draft - pdfs.semanticscholar.org...draft 2 13 abstract: bacillus megaterium mnsh1-9k-1 and...

Draft

Identification of Bacillus megaterium and Microbacterium

liquefaciens genes involved in metal resistance and metal removal

Journal: Canadian Journal of Microbiology

Manuscript ID cjm-2015-0507.R2

Manuscript Type: Article

Date Submitted by the Author: 25-Jan-2016

Complete List of Authors: Fierros-Romero, Grisel; INSTITUTO POLITECNICO NACIONAL,

BIOTECHNOLOGY Gomez-Ramirez, Marlenne; INSTITUTO POLITECNICO NACIONAL, BIOTECHNOLOGY Arenas-Isaac, Ginesa E.; INSTITUTO POLITECNICO NACIONAL, BIOTECHNOLOGY Pless-Elling, Reynaldo C.; INSTITUTO POLITECNICO NACIONAL, BIOTECHNOLOGY ROJAS-AVELIZAPA, NORMA G.; INSTITUTO POLITECNICO NACIONAL, BIOTECHNOLOGY

Keyword: Ni-V removal, spent catalyst, Bacillus megaterium, Microbacterium liquefaciens, metal resistance

https://mc06.manuscriptcentral.com/cjm-pubs

Canadian Journal of Microbiology

Draft

1

Identification of Bacillus megaterium and Microbacterium liquefaciens genes involved in metal 1

resistance and metal removal 2

3

Grisel Fierros-Romero, Marlenne Gómez-Ramírez, Ginesa E. Arenas-Isaac, Reynaldo C. Pless, and 4

Norma G. Rojas-Avelizapa*

5

6

7

Centro de Investigación en Ciencia Aplicada y Tecnología Avanzada del IPN, Cerro Blanco 141, Col. Colinas 8

del Cimatario, Querétaro, Querétaro 76090, Mexico 9

Phone: +52 (442) 229 08 04 Ext. 81031. 10

*Corresponding author: e-mail: [email protected] 11

12

Page 1 of 23



Draft

2

Abstract: Bacillus megaterium MNSH1-9K-1 and Microbacterium liquefaciens MNSH2-PHGII-2, 13

two nickel-vanadium resistant bacteria from mine tailings located in Guanajuato, Mexico, are 14

shown to have the ability to remove 33.1% and 17.8% of Ni and 50.8% and 14.0% of V, 15

respectively, from spent petrochemical catalysts containing 428 ± 30 mg kg-1

of Ni and 2165 ± 77 16

mg kg-1

of V. In these strains, several Ni resistance determinants were detected by conventional 17

PCR. The nccA (Ni-Co-Cd was found for the first time in B. megaterium. In M. liquefaciens the 18

above gene and, additionally czcD gene (Co-Zn-Cd resistance) and a high-affinity nickel transporter 19

were detected for the first time. This study characterizes the resistance of M. liquefaciens and B. 20

megaterium to nickel through the expression of genes conferring metal resistance. 21

Keywords: Ni-V removal, spent catalyst, Bacillus megaterium, Microbacterium liquefaciens, metal 22

resistance. 23

24

Résumé: Bacillus megaterium MNSH1-9K-1 et Microbacterium liquefaciens MNSH2-PHGII-2, 25

deux bactéries résistantes à nickel et vanadium, obtenues des décombres miniers de l’état de 26

Guanajuato, Mexique, se montrent capables d’enlever 33.1% et 17.8% de Ni, et 50.8% et 14.0% de 27

V, respectivement, des catalyseurs épuisés avec une teneur de 428 ± 30 mg kg-1

de Ni et 2165 ± 77 28

mg kg-1

de V. Dans cettes souches, plusieurs déterminants de résistance à Ni furent détectés par 29

PCR conventionelle. Le gène nccA (resistance à Ni, Co et Cd) fut détecté pour la première fois en 30

B. megaterium. En M. liquefaciens, les gènes mentionnés ci-dessus et, en plus czcD (résistance à 31

Co, Zn et Cd) et un porteur de nickel de haute affinité furent détectés pour la première fois. Cette 32

recherche caractérise la resistance de M. liquefaciens et B. megaterium à nickel, au moyen de 33

l’expression de gènes conférants une résistance aux métaux. 34

35

Mots-clés: enlèvement de Ni et V, catalyseur épuisé, Bacillus megaterium, Microbacterium 36

liquefaciens, résistance aux métaux. 37

38

Page 2 of 23



Draft

3

Introduction 39

Spent catalysts from the petrochemical industry contain a variety of toxic elements that define 40

them as hazardous wastes, requiring special handling to prevent metal accumulation in the 41

environment. During petroleum refining processes, hydrotreating catalyst accumulate nickel and 42

vanadium, present in petroleum streams, that cause poisoning decreasing their catalytic activity, 43

then they must be discharged and disposed as hazardous wastes (Torres-Martinez et al. 2001; 44

Philippaerts et al. 2011). 45

Nowadays, these wastes are treated by chemical methods which themselves generate toxic 46

wastes (Rocchetti et al. 2013). Biological methods represent an environment-friendly alternative 47

because they obviate the use of these chemicals. Such biological methods, take advantage of the 48

adaptive mechanisms of the microorganisms to survive and grow in hostile environments, such as 49

polluted industrial and mining areas. These adaptations are considered a valuable tool in the 50

treatment of toxic wastes (Hinojosa et al. 2005). 51

Nickel is a trace element for bacteria, serving as an essential component of enzymes such as 52

ureases, hydrogenases, CO dehydrogenases, and enzymes in the metabolism of strictly anaerobic 53

bacteria (Mulrooney and Hausinger 2003). Compared to nickel, vanadium appears to have less of an 54

intrinsic biological role in bacteria. Divers mechanisms can be involved in heavy-metal resistance in 55

bacteria, such as blocking the entry of toxic ions into the cells, enzymatic detoxification, 56

intracellular sequestration of the metals by metal-binding proteins and energy-driven cation/anion 57

efflux systems encoded by resistance genes such as czcCBA, cnrYXHCBA, and nccCBA (Mergeay 58

et al. 1985; Diels et al. 1995; Bruins et al. 2000; Taghavi et al. 2001). Trace elements such as Zn2+

, 59

Co2+

, V4+

, V

5+, and Ni

2+ are usually actively transported into or out of cells against concentration 60

gradients (Nies 2003). Among the transporter systems reported are cation/anion pumps: I) Cation 61

diffusion facilitators (CDF) carrying cadmium, cobalt, nickel, and iron ions; the prototype is czcD 62

(Diels et al. 1995), II) P-type ATPases (Sandrin et al. 2000; Nies 2003), III) The bacterial family of 63

RND transporters (resistance, nodulation and cell division(Zhang et al. 2012; Zhu et al. 2012). 64

Page 3 of 23



Draft

4

Some of these high-affinity energy-dependent metal transport systems have been described for 65

nickel in Cupriavidus metallidurans (Lohmeyer and Friedrich 1987), Anabaena cylindrica 66

(Campbell and Smith 1986), Methanobacterium bryantii (Jarrell and Sprott 1982), and Clostridium 67

thermoaceticum (Lundie et al. 1988); these efflux-mediated systems mostly use plasmid-encoded 68

mechanisms involving operons such as cnrYXHCBA, czcCBA, or nccCBA, whereby the toxic ions 69

enter the cell via active transport (an ATPase pump) or diffusion (a chemiosmotic ion or proton 70

pump) (Nies 2003; Gutierrez et al. 2009). The cnrYXHCBA operon of Cupriavidus metallidurans 71

is the most frequently studied genetic determinant; it mediates high levels of nickel resistance (up to 72

10 mM) (Liesegang et al. 1993; Stoppel and Schlegel 1995). Broad-host-range expression of the 73

nccCBA (nickel-cobalt-cadmium resistance) operon was also found in many nickel-resistant strains 74

of Cupriavidus metallidurans, Achromobacter xylosoxidans, Sphingobacterium heparinum, 75

Burkholderia, Comamonas, Flavobacteria, and Arthrobacter (Dong et al. 1998; Brim et al. 1999). 76

The nccCBA complex also shows close similarities to the czcCBA complex, which seems to be a 77

three-component cation-proton antiporter (Schmidt and Schlegel 1994). 78

Among the mechanisms reported for vanadium resistance are an iron-dependent superoxide 79

dismutase (sodB) (Baysse et al. 2000) and an efflux pump, MexGHI-opmD, both conferring 80

resistance in Pseudomonas aeruginosa against V (Vandermeulen et al. 2011). It has been 81

demonstrated that vanadate can enter the cell via the phosphate transport system in erythrocytes 82

(Cantley et al. 1978) and in Neurospora crassa (Bowman 1983). The VAN1 and VAN2 genes 83

identified in Saccharomyces confer resistance to V through mechanisms which are still unclear. The 84

VAN2 gene (also known as VRG4) encodes a 39.6-kDa protein with multiple transmembrane 85

domains, and VAN2 deletions are lethal (Kanik-Ennulat and Neff 1990; Kanik-Ennulat et al. 1995; 86

Poster and Dean 1996). 87

The present paper studies the resistance of Bacillus megaterium and Microbacterium 88

liquefaciens to Ni and V through the expression of genes conferring resistance to these metals, in 89

order to understand the mechanisms involved in the process, with a view to a possible use of these 90

Page 4 of 23



Draft

5

microorganisms in the biological treatment of spent catalyst for its safe disposal or for potential 91

nickel-vanadium recovery. 92

93

Materials and methods 94

Bacteria source 95

The bacterial strains Bacillus megaterium MNSH1-9K-1 (GenBank accession number 96

KM654562.1) and Microbacterium liquefaciens MNSH2-PHGII-2 (GenBank accession number 97

KJ848325.1) used in this study stem from the El Nopal mine in the state of Guanajuato, Mexico 98

(Arenas-Isaac et al. 2015; Gomez-Ramirez et al. 2015). 99

Spent catalyst 100

The spent catalyst used for the studies of Ni and V removal was provided by the Mexican 101

Petroleum Institute (Mexico City). It was used in oil hydrotreating processes and contains a variety 102

of metals in different concentrations on an alumina matrix. Metal characterization of this spent 103

catalyst by ICP-EOS had shown concentrations of Ni2+

and V5+

of 428±30 mg kg-1

and 2165±77 mg 104

kg-1

, respectively. Other elements detected include (in mg kg-1

): As (821.5±30), Cr (66.4±15), Fe 105

(3994±29), Mg (525.6±45), Mo (18.3±0.4), P (75.6±50), Zn (53.7±40), and Al (103071.6±546) 106

(Gomez-Ramirez et al. 2015). 107

Studies of Ni and V removal from spent catalyst by isolates 108

First, an inoculum was prepared as follows: each isolate was grown for 24 to 48 h in PHGII 109

liquid media at 150 rpm, 30°C, and the microbial density of each isolate was adjusted to 3x108 110

CFU/mL by microscopic enumeration with a cell-counting Neubauer camera. 2-mL inocula were 111

added to experimental sets, which were prepared in 125-mL Erlenmeyer flasks containing 20 mL of 112

PHGII medium plus spent catalyst at 16% (w/v) pulp density. Controls prepared in triplicate 113

consisting of dead biomass (to evaluate adsorption processes) and non-inoculated flasks were 114

Page 5 of 23



Draft

6

included. The flasks were incubated at 30°C, 150 rpm for 7 days. After the incubation period, 115

microbial growth was determined by cell counting. The liquid phase was filtered off using a 0.22-116

µm cellulose acetate syringe filter (Alltech, Deerfield, IL, USA). The filtrates were placed in 40-mL 117

glass tubes and the pH was determined according to method NMX-AA-008-2011, using a digital 118

potentiometer (PerpHect LogR meter 310). 119

Spent catalyst was dried at room temperature for 48 h, in preparation for the determination of its 120

content of Ni and V, which was performed by ICP-OES (Varian Model 710-ES) at the beginning 121

and at the end of the microbial treatment. Samples of 100 mg of dry spent catalyst were placed in 122

cylindrical silicon carbide vials, 6 mL of concentrated HNO3 and 2 mL of concentrated HCl were 123

added, and the samples were digested in a microwave reaction system (Multiwave PRO, Anton 124

Paar), using an HF100 rotor. Digestion conditions were: 600 W for 6 vessels, 40 bar, 210-240°C, 125

with pRate of 0.3 bar sec-1

, ramp 10 min, hold 20 min, and cooling 15 min. Afterwards, 20 mL of 126

deionized water was added to the cylindrical vial and the supernatant was collected and filled up to 127

100 mL with deionized water. Metal analysis was performed at 231.604 nm for Ni and 292.401 nm 128

for V. The concentrations of Ni and V in spent catalyst were calculated based on a calibration curve 129

covering 0.1-10 mg kg-1

, using a commercial standard (High-Purity, cat. # ICP-200-7-6). The total 130

amounts of Ni and V removed from the catalyst were calculated by difference in concentration (mg 131

kg-1

) between day 0 and 7. Previous studies showed that these microorganisms reach stationary 132

stage and maximal metal removal at day 7 (Data not shown). 133

DNA extraction for PCR analysis 134

DNA was extracted from 30 mL of fresh microbial culture of B. megaterium and M. 135

liquefaciens; cells were collected by centrifugation, and cell lysis was performed using 200 µL of 136

buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA, 10 mM NaCl, 1% SDS), 0.1 g of glass beads, and 137

200 µL of phenol:chloroform:isoamyl alcohol (25:24:1, v/v). This was followed by two 30-sec 138

vortex pulses and a 30-sec incubation on ice. After centrifugation, the aqueous phase was collected 139

and DNA was precipitated using 2 volumes of absolute ethanol. 140

Page 6 of 23



Draft

7

PCR amplification of Ni-V resistance genes of B. megaterium and M. liquefaciens 141

Genes czcD, nccA, MexGHI-OpmD, cnrA, cnrT, cnrX, smtAB, hant, and VAN2 involved in 142

mechanisms of resistance to Ni and V were investigated in Bacillus megaterium MNSH1-9K-1 and 143

Microbacterium liquefaciens MNSH2-PHGII-2 using specific primers, most of which were 144

designed in this study (Table 1). The reactions were performed according to the specifications of 145

InvitrogenTM

, using the annealing temperatures listed in Table 1, in a Techne TC‐3000 Thermal 146

Cycler (Barloworld Scientific, USA), and the product was purified with the QIAquick gel extraction 147

kit (QIAGEN N.V., Netherlands). The PCR reaction mixtures were analyzed by electrophoresis 148

through 1% agarose gels, against 1-Kbp or 100-bp molecular-weight markers (Thermo Scientific), 149

visualized with GelRed (Invitrogen) by transillumination and photographed. 150

Phylogenetic analysis of PCR amplicons 151

The PCR amplicons were then pyrosequenced at MACROGEN, Korea; the nucleotides were 152

queried against a taxonomic database of high quality sequences derived from NCBI using BLASTN 153

(Altschul et al. 1990). A collection of taxonomically related sequences was obtained from the NCBI 154

Taxonomy Homepage and used to perform a multiple alignment analysis with T-coffee (Magis et 155

al. 2014). Only common gene regions were included in the phylogenetic tree, and similarity 156

analyses using the Jukes_Cantor model were performed with the MEGA 6 (Tamura et al. 2011). 157

The phylogenetic trees were constructed using the neighbor_joining method, and 500 bootstrap 158

replications were assessed to support internal branches (Hillis and Bull 1993). 159

Statistical analyses 160

The data were statistically analyzed using the Minitab 17 computer software with Tukey HSD 161

pairwise comparisons. 162

163

164

165

166

Page 7 of 23



Draft

8

Results 167

Growth of B. megaterium and M. liquefaciens in the presence of spent catalyst 168

The growth of B. megaterium and M. liquefaciens in PHGII medium containing Ni-V catalyst at 169

16% (w/v) pulp density over 7 days of incubation is shown in Figure 1. In general, B. megaterium 170

and M. liquefaciens remain viable during this treatment. B. megaterium increases its population 171

density from 6.5 ± 0.5 Log CFU/mL to 8.8 ± 1.0 Log CFU/mL, indicating that the catalyst does not 172

affect the development of this microorganism. In the case of M. liquefaciens the population density 173

decreased from 6.1± 0.2 Log CFU/mL to 4.6 ± 0.3 Log CFU/mL (Fig. 1); however, the 174

microorganisms remained viable during exposure to the catalyst and reached a maximum level of 175

6.9 ± 0.4 Log CFU/mL on day 2 (data not shown). 176

Nickel -Vanadium Removal from Spent Catalyst 177

The ability of B. megaterium and M. liquefaciens to remove nickel and vanadium from spent 178

catalyst at 16% (w/v) pulp density in PHGII medium over 7 days is shown in Figure 2. The amounts 179

removed by B. megaterium were 141.5 mg kg-1

of Ni and 1101.5 mg kg-1

of V, corresponding to

180

33.1% and 50.8% respectively. M. liquefaciens removed 76.04 mg kg-1

of Ni and 302.18 mg kg

-1 of 181

V, corresponding to 17.8% and 14.0 %, respectively (Figure 2). Dead biomass from B. megaterium 182

and M. liquefaciens removed 50.85 mg kg-1

and 10.39 mg kg-1

of Ni, and 117.09 mg kg-1

and 183

28.27 mg kg-1

of V, respectively (values were calculated subtracting the removal observed with the 184

abiotic control) (Figure 2). Thus, B. megaterium was more effective in the removal of either metal, 185

compared to M. liquefaciens. Both microorganisms were clearly more effective in removing 186

vanadium, compared to nickel. 187

The pH was tested during the kinetic runs, remaining steady between 5.5 and 5.8 throughout the 188

treatments (data not shown), indicating that the metal removal from the spent catalyst was not due 189

to acid production. 190

191

192

Page 8 of 23



Draft

9

Identification of Ni-V resistance genes 193

Molecular studies were undertaken to investigate the resistance ability of the microbial isolates 194

B. megaterium and M. liquefaciens on a gene level using conventional PCR, to check whether the 195

heavy-metal removal ability of the microorganisms is linked to specific genes such as czcD (Co, Zn, 196

Cd), hant (high-affinity nickel transporter of B. megaterium), nccA (Ni, Co, Cd-resistance), cnrA, 197

cnrX, and cnrT (Ni and Co-resistance), MexGHI-OpmD (V-resistance), VAN2 (V-resistance), and 198

smtAB (a gene encoding synechococcal metallothioneins). Four of the genes targeted in the gDNA 199

of B. megaterium, nccA, hant, smtAB, and VAN2, showed positive amplification, reproducibly 200

giving amplicons of the expected sizes: app. 1141 bp, app. 593 bp, app. 500 bp and app. 490 bp, 201

respectively (Data not shown). In contrast, the cnrA, cnrT, cnrX, czcD, and MexGHI-opmD (data 202

not shown) genes were not found in B. megaterium when tested for with the appropriate pairs of 203

primers. 204

In our testing of the M. liquefaciens gDNA, the nccA, hant, czcD, smtAB, MexGHI-OpmD, and 205

VAN2 genes were found with amplicons of app. 1200 bp for MexGHI-OpmD, app. 1000 bp for 206

czcD, and the rest with the sizes mentioned previously, while no PCR products were generated with 207

the cnrA, cnrT, and cnrX pairs of primers (Data not shown). The possible resistance ability of both 208

B. megaterium and M. liquefaciens towards V was showed by a positive amplification of gene VAN 209

2 (Data not shown). 210

Phylogenetic analysis of nccA, hant and czcD 211

Because of the smtAB, MexGHI-OpmD, and VAN2 shown some nonspecific amplicons during 212

experiments (Data not shown). The phylogenetic analysis from reproducible specific amplicons of 213

czcD, nccA, and hant genes were done. The nccA partial nucleotide sequences obtained from B. 214

megaterium were 95% and 97% identical with nccA from M. arabinogalactanolyticum (DQ485160) 215

and nccA of A. xylosoxidans (L31363). The nccA partial nucleotide sequences obtained from 216

M.liquefaciens were 99% and 98% identical with nccA from M. arabinogalactanolyticum 217

(DQ485160) and nccA of A. xylosoxidans (L31363) (Fig. 3). The hant partial nucleotide sequences 218

Page 9 of 23



Draft

10

obtained from B. megaterium and M. liquefaciens were 100% and 95% identical with hant of B. 219

megaterium WSH-002 (384044176). The czcD partial nucleotides sequence obtained from M. 220

liquefaciens were 97% identical with czcD from M. arabinogalactanolyticum (DQ485161), and 221

95% identical with czcD from Ralstonia sp.CH34 and 94%with the cation diffusion facilitator 222

family transporter from C. aquatic SB20 (KC432582) (Fig. 3). 223

224

Discussion 225

Nickel and vanadium removal from spent catalyst 226

This study examined the removal of nickel and vanadium from spent catalyst by B. megaterium 227

and M. liquefaciens. Both bacteria have previously been shown to have MICs > 200 ppm for Ni and 228

V (Gomez-Ramirez et al. 2015; Arenas-Isaac et al. 2015). B. megaterium is considered a 229

microorganism with a high potential for tolerating toxic elements, such as exposure to maximal 230

tolerable concentrations of (ppm): 1200 of Ni, 500 of Zn, 100 of Pb, 450 of Cu, and 300 of Cr 231

(Rajkumar, Ma, and Freitas 2013). On the other hand, M. liquefaciens from Ni-rich soil has been 232

reported with MICs (ppm) of 880.3 for Ni, 2070 for Pb, 10.0 for Hg, and 374. 6 for As (Abou-233

Shanab, van Berkum, and Angle 2007). The greater ability of B. megaterium, compared to M. 234

liquefaciens (Fig. 1) to grow in the presence of our spent catalyst, which contains numerous 235

elements (Ni, V, As, Cr, Mg, Fe, Mo, P, Zn, Cd, Zn, and Al) (Gomez-Ramirez et al. 2015), may be 236

related to the fact that the B. megaterium genome contains many predicted open reading frames 237

(ORFs) involved in stress responses: 26 for osmotic stress, 46 in oxidative processes, 2 for cold 238

shock, 14 for heat shock and 1 for detoxification (Pal et al. 2014). Also, this microorganism 239

contains seven plasmids, and different resistance functions have been reported for these (Eppinger 240

et al. 2011). 241

In the present comparison B. megaterium was the better microorganism in terms of nickel 242

(31.52%) and vanadium (50.77%) removal from spent catalyst (compare the M. liquefaciens 243

numbers of 17.88% and 14.09% respectively) (Fig. 2). Recently, B. megaterium has been used in 244

Page 10 of 23



Draft

11

biologically mediated recovery of rhenium and platinum from a Ni-V-free spent catalyst, Pt–245

Re/Al2O3, with recovery efficiencies of 17.7% of rhenium and 98% of platinum (Eppinger et al. 246

2011; Liu et al. 2011; Pal et al. 2014). A nickel-resistant Microbacterium sp. isolated from a nickel-247

electroplating industrial effluent was shown to be capable of converting soluble NiSO4 into 248

insoluble NiO nanoparticles (Sathyavathi et al. 2014). 249

Our results suggest that the removal of Ni and V in the two microorganisms tested is 250

accomplished primarily through a metabolism that may include ion carriers or enzymatic 251

detoxification, because much higher levels of nickel and vanadium removal were obtained with the 252

live cells compared to the dead-biomass control (Fig. 2). However, a small extent of metal removal 253

may have occurred through leaching by the culture medium and sorption by biomass. Such sorption 254

would be based on the fact that most microbial surfaces are negatively charged, due to the 255

ionization of functional groups, and thereby contribute to metal-ion binding (Yan and Viraraghavan 256

2003). In the present work we observed a significant fraction of the Ni removed by dead biomass 257

from B. megaterium (though not from M. liquefaciens), and no V removal by dead biomass from 258

either microorganism, possibly because, in contrast to cationic Ni2+

, the vanadium is present in the 259

form of a negatively charged ion, V043-

. 260

The growth medium in these experiments is not conducive to the biosynthesis of acids; at any 261

event, no significant pH reduction (p>0.1) was seen over the course of the experiments, and acid 262

leaching of the metals should therefore be unimportant (Amiri et al.2011). 263

Nickel and vanadium gene identification in B. megaterium and M. liquefaciens 264

Both microorganisms, B. megaterium and M. liquefaciens, can tolerate high concentrations of Ni 265

and V and remove metals from wastes, but our understanding of the underlying mechanisms is 266

incomplete. Metal tolerance is essential for microbial survival in soils with high metal content. 267

Some microorganisms are naturally metal tolerant, whereas others have developed various 268

resistance mechanisms to survive in hostile conditions (Babich and Stotzky 1985; Das et al. 2014). 269

Page 11 of 23



Draft

12

The search for metal resistance genes may help to understand the metabolism involved. The 270

nccA and hant genes were found in both bacteria, and czcD gene in M. liquefaciens. 271

Concerning nickel resistance, the primer pair ncc upper/ncc lower yielded the expected 1141-bp 272

product both with B. megaterium and M. liquefaciens (Data not shown), similar to what is observed 273

for C. metallidurans CH34 (Schmidt and Schlegel 1994) and were identified by phylogenetic 274

analysis (Fig. 3). This confirms the molecular-level resistance of both microorganisms to this 275

element. Gene nccA encodes a transmembrane protein that allows entry of nickel, cobalt, and 276

cadmium into the cell (Schmidt and Schlegel 1994). It is known that ncc loci contain seven open 277

reading frames, designated nccYXHCBAN, where nccA functions as a regulator (Schmidt and 278

Schlegel 1994). Recently, this gene has been identified in Achromobacter xylosoxidans, 279

Sphingobacterium heparinum, Burkholderia sp., Comamonas sp., Flavobacterium sp., Arthrobacter 280

sp., Rhizobium sp., Microbacterium arabinogalactanolyticum, Bacillus flexus, and some species of 281

Marinobacter (Abou-Shanab et al. 2007; Kamika and Momba 2013). 282

As expected, the hant amplicon was obtained in B. megaterium and was also found in M. 283

liquefaciens and identified by phylogenetic analysis (Fig. 3). This gene encodes a high-affinity 284

nickel transporter which had been identified in the strains DSM 319, QM B1551, and WSH-002 of 285

B. megaterium (Eppinger et al. 2011; Liu et al. 2011; Pal et al. 2014), but had not been reported in 286

M. liquefaciens. 287

Presumptive evidence for the presence of the czc locus in the genome of M. liquefaciens was 288

obtained by using the primer pair czcD reported by Abou-Shanab et al. (2007) and were identified 289

by phylogenetic analysis (Fig. 3). The efflux chemiosmotic transporters czc have been widely 290

reported in C. metallidurans (Diels et al. 1995), Burkholderia sp. (Brim et al. 1999), Bacillus 291

subtilis (Guffanti et al. 2002), and Pseudomonas sp. (Hu and Zhao 2007), and have been related to 292

nickel resistance in bacteria of the genera Bacillus and Microbacterium (Abou-Shanab et al. 2007). 293

Metal resistance has been reported for a number of bacteria, most frequently for C. 294

metallidurans, which has several genes encoding resistance to toxic heavy metals (Schmidt and 295

Page 12 of 23



Draft

13

Schlegel 1994). These genes are located either within the bacterial chromosome or on one of the 296

two plasmids pMOL28 or pMOL30 (Mergeay et al. 1985; Siddiqui et al. 1989; Liesegang et al. 297

1993). Some studies have linked the metal-removal capacity to the presence of resistance genes like 298

nccA, smtAB, and cnrB, identified in some species of the genus Marinobacter isolated from the soil 299

of a vanadium mine. These microorganisms are capable of removing 23.96 % of Ni and 30.15% of 300

V from modified wastewater liquid media containing 100 ppm of Ni and V (Kamika and Momba 301

2014). Also, Bacillus sp. and Arthrobacter sp. isolated from uranium mine wastes were able to 302

remove 257 mg kg-1

of U, 250 mg kg-1

of Th, 26.77 mg kg-1

of Cu, 305 mg kg-1

of Cd, 16.25 mg kg-1

303

of Zn, and 14.5 mg kg-1

of Ni, and were found to contain genes that encode P(1B)-type ATPases 304

(Cu-CPx and Zn-CPx) and ABC transporters (nik) (Choudhary et al. 2012). Because these metal-305

resistance genes are frequently located on plasmids, the suggestion has been made that they may be 306

spread to divergent bacteria by horizontal transfer (Barkay et al. 1985). 307

The detection of the metal resistance genes within the genomes of B. megaterium (nccA and 308

hant) and M. liquefaciens (hant and czcD) in the present work suggests that these genes are shared 309

in a bacterial community exposed to high metal concentrations, e.g. in mining soils, and they might 310

be some of the genetic determinants that enable bacteria to remove Ni and V from spent catalysts. 311

Though more genes were identified in M. liquefaciens, compared to B. megaterium, these may have 312

functions more related to metal resistance than to metal removal, so that B. megaterium still ends up 313

being the better metal remover of the two tested. 314

315

Conclusions 316

For the first time nccA gene was identified by phylogenetic analysis in B. megaterium and nccA, 317

czcD, and hant, genes in M. liquefaciens. These genes are of interest for the potential of these 318

bacteria as biological agents for the elimination of nickel and vanadium from hazardous wastes. 319

320

Acknowledgements 321

Page 13 of 23



Draft

14

This project was supported by stipend No. 356684 and grant 131203 from CONACYT, Mexico, 322

and 20151560 from BEIFI, Instituto Politécnico Nacional, Mexico. 323

Page 14 of 23



Draft

15

References 324

325

Abou-Shanab, R. A., van Berkum, P., and Angle, J. S. 2007. Heavy metal resistance and genotypic 326

analysis of metal resistance genes in gram-positive and gram-negative bacteria present in 327

Ni-rich serpentine soil and in the rhizosphere of Alyssum murale. Chemosphere 68 (2):360-328

7. 329

Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. 1990. Basic local alignment 330

search tool. J. Mol. Biol. 215 (3):403-10. 331

Amiri, F., Yaghmaei, S., and Mousavi, S. M. 2011. Bioleaching of tungsten-rich spent 332

hydrocracking catalyst using Penicillium simplicissimum. Bioresour. Technol. 102 333

(2):1567-73. 334

Arenas-Isaac, G., Montero-Aviles, L. A., Fierros-Romero, G., Gomez-Ramirez, M., and Rojas-335

Avelizapa, N. G. 2015. Novel microorganisms for the treatment of Ni and V of spent 336

catalysts. In Press. 337

Babich, H., and Stotzky, G. 1985. Heavy metal toxicity to microbe-mediated ecologic processes: a 338

review and potential application to regulatory policies. Environ. Res. 36 (1):111-37. 339

Barkay, T., Tripp, S. C., and Olson, B. H. 1985. Effect of metal-rich sewage sludge application on 340

the bacterial communities of grasslands. Appl. Environ. Microbiol. 49 (2):333-7. 341

Baysse, C., De Vos, D., Naudet, Y., Vandermonde, A., Ochsner, U., Meyer, J. M., Budzikiewicz, 342

H., Schafer, M., Fuchs, R., and Cornelis, P. 2000. Vanadium interferes with siderophore-343

mediated iron uptake in Pseudomonas aeruginosa. Microbiology. 146 (Pt 10):2425-34. 344

Bowman, B. J. 1983. Vanadate uptake in Neurospora crassa occurs via phosphate transport system 345

II. J. Bacteriol. 153 (1):286-91. 346

Brim, H., Heyndrickx, M., de Vos, P., Wilmotte, A., Springael, D., Schlegel, H. G., and Mergeay, 347

M. 1999. Amplified rDNA restriction analysis and further genotypic characterisation of 348

metal-resistant soil bacteria and related facultative hydrogenotrophs. Syst. Appl. Microbiol. 349

22 (2):258-68. 350

Bruins, M. R., Kapil, S., and Oehme, F. W. 2000. Microbial resistance to metals in the environment. 351

Ecotoxicol. Environ. Saf. 45 (3):198-207. 352

Campbell, P. M., and Smith, G. D. 1986. Transport and accumulation of nickel ions in the 353

cyanobacterium Anabaena cylindrica. Arch. Biochem. Biophys. 244 (2):470-7. 354

Cantley, L. C., Jr., Resh, M. D., and Guidotti, G. 1978. Vanadate inhibits the red cell (Na+, K+) 355

ATPase from the cytoplasmic side. Nature. 272 (5653):552-4. 356

Choudhary, S., Islam, E., Kazy, S. K., and Sar, P. 2012. Uranium and other heavy metal resistance 357

and accumulation in bacteria isolated from uranium mine wastes. J. Environ. Sci. Health A. 358

Tox. Hazard. Subst. Environ. Eng. 47 (4):622-37. 359

Das, S., Mishra, J., Das, S. K., Pandey, S., Rao, D. S., Chakraborty, A., Sudarshan, M., Das, N., and 360

Thatoi, H. 2014. Investigation on mechanism of Cr(VI) reduction and removal by Bacillus 361

amyloliquefaciens, a novel chromate tolerant bacterium isolated from chromite mine soil. 362

Chemosphere. 96:112-21. 363

Diels, L., Dong, Q., van der Lelie, D., Baeyens, W., and Mergeay, M. 1995. The czc operon of 364

Alcaligenes eutrophus CH34: from resistance mechanism to the removal of heavy metals. J. 365

Ind. Microbiol. 14 (2):142-53. 366

Dong, Q., Springeal, D., Schoeters, J., Nuyts, G., Mergeay, M., and Diels, L. 1998. Horizontal 367

transfer of bacterial heavy metal resistance genes and its applications in activated sludge 368

systems. Water Sci. Technol. 37 (4–5):465-468. 369

Eppinger, M., Bunk, B., Johns, M. A., Edirisinghe, J. N., Kutumbaka, K. K., Koenig, S. S., Creasy, 370

H. H., Rosovitz, M. J., Riley, D. R., Daugherty, S., Martin, M., Elbourne, L. D., Paulsen, I., 371

Biedendieck, R., Braun, C., Grayburn, S., Dhingra, S., Lukyanchuk, V., Ball, B., Ul-Qamar, 372

R., Seibel, J., Bremer, E., Jahn, D., Ravel, J., and Vary, P. S. 2011. Genome sequences of 373

Page 15 of 23



Draft

16

the biotechnologically important Bacillus megaterium strains QM B1551 and DSM319. J. 374

Bacteriol. 193 (16):4199-213. 375

Gomez-Ramirez, M., Montero-Alvarez, L. A., Tobon-Aviles, A. , Fierros-Romero, G., and Rojas-376

Avelizapa, N. G. 2015. Microbacterium oxydans and Microbacterium liquefaciens: A 377

biological alternative for the treatment of Ni-V-containing wastes. J. Environ. Sci. Health 378

A. Tox. Hazard. Subst. Environ. Eng .50 (6):602-10. 379

Guffanti, A. A., Wei, Y., Rood, S. V., and Krulwich, T. A. 2002. An antiport mechanism for a 380

member of the cation diffusion facilitator family: divalent cations efflux in exchange for K+ 381

and H+. Mol. Microbiol. 45 (1):145-53. 382

Gutierrez, J. C., Amaro, F., and Martin-Gonzalez, A.. 2009. From heavy metal-binders to 383

biosensors: ciliate metallothioneins discussed. Bioessays. 31 (7):805-16. 384

Hillis, D. M., and Bull, J. J. 1993. An Empirical Test of Bootstrapping as a Method for Assessing 385

Confidence in Phylogenetic Analysis. Syst. Biol. 42 (2):182-192. 386

Hinojosa, M. B., Carreira, J. A., Garcia-Ruiz, R., and Dick, R. P. 2005. Microbial response to heavy 387

metal-polluted soils: community analysis from phospholipid-linked fatty acids and ester-388

linked fatty acids extracts. J. Environ. Qual. 34 (5):1789-800. 389

Hu, N., and Zhao, B. 2007. Key genes involved in heavy-metal resistance in Pseudomonas putida 390

CD2. FEMS Microbiol. Lett. 267 (1):17-22. 391

Jarrell, K. F., and Sprott, G. D. 1982. Sprott. 1982. Nickel transport in Methanobacterium bryantii. 392

J. Bacteriol. 151 (3):1195-203. 393

Kamika, I., and Momba, M. N. 2013. Assessing the resistance and bioremediation ability of 394

selected bacterial and protozoan species to heavy metals in metal-rich industrial 395

wastewater. BMC Microbiol. 13 (28):1471-2180. 396

Kamika, I., and Momba, M. N. 2014. Microbial diversity of Emalahleni mine water in South Africa 397

and tolerance ability of the predominant organism to vanadium and nickel. PLoS One 9 (1). 398

Kanik-Ennulat, C., Montalvo, E., and Neff, N. 1995. Sodium orthovanadate-resistant mutants of 399

Saccharomyces cerevisiae show defects in Golgi-mediated protein glycosylation, 400

sporulation and detergent resistance. Genetics. 140 (3):933-43. 401

Kanik-Ennulat, C., and Neff, N. 1990. Vanadate-resistant mutants of Saccharomyces cerevisiae 402

show alterations in protein phosphorylation and growth control. Mol. Cell. Biol. 10 (3):898-403

909. 404

Liesegang, H., Lemke, K., Siddiqui, R. A., and Schlegel, H. G. 1993. Characterization of the 405

inducible nickel and cobalt resistance determinant cnr from pMOL28 of Alcaligenes 406

eutrophus CH34. J. Bacteriol. 175 (3):767-78. 407

Liu, L., Li, Y., Zhang, J., Zou, W., Zhou, Z., Liu, J., Li, X., Wang, L., and Chen, J. 2011. Complete 408

genome sequence of the industrial strain Bacillus megaterium WSH-002. J. Bacteriol. 193 409

(22):6389-90. 410

Lohmeyer, M., and Friedrich, C. G. 1987. Nickel transport in Alcaligenes eutrophus. Arch. 411

Microbiol. 149 (2):130-135. 412

Lundie, L. L., Jr., Yang, H. C. , Heinonen, J. K., Dean, S. I., and Drake, H. L. 1988. Energy-413

dependent, high-affinity transport of nickel by the acetogen Clostridium thermoaceticum. J. 414

Bacteriol. 170 (12):5705-8. 415

Magis, C., Taly, J. F., Bussotti, G., Chang, J. M., Di Tommaso, P., Erb, I., Espinosa-Carrasco, J. , 416

and Notredame, C. 2014. T-coffee: tree-based consistency objective function for alignment 417

evaluation. Methods Mol. Biol.646-677. 418

Mergeay, M., Nies, D., Schlegel, H. G., Gerits, J., Charles, P., and Van Gijsegem, F. 1985. 419

Alcaligenes eutrophus CH34 is a facultative chemolithotroph with plasmid-bound 420

resistance to heavy metals. J. Bacteriol. 162 (1):328-34. 421

Mulrooney, S. B., and Hausinger, R. P. 2003. Nickel uptake and utilization by microorganisms. 422

FEMS Microbiol. Rev. 27 (2-3):239-61. 423

Page 16 of 23



Draft

17

Nies, D. H. 2003. Efflux-mediated heavy metal resistance in prokaryotes. FEMS Microbiol. Rev. 27 424

(2-3):313-39. 425

Pal, K. K., Dey, R., Sherathia, D., Vanpariya, S., Patel, I., Dalsania, T., Savsani, K., Sukhadiya, B., 426

Mandaliya, M., Thomas, M., Ghorai, S., Rupapara, R., Rawal, P., Shah, A., and Bhayani, S. 427

2014. Draft Genome Sequence of a Moderately Halophilic Bacillus megaterium Strain, 428

MSP20.1, Isolated from a Saltern of the Little Rann of Kutch, India. Genome Announc. 2 429

(1):01134-13. 430

Philippaerts, A., Goossens, S., Jacobs, P. A., and Sels, B. F. 2011. Catalytic production of 431

conjugated fatty acids and oils. Chem. Sus. Chem. 4 (6):684-702. 432

Poster, J. B., and Dean, N. 1996. The yeast VRG4 gene is required for normal Golgi functions and 433

defines a new family of related genes. J. Biol. Chem. 271 (7):3837-45. 434

Rajkumar, M., Ma, Y., and Freitas, H. 2013. Improvement of Ni phytostabilization by inoculation 435

of Ni resistant Bacillus megaterium SR28C. J. Environ. Manag. 128 (0):973-980. 436

Rocchetti, L., Fonti, V., Veglio, F., and Beolchini, F. 2013. An environmentally friendly process for 437

the recovery of valuable metals from spent refinery catalysts. Waste Manag. Res. 31 438

(6):568-76. 439

Sandrin, T. R., Chech, A. M., and Maier, R. M. 2000. A rhamnolipid biosurfactant reduces 440

cadmium toxicity during naphthalene biodegradation. Appl. Environ. Microbiol. 66 441

(10):4585-8. 442

Sathyavathi, S., Manjula, A., Rajendhran, J., and Gunasekaran, P. 2014. Extracellular synthesis and 443

characterization of nickel oxide nanoparticles from Microbacterium sp. MRS-1 towards 444

bioremediation of nickel electroplating industrial effluent. Bioresour. Technol. 165:270-3. 445

Schmidt, T., and Schlegel, H. G. 1994. Combined nickel-cobalt-cadmium resistance encoded by the 446

ncc locus of Alcaligenes xylosoxidans 31A. J. Bacteriol. 176 (22):7045-54. 447

Siddiqui, R. A., Benthin, K., and Schlegel, H. G. 1989. Cloning of pMOL28-encoded nickel 448

resistance genes and expression of the genes in Alcaligenes eutrophus and Pseudomonas 449

spp. J. Bacteriol. 171 (9):5071-8. 450

Stoppel, R., and Schlegel, H. G. 1995. Nickel-resistant bacteria from anthropogenically nickel-451

polluted and naturally nickel-percolated ecosystems. Appl. Environ. Microbiol. 61 452

(6):2276-85. 453

Taghavi, S., Delanghe, H., Lodewyckx, C., Mergeay, M. and van der Lelie, D. 2001. Nickel-454

resistance-based minitransposons: new tools for genetic manipulation of environmental 455

bacteria. Appl. Environ. Microbiol. 67 (2):1015-9. 456

Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., and Kumar, S. 2011. MEGA5: 457

molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, 458

and maximum parsimony methods. Mol. Biol. Evol. 28 (10):2731-9. 459

Torres-Martinez, L. N., Kharisov, B. I., and Elizondo, N. V. 2001. V and Mo recovery of spent 460

catalysts for the petrochemical industry. Part I. Principles and recovery methods. Ciencia 461

UANL. 4. 462

Vandermeulen, G., Marie, C., Scherman, D., and Preat, V. 2011. New generation of plasmid 463

backbones devoid of antibiotic resistance marker for gene therapy trials. Mol. Ther. 19 464

(11):1942-9. 465

Yan, G., and Viraraghavan, T. 2003. Heavy-metal removal from aqueous solution by fungus Mucor 466

rouxii. Water Res. 37 (18):4486-4496. 467

Zhang, W. H., Huang, Z., He, L. Y., and Sheng, X. F. 2012. Assessment of bacterial communities 468

and characterization of lead-resistant bacteria in the rhizosphere soils of metal-tolerant 469

Chenopodium ambrosioides grown on lead-zinc mine tailings. Chemosphere. 87 (10):1171-470

8. 471

Zhu, H., Guo, J., Chen, M., Feng, G., and Yao, Q. 2012. Burkholderia Dabaoshanensis sp. nov., a 472

heavy-metal-tolerant bacteria isolated from Dabaoshan mining area soil in China. PLoS 473

One. 7 (12):4. 474

Page 17 of 23



Draft

18

475

Page 18 of 23



Draft

Table 1. PCR primers used to test for metal-related genes.

Gene Metal-resistance

mechanism

Sequence (5´ to 3´) Orientation Amplicon

size (bp)

Annealing

temperature

(ºC)

Reference

czcD Cation- proton

antiporter

ATCTTTTACCACCATGGGCGCA

GGTCACTCACACGAC

Forward 1000 60 (Nies et al. 1989)

GCTGAACATCATACCCTAGTTT

CCTCTGCAGCAAGCGA

Reverse

nccA Energy-dependent

ion-efflux

ACGCCGGACATCACGAACAAG Forward 1141 54 (Abou-Shanab,

van Berkum, and

Angle 2007) CCAGCGCACCGAGACTCATCA Reverse

smtAB Metal-binding

metallothionein

GATCGACGTTGCAGAGACAG Forward 500 52 (Naz et al. 2005)

GATCGAGGGCGTTTTGATAA Reverse

cnrA Membrane-bound

protein complex

of energy-

dependent

CCTACGATCTCGCAGGTGAC Forward 422 60 This study

GCAGTGTCACGGAAACAACC Reverse

cnrT GGGTGGTGTTCAAGGAGAAT Forward 420 58 This study

CAAGCAGGACGCCAAATAATG Reverse

cnrX TCCTTGTCTACGCTGTTTGG Forward 388 58 This study

GTACGTAAGCAGGTCGATGTT Reverse

MexGHI-

OpmD

Multidrug type

Efflux pump

CAGTGGGAAATCGACCTGTT Forward 1200 58 This study

TTCGGCCAGTTGGTTGAG Reverse

Hant High-affinity

nickel transporter

CGGATTGGATGCAGATCACTTA Forward 593 55 This study

AGCAGATCGCCCAAACTTAC Reverse

VAN2 Component of

ATPase type

efflux pump

TGCTTTTCGTGCAATCTTTGGT Forward 490 58 This study

GGCAATTGGCAGCTTGTTCA Reverse

Page 19 of 23



Draft

1

Figure captions: 1

2

Fig. 1. Growth of B. megaterium and M. liquefaciens in PHGII medium containing spent Ni-V 3

catalyst at 16%, evaluated at time 0 and 7 days, 30°C, 150 rpm. 4

5

Fig. 2. Percentage of Ni and V removal from spent Ni-V catalyst at 16% (w/v) by B. megaterium 6

and M. liquefaciens in PHGII medium after 7 days of incubation at 30°C, 150 rpm. Statistically 7

significant differences (one-way ANOVA with Tukey HSD (P < 0.05) are indicated by different 8

letters. 9

10

Fig. 3. The cladogram of metal resistance genes was constructed by using MEGA 6 software. 11

Evolutionary relationships were estimated by UPGMA method with 500 bootstrap value to obtain 12

the consensus tree. Evolutionary distances were calculated using the Jukes-Cantor method. Bar, 0.2 13

substitutions per nucleotide position. 14

Page 20 of 23



Draft

Fig. 1

3

4

5

6

7

8

9

10

B. megaterium M. liquefaciens

Population density

(Log 10UFC/mL)

0 days 7 days

Page 21 of 23



Draft

Fig. 2

Page 22 of 23



Draft

Fig. 3

ncc

YXH

CBA gen

es A

. xyloso

xid

ans (L

31363)

nccA M

. liquefac

iens strain M

NSH2-PHGII-2

nccA M

. arabi

nogala

binoga

lactan

olyticu

m (DQ485

160)

nccA B.megaterium strain MNSHI-9K-1

CzcD like gene M

.arabinogalactanolyticum(D

Q485161)

CzcD

M.liq

uefa

ciens stra

in M

NSH2-P

HGII-2

Czc

D R

alstonia sp. CH34(1

731912)

Catio

n diffu

sion facilitator fa

mily tran

sporter C

.aqu

atica str

ain SB

20 (K

C432582)

hant M. liquefaciens str

ain MNSH2-PHGII-2

High affinity nickel transporter B.megaterium strain WSH00 (384044176)

han

t B.m

egaterium strain

MNSH1-9K

-1

0.2

Page 23 of 23



draft - pdfs.semanticscholar.org...draft 2 13 abstract: bacillus megaterium mnsh1-9k-1 and...

Documents