutate some amino
acids located at the H1-H2 hydrophobic interface of c-Src, and to assess their
importance in conformational plasticity via the evaluation of the affinity of the mutants
towards imatinib.
11
Materials and Methods
Plasmid
The plasmid pET-28a(+) containing the chicken c-Src kinase domain was used (a gift
from Markus Seeliger, University of California [23]). It was constructed using the NdeI
and XhoI restriction sites, and subcloned into a pET-28a(+) vector (Novagen) in order
to have the kinase domain (amino acids 251 to 533), according to the sequence of the
complete c-src gene from Gallus gallus (GenBank accession number V00402). The
pET-28a(+) vector carries an N-terminal hexahistidine tag, and was further modified to
carry the amino acid sequence ENLYFQG, that can be cleaved by the tobacco etch virus
(TEV) protease between the amino acids Q and G.
Design of mutations
The mutations were designed in order to swap some amino acids of c-Src located at the
hydrophobic interface between the N- and C-lobes to the corresponding amino acids in
c-Abl, c-Kit, or PDGFR. Briefly, the amino acid sequences of chicken c-Src, human c-
Abl, human c-Kit, human PDGFR, and human INSR were retrieved from UniProtKB
database, release 14.8 [24], under the following accession numbers: P00523, P00519,
P10721, P09619, and P06213. A multiple sequence alignment was carried out using
CLUSTAL W [25]. Then, the fourteen amino acids located at the hydrophobic interface
of INSR were identified in the remaining kinases, and the numbering was changed to
the one of chicken c-Src (Figure 5 on next page). The seven mutations designed for this
study were as follow: 1) an insertion of Glycine at position 318 (i.e. mutant G318),
which was based on the Glycine observed in the sequence of c-Kit and PDGFR; 2) the
mutation L322I, which was based on an Isoleucine found in c-Kit; 3) the mutation
V377L, which was based on a Leucine found in c-Abl; 4) the double mutant L317I-
L322I, which was based on an Isoleucine found in c-Abl and c-Kit, respectively; 5) the
double mutant L317I-V377L, which was based on an Isoleucine and a Leucine found
both in c-Abl; 6) the double mutant G318-V378L, which was based on an insertion of
Glycine and a swapping to Leucine (found in c-Kit-PDGFR and c-Abl, respectively). It
should be noted that the insertion causes a shift in the numbering upstream this
mutation; and 7) the triple mutant G318-L323I-V378L, which was based on an insertion
12
of Glycine, and swapping to Isoleucine and Leucine, which are found in c-Kit-PDGFR,
c-Kit, and c-Abl, respectively.
(a) G318 [H1] (b) L322I [H1] 310 321 310 320 |....|.....|....| |....|..-..|....| Chicken c-Src EAQVMKKL-RHEKLVQL Chicken c-Src EAQVMKKL-RHEKLVQL Human c-Kit ELKVLSYLGNHMNIVNL Human c-Kit ELKVLSYLGNHMNIVNL Human PDGFRb ELKIMSHLGPHLNVVNL
(c) V377L [H2] 370 380 |....|....|....| P00523-Chicken c-Src IASGMAYVERMNYVHR P00519-Human c-Abl ISSAMEYLEKKNFIHR
(d) L317I-L322I [H1] 310 320 310 320 |....|....|....| |....|..-..|....| Chicken c-Src EAQVMKKLRHEKLVQL Chicken c-Src EAQVMKKL-RHEKLVQL Human c-Abl EAAVMKEIKHPNLVQL Human c-Kit ELKVLSYLGNHMNIVNL
(e) L317I-V377L [H1-H2] 310 320 370 380 |....|....|....| |....|....|....| Chicken c-Src EAQVMKKLRHEKLVQL IASGMAYVERMNYVHR Human c-Abl EAAVMKEIKHPNLVQL ISSAMEYLEKKNFIHR
(f) G318-V378L [H1-H2] 310 321 371 381 |....|.....|....| |....|....|....| Chicken c-Src EAQVMKKL-RHEKLVQL Chicken c-Src IASGMAYVERMNYVHR Human c-Kit ELKVLSYLGNHMNIVNL Human c-Abl ISSAMEYLEKKNFIHR Human PDGFRb ELKIMSHLGPHLNVVNL
(g) G318-L323I-V378L [H1-H1-H2] 310 321 371 381 |....|.....|....| |....|....|....| Chicken c-Src EAQVMKKL-RHEKLVQL Chicken c-Src IASGMAYVERMNYVHR Human c-Kit ELKVLSYLGNHMNIVNL Human c-Abl ISSAMEYLEKKNFIHR Human PDGFRb ELKIMSHLGPHLNVVNL
Figure 5. Multiple sequence alignments of amino acid sequences of chicken c-Src, human c-Abl, human
c-Kit, and human PDGFR. (a-g) Insertion and swapping of amino acids on c-Src to the corresponding
ones in c-Abl, c-Kit, or PDGFR are depicted in gray bars for each c-Src mutant. The localization of each
mutation at the H1 or H2 interface or both is shown between brackets.
13
Site directed mutagenesis
Mutants of c-Src protein were created by in vitro site directed mutagenesis. The reaction
was performed in 50 µl reaction mixture, and contained 5 ng of plasmid pET-28a(+) c-
src (wild type), 2.5U of Pfu DNA polymerase, Pfu Buffer 10X, 50 pmol of each primer
(forward and reverse; see Table 1 for details), and 0.25 mM of Deoxynucleotide
triphosphates (dNTPs) mix. Two negative controls were included, one without plasmid
and the other without DNA polymerase. Three more conditions were tested, with 5%
Dimethyl Sulfoxide (DMSO), 5% Dimethylformamide (DMF), and 5% Glycerol,
respectively. The oligonucleotides were designed using the online softwares PrimerX
[26] and Oligocalc [27] (Table 1).
Table 1. Primer sequences for the construction of c-src mutants by site directed mutagenesis. Codons that
were mutated are underlined. The first three mutants were constructed directly in one PCR reaction.
Among the mutants market by an asterisk (*), double mutants were constructed in two PCR steps: first,
the single mutation was introduced, and afterwards this was used as template for the second mutation.
The triple mutant was constructed using the plasmid coding for c-Src V377L as template.
The criteria to design the primers using PrimerX were as follow: 1) the mutation should
be in the middle of the primer sequence; 2) terminate in Guanine (G) or Cytosine (C); 3)
of approximately 25 to 45 base pairs; 4) with a melting temperature between 65°C and
75°C; and 5) a GC content between 40% and 60%. The theoretical formation of
secondary structures and dimers was verified with Oligocalc, and avoided when
possible.
Mutation Sense Primer sequence (5' → 3')
G318 Forward CCAAGTGATGAAGAAGCTCGGACGGCATGAGAAGCTGG
Reverse CCAGCTTCTCATGCCGTCCGAGCTTCTTCATCACTTGG
L322I Forward CCGGCATGAGAAGATTGTTCAGCTGTACGC
Reverse GCGTACAGCTGAACAATCTTCTCATGCCGG
V377L Forward CGGCATGGCCTATTTGGAGAGGATGAACTACG
Reverse CGTAGTTCATCCTCTCCAAATAGGCCATGCCG
L317I-L322I*
L317I-V377L*
G318-V378L*
G318-L323I-V378L* Forward GCTCGGACGGCATGAGAAGATTGTTCAGCTGTACGCAGTGG
Reverse CCACTGCGTACAGCTGAACAATCTTCTCATGCCGTCCGAGC
14
The Polymerase Chain Reaction (PCR) was carried out in a thermocycler (model
Techgene TC-312, Techne, UK). The initial denaturation at 94°C for 2 minutes was
followed by 18 PCR cycles each consisting of denaturation at 94°C for 30 seconds,
annealing at 52°C for 1 minute, and extension at 68°C for 14 minutes. The final
extension was at 68°C for 8 minutes. The parental plasmid was digested with 1 µl of
DpnI (applied directly to PCR reactions) at 37°C for 1.5 hours. The mutated plasmids
were purified using the GenEluteTM PCR Clean-Up Kit (SIGMA, USA), and eluted in
10 µl of 10% elution buffer (diluted with H20).
Transformation of Escherichia coli competent cells
The entire volume of purified plasmid (10 µl), usually corresponding to 100 ng of DNA,
was used to transform Escherichia coli (E. coli) competent cells, NovaBlue strain
(Novagen). Competent cells were prepared using Calcium Chloride, as described
elsewhere [28]. Transformation was carried out using an in-house protocol. Briefly, 10
µl of plasmid containing the mutated c-src gene was added to 60 µl of E.coli competent
cells, let on ice for 20 minutes, and incubated at 42°C for 30 seconds. Then, 200 µl of
Super Optimal broth with Catabolite repression (SOC) medium was added and
incubated at 37°C, at 200 rpm for 1 hour. Transformed cells were plated on Lysogeny
Broth (LB) agar plates containing Kanamycin at 50 µg/ml, and incubated overnight at
37°C.
DNA sequencing and analysis
To know whether the mutation was inserted successfully, the mutated c-src gene
inserted in the plasmid has to be sequenced at the DNA level. Briefly, obtained colonies
were selected and inoculated in 5 ml of LB medium containing Kanamycin at 50 µg/ml,
and incubated overnight at 37°C. The plasmid was purified using the GenEluteTM
Plasmid Miniprep Kit (SIGMA, USA), and eluted in 50 µl of elution buffer. The
purified plasmid was diluted up to 0.8 µg in 10 µl of water, and sent for sequencing at
Microsynth (Balgach, CH) by the Sanger method [29], using the T7 promoter primer.
Obtained electropherograms were verified using Chromas 2.31 (Technelysium Pty Ltd.,
Helensville, Queensland, Australia), and edited using BioEdit v7.0.0 [30]. The
comparison between electropherograms was carried out with CodonCode Aligner 2.0.6
[31]. Nucleotide and deduced amino acid sequences were aligned with CLUSTAL W
[25].
15
Co-transformation in Escherichia coli BL21DE3 strain
Purified pET-28a(+) plasmids containing the designed mutations on c-src were
transformed into E.coli BL21DE3 competent cells (Novagen). The E.coli BL21DE3
cells have been previously transformed with a pCDFDuet-1 plasmid (Novagen) [23],
modified to express the full-length YopH phosphatase from the bacteria Yersinia pestis
[32]. The co-expression of a tyrosine phosphatase has been shown to rescue the lethality
of unregulated c-Src expression in yeast [33]. Therefore, the c-Src co-expression
together with a phosphatase was adopted to maintain the kinase in the unphosphorylated
state, to improve the yield of soluble protein, and to produce a preparation of protein
which will be conformationally homogeneous.
Co-transformed cells were selected on LB-agar plates containing Kanamycin (50 µg/ml)
and Streptomycin (50 µg/ml), and incubated overnight at 37°C.
Protein expression
Co-transformed E.coli BL21DE3 cells from LB-agar plates were resuspended in 10 ml
of LB media, containing Kanamycin (50 µg/ml) and Streptomycin (50 µg/ml). The
culture was incubated overnight at 37°C, with agitation at 200 rpm. The next day, 1 liter
of selective Terrific Broth (TB) medium was inoculated with the 10 ml culture, let at
37°C for 16 hours with shaking, and then cooled for 3 hours at 18°C prior to induction
with 0.2 mM of IPTG, at 18°C for 16 hours. Cell culture was splitted in six bottles of
250 ml capacity, and centrifuged in a pre-cooled Sorvall centrifuge at 4°C, at 5’000 rpm
for 10 minutes. The pellet was recovered and stored at -20°C.
Protein purification
Cell pellets were diluted up to 30 ml in Lysis buffer, composed of Buffer A with 1 mM
Ethylene Diamine Tetraacetic Acid (EDTA) and 20 mg of DNase (Deoxyribonuclease I
from bovine pancreas, SIGMA, USA). Cell lysates were obtained using a mechanical
French Press, by three cycles of homogenization at 15’000 psi of pressure, at 4°C. Cell
debris and insoluble protein was sedimented by centrifugation at 9’500 rpm, at 4°C for
40 minutes.
The protein was purified by three consecutive types of chromatography on an
ÄKTA TMFPLCTM (GE Healthcare, UK): 1) immobilized Nickel (Ni)-affinity
chromatography, to isolate the histidine tagged recombinant c-Src; 2) ion exchange
chromatography, to eliminate residual amounts of YopH phosphatase, which tends to
16
bind to Ni-affinity resin despite the lack of a histidine tag; and 3) size exclusion
chromatography, to recover the homogenous monomeric protein. Thus, the supernatant
was filtered through a 0.45 µm filter and loaded onto a Ni affinity column (HisTrap HP,
GE Healthcare, UK), equilibrated with Buffer A (50 mM Tris pH 8.0, 500 mM NaCl,
5% Glycerol, 25 mM Imidazole). The column was washed with five column volumes of
Buffer A, and the protein was eluted with a linear gradient of 0-50% of Buffer B (i.e.
Buffer A with 0.5 M Imidazole). The fractions of protein were put on ice.
To verify the presence of the purified recombinant protein in the fractions, a 12%
Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis (SDS-PAGE) was
performed, followed by Coomassie Blue staining, as described elsewhere [34]. The
histidine tag was not cleaved for the kinase inhibition analysis, since its presence did not
show any interference with the activity of c-Src (data not shown).
Peak fractions containing c-Src mutants were assembled and dialyzed through a 8 kDa
Molecular Weight Cut Off (MWCO) membrane in Dialysis buffer (20 mM Tris pH 8.0,
100 mM Sodium Chloride [NaCl], 5% Glycerol, and 1 mM Dithiothreitol [DTT]),
overnight at 4°C.
For the second step of purification (anion exchange chromatography), the dialyzed
protein was diluted to 20 ml in Buffer QA (20 mM Tris pH 8.0, 5% Glycerol, and 1 mM
DTT), filtered through a 0.45 µm filter and loaded onto the ion exchange column
(HiTrap HP, GE Healthcare, UK), equilibrated with Buffer QA. The column was
washed with five column volumes of Buffer QA, and the protein was eluted with a
linear gradient of 0-35% of Buffer QB (i.e. Buffer QA with 1 M NaCl). The fractions of
protein were put on ice. The presence of our protein in the fractions was verified by a
12% SDS-PAGE (as shown above).
The fractions containing the c-Src protein were concentrated to 1 ml, using the Amicon
Ultra 4 falcon tube 10 kDa MWCO (Millipore, USA), upon centrifugation at 3’500 rpm,
at 4°C for 20 minutes. Then, the concentrated protein was loaded onto a size-exclusion
column (S75, GE Healthcare, UK), and equilibrated with Buffer S75 (50 mM Tris pH
8.0, 100 mM NaCl, and 5% Glycerol). The presence of recombinant protein in the
fractions was verified by a 12% SDS-PAGE (as shown above). Purified c-Src protein
was stored at -80°C in aliquots of 100 µl, until needed.
17
Verification of absence of post-translational modifications
ESI-time-of-flight mass spectrometry (TOF MS/MS) analyses were performed using a
QSTAR XL quadrupole TOF mass spectrometer (AB/MSD Sciex, Toronto, Canada), by
the Laboratory of Life Sciences Mass Spectrometry (Section of Pharmaceutical
Sciences, University of Geneva). This analysis was carried our in order to verify the
absence of phosphorylation or any post-translational modifications on the c-Src kinase
domain that may have occurred during the expression or purifications of the proteins.
Calculated masses were obtained from the deduced amino acid sequences of each
mutant, using ProtParam [35].
Western blot
Autophosphorylation of c-Src wild type and mutants was analyzed by Western blot. We
performed this analysis for the following reasons: 1) to know the phosphorylation state
of purified mutants, which should be unphosphorylated; 2) to test whether the purified
mutants were enzymatically active; and 3) to compare the autophosphorylation rate of
each purified mutant against the wild type. In this assay, we used 1 µg of purified
protein, 5 mM Magnesium Chloride (MgCl2), 20 µM ATP, and Buffer S75 up to 20µl
reaction. The mix was incubated at 30°C without ATP, and the reaction was started by
adding ATP with different times of incubation (0 second, 15 seconds, 1 minute, 10
minutes, and 30 minutes), and stopped by denaturating the protein with Sample Buffer
3X (0.24 M Tris-Cl pH 6.8, 6% SDS, 30% Glycerol, 16% B-mercaptoethanol, and 8.9
mM Bromophenol blue). A negative control was included (without MgCl2 and ATP), as
well as a positive phosphorylation control (EGF-Stimulated A431 cell lysate, Millipore,
USA). All the samples were boiled at 95°C for 5 minutes, and separated by 12 % SDS-
PAGE (see above). The nitrocellulose membrane and two Watman® papers (with the
obtained gel) were equilibrated in water and Transfer buffer (Tris 25 mM pH 8.5, 0.2 M
Glycine, 20% Methanol, and 0.05% SDS), respectively, for 30 minutes. The protein
transfer was carried out at 19 V, 400 mA, for 2.5 hours, in a Trans-Blot Semi-Dry
Transfer Cell (Bio-Rad, UK). Then, the nitrocellulose membrane was blocked with
Blocking buffer (1X Tris-buffered saline [TBS], and 3% nonfat dry milk) for 1 hour at
room temperature with constant agitation. After that, it was incubated with 0.5 µg/ml of
Monoclonal Anti-Phosphotyrosine Antibody, clone 4G10® (Millipore, USA), diluted in
freshly prepared Blocking buffer, overnight with agitation at 4°C. Then, the
nitrocellulose was washed twice with water, and incubated with the secondary antibody
18
(Goat Anti-Mouse Horseradish Peroxidase Conjugate, Bio-Rad, UK) diluted 1:3’000
times in Blocking buffer for 1.5 hours at room temperature with constant agitation. The
nitrocellulose was washed twice with water, then once with TBS-0.05% Tween® 20 for
5 minutes, and five times with water. Bound antibodies were detected using the ECL
Plus Western Blotting Detection System (GE Healthcare, UK), after 5 minutes of
incubation at room temperature. A FUGI Medical X-Ray film (FUJIFILM Corporation,
Tokyo) was used to image the nitrocellulose membrane after 5 seconds of exposure.
A picture of each western blot film was taken using the software Quantity One 4.5.1
(Bio-Rad, UK). A densitometric analysis of each gel was carried out, in order to know
whether we can correlate the autophosphorylation rate of each mutant with its capacity
to stabilize the inactive conformation. Briefly, the intensities of each band were
calculated in duplicates and averaged, using the Scion Image software (Scion
Corporation, USA). The highest calculated autophosphorylation score (after 30 minutes
of incubation, at 30°C with ATP/MgCl2) was scaled to 100%. Each value was corrected
for background by subtracting the value from a negative control (protein incubated for 0
second at 30°C, without ATP/MgCl2).
Kinase assay and inhibition of protein activity by imatinib
The kinase activity of c-Src in vitro was monitored using a continuous
spectrophotometric assay, as described elsewhere [36]. Briefly, the consumption of ATP
is coupled via the Pyruvate kinase (PK)/Lactate dehydrogenase (LDH) enzyme pair to
the oxidation of Nicotinamide adenine dinucleotide (NADH) to NAD+. Since NADH
absorbs Ultraviolet (UV) light at 340 nm, and the reaction is equimolar, the decrease in
absorption of NADH is directly linked to the kinase activity (Figure 6).
Figure 6. Representation of c-Src kinase assay in vitro.
19
Reaction mixtures contained 100 mM Tris (pH 8.0), 10 mM MgCl2, 275 µM ATP, 1
mM Phosphoenolpyruvate (PEP), 180 µM NADH, 1 mM DTT, 75 U/ml Pyruvate
kinase, 105 U/ml Lactate dehydrogenase, and 0.75 mM of peptide as substrate for c-Src
(sequence: EAIYAAPFAKKK, molecular weight of 1336.6 Da). The reaction mix was
diluted in Buffer S75, to a final volume of 75 µl, and pre-incubated for 5 minutes at
30°C. Protein inhibition was measured at different concentrations of imatinib (from 1
nM to 500 µM). Imatinib was dissolved in DMSO, which was maintained constant at
5% for each measurement. The assay was initiated with the addition of peptide
(incubated at 30°C) at a final concentration of 120 nM. The reactions were carried out at
30°C, and the decrease in absorbance at 340 nm was monitored over 30 minutes in a
Varian Cary 50 UV-Vis spectrophotometer (Varian, Inc., USA). The background
activity of the proteins in 5% DMSO was calculated without the substrate peptide and
imatinib, and subtracted from the kinase assay. The slope value of the obtained curve at
1 nM of imatinib was used as measure for the highest protein activity, because this
concentration showed no interference with protein activity. In total, three series of
measurements were carried out for each c-Src mutant. The half maximal inhibitory
constant (IC50), or the concentration of inhibitor which causes 50 percent inhibition of
an enzymatic reaction , was calculated for each c-Src mutant by using GraphPad Prism
4.0 (GraphPad Software, Inc., USA) using the non-linear four parameter logistic
equation, as shown below:
Y = Bottom + (Top – Bottom) / (1+10^ ( (LogIC50 – X) * Hill Slope) )
where X is the logarithm of concentration, and Y is the response.
Inhibitory constants (Ki) were calculated from each IC50 values, according the following
relationship [37, 38]:
50
[ ]1
i
ICK
ATP
Km
=+
where [ATP] is the concentration of ATP in the assay (275 µM), and Km is the
Michaelis-Menten constant for ATP, which was determined for c-Src to be 70 µM [21].
20
Results
In this work, seven mutants of c-Src protein were constructed. They were all located at a
hydrophobic interface of the kinase domain, between the N- and C-lobes, called the H1-
H2 interface. All the mutants were analyzed and contained the desired mutations
(Figure 7 on next page). The group of mutants was formed as follow: an insertion of a
Glycine at position 318 (i.e. G318), two single mutants (L322I and V377L), three
double mutants (L317I-L322I, L317I-V377L, and G318-V378L), and one triple mutant
(G318-L323I-V378L).
All the c-Src mutants were purified and showed the same “profile” of purification. As
an example, we show the results of purification of the mutant L317I-L322I (Figure 8 on
page 22). Chromatograms from Ni-affinity chromatography showed two peaks (Figure
8a). The first peak, formed by fractions 5 to 8, corresponded to a contamination by
YopH phosphatase which was co-expressed to prevent c-Src phosphorylation. The
second peak, formed by fractions 13 to 17, corresponded to the c-Src mutant. This was
verified by a 12% SDS-PAGE gel, in which the phosphatase was seen at the expected
Molecular Weight (MW) of 50.9 kDa. The c-Src mutants were observed in fractions of
the second peak, at the expected MW (~35 kDa). These fractions containing c-Src
mutant were used for the second purification, the anion exchange chromatography
(Figure 8b). Here, the chromatogram showed only one peak (fractions 5 to 8)
corresponding to a pure c-Src mutant. This was verified by a second SDS-PAGE gel.
Finally, the third purification (size-exclusion chromatography) was carried out using
these fractions (Figure 8c). The chromatogram showed one peak corresponding to pure
and monomeric c-Src mutant (fractions 10 to 12), which was verified subsequently by a
third SDS-PAGE gel. All the purifications of c-Src mutants were carried out following
the same steps. The yield of purified protein ranged from 0.3 mg to 5.8 mg per liter of
TB culture, which was sufficient for the subsequent analyses.
21
(a) (b) (c) (d)
(e) (f)
(g)
Figure 7. Extract of electropherograms after DNA sequencing of c-src mutants. Each mutant is compared
with c-src wild type (wild type sequence is shown over the mutant sequence). Mutated codons are shown
in a frame. (a) G318 insertion. (b) L322I. (c) V377L. (d) L317I-L322I. (e) L317I-V377L. (f) G318-
V378L. (g) G318-L323I-V378L.
22
(a)
(b)
(c)
Figure 8. Protein purification of mutant L317I-L322I. On the left are shown the chromatograms depicting
the UV absorbance of purified proteins (in blue). The green line shows the gradient of the buffer
containing imidazole. On the right are presented 12% SDS-PAGE gels stained by Coomassie Blue, after
each purification. (a) Ni-affinity chromatography. (b) Anion exchange chromatography. (c) Size-
exclusion chromatography. Purified c-Src mutants appears at ~35 kDa.
104.4 → 97.3 → 50.4 → 37.2 → 29.2 → 20.2 →
kDa M FP P AF FT F13 F14 F15 F17
104.4 → 97.3 → 50.4 → 37.2 → 29.2 → 20.2 →
kDa M D AF FT F5 F6 F7 F8
104.4 → 97.3 → 50.4 → 37.2 → 29.2 → 20.2 →
kDa M FT C F11 F12 F13
M : marker FP: after French Press P: pellet AF: after filtration FT: flow-through F13-F17: purified protein fractions
M : marker D: after dialysis AF: after filtration FT: flow-through F5-F8: purified protein fractions
M : marker FT: flow-through C: after concentration F11-F13: purified protein fractions
23
A western blot analysis was performed for all recombinant c-Src mutants to verify
whether the mutants were purified in their unphosphorylated state, and whether they
were active (Figure 9).
(a) G318 (b) L322I (c) L317I-L322I
(d) L317I-V377L (e) G318-V378L (f) V377L
(g) G318-L323I-V378L
Figure 9. Western blots showing the autophosphorylation of c-Src kinase mutants. Proteins were detected
by immunostaining with an Anti-Phosphotyrosine Antibody, after incubation with ATP and MgCl2 at
30°C. On each blot we have, from left to right: a negative control (protein incubated without
ATP/MgCl2), and purified proteins collected after different times of incubation (0 second, 15 seconds, 1
minute, 10 minutes, 30 minutes) with 20 µM ATP, and 5 mM MgCl2. (g) Comparison of the
autophosphorylation rate between c-Src wild type and the triple mutant, after 30 minutes of incubation in
presence of ATP and MgCl2. The arrow shows a low level of autophosphorylation for the triple mutant.
Six out of seven c-Src mutants were purified in their unphosphorylated state, which can
be verified by the lack of detected phosphorylation at 0 second of incubation with ATP
and MgCl2. One mutant, V377L, was purified in its phosphorylated state (Figure 9f).
This was verified by the presence of a band under the control conditions (incubation of
c-Src mutant without ATP and MgCl2, and incubation at 0 second with ATP and
MgCl2). This mutant, V377L, was not re-purified again due to lack of time. From the
six remaining mutant proteins, the triple mutant G18-L323I-V378L did not showed a
significant level of autophosphorylation (Figure 9g). This was verified comparing the
24
level of autophosphorylation between c-Src wild type and the triple mutant, after 30
minutes of autophosphorylation in presence of ATP and MgCl2. Thus, c-Src mutants
V377L and G318-L323I-V378L obtained in this study were not taken into consideration
for the kinetic assays.
The next step of analysis consisted in verifying the absence of post-translational
modifications on the c-Src kinase domain. The analysis was carried out by Electrospray
ionization-time-of-flight mass spectrometry. Six out of seven c-Src mutants were
analyzed (except V377L) and showed no evidence for phosphorylation or other post-
translational modification on the kinase domain (Figure 10, and Table 2 on next page),
indicating that those mutants were purified in their inactive conformation.
Figure 10. Example of a mass spectrum (Electrospray ionization-time-of-flight) for c-Src mutant L317I-
L322I preparation. The calculated mass from the deduced amino acid sequence is 35,344.40 Da, and the
experimental mass is 35,344.80 Da (standard deviation 1 Da), indication that the c-Src kinase domain is
not post-translationally modified (see also Table 2 on next page).
Inte
nsi
ty
m/z
25
Table 2. Results from Electrospray ionization-time-of-flight mass spectrometry analyses of six c-Src
mutants. The calculated masses agree with the experimental masses.
c-Src Mutation Calculated mass (Da) Experimental mass (Da)
G318 35,401.50 35,401.57
L322I 35,344.40 35,343.60
L317I-L322I 35,344.40 35,344.80
L317I-V377L 35,358.40 35,358.50
G318-V378L 35,415.50 35,415.70
G318-L323I-V378L 35,415.50 35,416.00
To see whether we can correlate the autophosphorylation rate of each c-Src mutant with
its capacity to stabilize the inactive conformation, a semi-quantitative analysis by
densitometry on western blots was carried out for each mutant through the time (Figure
11).
-20.00
0.00
20.00
40.00
60.00
80.00
100.00
120.00
0sec 15sec 30sec 1min 10min 30min
ATP/Mg2+ incubation at 30°C
Aut
opho
spho
ryla
tion
[%]
c-Src G318
c-Src L322I
c-Src L317I-L322I
c-Src L317I-V377L
c-Src G318-V378L
c-Src WT
Figure 11. Comparison of in vitro autophosphorylation rate over time between c-Src mutants and wild
type. The values were obtained from a densitometric analysis using western blots of each mutant at
different times of incubation with ATP and MgCl2.
We found that four out of five mutants (i.e. G318, L317I-L322I, L317I-V377L, and
G318-V378L) showed a lower rate of autophosphorylation over time compared to the
wild type (which reached almost complete autophosphorylation after 15 seconds of
26
incubation in presence of ATP and MgCl2). However, the mutant L322I showed a
similar profile of autophosphorylation as the wild type, with more than 80% of
phosphorylation after 15 seconds of incubation in presence of ATP and MgCl2) (Figure
11). To be sure that the difference in autophosphorylation over time was due to intrinsic
properties of mutants (and no to an unequal volume of loaded proteins into gels), a
control 12% SDS-PAGE gel was stained by Coomassie Blue and showed that an equal
amount of proteins was loaded for each mutant (data not showed).
Before performing the test of inhibition of c-Src kinase activity, we verified that the
concentrations of c-Src (120 nM) and ATP (275 µM) that were going to be used in the
inhibition test did not trigger an autophosphorylation activity, since it may interfere with
the IC50 measurements as the inhibitor targets the inactive, unphosphorylated c-Src. For
this analysis, a western blot was made using c-Src wild type at 120 nM and 1 µM
(positive control), both with 275 µM ATP and 5 mM MgCl2 at different times of
incubation (see Materials and Methods). We showed that 120 nM of c-Src did not
showed any autophosphorylation activity after more than 1 hour, and that at a
concentration of 1 µM c-Src starts being autophosphorylated almost immediately
(Figure 12).
(a) (b)
Figure 12. Western blots showing the autophosphorylation rate of c-Src wild type over time, using 275
µM ATP, 5 mM MgCl2, and c-Src protein at (a) 120 nM, and (b) 1 µM. The mix was incubated at 30°C
through increasing times, and the reaction was started by the addition of ATP.
The test of inhibition of c-Src kinase activity by imatinib was performed for five out of
seven c-Src mutants (except the mutants V377L and G318-L323I-V378L, the first
purified in its active conformation and the second in a catalytically inactive state)
(Figure 13 on next page).
No ATP/ MW MgCl2 0 ' 2' 10' 30' 60' 120'
37 29
37 29
No ATP/ MW MgCl2 0 ' 2' 10' 30' 60' 120'
27
(a) (b) (c)
(d) (e)
Figure 13. Inhibition of the enzymatic activity for five c-Src mutants by imatinib. The fitting was
calculated from mean values of triplicate measurements. The standard deviations are depicted as error
bars. The activity of the protein decreases with increasing concentration of imatinib (expressed at the x-
axis as the logarithm of imatinib concentrations in nanomoles).
All the mutants showed an IC50 value at the micromolar (µM) range, with inhibitory
constants (Ki) ranging from 14.6 to 50.7 µM (in the same order of magnitude as the wild
type, which shows an IC50 = 221 µM and Ki = 31.1 µM) (Table 3). It is interesting to
note that three out of five mutants (i.e. L317I-V377L, G318, and G318-V378L) showed
an increase in affinity compared to the wild type.
Table 3. Obtained IC50 values and inhibitory constants (Ki) of c-Src mutants towards imatinib. The
values for c-Src wild type (*) were obtained from Bendhiaf [39].
c-Src protein IC50 (µM) K i (µM)
Wild type* 221 31.1
G318 131 26.6
L322I 250 50.7
L317I-L322I 249 50.5
L317I-V377L 72 14.6
G318-V378L 149 30.2
28
Thus, the mutant L317I-V377L showed a ~3 fold increase in affinity towards imatinib
(K i = 14.6 µM). Another finding was that two mutants (i.e. L322I, and L317I-L322I)
showed a similar IC50 value with respect to the wild type. If we compare our results,
however, to a recent finding that shows that the c-Src mutant L317I enhances the
affinity towards imatinib at the nanomolar range, this indicates that we did not reach the
same degree of improvement (see discussion).
29
Discussion
The seven c-Src mutants constructed in this study were located at a hydrophobic
interface between the two lobes of the kinase domain, called H1-H2 interface (H1
corresponding to the N-lobe, and H2 corresponding to the C-lobe). This interface was
initially described for the insulin receptor (INSR) tyrosine kinase by molecular dynamic
simulations, and contains fourteen amino acids in total (six amino acids at the N-lobe,
and eight amino acids at the C-lobe) [22]. The interactions between amino acids at this
interface are mainly of the type van der Waals, and one polar interaction. It was
observed that the amino acids located at this interface were moving in a concerted way
during the transition from active to inactive conformations and vice versa, showing a
greater movement than the rest of the kinase domain [22]. Thus, the movements of N-
and C-lobe, described as rotations and torsions, apparently have their focus at this
interface, with changes of hydrophobic contacts and the conservation of the polar
interaction. It is interesting to note that other studies have described other hydrophobic
cores, but their formations are restricted to the active state [40, 41]. Thus, the idea of
this study was to address the importance of some of the amino acids located at the H1-
H2 hydrophobic interface of c-Src using site directed mutagenesis, to see whether we
can find the amino acids determining the equilibrium of the conformational switch
(from “on” to “off” states, and vice versa).
Our mutagenesis strategy consisted on swapping amino acids located at the H1-H2
interface from c-Src to the corresponding amino acids from c-Abl, c-Kit, and PDGFR,
because it is known that these later kinases can be inhibited by the drug imatinib with
high affinity [42]. The seven mutants constructed in this study were designed following
this rational. The first systematic attempt to discover important amino acids on c-Src
was carried out within other regions of the c-Src kinase domain: the activation loop,
beta3-αC loop, and the P-loop [21]. Kuriyan and co-workers studied 23 mutants of c-Src
by extracting the inhibition constant towards imatinib, but did not found any significant
increase in affinity. The second report came from a mutagenesis study of c-Src at the
activation loop and H1-H2 interface, which was carried out in our lab [39]. In this
study, an interesting mutation was done at the H1-H2 interface, which consisted in a
swap of Leucine from c-Src to the corresponding Isoleucine in c-Abl (L317I). This c-
30
Src mutant showed an increase in relative affinity towards imatinib at the nanomolar
range (IC50 = 37nM, Ki = 9 nM), depicting for the first time an important amino acid
that could be involved in the conformational switch of c-Src. This prompted us to
further study this hydrophobic interface in order to address the question whether there
are other amino acids within this interface which are playing an important role in
shifting the conformational equilibrium.
The expression system used in this study consisted of a bacterial system, expressing
both the c-Src kinase domain and a bacterial phosphatase (YopH) at the same time [21].
This co-expression was designed to increase the amount of soluble protein to miligrams,
because it was reported that the yield of the tyrosine kinase in bacteria is very low [43,
44]. Other expression systems for c-Src exist, for instance insect cells [45, 46] or yeast
[33]. The disadvantages of these systems are that they are more demanding in cost and
time. The bacterial system used in this study, however, is not perfect. We still found
more than 90% of protein in the insoluble fraction, in accordance with published data
[23]. A possible explanation to this could be that c-Src proteins co-aggregate with
bacterial membranes, and thus are deposited in the pellet. Another possible explanation
is that c-Src is toxic for the bacteria, and thus it is confined in inclusion bodies.
Nevertheless, the obtained yield of protein (0.3 mg to 5.8 mg per liter of culture) was
sufficient for subsequent analyses.
During the purification of c-Src mutant proteins by Ni-affinity chromatography, it was
observed that YopH phosphatase was co-eluting with c-Src protein. Surprisingly, YopH
phosphatase was binding to the resin, even though it lacks the histidine tag. This
contamination, already seen before [23], could be due to a certain affinity of the
phosphatase for the resin. This problem was overcome by using another step of
purification, the anion exchange chromatography. A final size exclusion
chromatography was used in order to have pure and monomeric c-Src proteins.
In the process of activation of c-Src, it can autophosphorylate on Tyr416 at the
activation loop [47]. This phosphorylation constitutes a positive regulatory mechanism,
which stabilizes the activation loop in an open conformation, and allows the binding of
ATP and peptide for the phosphotransfer [18]. Another site of phosphorylation for c-
Src is on Tyr527, which is phosphorylated in vivo by the tyrosine kinase Csk and
31
negatively regulate its activity [48]. In this study, we carried out a western blot analysis
for each c-Src mutant (at different times of incubation with ATP and MgCl2) and
observed that: 1) six out of seven c-Src mutants were purified in their unphosphorylated
state similar to the wild type, as expected; and 2) they could be activated, showing an
increasing autophosphorylation rate over time. Two exceptions to this were found. The
mutant V377L was purified in its phosphorylated state, possibly due to: 1) a lost of the
plasmid containing the phosphatase during the expression of c-Src proteins; or 2) a shift
towards a more active conformation, overcoming the regulation by the phosphatase.
This mutant was not further characterized due to lack of time. The other exception was
the triple mutant G318-L323I-V378L, which showed no significant level of
autophosphorylation over time. One possible hypothesis could be that this mutation can
stabilize the inactive conformation of c-Src more than the other mutations, taking more
time to autophosphorylate. This mutant seems to be properly folded. Two facts points
towards this direction: 1) the triple mutant was purified from a soluble fraction, which
usually requires a globular conformation; and 2) it showed a very low level of
autophosphorylation, which can only be achieved by adopting an active conformation.
Based on these experimental evidences, other experiments will be performed to
definitely answer this folding issue. The correct folding of the triple mutant can be
verified by some techniques, for instance by using Circular Dichroism spectroscopy.
Another point that arises here is whether the phosphorylation observed in western blot is
due to Tyr416 autophosphorylation or Tyr572 (which is usually phosphorylated by
Csk). Tyr527 is indeed also present on our constructs. A possible assay to address this
issue could be the use of a specific anti-phosphotyrosine antibody directed towards
phosphotyrosine-416 which does not cross react with phosphotyrosine-527, for instance
the Phospho-Src Family (Tyr416) antibody (Cell Signaling Technology, USA).
Can we correlate the autophosphorylation rate of c-Src mutant with its capacity to
stabilize the inactive conformation? In other words, a lower rate of autophosphorylation
is directly proportional to a higher stabilization of the inactive conformation?
Apparently no. A semi-quantitative analysis by densitometry on western blots showed
that even though this pattern can be observed for most of the mutants analyzed, the
mutant L322I showed a similar rate of autophosphorylation as the wild type.
Furthermore, there is no direct correlation when considering the kinetic analyses.
32
The inhibition test was performed using concentrations of c-Src (120 nM) and ATP
(275 µM) that did not show any autophosphorylation activity, as observed in western
blot analyses. This was important since an autophosphorylation activity of c-Src may
interfere with the IC50 measurements because the inhibitor targets the inactive,
unphosphorylated c-Src.
The drug imatinib was used as a marker for the inactive conformation of c-Src. Other
tyrosine kinases (c-Kit and PDGFR) show a high affinity towards imatinib at the
nanomolar range [42]. Even though c-Src shows structural similarities with these
tyrosine kinases, its affinity towards imatinib remains at the micromolar range. This fact
was explained by the observation that the residue Phenylalanine from DFG motif was
flipped 180° in c-Src with respect to c-Abl, meaning that more energy is needed to
break this steric hindrance [21].
In this study, three out of five mutants (i.e. G318, L317I-V377L, and G318-V378L)
showed an increase in affinity towards imatinib at the micromolar range, compared to
the wild type. It was reported, however, that the mutation L317I located at the same
hydrophobic interface enhances the affinity of c-Src into the nanomolar range [39], a
finding that was not improved despite important efforts of the scientific community
[21]. Another important finding was that mutations L322I and L317I-L322I showed
similar IC50 values with respect to the wild type, showing that L322I can reverts
completely the influence of L317I. The importance of the mutation L322I to revert the
action of better mutations can be tested by constructing other c-Src mutants, for instance
G318-L322I, expecting to find again an affinity toward imatinib similar to the wild
type. At the same time, the c-Src mutant L317I-L322I is an interesting candidate to be
crystallized for future X-ray diffractions, to understand the structural basis of this
reversion.
33
Concluding remarks
In this work, we have extended the search of amino acids that could govern the
plasticity of c-Src kinase domain. The strategy was based on swapping amino acids of
c-Src located at the hydrophobic interface between the N- and C-lobes to the
corresponding ones in c-Abl, c-Kit, and PDGFR, and to assess their importance in
conformational plasticity via the evaluation of the affinity of the mutants towards
imatinib. The affinity for imatinib was used as an indirect marker of the stabilization of
the inactive conformation of c-Src kinase domain. Seven c-Src mutants were
constructed following this rational. Five mutants were further analyzed by kinetic
assays, and three of them (i.e. G318, L317I-V377L, and G318-V378L) showed an
increase in affinity towards imatinib at the micromolar range, compared to the wild
type. The remaining two mutants (i.e. L322I, and L317I-L322I) showed similar affinity
values as the wild type. Interestingly, the mutation L322I reverted completely the action
of L317I (which drops the affinity at the nanomolar range). Future efforts can be
focused on: 1) assessing whether the mutation V377L is purified always in a more
active state; 2) analyzing whether the triple mutant adopts a correct folding; 3) testing
the importance of the mutation L322I to revert the action of better mutations by
constructing other c-Src mutants, like G318-L322I, in which we expect to find a similar
affinity towards imatinib as the wild type; 4) crystallizing the mutant L317I-L322I to
understand the structural basis of this reversion; 5) analyzing the importance of the rest
of amino acids localized at the H1-H2 interface; 6) extending the analysis to other
hydrophobic interfaces; and 7) extending this work on other tyrosine kinases, including
RTKs and NRTKs.
34
References
1. Hubbard SR, Till JH (2000) Protein tyrosine kinase structure and function.
Annu. Rev. Biochem. 69: 373-398 2. Yaffe MB (2002) Phosphotyrosine-binding domains in signal transduction. Nat.
Rev. Mol. Cell Biol. 3: 177-186 3. Blume-Jensen P, Hunter T (2001) Oncogenic kinase signalling. Nature 411:
355-365 4. Levitzki A (1999) Protein tyrosine kinase inhibitors as novel therapeutic agents.
Pharmacol. Ther. 82: 231-239 5. Robinson DR, Wu YM, Lin SF (2000) The protein tyrosine kinase family of the
human genome. Oncogene 19: 5548-5557 6. Brown MT, Cooper JA (1996) Regulation, substrates and functions of src.
Biochim. Biophys. Acta 1287: 121-149 7. Summy JM, Gallick GE (2003) Src family kinases in tumor progression and
metastasis. Cancer Metastasis Rev. 22: 337-358 8. Rous P (1966) The challenge to man of the neoplastic cell. Nobel Lecture,
Physiology or Medicine. http://nobelprize.org/ 9. Czernilofsky AP, Levinson AD, Varmus HE, Bishop JM, Tischer E, Goodman
HM (1980) Nucleotide sequence of an avian sarcoma virus oncogene (src) and proposed amino acid sequence for gene product. Nature 287: 198-203
10. Duesberg PH, Vogt PK (1970) Differences between the ribonucleic acids of transforming and nontransforming avian tumor viruses. Proc. Natl. Acad. Sci. U.S.A. 67: 1673-1680
11. Martin GS (2001) The hunting of the Src. Nat. Rev. Mol. Cell Biol. 2: 467-475 12. Stehelin D, Varmus HE, Bishop JM, Vogt PK (1976) DNA related to the
transforming gene(s) of avian sarcoma viruses is present in normal avian DNA. Nature 260: 170-173
13. Yeatman TJ (2004) A renaissance for SRC. Nat. Rev. Cancer 4: 470-480 14. Xu W, Harrison SC, Eck MJ (1997) Three-dimensional structure of the tyrosine
kinase c-Src. Nature 385: 595-602 15. Xu W, Doshi A, Lei M, Eck MJ, Harrison SC (1999) Crystal structures of c-Src
reveal features of its autoinhibitory mechanism. Mol. Cell 3: 629-638 16. Pawson T (1995) Protein modules and signalling networks. Nature 373: 573-580 17. Nolen B, Taylor S, Ghosh G (2004) Regulation of protein kinases; controlling
activity through activation segment conformation. Mol. Cell 15: 661-675 18. Huse M, Kuriyan J (2002) The conformational plasticity of protein kinases. Cell
109: 275-282 19. Cowan-Jacob SW, Fendrich G, Manley PW, Jahnke W, Fabbro D, Liebetanz J,
Meyer T (2005) The crystal structure of a c-Src complex in an active conformation suggests possible steps in c-Src activation. Structure 13: 861-871
20. Mol CD, Dougan DR, Schneider TR, Skene RJ, Kraus ML, Scheibe DN, Snell GP, Zou H, Sang BC, Wilson KP (2004) Structural basis for the autoinhibition and STI-571 inhibition of c-Kit tyrosine kinase. J. Biol. Chem. 279: 31655-31663
21. Seeliger MA, Nagar B, Frank F, Cao X, Henderson MN, Kuriyan J (2007) c-Src binds to the cancer drug imatinib with an inactive Abl/c-Kit conformation and a distributed thermodynamic penalty. Structure 15: 299-311
35
22. Moretti L (2007) Exploring structure and plasticity of tyrosine kinase domains for drug discovery. Thesis N° 3904. University of Geneva, Switzerland
23. Seeliger MA, Young M, Henderson MN, Pellicena P, King DS, Falick AM, Kuriyan J (2005) High yield bacterial expression of active c-Abl and c-Src tyrosine kinases. Protein Sci. 14: 3135-3139
24. UniProtKB release 14.8. http://www.uniprot.org 25. Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the
sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22: 4673-4680
26. Lapid C, Gao Y (2003) PrimerX: automated design of mutagenic primers for site-directed mutagenesis. http://www.bioinformatics.org/primerx/index.htm
27. Kibbe WA (2007) OligoCalc: an online oligonucleotide properties calculator. Nucleic Acids Res. 35: W43-46
28. Sambrook J, Russell D (2001) Molecular Cloning: A Laboratory Manual, Third edn. Cold Spring Harbor Laboratory Press, New York
29. Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. U.S.A. 74: 5463-5467
30. Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids. Symp. Ser. 41: 95-98
31. CodonCode Aligner 2.0.6. http://www.codoncode.com/aligner/ 32. Bliska JB, Guan KL, Dixon JE, Falkow S (1991) Tyrosine phosphate hydrolysis
of host proteins by an essential Yersinia virulence determinant. Proc. Natl. Acad. Sci. U.S.A. 88: 1187-1191
33. Weijland A, Neubauer G, Courtneidge SA, Mann M, Wierenga RK, Superti-Furga G (1996) The purification and characterization of the catalytic domain of Src expressed in Schizosaccharomyces pombe. Comparison of unphosphorylated and tyrosine phosphorylated species. Eur. J. Biochem. 240: 756-764
34. Smith BJ (1994) SDS polyacrylamide gel electrophoresis of proteins, in: Methods in Molecular Biology, Vol. 32: Basic Protein and Peptide Protocols (Walker JM, ed), Springer-Verlag New York, pp 23-34
35. ProtParam. http://www.expasy.ch/tools/protparam.html 36. Barker SC, Kassel DB, Weigl D, Huang X, Luther MA, Knight WB (1995)
Characterization of pp60c-src tyrosine kinase activities using a continuous assay: autoactivation of the enzyme is an intermolecular autophosphorylation process. Biochemistry 34: 14843-14851
37. Cheng HC (2001) The power issue: determination of KB or Ki from IC50. A closer look at the Cheng-Prusoff equation, the Schild plot and related power equations. J. Pharmacol. Toxicol. Methods 46: 61-71
38. Cheng Y, Prusoff WH (1973) Relationship between the inhibition constant (K1) and the concentration of inhibitor which causes 50 per cent inhibition (I50) of an enzymatic reaction. Biochem. Pharmacol. 22: 3099-3108
39. Bendhiaf SM (2008) Expression, purification and analysis of Src kinase domain mutants for understanding inhibitors's selectivity. Diploma Thesis. University of Geneva, Switzerland
40. Kornev AP, Haste NM, Taylor SS, Eyck LF (2006) Surface comparison of active and inactive protein kinases identifies a conserved activation mechanism. Proc. Natl. Acad. Sci. U.S.A. 103: 17783-17788
36
41. Ten Eyck LF, Taylor SS, Kornev AP (2008) Conserved spatial patterns across the protein kinase family. Biochim. Biophys. Acta 1784: 238-243
42. Buchdunger E, Cioffi CL, Law N, Stover D, Ohno-Jones S, Druker BJ, Lydon NB (2000) Abl protein-tyrosine kinase inhibitor STI571 inhibits in vitro signal transduction mediated by c-kit and platelet-derived growth factor receptors. J. Pharmacol. Exp. Ther. 295: 139-145
43. Garcia P, Shoelson SE, George ST, Hinds DA, Goldberg AR, Miller WT (1993) Phosphorylation of synthetic peptides containing Tyr-Met-X-Met motifs by nonreceptor tyrosine kinases in vitro. J. Biol. Chem. 268: 25146-25151
44. Williams DM, Wang D, Cole PA (2000) Chemical rescue of a mutant protein-tyrosine kinase. J. Biol. Chem. 275: 38127-38130
45. Nagar B, Hantschel O, Young MA, Scheffzek K, Veach D, Bornmann W, Clarkson B, Superti-Furga G, Kuriyan J (2003) Structural basis for the autoinhibition of c-Abl tyrosine kinase. Cell 112: 859-871
46. Sicheri F, Moarefi I, Kuriyan J (1997) Crystal structure of the Src family tyrosine kinase Hck. Nature 385: 602-609
47. Smart JE, Oppermann H, Czernilofsky AP, Purchio AF, Erikson RL, Bishop JM (1981) Characterization of sites for tyrosine phosphorylation in the transforming protein of Rous sarcoma virus (pp60v-src) and its normal cellular homologue (pp60c-src). Proc. Natl. Acad. Sci. U.S.A. 78: 6013-6017
48. Thomas JE, Soriano P, Brugge JS (1991) Phosphorylation of c-Src on tyrosine 527 by another protein tyrosine kinase. Science 254: 568-571