Draft
Identification of Bacillus megaterium and Microbacterium
liquefaciens genes involved in metal resistance and metal removal
Journal: Canadian Journal of Microbiology
Manuscript ID cjm-2015-0507.R2
Manuscript Type: Article
Date Submitted by the Author: 25-Jan-2016
Complete List of Authors: Fierros-Romero, Grisel; INSTITUTO POLITECNICO NACIONAL,
BIOTECHNOLOGY Gomez-Ramirez, Marlenne; INSTITUTO POLITECNICO NACIONAL, BIOTECHNOLOGY Arenas-Isaac, Ginesa E.; INSTITUTO POLITECNICO NACIONAL, BIOTECHNOLOGY Pless-Elling, Reynaldo C.; INSTITUTO POLITECNICO NACIONAL, BIOTECHNOLOGY ROJAS-AVELIZAPA, NORMA G.; INSTITUTO POLITECNICO NACIONAL, BIOTECHNOLOGY
Keyword: Ni-V removal, spent catalyst, Bacillus megaterium, Microbacterium liquefaciens, metal resistance
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
1
Identification of Bacillus megaterium and Microbacterium liquefaciens genes involved in metal 1
resistance and metal removal 2
3
Grisel Fierros-Romero, Marlenne Gómez-Ramírez, Ginesa E. Arenas-Isaac, Reynaldo C. Pless, and 4
Norma G. Rojas-Avelizapa*
5
6
7
Centro de Investigación en Ciencia Aplicada y Tecnología Avanzada del IPN, Cerro Blanco 141, Col. Colinas 8
del Cimatario, Querétaro, Querétaro 76090, Mexico 9
Phone: +52 (442) 229 08 04 Ext. 81031. 10
*Corresponding author: e-mail: [email protected] 11
12
Page 1 of 23
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
2
Abstract: Bacillus megaterium MNSH1-9K-1 and Microbacterium liquefaciens MNSH2-PHGII-2, 13
two nickel-vanadium resistant bacteria from mine tailings located in Guanajuato, Mexico, are 14
shown to have the ability to remove 33.1% and 17.8% of Ni and 50.8% and 14.0% of V, 15
respectively, from spent petrochemical catalysts containing 428 ± 30 mg kg-1
of Ni and 2165 ± 77 16
mg kg-1
of V. In these strains, several Ni resistance determinants were detected by conventional 17
PCR. The nccA (Ni-Co-Cd was found for the first time in B. megaterium. In M. liquefaciens the 18
above gene and, additionally czcD gene (Co-Zn-Cd resistance) and a high-affinity nickel transporter 19
were detected for the first time. This study characterizes the resistance of M. liquefaciens and B. 20
megaterium to nickel through the expression of genes conferring metal resistance. 21
Keywords: Ni-V removal, spent catalyst, Bacillus megaterium, Microbacterium liquefaciens, metal 22
resistance. 23
24
Résumé: Bacillus megaterium MNSH1-9K-1 et Microbacterium liquefaciens MNSH2-PHGII-2, 25
deux bactéries résistantes à nickel et vanadium, obtenues des décombres miniers de l’état de 26
Guanajuato, Mexique, se montrent capables d’enlever 33.1% et 17.8% de Ni, et 50.8% et 14.0% de 27
V, respectivement, des catalyseurs épuisés avec une teneur de 428 ± 30 mg kg-1
de Ni et 2165 ± 77 28
mg kg-1
de V. Dans cettes souches, plusieurs déterminants de résistance à Ni furent détectés par 29
PCR conventionelle. Le gène nccA (resistance à Ni, Co et Cd) fut détecté pour la première fois en 30
B. megaterium. En M. liquefaciens, les gènes mentionnés ci-dessus et, en plus czcD (résistance à 31
Co, Zn et Cd) et un porteur de nickel de haute affinité furent détectés pour la première fois. Cette 32
recherche caractérise la resistance de M. liquefaciens et B. megaterium à nickel, au moyen de 33
l’expression de gènes conférants une résistance aux métaux. 34
35
Mots-clés: enlèvement de Ni et V, catalyseur épuisé, Bacillus megaterium, Microbacterium 36
liquefaciens, résistance aux métaux. 37
38
Page 2 of 23
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
3
Introduction 39
Spent catalysts from the petrochemical industry contain a variety of toxic elements that define 40
them as hazardous wastes, requiring special handling to prevent metal accumulation in the 41
environment. During petroleum refining processes, hydrotreating catalyst accumulate nickel and 42
vanadium, present in petroleum streams, that cause poisoning decreasing their catalytic activity, 43
then they must be discharged and disposed as hazardous wastes (Torres-Martinez et al. 2001; 44
Philippaerts et al. 2011). 45
Nowadays, these wastes are treated by chemical methods which themselves generate toxic 46
wastes (Rocchetti et al. 2013). Biological methods represent an environment-friendly alternative 47
because they obviate the use of these chemicals. Such biological methods, take advantage of the 48
adaptive mechanisms of the microorganisms to survive and grow in hostile environments, such as 49
polluted industrial and mining areas. These adaptations are considered a valuable tool in the 50
treatment of toxic wastes (Hinojosa et al. 2005). 51
Nickel is a trace element for bacteria, serving as an essential component of enzymes such as 52
ureases, hydrogenases, CO dehydrogenases, and enzymes in the metabolism of strictly anaerobic 53
bacteria (Mulrooney and Hausinger 2003). Compared to nickel, vanadium appears to have less of an 54
intrinsic biological role in bacteria. Divers mechanisms can be involved in heavy-metal resistance in 55
bacteria, such as blocking the entry of toxic ions into the cells, enzymatic detoxification, 56
intracellular sequestration of the metals by metal-binding proteins and energy-driven cation/anion 57
efflux systems encoded by resistance genes such as czcCBA, cnrYXHCBA, and nccCBA (Mergeay 58
et al. 1985; Diels et al. 1995; Bruins et al. 2000; Taghavi et al. 2001). Trace elements such as Zn2+
, 59
Co2+
, V4+
, V
5+, and Ni
2+ are usually actively transported into or out of cells against concentration 60
gradients (Nies 2003). Among the transporter systems reported are cation/anion pumps: I) Cation 61
diffusion facilitators (CDF) carrying cadmium, cobalt, nickel, and iron ions; the prototype is czcD 62
(Diels et al. 1995), II) P-type ATPases (Sandrin et al. 2000; Nies 2003), III) The bacterial family of 63
RND transporters (resistance, nodulation and cell division(Zhang et al. 2012; Zhu et al. 2012). 64
Page 3 of 23
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
4
Some of these high-affinity energy-dependent metal transport systems have been described for 65
nickel in Cupriavidus metallidurans (Lohmeyer and Friedrich 1987), Anabaena cylindrica 66
(Campbell and Smith 1986), Methanobacterium bryantii (Jarrell and Sprott 1982), and Clostridium 67
thermoaceticum (Lundie et al. 1988); these efflux-mediated systems mostly use plasmid-encoded 68
mechanisms involving operons such as cnrYXHCBA, czcCBA, or nccCBA, whereby the toxic ions 69
enter the cell via active transport (an ATPase pump) or diffusion (a chemiosmotic ion or proton 70
pump) (Nies 2003; Gutierrez et al. 2009). The cnrYXHCBA operon of Cupriavidus metallidurans 71
is the most frequently studied genetic determinant; it mediates high levels of nickel resistance (up to 72
10 mM) (Liesegang et al. 1993; Stoppel and Schlegel 1995). Broad-host-range expression of the 73
nccCBA (nickel-cobalt-cadmium resistance) operon was also found in many nickel-resistant strains 74
of Cupriavidus metallidurans, Achromobacter xylosoxidans, Sphingobacterium heparinum, 75
Burkholderia, Comamonas, Flavobacteria, and Arthrobacter (Dong et al. 1998; Brim et al. 1999). 76
The nccCBA complex also shows close similarities to the czcCBA complex, which seems to be a 77
three-component cation-proton antiporter (Schmidt and Schlegel 1994). 78
Among the mechanisms reported for vanadium resistance are an iron-dependent superoxide 79
dismutase (sodB) (Baysse et al. 2000) and an efflux pump, MexGHI-opmD, both conferring 80
resistance in Pseudomonas aeruginosa against V (Vandermeulen et al. 2011). It has been 81
demonstrated that vanadate can enter the cell via the phosphate transport system in erythrocytes 82
(Cantley et al. 1978) and in Neurospora crassa (Bowman 1983). The VAN1 and VAN2 genes 83
identified in Saccharomyces confer resistance to V through mechanisms which are still unclear. The 84
VAN2 gene (also known as VRG4) encodes a 39.6-kDa protein with multiple transmembrane 85
domains, and VAN2 deletions are lethal (Kanik-Ennulat and Neff 1990; Kanik-Ennulat et al. 1995; 86
Poster and Dean 1996). 87
The present paper studies the resistance of Bacillus megaterium and Microbacterium 88
liquefaciens to Ni and V through the expression of genes conferring resistance to these metals, in 89
order to understand the mechanisms involved in the process, with a view to a possible use of these 90
Page 4 of 23
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
5
microorganisms in the biological treatment of spent catalyst for its safe disposal or for potential 91
nickel-vanadium recovery. 92
93
Materials and methods 94
Bacteria source 95
The bacterial strains Bacillus megaterium MNSH1-9K-1 (GenBank accession number 96
KM654562.1) and Microbacterium liquefaciens MNSH2-PHGII-2 (GenBank accession number 97
KJ848325.1) used in this study stem from the El Nopal mine in the state of Guanajuato, Mexico 98
(Arenas-Isaac et al. 2015; Gomez-Ramirez et al. 2015). 99
Spent catalyst 100
The spent catalyst used for the studies of Ni and V removal was provided by the Mexican 101
Petroleum Institute (Mexico City). It was used in oil hydrotreating processes and contains a variety 102
of metals in different concentrations on an alumina matrix. Metal characterization of this spent 103
catalyst by ICP-EOS had shown concentrations of Ni2+
and V5+
of 428±30 mg kg-1
and 2165±77 mg 104
kg-1
, respectively. Other elements detected include (in mg kg-1
): As (821.5±30), Cr (66.4±15), Fe 105
(3994±29), Mg (525.6±45), Mo (18.3±0.4), P (75.6±50), Zn (53.7±40), and Al (103071.6±546) 106
(Gomez-Ramirez et al. 2015). 107
Studies of Ni and V removal from spent catalyst by isolates 108
First, an inoculum was prepared as follows: each isolate was grown for 24 to 48 h in PHGII 109
liquid media at 150 rpm, 30°C, and the microbial density of each isolate was adjusted to 3x108 110
CFU/mL by microscopic enumeration with a cell-counting Neubauer camera. 2-mL inocula were 111
added to experimental sets, which were prepared in 125-mL Erlenmeyer flasks containing 20 mL of 112
PHGII medium plus spent catalyst at 16% (w/v) pulp density. Controls prepared in triplicate 113
consisting of dead biomass (to evaluate adsorption processes) and non-inoculated flasks were 114
Page 5 of 23
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
6
included. The flasks were incubated at 30°C, 150 rpm for 7 days. After the incubation period, 115
microbial growth was determined by cell counting. The liquid phase was filtered off using a 0.22-116
µm cellulose acetate syringe filter (Alltech, Deerfield, IL, USA). The filtrates were placed in 40-mL 117
glass tubes and the pH was determined according to method NMX-AA-008-2011, using a digital 118
potentiometer (PerpHect LogR meter 310). 119
Spent catalyst was dried at room temperature for 48 h, in preparation for the determination of its 120
content of Ni and V, which was performed by ICP-OES (Varian Model 710-ES) at the beginning 121
and at the end of the microbial treatment. Samples of 100 mg of dry spent catalyst were placed in 122
cylindrical silicon carbide vials, 6 mL of concentrated HNO3 and 2 mL of concentrated HCl were 123
added, and the samples were digested in a microwave reaction system (Multiwave PRO, Anton 124
Paar), using an HF100 rotor. Digestion conditions were: 600 W for 6 vessels, 40 bar, 210-240°C, 125
with pRate of 0.3 bar sec-1
, ramp 10 min, hold 20 min, and cooling 15 min. Afterwards, 20 mL of 126
deionized water was added to the cylindrical vial and the supernatant was collected and filled up to 127
100 mL with deionized water. Metal analysis was performed at 231.604 nm for Ni and 292.401 nm 128
for V. The concentrations of Ni and V in spent catalyst were calculated based on a calibration curve 129
covering 0.1-10 mg kg-1
, using a commercial standard (High-Purity, cat. # ICP-200-7-6). The total 130
amounts of Ni and V removed from the catalyst were calculated by difference in concentration (mg 131
kg-1
) between day 0 and 7. Previous studies showed that these microorganisms reach stationary 132
stage and maximal metal removal at day 7 (Data not shown). 133
DNA extraction for PCR analysis 134
DNA was extracted from 30 mL of fresh microbial culture of B. megaterium and M. 135
liquefaciens; cells were collected by centrifugation, and cell lysis was performed using 200 µL of 136
buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA, 10 mM NaCl, 1% SDS), 0.1 g of glass beads, and 137
200 µL of phenol:chloroform:isoamyl alcohol (25:24:1, v/v). This was followed by two 30-sec 138
vortex pulses and a 30-sec incubation on ice. After centrifugation, the aqueous phase was collected 139
and DNA was precipitated using 2 volumes of absolute ethanol. 140
Page 6 of 23
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
7
PCR amplification of Ni-V resistance genes of B. megaterium and M. liquefaciens 141
Genes czcD, nccA, MexGHI-OpmD, cnrA, cnrT, cnrX, smtAB, hant, and VAN2 involved in 142
mechanisms of resistance to Ni and V were investigated in Bacillus megaterium MNSH1-9K-1 and 143
Microbacterium liquefaciens MNSH2-PHGII-2 using specific primers, most of which were 144
designed in this study (Table 1). The reactions were performed according to the specifications of 145
InvitrogenTM
, using the annealing temperatures listed in Table 1, in a Techne TC‐3000 Thermal 146
Cycler (Barloworld Scientific, USA), and the product was purified with the QIAquick gel extraction 147
kit (QIAGEN N.V., Netherlands). The PCR reaction mixtures were analyzed by electrophoresis 148
through 1% agarose gels, against 1-Kbp or 100-bp molecular-weight markers (Thermo Scientific), 149
visualized with GelRed (Invitrogen) by transillumination and photographed. 150
Phylogenetic analysis of PCR amplicons 151
The PCR amplicons were then pyrosequenced at MACROGEN, Korea; the nucleotides were 152
queried against a taxonomic database of high quality sequences derived from NCBI using BLASTN 153
(Altschul et al. 1990). A collection of taxonomically related sequences was obtained from the NCBI 154
Taxonomy Homepage and used to perform a multiple alignment analysis with T-coffee (Magis et 155
al. 2014). Only common gene regions were included in the phylogenetic tree, and similarity 156
analyses using the Jukes_Cantor model were performed with the MEGA 6 (Tamura et al. 2011). 157
The phylogenetic trees were constructed using the neighbor_joining method, and 500 bootstrap 158
replications were assessed to support internal branches (Hillis and Bull 1993). 159
Statistical analyses 160
The data were statistically analyzed using the Minitab 17 computer software with Tukey HSD 161
pairwise comparisons. 162
163
164
165
166
Page 7 of 23
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
8
Results 167
Growth of B. megaterium and M. liquefaciens in the presence of spent catalyst 168
The growth of B. megaterium and M. liquefaciens in PHGII medium containing Ni-V catalyst at 169
16% (w/v) pulp density over 7 days of incubation is shown in Figure 1. In general, B. megaterium 170
and M. liquefaciens remain viable during this treatment. B. megaterium increases its population 171
density from 6.5 ± 0.5 Log CFU/mL to 8.8 ± 1.0 Log CFU/mL, indicating that the catalyst does not 172
affect the development of this microorganism. In the case of M. liquefaciens the population density 173
decreased from 6.1± 0.2 Log CFU/mL to 4.6 ± 0.3 Log CFU/mL (Fig. 1); however, the 174
microorganisms remained viable during exposure to the catalyst and reached a maximum level of 175
6.9 ± 0.4 Log CFU/mL on day 2 (data not shown). 176
Nickel -Vanadium Removal from Spent Catalyst 177
The ability of B. megaterium and M. liquefaciens to remove nickel and vanadium from spent 178
catalyst at 16% (w/v) pulp density in PHGII medium over 7 days is shown in Figure 2. The amounts 179
removed by B. megaterium were 141.5 mg kg-1
of Ni and 1101.5 mg kg-1
of V, corresponding to
180
33.1% and 50.8% respectively. M. liquefaciens removed 76.04 mg kg-1
of Ni and 302.18 mg kg
-1 of 181
V, corresponding to 17.8% and 14.0 %, respectively (Figure 2). Dead biomass from B. megaterium 182
and M. liquefaciens removed 50.85 mg kg-1
and 10.39 mg kg-1
of Ni, and 117.09 mg kg-1
and 183
28.27 mg kg-1
of V, respectively (values were calculated subtracting the removal observed with the 184
abiotic control) (Figure 2). Thus, B. megaterium was more effective in the removal of either metal, 185
compared to M. liquefaciens. Both microorganisms were clearly more effective in removing 186
vanadium, compared to nickel. 187
The pH was tested during the kinetic runs, remaining steady between 5.5 and 5.8 throughout the 188
treatments (data not shown), indicating that the metal removal from the spent catalyst was not due 189
to acid production. 190
191
192
Page 8 of 23
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
9
Identification of Ni-V resistance genes 193
Molecular studies were undertaken to investigate the resistance ability of the microbial isolates 194
B. megaterium and M. liquefaciens on a gene level using conventional PCR, to check whether the 195
heavy-metal removal ability of the microorganisms is linked to specific genes such as czcD (Co, Zn, 196
Cd), hant (high-affinity nickel transporter of B. megaterium), nccA (Ni, Co, Cd-resistance), cnrA, 197
cnrX, and cnrT (Ni and Co-resistance), MexGHI-OpmD (V-resistance), VAN2 (V-resistance), and 198
smtAB (a gene encoding synechococcal metallothioneins). Four of the genes targeted in the gDNA 199
of B. megaterium, nccA, hant, smtAB, and VAN2, showed positive amplification, reproducibly 200
giving amplicons of the expected sizes: app. 1141 bp, app. 593 bp, app. 500 bp and app. 490 bp, 201
respectively (Data not shown). In contrast, the cnrA, cnrT, cnrX, czcD, and MexGHI-opmD (data 202
not shown) genes were not found in B. megaterium when tested for with the appropriate pairs of 203
primers. 204
In our testing of the M. liquefaciens gDNA, the nccA, hant, czcD, smtAB, MexGHI-OpmD, and 205
VAN2 genes were found with amplicons of app. 1200 bp for MexGHI-OpmD, app. 1000 bp for 206
czcD, and the rest with the sizes mentioned previously, while no PCR products were generated with 207
the cnrA, cnrT, and cnrX pairs of primers (Data not shown). The possible resistance ability of both 208
B. megaterium and M. liquefaciens towards V was showed by a positive amplification of gene VAN 209
2 (Data not shown). 210
Phylogenetic analysis of nccA, hant and czcD 211
Because of the smtAB, MexGHI-OpmD, and VAN2 shown some nonspecific amplicons during 212
experiments (Data not shown). The phylogenetic analysis from reproducible specific amplicons of 213
czcD, nccA, and hant genes were done. The nccA partial nucleotide sequences obtained from B. 214
megaterium were 95% and 97% identical with nccA from M. arabinogalactanolyticum (DQ485160) 215
and nccA of A. xylosoxidans (L31363). The nccA partial nucleotide sequences obtained from 216
M.liquefaciens were 99% and 98% identical with nccA from M. arabinogalactanolyticum 217
(DQ485160) and nccA of A. xylosoxidans (L31363) (Fig. 3). The hant partial nucleotide sequences 218
Page 9 of 23
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
10
obtained from B. megaterium and M. liquefaciens were 100% and 95% identical with hant of B. 219
megaterium WSH-002 (384044176). The czcD partial nucleotides sequence obtained from M. 220
liquefaciens were 97% identical with czcD from M. arabinogalactanolyticum (DQ485161), and 221
95% identical with czcD from Ralstonia sp.CH34 and 94%with the cation diffusion facilitator 222
family transporter from C. aquatic SB20 (KC432582) (Fig. 3). 223
224
Discussion 225
Nickel and vanadium removal from spent catalyst 226
This study examined the removal of nickel and vanadium from spent catalyst by B. megaterium 227
and M. liquefaciens. Both bacteria have previously been shown to have MICs > 200 ppm for Ni and 228
V (Gomez-Ramirez et al. 2015; Arenas-Isaac et al. 2015). B. megaterium is considered a 229
microorganism with a high potential for tolerating toxic elements, such as exposure to maximal 230
tolerable concentrations of (ppm): 1200 of Ni, 500 of Zn, 100 of Pb, 450 of Cu, and 300 of Cr 231
(Rajkumar, Ma, and Freitas 2013). On the other hand, M. liquefaciens from Ni-rich soil has been 232
reported with MICs (ppm) of 880.3 for Ni, 2070 for Pb, 10.0 for Hg, and 374. 6 for As (Abou-233
Shanab, van Berkum, and Angle 2007). The greater ability of B. megaterium, compared to M. 234
liquefaciens (Fig. 1) to grow in the presence of our spent catalyst, which contains numerous 235
elements (Ni, V, As, Cr, Mg, Fe, Mo, P, Zn, Cd, Zn, and Al) (Gomez-Ramirez et al. 2015), may be 236
related to the fact that the B. megaterium genome contains many predicted open reading frames 237
(ORFs) involved in stress responses: 26 for osmotic stress, 46 in oxidative processes, 2 for cold 238
shock, 14 for heat shock and 1 for detoxification (Pal et al. 2014). Also, this microorganism 239
contains seven plasmids, and different resistance functions have been reported for these (Eppinger 240
et al. 2011). 241
In the present comparison B. megaterium was the better microorganism in terms of nickel 242
(31.52%) and vanadium (50.77%) removal from spent catalyst (compare the M. liquefaciens 243
numbers of 17.88% and 14.09% respectively) (Fig. 2). Recently, B. megaterium has been used in 244
Page 10 of 23
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
11
biologically mediated recovery of rhenium and platinum from a Ni-V-free spent catalyst, Pt–245
Re/Al2O3, with recovery efficiencies of 17.7% of rhenium and 98% of platinum (Eppinger et al. 246
2011; Liu et al. 2011; Pal et al. 2014). A nickel-resistant Microbacterium sp. isolated from a nickel-247
electroplating industrial effluent was shown to be capable of converting soluble NiSO4 into 248
insoluble NiO nanoparticles (Sathyavathi et al. 2014). 249
Our results suggest that the removal of Ni and V in the two microorganisms tested is 250
accomplished primarily through a metabolism that may include ion carriers or enzymatic 251
detoxification, because much higher levels of nickel and vanadium removal were obtained with the 252
live cells compared to the dead-biomass control (Fig. 2). However, a small extent of metal removal 253
may have occurred through leaching by the culture medium and sorption by biomass. Such sorption 254
would be based on the fact that most microbial surfaces are negatively charged, due to the 255
ionization of functional groups, and thereby contribute to metal-ion binding (Yan and Viraraghavan 256
2003). In the present work we observed a significant fraction of the Ni removed by dead biomass 257
from B. megaterium (though not from M. liquefaciens), and no V removal by dead biomass from 258
either microorganism, possibly because, in contrast to cationic Ni2+
, the vanadium is present in the 259
form of a negatively charged ion, V043-
. 260
The growth medium in these experiments is not conducive to the biosynthesis of acids; at any 261
event, no significant pH reduction (p>0.1) was seen over the course of the experiments, and acid 262
leaching of the metals should therefore be unimportant (Amiri et al.2011). 263
Nickel and vanadium gene identification in B. megaterium and M. liquefaciens 264
Both microorganisms, B. megaterium and M. liquefaciens, can tolerate high concentrations of Ni 265
and V and remove metals from wastes, but our understanding of the underlying mechanisms is 266
incomplete. Metal tolerance is essential for microbial survival in soils with high metal content. 267
Some microorganisms are naturally metal tolerant, whereas others have developed various 268
resistance mechanisms to survive in hostile conditions (Babich and Stotzky 1985; Das et al. 2014). 269
Page 11 of 23
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
12
The search for metal resistance genes may help to understand the metabolism involved. The 270
nccA and hant genes were found in both bacteria, and czcD gene in M. liquefaciens. 271
Concerning nickel resistance, the primer pair ncc upper/ncc lower yielded the expected 1141-bp 272
product both with B. megaterium and M. liquefaciens (Data not shown), similar to what is observed 273
for C. metallidurans CH34 (Schmidt and Schlegel 1994) and were identified by phylogenetic 274
analysis (Fig. 3). This confirms the molecular-level resistance of both microorganisms to this 275
element. Gene nccA encodes a transmembrane protein that allows entry of nickel, cobalt, and 276
cadmium into the cell (Schmidt and Schlegel 1994). It is known that ncc loci contain seven open 277
reading frames, designated nccYXHCBAN, where nccA functions as a regulator (Schmidt and 278
Schlegel 1994). Recently, this gene has been identified in Achromobacter xylosoxidans, 279
Sphingobacterium heparinum, Burkholderia sp., Comamonas sp., Flavobacterium sp., Arthrobacter 280
sp., Rhizobium sp., Microbacterium arabinogalactanolyticum, Bacillus flexus, and some species of 281
Marinobacter (Abou-Shanab et al. 2007; Kamika and Momba 2013). 282
As expected, the hant amplicon was obtained in B. megaterium and was also found in M. 283
liquefaciens and identified by phylogenetic analysis (Fig. 3). This gene encodes a high-affinity 284
nickel transporter which had been identified in the strains DSM 319, QM B1551, and WSH-002 of 285
B. megaterium (Eppinger et al. 2011; Liu et al. 2011; Pal et al. 2014), but had not been reported in 286
M. liquefaciens. 287
Presumptive evidence for the presence of the czc locus in the genome of M. liquefaciens was 288
obtained by using the primer pair czcD reported by Abou-Shanab et al. (2007) and were identified 289
by phylogenetic analysis (Fig. 3). The efflux chemiosmotic transporters czc have been widely 290
reported in C. metallidurans (Diels et al. 1995), Burkholderia sp. (Brim et al. 1999), Bacillus 291
subtilis (Guffanti et al. 2002), and Pseudomonas sp. (Hu and Zhao 2007), and have been related to 292
nickel resistance in bacteria of the genera Bacillus and Microbacterium (Abou-Shanab et al. 2007). 293
Metal resistance has been reported for a number of bacteria, most frequently for C. 294
metallidurans, which has several genes encoding resistance to toxic heavy metals (Schmidt and 295
Page 12 of 23
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
13
Schlegel 1994). These genes are located either within the bacterial chromosome or on one of the 296
two plasmids pMOL28 or pMOL30 (Mergeay et al. 1985; Siddiqui et al. 1989; Liesegang et al. 297
1993). Some studies have linked the metal-removal capacity to the presence of resistance genes like 298
nccA, smtAB, and cnrB, identified in some species of the genus Marinobacter isolated from the soil 299
of a vanadium mine. These microorganisms are capable of removing 23.96 % of Ni and 30.15% of 300
V from modified wastewater liquid media containing 100 ppm of Ni and V (Kamika and Momba 301
2014). Also, Bacillus sp. and Arthrobacter sp. isolated from uranium mine wastes were able to 302
remove 257 mg kg-1
of U, 250 mg kg-1
of Th, 26.77 mg kg-1
of Cu, 305 mg kg-1
of Cd, 16.25 mg kg-1
303
of Zn, and 14.5 mg kg-1
of Ni, and were found to contain genes that encode P(1B)-type ATPases 304
(Cu-CPx and Zn-CPx) and ABC transporters (nik) (Choudhary et al. 2012). Because these metal-305
resistance genes are frequently located on plasmids, the suggestion has been made that they may be 306
spread to divergent bacteria by horizontal transfer (Barkay et al. 1985). 307
The detection of the metal resistance genes within the genomes of B. megaterium (nccA and 308
hant) and M. liquefaciens (hant and czcD) in the present work suggests that these genes are shared 309
in a bacterial community exposed to high metal concentrations, e.g. in mining soils, and they might 310
be some of the genetic determinants that enable bacteria to remove Ni and V from spent catalysts. 311
Though more genes were identified in M. liquefaciens, compared to B. megaterium, these may have 312
functions more related to metal resistance than to metal removal, so that B. megaterium still ends up 313
being the better metal remover of the two tested. 314
315
Conclusions 316
For the first time nccA gene was identified by phylogenetic analysis in B. megaterium and nccA, 317
czcD, and hant, genes in M. liquefaciens. These genes are of interest for the potential of these 318
bacteria as biological agents for the elimination of nickel and vanadium from hazardous wastes. 319
320
Acknowledgements 321
Page 13 of 23
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
14
This project was supported by stipend No. 356684 and grant 131203 from CONACYT, Mexico, 322
and 20151560 from BEIFI, Instituto Politécnico Nacional, Mexico. 323
Page 14 of 23
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
15
References 324
325
Abou-Shanab, R. A., van Berkum, P., and Angle, J. S. 2007. Heavy metal resistance and genotypic 326
analysis of metal resistance genes in gram-positive and gram-negative bacteria present in 327
Ni-rich serpentine soil and in the rhizosphere of Alyssum murale. Chemosphere 68 (2):360-328
7. 329
Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. 1990. Basic local alignment 330
search tool. J. Mol. Biol. 215 (3):403-10. 331
Amiri, F., Yaghmaei, S., and Mousavi, S. M. 2011. Bioleaching of tungsten-rich spent 332
hydrocracking catalyst using Penicillium simplicissimum. Bioresour. Technol. 102 333
(2):1567-73. 334
Arenas-Isaac, G., Montero-Aviles, L. A., Fierros-Romero, G., Gomez-Ramirez, M., and Rojas-335
Avelizapa, N. G. 2015. Novel microorganisms for the treatment of Ni and V of spent 336
catalysts. In Press. 337
Babich, H., and Stotzky, G. 1985. Heavy metal toxicity to microbe-mediated ecologic processes: a 338
review and potential application to regulatory policies. Environ. Res. 36 (1):111-37. 339
Barkay, T., Tripp, S. C., and Olson, B. H. 1985. Effect of metal-rich sewage sludge application on 340
the bacterial communities of grasslands. Appl. Environ. Microbiol. 49 (2):333-7. 341
Baysse, C., De Vos, D., Naudet, Y., Vandermonde, A., Ochsner, U., Meyer, J. M., Budzikiewicz, 342
H., Schafer, M., Fuchs, R., and Cornelis, P. 2000. Vanadium interferes with siderophore-343
mediated iron uptake in Pseudomonas aeruginosa. Microbiology. 146 (Pt 10):2425-34. 344
Bowman, B. J. 1983. Vanadate uptake in Neurospora crassa occurs via phosphate transport system 345
II. J. Bacteriol. 153 (1):286-91. 346
Brim, H., Heyndrickx, M., de Vos, P., Wilmotte, A., Springael, D., Schlegel, H. G., and Mergeay, 347
M. 1999. Amplified rDNA restriction analysis and further genotypic characterisation of 348
metal-resistant soil bacteria and related facultative hydrogenotrophs. Syst. Appl. Microbiol. 349
22 (2):258-68. 350
Bruins, M. R., Kapil, S., and Oehme, F. W. 2000. Microbial resistance to metals in the environment. 351
Ecotoxicol. Environ. Saf. 45 (3):198-207. 352
Campbell, P. M., and Smith, G. D. 1986. Transport and accumulation of nickel ions in the 353
cyanobacterium Anabaena cylindrica. Arch. Biochem. Biophys. 244 (2):470-7. 354
Cantley, L. C., Jr., Resh, M. D., and Guidotti, G. 1978. Vanadate inhibits the red cell (Na+, K+) 355
ATPase from the cytoplasmic side. Nature. 272 (5653):552-4. 356
Choudhary, S., Islam, E., Kazy, S. K., and Sar, P. 2012. Uranium and other heavy metal resistance 357
and accumulation in bacteria isolated from uranium mine wastes. J. Environ. Sci. Health A. 358
Tox. Hazard. Subst. Environ. Eng. 47 (4):622-37. 359
Das, S., Mishra, J., Das, S. K., Pandey, S., Rao, D. S., Chakraborty, A., Sudarshan, M., Das, N., and 360
Thatoi, H. 2014. Investigation on mechanism of Cr(VI) reduction and removal by Bacillus 361
amyloliquefaciens, a novel chromate tolerant bacterium isolated from chromite mine soil. 362
Chemosphere. 96:112-21. 363
Diels, L., Dong, Q., van der Lelie, D., Baeyens, W., and Mergeay, M. 1995. The czc operon of 364
Alcaligenes eutrophus CH34: from resistance mechanism to the removal of heavy metals. J. 365
Ind. Microbiol. 14 (2):142-53. 366
Dong, Q., Springeal, D., Schoeters, J., Nuyts, G., Mergeay, M., and Diels, L. 1998. Horizontal 367
transfer of bacterial heavy metal resistance genes and its applications in activated sludge 368
systems. Water Sci. Technol. 37 (4–5):465-468. 369
Eppinger, M., Bunk, B., Johns, M. A., Edirisinghe, J. N., Kutumbaka, K. K., Koenig, S. S., Creasy, 370
H. H., Rosovitz, M. J., Riley, D. R., Daugherty, S., Martin, M., Elbourne, L. D., Paulsen, I., 371
Biedendieck, R., Braun, C., Grayburn, S., Dhingra, S., Lukyanchuk, V., Ball, B., Ul-Qamar, 372
R., Seibel, J., Bremer, E., Jahn, D., Ravel, J., and Vary, P. S. 2011. Genome sequences of 373
Page 15 of 23
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
16
the biotechnologically important Bacillus megaterium strains QM B1551 and DSM319. J. 374
Bacteriol. 193 (16):4199-213. 375
Gomez-Ramirez, M., Montero-Alvarez, L. A., Tobon-Aviles, A. , Fierros-Romero, G., and Rojas-376
Avelizapa, N. G. 2015. Microbacterium oxydans and Microbacterium liquefaciens: A 377
biological alternative for the treatment of Ni-V-containing wastes. J. Environ. Sci. Health 378
A. Tox. Hazard. Subst. Environ. Eng .50 (6):602-10. 379
Guffanti, A. A., Wei, Y., Rood, S. V., and Krulwich, T. A. 2002. An antiport mechanism for a 380
member of the cation diffusion facilitator family: divalent cations efflux in exchange for K+ 381
and H+. Mol. Microbiol. 45 (1):145-53. 382
Gutierrez, J. C., Amaro, F., and Martin-Gonzalez, A.. 2009. From heavy metal-binders to 383
biosensors: ciliate metallothioneins discussed. Bioessays. 31 (7):805-16. 384
Hillis, D. M., and Bull, J. J. 1993. An Empirical Test of Bootstrapping as a Method for Assessing 385
Confidence in Phylogenetic Analysis. Syst. Biol. 42 (2):182-192. 386
Hinojosa, M. B., Carreira, J. A., Garcia-Ruiz, R., and Dick, R. P. 2005. Microbial response to heavy 387
metal-polluted soils: community analysis from phospholipid-linked fatty acids and ester-388
linked fatty acids extracts. J. Environ. Qual. 34 (5):1789-800. 389
Hu, N., and Zhao, B. 2007. Key genes involved in heavy-metal resistance in Pseudomonas putida 390
CD2. FEMS Microbiol. Lett. 267 (1):17-22. 391
Jarrell, K. F., and Sprott, G. D. 1982. Sprott. 1982. Nickel transport in Methanobacterium bryantii. 392
J. Bacteriol. 151 (3):1195-203. 393
Kamika, I., and Momba, M. N. 2013. Assessing the resistance and bioremediation ability of 394
selected bacterial and protozoan species to heavy metals in metal-rich industrial 395
wastewater. BMC Microbiol. 13 (28):1471-2180. 396
Kamika, I., and Momba, M. N. 2014. Microbial diversity of Emalahleni mine water in South Africa 397
and tolerance ability of the predominant organism to vanadium and nickel. PLoS One 9 (1). 398
Kanik-Ennulat, C., Montalvo, E., and Neff, N. 1995. Sodium orthovanadate-resistant mutants of 399
Saccharomyces cerevisiae show defects in Golgi-mediated protein glycosylation, 400
sporulation and detergent resistance. Genetics. 140 (3):933-43. 401
Kanik-Ennulat, C., and Neff, N. 1990. Vanadate-resistant mutants of Saccharomyces cerevisiae 402
show alterations in protein phosphorylation and growth control. Mol. Cell. Biol. 10 (3):898-403
909. 404
Liesegang, H., Lemke, K., Siddiqui, R. A., and Schlegel, H. G. 1993. Characterization of the 405
inducible nickel and cobalt resistance determinant cnr from pMOL28 of Alcaligenes 406
eutrophus CH34. J. Bacteriol. 175 (3):767-78. 407
Liu, L., Li, Y., Zhang, J., Zou, W., Zhou, Z., Liu, J., Li, X., Wang, L., and Chen, J. 2011. Complete 408
genome sequence of the industrial strain Bacillus megaterium WSH-002. J. Bacteriol. 193 409
(22):6389-90. 410
Lohmeyer, M., and Friedrich, C. G. 1987. Nickel transport in Alcaligenes eutrophus. Arch. 411
Microbiol. 149 (2):130-135. 412
Lundie, L. L., Jr., Yang, H. C. , Heinonen, J. K., Dean, S. I., and Drake, H. L. 1988. Energy-413
dependent, high-affinity transport of nickel by the acetogen Clostridium thermoaceticum. J. 414
Bacteriol. 170 (12):5705-8. 415
Magis, C., Taly, J. F., Bussotti, G., Chang, J. M., Di Tommaso, P., Erb, I., Espinosa-Carrasco, J. , 416
and Notredame, C. 2014. T-coffee: tree-based consistency objective function for alignment 417
evaluation. Methods Mol. Biol.646-677. 418
Mergeay, M., Nies, D., Schlegel, H. G., Gerits, J., Charles, P., and Van Gijsegem, F. 1985. 419
Alcaligenes eutrophus CH34 is a facultative chemolithotroph with plasmid-bound 420
resistance to heavy metals. J. Bacteriol. 162 (1):328-34. 421
Mulrooney, S. B., and Hausinger, R. P. 2003. Nickel uptake and utilization by microorganisms. 422
FEMS Microbiol. Rev. 27 (2-3):239-61. 423
Page 16 of 23
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
17
Nies, D. H. 2003. Efflux-mediated heavy metal resistance in prokaryotes. FEMS Microbiol. Rev. 27 424
(2-3):313-39. 425
Pal, K. K., Dey, R., Sherathia, D., Vanpariya, S., Patel, I., Dalsania, T., Savsani, K., Sukhadiya, B., 426
Mandaliya, M., Thomas, M., Ghorai, S., Rupapara, R., Rawal, P., Shah, A., and Bhayani, S. 427
2014. Draft Genome Sequence of a Moderately Halophilic Bacillus megaterium Strain, 428
MSP20.1, Isolated from a Saltern of the Little Rann of Kutch, India. Genome Announc. 2 429
(1):01134-13. 430
Philippaerts, A., Goossens, S., Jacobs, P. A., and Sels, B. F. 2011. Catalytic production of 431
conjugated fatty acids and oils. Chem. Sus. Chem. 4 (6):684-702. 432
Poster, J. B., and Dean, N. 1996. The yeast VRG4 gene is required for normal Golgi functions and 433
defines a new family of related genes. J. Biol. Chem. 271 (7):3837-45. 434
Rajkumar, M., Ma, Y., and Freitas, H. 2013. Improvement of Ni phytostabilization by inoculation 435
of Ni resistant Bacillus megaterium SR28C. J. Environ. Manag. 128 (0):973-980. 436
Rocchetti, L., Fonti, V., Veglio, F., and Beolchini, F. 2013. An environmentally friendly process for 437
the recovery of valuable metals from spent refinery catalysts. Waste Manag. Res. 31 438
(6):568-76. 439
Sandrin, T. R., Chech, A. M., and Maier, R. M. 2000. A rhamnolipid biosurfactant reduces 440
cadmium toxicity during naphthalene biodegradation. Appl. Environ. Microbiol. 66 441
(10):4585-8. 442
Sathyavathi, S., Manjula, A., Rajendhran, J., and Gunasekaran, P. 2014. Extracellular synthesis and 443
characterization of nickel oxide nanoparticles from Microbacterium sp. MRS-1 towards 444
bioremediation of nickel electroplating industrial effluent. Bioresour. Technol. 165:270-3. 445
Schmidt, T., and Schlegel, H. G. 1994. Combined nickel-cobalt-cadmium resistance encoded by the 446
ncc locus of Alcaligenes xylosoxidans 31A. J. Bacteriol. 176 (22):7045-54. 447
Siddiqui, R. A., Benthin, K., and Schlegel, H. G. 1989. Cloning of pMOL28-encoded nickel 448
resistance genes and expression of the genes in Alcaligenes eutrophus and Pseudomonas 449
spp. J. Bacteriol. 171 (9):5071-8. 450
Stoppel, R., and Schlegel, H. G. 1995. Nickel-resistant bacteria from anthropogenically nickel-451
polluted and naturally nickel-percolated ecosystems. Appl. Environ. Microbiol. 61 452
(6):2276-85. 453
Taghavi, S., Delanghe, H., Lodewyckx, C., Mergeay, M. and van der Lelie, D. 2001. Nickel-454
resistance-based minitransposons: new tools for genetic manipulation of environmental 455
bacteria. Appl. Environ. Microbiol. 67 (2):1015-9. 456
Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., and Kumar, S. 2011. MEGA5: 457
molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, 458
and maximum parsimony methods. Mol. Biol. Evol. 28 (10):2731-9. 459
Torres-Martinez, L. N., Kharisov, B. I., and Elizondo, N. V. 2001. V and Mo recovery of spent 460
catalysts for the petrochemical industry. Part I. Principles and recovery methods. Ciencia 461
UANL. 4. 462
Vandermeulen, G., Marie, C., Scherman, D., and Preat, V. 2011. New generation of plasmid 463
backbones devoid of antibiotic resistance marker for gene therapy trials. Mol. Ther. 19 464
(11):1942-9. 465
Yan, G., and Viraraghavan, T. 2003. Heavy-metal removal from aqueous solution by fungus Mucor 466
rouxii. Water Res. 37 (18):4486-4496. 467
Zhang, W. H., Huang, Z., He, L. Y., and Sheng, X. F. 2012. Assessment of bacterial communities 468
and characterization of lead-resistant bacteria in the rhizosphere soils of metal-tolerant 469
Chenopodium ambrosioides grown on lead-zinc mine tailings. Chemosphere. 87 (10):1171-470
8. 471
Zhu, H., Guo, J., Chen, M., Feng, G., and Yao, Q. 2012. Burkholderia Dabaoshanensis sp. nov., a 472
heavy-metal-tolerant bacteria isolated from Dabaoshan mining area soil in China. PLoS 473
One. 7 (12):4. 474
Page 17 of 23
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
18
475
Page 18 of 23
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
Table 1. PCR primers used to test for metal-related genes.
Gene Metal-resistance
mechanism
Sequence (5´ to 3´) Orientation Amplicon
size (bp)
Annealing
temperature
(ºC)
Reference
czcD Cation- proton
antiporter
ATCTTTTACCACCATGGGCGCA
GGTCACTCACACGAC
Forward 1000 60 (Nies et al. 1989)
GCTGAACATCATACCCTAGTTT
CCTCTGCAGCAAGCGA
Reverse
nccA Energy-dependent
ion-efflux
ACGCCGGACATCACGAACAAG Forward 1141 54 (Abou-Shanab,
van Berkum, and
Angle 2007) CCAGCGCACCGAGACTCATCA Reverse
smtAB Metal-binding
metallothionein
GATCGACGTTGCAGAGACAG Forward 500 52 (Naz et al. 2005)
GATCGAGGGCGTTTTGATAA Reverse
cnrA Membrane-bound
protein complex
of energy-
dependent
CCTACGATCTCGCAGGTGAC Forward 422 60 This study
GCAGTGTCACGGAAACAACC Reverse
cnrT GGGTGGTGTTCAAGGAGAAT Forward 420 58 This study
CAAGCAGGACGCCAAATAATG Reverse
cnrX TCCTTGTCTACGCTGTTTGG Forward 388 58 This study
GTACGTAAGCAGGTCGATGTT Reverse
MexGHI-
OpmD
Multidrug type
Efflux pump
CAGTGGGAAATCGACCTGTT Forward 1200 58 This study
TTCGGCCAGTTGGTTGAG Reverse
Hant High-affinity
nickel transporter
CGGATTGGATGCAGATCACTTA Forward 593 55 This study
AGCAGATCGCCCAAACTTAC Reverse
VAN2 Component of
ATPase type
efflux pump
TGCTTTTCGTGCAATCTTTGGT Forward 490 58 This study
GGCAATTGGCAGCTTGTTCA Reverse
Page 19 of 23
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
1
Figure captions: 1
2
Fig. 1. Growth of B. megaterium and M. liquefaciens in PHGII medium containing spent Ni-V 3
catalyst at 16%, evaluated at time 0 and 7 days, 30°C, 150 rpm. 4
5
Fig. 2. Percentage of Ni and V removal from spent Ni-V catalyst at 16% (w/v) by B. megaterium 6
and M. liquefaciens in PHGII medium after 7 days of incubation at 30°C, 150 rpm. Statistically 7
significant differences (one-way ANOVA with Tukey HSD (P < 0.05) are indicated by different 8
letters. 9
10
Fig. 3. The cladogram of metal resistance genes was constructed by using MEGA 6 software. 11
Evolutionary relationships were estimated by UPGMA method with 500 bootstrap value to obtain 12
the consensus tree. Evolutionary distances were calculated using the Jukes-Cantor method. Bar, 0.2 13
substitutions per nucleotide position. 14
Page 20 of 23
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
Fig. 1
3
4
5
6
7
8
9
10
B. megaterium M. liquefaciens
Population density
(Log 10UFC/mL)
0 days 7 days
Page 21 of 23
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
Fig. 2
Page 22 of 23
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
Fig. 3
ncc
YXH
CBA gen
es A
. xyloso
xid
ans (L
31363)
nccA M
. liquefac
iens strain M
NSH2-PHGII-2
nccA M
. arabi
nogala
binoga
lactan
olyticu
m (DQ485
160)
nccA B.megaterium strain MNSHI-9K-1
CzcD like gene M
.arabinogalactanolyticum(D
Q485161)
CzcD
M.liq
uefa
ciens stra
in M
NSH2-P
HGII-2
Czc
D R
alstonia sp. CH34(1
731912)
Catio
n diffu
sion facilitator fa
mily tran
sporter C
.aqu
atica str
ain SB
20 (K
C432582)
hant M. liquefaciens str
ain MNSH2-PHGII-2
High affinity nickel transporter B.megaterium strain WSH00 (384044176)
han
t B.m
egaterium strain
MNSH1-9K
-1
0.2
Page 23 of 23
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology