dual recognition of a human cytotoxic t-cell clone for ... · and by nk cells (1, 2)....

ICANCER RESEARCH 56, 2368-2374. May 15. 1996]

Dual Recognition of a Human Cytotoxic T-Cell Clone for Melanoma Antigens1

Hitomi Kubo,2 Jun Abe, Fumiya Obata, Hideo Nakajima, Misao Tsunoda, Atsuko Ogawa, Setsuko Nakayama,

Yoshifumi Beck, Takao Kohsaka, Timothy L. Darrow, Zeinab Abdel-Wahab, Toshiaki Saida, andMasafumi Takiguchi3

Departments of Tumor Biology [H. K., J. A., H. N.. A. O., M. Ta.J and Organ Transplantation Â¡S.N., Y. B.I, Institute of Medical Science, University of Tokyo, 4-6-1 Shirokanedai,Minato-ku, Tokyo 108, Japan; Department of Immunologv, National Children's Medical Research Center, Tokyo 154, Japan [J. A., T. K.]; Department of Immunologv, School of

Medicine, Kitasato University, Sagamihara, Kanagawa 228, Japan Â¡F.O., M. Ts.l; Department of Dermatology, School of Medicine, Shinshu University, Matsumoto, Nagano 320,Japan IT. S.j: and Department of Surgery, Duke University Medical Center, Durham, North Carolina 27710 [T. L. D., Z. A-W.Â¡

ABSTRACT

It is well known that tumor-specific CTLs have a crucial role in the

elimination of tumors and that different CTL populations recognize tumor antigens in MHC-restricted and MHC-unrestricted manners. We

have established two aÃŸCTL clones that recognize melanoma antigens inboth human lymphocyte antigen (HLA)-A2-restricted and HLA-unre-

stricted manners. Flow cytometry analysis showed that these CTL clonescarry CD3, CDS, and aÃŸT-cell receptor (TCR) and express low levels of

CD56. In contrast, these CTL clones do not express CD16, indicating thatthey do not contain natural killer cells. TCR analysis of these CTL clonesusing an anchored PCR method revealed that each clone carries a singleaÃŸTCR. Both CTL clones contained the same Va and \'ÃŸgene segments

although they carried different Ja and .IÃŸgene segments. Taken together,these results confirm that CTL clones that carry a single aÃŸTCR recognize melanoma antigens in both HLA-A2-restricted and HLA-unre-

stricted manners. It is strongly suggested that the dual recognition of theseCTL clones for the melanoma antigens is mediated by TCRs. The novelmechanism for antitumor immunity by these CTLs may be important inthe effective elimination of tumors in vivo.

INTRODUCTION

Tumor cells are eliminated by specific CTLs that carry aÃŸTCRs4and by NK cells (1, 2). Tumor-specific CD8+ CTLs recognize a

peptide presented by MHC class I molecules (3-5). In contrast, therecognition of NK cells is not restricted by MHC molecules, andmolecules recognized by NK cells remain unknown. CD8 + CTLs can

eliminate tumor cells effectively because of their specific immunerecognition. Recent studies identified HLA class I binding peptidesrecognized by melanoma-specific CTLs (6-8). On the other hand,tumor cells often lose surface expression of MHC class I molecules(9-11). CD8+ CTLs fail to kill tumor cells lacking MHC class I

molecules although they are eliminated effectively by NK cells (12).Previous studies showed the presence of T cells that have NK activity(13, 14). These T cells also killed target cells losing MHC class Iexpression effectively, such as K562 cells ( 15). Thus, MHC-restrictedCTLs and NK cells or MHC-unrestricted CTLs together play a complementary role in tumor immunity.

Previous studies suggested the presence of a T-cell populationthat recognizes tumor antigens or alloantigens in both the HLAclass I-restricted and HLA-unrestricted manners (16, 17). However, it remains possible that T-cell clones contain more than one

Received 12/12/95; accepted 3/19/96.The costs of publication of this article were defrayed in part by the payment of page

charges. This article must therefore be hereby marked advertisement in accordance with18 U.S.C. Section 1734 solely to indicate this fact.

1This study was supported by a Grant-in-Aid for Scientific Research in Priority Areas

from the Ministry of Education. Science. Sports, and Culture, and a grant for a Comprehensive New 10-Year Strategy of Cancer Control from the Ministry of Health andWelfare, the Government of Japan.

2 Present address: Department of Dermatology, School of Medicine, Shinshu Univer

sity, Matsumoto, Nagano 320, Japan.3 To whom requests for reprints should be addressed.4 The abbreviations used are: TCR. T-cell receptor; NK, natural killer; mAb. mono

clonal antibody; IL. interleukin; MFI. mean fluorescence intensity; HLA, human lymphocyte antigen.

T-cell population or NK cells because the clonality of each T-cellclone was not confirmed by analyses of TCRs as well as cellsurface markers in these studies. We have investigated such aT-cell population in detail and present evidence that a single T-cellclone recognizes melanoma antigens in both HLA-A2-restrictedand HLA-unrestricted manners.

MATERIALS AND METHODS

Cells. Melanoma cell lines DM6, DM92, DM93, DM122, DM208, andDM252 were established previously (18, 19). HST2 cells were kindly providedby Dr. N. Sato (Sapporo Medical College, Sapporo, Japan). Other tumor celllines were provided by the Japanese Cancer Research Resources Bank. Thesecell lines were cultured in RPMI 1640 containing 10% FCS.

Monoclonal Antibodies. Hybridoma cells secreting W6/32 anti-HLA classI, L243 anti-HLA class II, BB7.2 anti-HLA-A2, MA2.1 anti-HLA-A2, OKT3anti-CD3, OTK4 anti-CD4, and OKT8 anti-CD8 mAbs were purchased fromthe American Type Culture Collection. Anti-CD56, anti-CD 16. and WT31anti-aj3 TCR mAbs were purchased from Becton Dickinson (Mountain View,CA). HO-2 anti-HLA-A2 mAb was kindly provided by Dr. S. Ferrone (New

York Medical College, Valhalla, NY).Cloning of HLA-A2 Genes. HLA class I genes were cloned from DM252

cells as described previously (20). The genes encoding HLA-A2 were selectedby RFLP. The coding region of HLA-A2 genes was sequenced as described

previously (21).Gene Transfer of the HLA-A*0201 Gene into DM92 Cells. The HLA-

A*0201 gene was transfected by electroporation with neomycin-resistant genes

into HLA-A2-negattve DM92 cells. Cells were added to each well of a96-well, flat-bottomed microtiter plate (Nunc, Roskilde, Denmark). After

selection by G418, resistant cells were isolated from separate wells. Surfaceexpression of HLA-A2 was detected by flow cytometry with anti-HLA-A2mAb. DM92 cells expressing HLA-A*020l (DM92-A*0201) were cultured in

RPMI 1640 containing 10% FCS.Flow Cytometry Analysis. About 2 X IO5 cells were incubated with 50 /JLÃŒ

of properly dilute mAb for 30 min on ice. After two washes with PBScontaining 2% PCS, the cells were incubated with 50 /*! of FITC-conjugatedF(ab')2 goat antimouse immunoglobulin (Silenus Laboratories Pty. Ltd., Haw

thorn, Australia) at a dilution of 1:40 for 30 min on ice. Afterward, the cellswere washed three times and resuspended in PBS containing 2% FCS; then thefluorescence intensity of the cells was measured by FACS.

Generation of CTL Clones. Peripheral blood lymphocytes from a melanoma patient (no. 252) were stimulated with autologous melanoma cell lineDM252S1 three times for 4 weeks. The cells were cultured in RPMI 1640containing 100 units of recombinant human IL-2. After specific cytotoxicity

against DM252S1 cells was detected, CTL clones were established by using alimiting-dilution technique. T-cell blasts were placed in a 96-well, round-bottomed plate (Nunc) at 0.6 cell/well with 1 X IO3 irradiated DM252S1 cells,

100 fil of RPMI 1640 supplemented with 10% FCS. and 100 units of recombinant human IL-2. Cells were fed with the medium every 2-3 days.

CTL Assay. Target cells (5 x IO5) were incubated for 60 min with 100fid of Na,5lCrO4 in PBS and washed three times with RPMI 1640 containing

10% FCS. Labeled target cells (5 X lOVwell) were added to a 96-well,

round-bottomed microtiter plate (Nunc), and effector cells at an E;T ratio of2:1 were added. After the mixtures were incubated for 4 h at 37Â°C, the

supematants were collected and analyzed with a gamma counter. The spontaneous "Cr release (cpm spn) was determined by measuring the cpm in the

2368

Research. on October 12, 2020. © 1996 American Association for Cancercancerres.aacrjournals.org Downloaded from

http://cancerres.aacrjournals.org/

T-CELL RECOGNITION FOR MELANOMA

supernatant in wells containing only target cells. The maximum release (cpmmax) was determined by measuring the release of 5lCr from target cells in the

presence of 2% Triton X-100. The specific lysis was calculated by:

% of specific lysis =spm exp - cpm spn

cpm max â€”¿�cpm spn x 100

where cpm exp represents the cpm in the supernatant in wells containing target

and effector cells.Cold Target Inhibition Assay. Two X IO3labeled DM252S1 and DM122

cells were added with DM252S1, DM 122, or HST-2 cells (1 X 103or4X IO3)

to a 96-well, round-bottomed microtiter plate. Effector cells were added intoeach well. After a 4-h incubation at 37Â°C,the supernatants were collected and

analyzed with a gamma counter.Detection of V Gene Family of aÃŸTCR. After total RNA was isolated

from 2 X IO5 DT252 12-1H10 and DT252 12-6C7 CTL clones, it was

converted into first-strand cDNA using reverse transcriptase. cDNA was usedfor PCR amplification using 18 V Â«-specific oligonucleotides (Val to Val8)and 26 V/3-specific oligonucleotides (VÃŸlto V/324) as described previously(22-24). The amplification was performed with 1.25 units of Taq polymerase

(Takara Shuzo Co., Ltd., Tokyo, Japan) under the following conditions: 35cycles for TCR Va chain of denaturation and 30 cycles for TCR Vj3 chain ofdenaturation at 95Â°Cfor 60 s, annealing at 55Â°Cfor 60 s, and extension at 72Â°C

for 60 s. Each amplified product was separated on 2% agarose gels containingethidium bromide.

Isolation of aÃŸ TCR of DT252 12-1H10 and DT252 12-6C7 CTLClones. Double-stranded TCR ÃŸcDNA was synthesized from mRNA of CTLclones (25) and amplified by anchor-ligation PCR (26), a method in which asynthetic double-stranded anchor was ligated upstream of the cDNA and theanchored cDNA was amplified by 30 cycles of the CÃŸ.Similarly, double-

stranded TCR a cDNA was synthesized and amplified using a forward primercomplementary to the anchor and a reverse primer specific to the Ca. Theamplified cDNA was introduced into the plasmid vector for bacterial cDNAcloning, and cDNA clones selected at random were subjected to sequenceanalysis of Va and VÃŸthrough the beginning of Ca and CÃŸ.

RESULTS

HLA-A2-restricted and HLA-unrestricted Dual Recognition of

CTL Clones for Melanoma Antigens. PBL from a melanoma patient (no. 252) were stimulated with autologous melanoma cell lineDM252S1 to induce melanoma-specific CTLs. After specific cytotox-

icity against DM252S1 cells was confirmed in bulk culture, CTLclones were generated to investigate the mechanism of recognition ofthese T cells for melanoma antigens in detail. Of the generated CTLclones, DT252 12-1H10 and DT252 12-6C7 killed all of the threemelanoma cells expressing HLA-A2 and were strong in killing one(DM122) of three melanoma cells expressing no HLA-A2 and par

tially killed other melanoma cells (DM92 and DM208; Table 1).These findings suggest that these two CTL clones recognize not onlythe melanoma antigens presented by HLA-A2 molecules but also

recognize different melanoma antigens that are not presented by HLAmolecules or are presented by other HLA molecules.

To clarify the HLA-A2 restriction of these CTL clones, recognition

DT252 12-1H10 CTL clone

Target: DM252S1

75

50

* 25

Target: DM122

75

LtW6/32 HO-2 L243 - W6/32 HO-2 L243

monoclonal antibodies

DT252 12-6C7 CTL clone

Target: DM252S175-

Target: DM122

W6/32 HO-2 L243 - Â«6/32 HO-2 L243

monoclonal antibodies

Fig. 1. Inhibition of recognition of DT252 12-1H10 and DT252 12-6C7 clones bymAbs specific for HLA class I molecules. 51Cr-labeled target cells (5 X 103/well) were

added into a 96-well, round-bottomed microtiter plate (Nunc) with 40 /ig/ml of W6/32anti-HLA class I mAb. HO-2 anti-HLA-A2 mAb, L243 anti-HLA-DR mAb, or in theabsence of mAb. After a 1-h incubation. 3 X IO4 T-cell clones were added, and themixtures were incubated for 4 h at 37Â°C.

of these CTL clones for DM252S1 cells was blocked by both HO-2anti-HLA-A2 mAb and W6/32 anti-HLA class 1 mAb. Both mAbs

inhibited the recognition of these CTL for DM252S1 cells (Fig. 1),supporting the idea that the CTL clones recognize melanoma antigenspresented by HLA-A2 molecules on melanoma cells expressing HLA-A2. We attempted to investigate the HLA-A2-restriction of these CTLclones further using transfectants of the HLA-A2-negative melanomaline with the HLA-A2 gene: (a) the HLA-A2 genotype of the DT252

patient was identified by cloning and sequencing a gene encodingHLA-A2 from DM252S1 cells. The sequencing data of a clonedHLA-A2 gene demonstrated that DM252S1 cells express HLA-A*0201(data not shown); (b) the HLA-A*0201 gene was transfected into

DM92 cells. The DM92 transfectants expressing HLA-A2 (DM92-

Table 1 Recognition of melanoma cell lines by DT252 I2-1HIO and DT252 I2-6C7 CTL clones

TargetcellsDM25

2S1DM6DM92DM93DM122DM208EB252'DT252

12-IH10OriginMelanomaMelanomaMelanomaMelanomaMelanomaMelanomaEBV-transformed

B cellsHLA

haplotypeA2/23.

B57/62,Cw-/-A2/-,B12/13,Cwl/2Al/3,

BI5/-.Cw3/-A2/33,B8/49,Cw-/-A3/33,B7/18.Cw-/-A3/11,B7/8,Cw-/-A2/23.B57/62, Cw-/-4:1Â°46.8fc40.310.444.233.410.60.82:1"42.934.510.835.123.99.6-0.81:1"43.627.07.130.214.44.6-0.74:1Â°68.371.214.462.154.313.30.5DT252

12-6C72:1"55.967.88.459.529.86.71.51:1"41.448.55.245.711.33.0-0.4

E:T ratio.% specific lysis.

1 Epstein-Barr virus (EBV)-transformed B cells derived from a melanoma patient (no. 252).

2369




DT252 12-1H10 DT252 12-6C7

30w

IÂ¡C20

iÂ«

* 10

60

40

20

4:1 2:1 1:1 0.5:1 4:1 2:1 1:1 0.5:1

effector target ratio

Fig. 2. Restoration of recognition of DT252 12-1H10 and DT252 12-6C7 clones forDM92 cells by transfection of H'LA-A'0201 genes. The killing activity of DT252 12-1H10

and DT252 I2-6C7 clones for DM92 cells (O) and DM92-A*020I cells (â€¢)was tested at

different E:T ratios.

A*020I) were isolated using flow cytometry with two anti-HLA-A2

mAbs. The flow cytometry analysis showed that MFI of DM92-A*0201 cells stained with BB7.2 anti-HLA-A2 mAb and MA2.1

anti-HLA-A2 mAb were 17.2 and 26.0. respectively, whereas the MFI

of DM92 cells stained with the same mAbs were 3.2 and 3.3, respectively. All transfectants expressed HLA-A2 (data not shown). Thecytotoxicity of DT252 12-1H10 and DT252 12-6C7 for this transfec-tant was tested. Both CTL clones killed DM92-A*0201 cells and

partially killed DM92 cells (Fig. 2). These results confirm that theseCTL clones recognize common melanoma antigens presented byHLA-A2 molecules.

Because DM122 cell lines do not possess HLA-A2, it is speculated

that the CTL clones recognize melanoma antigens that are presentedby other HLA molecules, or the recognition of the CTL clones is notrestricted with HLA molecules. To clarify these possibilities, weexamined whether anti-HLA class I mAb or anti-HLA-class II mAb

inhibits the killing of DM122 cells by these CTL clones. BecauseDM122 cells express HLA class I and HLA-DR but not HLA-DQ andHLA-DP molecules on the surface (data not shown), W6/32 anti-HLAclass I and L243 anti-HLA-DR mAbs were used for this purpose. The

killing of these clones for DM122 cells was not inhibited by thesemAbs (Fig. 1). It is well known that W6/32 mAb binds to monomor-phic determinants of all HLA class I molecules including HLA-E, -F,and -G molecules (27-29), whereas L243 mAb binds to monomorphicdeterminants of all HLA-DR molecules (29, 30). Because these mAbsare known to block the HLA-class I- or HLA-DR-restricted recognition of T cells (18, 31-36), the results indicate that the CTL clones

recognize melanoma antigens on DM 122 cells in an HLA-unrestricted

manner.Recognition of these CTL clones for other tumor cell lines was

investigated to clarify whether these CTL clones recognize onlymelanoma antigens. Both CTL clones killed giant-cell lung carcinomalines that do not express HLA-A2 and K562 cells, which are the

targets for NK cells (Table 2). These results suggest that the expression of the antigens that are recognized in an HLA-unrestricted

manner by these CTL clones is not restricted in melanoma cell lines,and the CTL clones may have NK-like activity.

The CTL Clones Carry a Single aÃŸ TCR. To exclude thepossibility that these clones contain NK cells, the surface molecules ofthese clones were examined. Both clones expressed CD3, CDS, andaÃŸTCR, and a low level of CD56 (MFI 45.2), but not CD4 (Fig. 3).They also lacked CD 16 (data not shown). In contrast, the NK cloneexpressed a high level of CD56 (MFI 168.7) and CD16 (MFI 165.3),whereas some CD3+CD8+ CTL clones lacked both CD16 and CD56

(data not shown). These findings were confirmed by repeating flowcytometry analysis. Taken together, these results indicate that the CTLclones are CD3+CD8+CD16~CD56 + CTLs bearing aÃŸTCR. How

ever, it remains possible that each CTL clone contains more than oneCDS+CTL population bearing different aÃŸTCR because some MHC-

unrestricted CTLs are known to express CD3 and CDS (37, 38).Therefore, the V gene family of aÃŸTCR in each CTL clone wasinvestigated using PCR with Vgene family-specific primers. A single

Va (VÂ«2)and two VÃŸ(VÃŸ7and VÃŸl9)TCR chains were detected onboth CTL clones (Fig. 4). These results suggest that both DT25212-1HIO and DT252 I2-6C7 clones contain two different T-cell

populations using the same single TCR a chain. To clarify thesepossibilities, TCR genes were cloned from the library that was constructed from these CTL clones using cDNA amplified by PCR withsynthetic anchor primer as well as Ca-specific and CÃŸ-specificprim

ers as described previously (26). The a and ÃŸchains of cloned TCRwere sequenced (Fig. 5). All 11 Va clones and all 8 VÃŸclones fromthe DT252 12-1H10 clone were identical and used Va2.i-Ja6.I andVÃŸ7.2-DÃŸ-JÃŸl.4gene segments. Similarly, all 12 Va clones and all

14 VÃŸclones from DT252 12-6C7 used the Va2.i-Ja9.7 and VÃŸ7.2-DÃŸ-JÃŸ2.2gene segments. No clone containing VÃŸl9 was found.

Moreover, the sequence data of the VÃŸ7.2gene (underlined in Fig. 5)strongly suggest that the VÃŸl9-specific primer was cross-hybridized

to the partially homologous sequences contained in the VÃŸ7.2gene.Thus, these results indicate that these CTL clones bear a single aÃŸTCR. Interestingly, both CTL clones used the same Va and VÃŸgenesegments, although they bear different Ja, DÃŸand JÃŸgene segments.

Table 2 Recognition of a panel of human tumor cell lines by DT2Ãœ212-IHIO and DT252 I2-6C7 CTL climes

Surface expression" DT252 12- 1H 10Target

cellsA172COLO320DMMlAPaCa-2HST2HuHLU99ALU99BPAIMLGaCAlK562DM252SIEB252OriginGlioblastomaColon

adenocarcinomaPancreaticcarcinomaGastriccarcinomaHepatomaGiant-cell

lungcarcinomaGiant-celllungcarcinomaOvarian

carcinomaGastriccarcinomaMyelogenousleukemiaMelanomaEB

virus-transformed cellsHLA-A2

HLA class I4:1*+

2.4C+

10.9+1.4+

+1.0+7.0+32.4+21.8+

3.8++-1.036.6A2/23.

B57/62. Cw-/-76.3A2/23.B57/62, Cw-/- -1.22:1*0.95.70.60.63.617.08.41.4-0.836.168.0-0.61:1*l.l1.80.10.73.43.63.20.7-1.022.257.20.4DT252

I2-6C74:1"4.69.92.81.210.245.323.511.6NT29.068.30.52:1*NTNTNTNTNTNTNTNTNT17.355.91.51:1*NTNTNTNTNTNTNTNTNT6.941.4-0.4

" The surface expression of HLA-A2 and HLA class I molecules on these cell lines was examined hy flow cytometry with BB7.2 anti-HLA-A2 and W6/32 anli-HLA class I mAbs.* E:T ratio.' % specific lysis.

2370



Fig. 3. Surface expression of CD3, CDS, and aÃŸTCR on DT252 12-1H10 clones. The clone wasstained with OKT3 anti-CD3, OKT4 anti-CD4.OKT8 anti-CD8, anti-CD56, or WT31 anti-a/3TCR mAb and FITC-conjugated anti-mouse immu-

noglobulin antibodies. Positive populations are asfollows: CD3, 99.0%; CD4, 0.3%; CD8, 98.7%;CD56, 54.5%; TCR aÃŸ,98.4%. The same resultswere found in the DT252 12-6C7 CTL clone.


CD3 CD4 CDS

200

A10' 10' 102 103

Fluorescence intensity

CD56

200

10" 10' 10! 103


200

A10'

200

10' 10Â°

10' 10' IO3


TCR a

104 10' 10' 102 103


10'

10' IO2 103 10Â«


A Single aÃŸTCR Recognizes Both Melanoma Antigens, WhichAre Presented by HLA-A2 Molecules and Are Not Presented byHLA Molecules. It is assumed that TCRs of these CTL clonesrecognize both melanoma antigens on DM252S1 cells and DM122cells by means of TCRs. To clarify this possibility, we investigatedthe effect of anti-CD3 mAb on the recognition of the DT252 12-1H10

Va

1 2345678 10 11 12 13 14 15 1Â«17 18

DT25212-1mo

123bp-

DT25212-6C7

t23bp

1 3 51 (2452

8 10 12 132 15 1779 11 13 1 14 16

19 21 2318 20 22 24

DT2S212-1H10 ,23bp-

123bp

DT2S212-6C7

1 3 51 6 > 10 12 132 IS 17 19 21 23i_^^^^2^^^iy^y^6 16202224

I -0IHFig. 4. Detection of Va and VÃŸTCRexpressed on DT252 12-1H10 and DT252 12-6C7

clones by PCR. The Va and VÃŸof the clones were detected by PCR using V genefamily-specific oligonucleotides. The weakly stained band of Va3 in the DT252 12-6C7clone is an artifact because the amplified fragment of Va3 is usually 40 bp longer than thatof Va2 by this PCR.

clone for both melanoma antigens on DM252S1 cells and DM122cells. Anti-CD3 mAb inhibited the recognition of the DT252 12-1H10

for both melanoma antigens on DM252S1 cells and DM122 cells (Fig.6). Similar findings were also observed in the DT252 12-6C7 clone

(data not shown). These findings suggest that TCR is involved in bothHLA-A2-restricted and HLA-unrestricted recognition. Furthermore, a

cold target inhibition test has shown that the cytolysis of DM252S1and DM122 cells by the DT252 12-1H10 clone was inhibited when

DM122 and DM252S1 cells were used as cold competitors (Fig. 7).Together, these results suggest that the same aÃŸTCR recognizes bothmelanoma antigens in both the HLA-A2-restricted and HLA-unre

stricted manners.

DISCUSSION

Previous studies (16, 17) suggested that a certain T-cell population

recognizes tumor antigens or alloantigens in both the HLA classI-restricted and HLA-unrestricted manners. However, because the

clonality of the CTL clones was not confirmed by analyses of TCRand cell surface markers in these studies, it remains possible that thedual recognition in both the HLA class I-restricted and HLA-unre

stricted manners results from more than one CTL population or thecontamination of NK cells. In the present study, we demonstrated thatthe CTL clones that recognize melanoma antigens in both mannerspossess a single aÃŸTCR and there was no contamination of NK cellsin CTL clones. Thus, we confirmed the presence of a T-cell popula

tion carrying a single TCR that recognizes melanoma antigens in boththe HLA class I-restricted and HLA-unrestricted manners.

HLA-A2-restricted recognition of the CTL clones was confirmedby both the inhibition of recognition by anti-HLA-A2 mAb and therestoration of killing activity for HLA-A2-negative melanoma cells bythe transfer of HLA-A2 genes. A previous study showed that mostHLA-A2-restricted melanoma-specific CTL clones carry Va8 VÃŸ2,

Va2 VÃŸl3.2, and Va2 VÃŸl4 (39). The present study revealed thatDT252 12-1H10 and DT252 12-6C7 carry the same Va and VÃŸgenes

(Va2.1 and VÃŸ7.2)but bear different Ja, DÃŸ,and JÃŸgenes. Together,these studies suggest that HLA-A2-restricted melanoma-specificCTLs may use limited TCR V genes. It is well known that HLA-A2-restricted melanoma-specific CTL clones recognize peptides derived

2371




DT252 12-1H10Va2.1-JÂ«6. 1

ATTGCCTCTCTCAACTGCACTTACAGTGACCGAGGTTCCCAGTCCTTCTTCTGGTACAGIASLNCTYSDRGSQSFFWÃ•RACAATATTCTGGGAAAAGCCCTGAGTTGATAATGTTCATATACTCCAATGGTGACAAAG

QYSGKSPELIMFIYSNGDKEAAGATGGAAGGTTTACAGCACAGCTCAATAAAGCCAGCCAGTATGTTTCTCTGCTCATC

DGRFTAQLNKASQYVSLLIVa2.1 Ja6.1

AGAGACTCCCAGCCCAGTGATTCAGCCACCTACCTCTGTGCCGTGAAC GCTGG TAATRDSQPSDSATYLCAVN AG NGCAGGCAACATGCTCACCTTTGGAGGGGGAACAAGGTTAATGGTCAAACCCAGNMLTFGGGTRLMVKP

VÃŸ7. 2-D|'.-J|tl - 4

TGGTACAAGCAAAGTGCTAAGAAGCCACTGGAGCTCATGTTTGTCTACAGTCTTGAAGAWYKQSAKKPLELMFVYSLEEACGGGTTGAAAACAACAGTGTGCCAAGTCGCTTCTCACCTGAATGCCCCAACAGCTCTC

RVENNSVPSRFSPECPNSSHACTTATTCCTTCACCTACACACCCTGCAGCCAGAAGACTCGGCCCTGTATCTCTGCGCC

LFLHLHTLQPEDSALYLCAv|'i) . 2 J i',1 . 4

AGCAGCCA AGAGGCGCCAGCCCTGGG TGAAAAACTGTTTTTTGGCAGTGGAACCCAGSSQ EAPALG EKLFFGSGTQCTCTCTGTCTTGL S V L

DT252 12-6C7Va2.1-Ja9.7

AGTGACCGAGGTTCCCAGTCCTTCTTCTGGTACAGACAATATTCTGGGAAAAGCCCTGASDRGSQSFFWYRQYSGKSPEGTTGATAATGTTCATATACTCCAATGGTGACAAAGAAGATGGAAGGTTTACAGCACAGCLIMFIYSNGDKEDGRFTAQL

TCAATAAAGCCAGCCAGTATGTTTCTCTGCTCATCAGAGACTCCCAGCCCAGTGATTCANKASQYVSLLIRDSQPSDS

Vu 2.1 Ja9.^GCCACCTACCTCTGTGCCGTGAAC GAG GGTGCTGACGGACTCACCTTTGGCAAAGGGATYLCAVN E GADGLTFGKGACTCATCTAATCATCCAGCCCT H L I I Q P

VÃŸ7.2-DÃŸ-JÃŸ2. lGGTCATAACGCTATGTATTGGTACAAGCAAAGTGCTAAGAAGCCACTGGAGCTCATGTTGHNAMYWYKQSAKKPLELMFTGTCTACAGTCTTGAAGAACGGGTTGAAAACAACAGTGTGCCAAGTCGCTTCTCACCTG

VYSLEERVENNSVPSRFSPEAATGCCCCAACAGCTCTCACTTATTCCTTCACCTACACACCCTGCAGCCAGAAGACTCG

CPNSSHLFLHLHTLQPEDSVÃŸ7.2 J|12 . 1

GCCCTGTATCTCTGCGCCAGCAGCCA AGGATCCCT CACCGGGGAGCTGTTTTTTGGAALYLCASSQ GSL TGELFFGGAAGGCTCTAGGCTGACCGTACTGEGSRLTVL

Fig. 5. Sequences of aÃŸTCR on DT252 I2-IH10 and DT252 I2-6C7 CTL clones.

from MART-1, tyrosinase, and gplOO (8, 40-43). Therefore, wespeculate that TCR V usage is restricted in HLA-A2-restricted CTLsspecific for MART-1, tyrosinase, and gplOO. In fact, recent studies(38, 44) demonstrated that HLA-A2-restricted MART-1-specific CTL

clones from five melanoma patients carried limited Va and VÃŸgenes(Va2, VÃŸ7,and VÃŸl4). Of these CTL clones, one CTL clone usedboth Va2 and VÃŸ7.This finding implies that both DT252 12-1H10and DT252 12-6C7 CTL clones also recognize peptides derived fromMART-1. However, because the D-J segment of the CTL clonecarrying Va2 and VÃŸ7is different from that of the DT252 12-1H10and DT252-12-6C7 CTL clones, it remains unknown whether bothCTL clones recognize MART-1.

It is well known that W6/32 mAb binds to monomorphic determinants on the a2 domain of all HLA class I molecules (45). This mAbstrongly inhibits the recognition of HLA class I-restricted T cells andanti-HLA class I alloreactive T cells (31-34). Thus far, there are noreports that this mAb failed to inhibit the recognition of HLA-A, -B,or -C restricted T cells. Similarly, it is well known that L243 mAb,specific for monomorphic determinants of HLA-DR molecules, inhibits recognition of HLA-DR-restricted T cells. Because DT25212-1H10 and DT252 12-6C7 CTL clones carry CDS, it is unlikely thatthese CTL clones recognize antigens presented by HLA-DR mole

cules. Thus, the findings strongly suggest that recognition of theseclones for DM 122 cells is HLA unrestricted. Moreover, it is supported

by the fact that these CTL clones are able to kill K562 cells that lacksurface expression of HLA molecules (46). However, the molecularmechanism of HLA-unrestricted recognition of these CTL clones

remains unknown. Both CTL clones killed K562 cellsthat are NK-sensitive cell lines, implying that these CTL clones

have NK activity. Previous studies showed the existence ofCD3 +CD16~CD56+ T cells that have NK activity (47). Because both

DT252 12-1H10 and DT252 12-6C7 CTL clones carry a single TCR,it is unlikely that CD3+CD16~CD56+ T cells carrying NK activity

and CD3+CD16 CD56 T cells carrying HLA-A2 restricted mela

noma-specific killing activity are mixed in the CTL clones. However,

the CTL clones described in the present study may belong to theCD3+CD16~CD56+ T-cell population. Because HLA-unrestricted

recognition of the DT252 12-1H10 and DT252 12-6C7 clones wasalso inhibited by anti-CD3 mAb, it is suspected that TCR of theseclones may be involved directly in HLA-unrestricted recognition.Recent studies (48-50) demonstrate the existence of a T-cell popu

lation expressing two TCRs on the cell surface and the function ofthese two TCRs. Therefore, it is suspected that CTL clones havingtwo different functions carry two different TCRs. However, the CTLclones described in the present study have a single TCR, stronglysuggesting that a single TCR is involved in two different functions.Recent study of ovarian tumor-specific CTLs demonstrated that polymorphic epithelial mucin core peptides are recognized in a MHC-unrestricted fashion by ovarian tumor-specific CTLs (51). The mo

lecular mechanism of recognition of these peptides by TCR isunknown. Further study to clarify the molecular mechanism of MHC-unrestricted T-cell recognition of these peptides should be very

40

'Ã¬n

u

lÃœ20

*

Target: DM252S120

10

Target: DM122

CDS CD4 CDS

monoclonal antibodies (40pg Ani)

CDS CD4 CDS

monoclonal antibodies (40pg Ani)

Fig. 6. Inhibition of recognition of DT252 12-1H10 by anti-CD3. anti-CD4. andanti-CD8 mAbs. Two X IO4 CTL clones incubated with 40 ng/ml of each mAb for l hwere added into a 96-well. round-bottomed microtiter plate containing 5 X IO3 slCr-

laheled target cells. After a 4-h incubation, the supernatant was collected and analyzedwith a gamma counter.

100

SO

Target: DM252S1

100

50

Target: DM122

DM2S2S DM122 HST-2 DM252S DM122 HST-2

Competitor cells

Fig. 7. Competitive inhibition of recognition of DT252 12-1HIO by DM252SI andDM 122 cells. The killing activity of DT252 12-1H10 was examined for labeled DM252S1cells and labeled DM 122 cells with competitors at an E:T ratio of 5.5:1. Four-fold (Ãœ)and1-fold (D) cold competitors were used. Gastric carcinoma cell line HST2 was used as a

negative control because both CTL clones failed to kill this cell line.

2372




important to understand not only MHC-unrestricted recognition of T

cells specific for other antigens but also the dual recognition of T cellsin MHC-restricted and -unrestricted fashions.

It is well known that tumor cells often lose the surface expressionof HLA class I molecules (9-11). The tumor cells lacking the surface

expression of HLA class I molecules are recognized and killed effectively by NK cells (46, 52, 53), whereas those expressing HLA classI molecules are removed by tumor-specific CD8+ CTLs. The recog

nition of NK cells is controlled negatively by receptors for MHC classI molecules (54-56). Similarly, recent studies showed that recognition

of T cells is inhibited by signal via receptors for MHC class Imolecules (57-59). The T-cell population recognizing tumor antigensin both the HLA class I-restricted and HLA-unrestricted manners

might be able to correspond effectively to the loss of HLA class Iexpression in tumor cells. The novel mechanism for antitumor immunity by T cells will provide a new insight into tumor immunity.

ACKNOWLEDGMENTS

We thank Dr. S. Ferrone for providing HO-2 mAb. Dr. N. Sato for providing

HST2 cells, Dr. A. Kariyone for technical assistance, and M. Noda forsecretarial assistance.

REFERENCES

18.

19.

20.

22.

23.

24.

25.

26.

27.

1. Anichini, A., Fossati. G.. and Parmiani. G. Clonal analysis of the cytolytic T-cellresponse to human tumors. Immunol. Today. 8: 385-389. 1987.

2. Gidlund. M.. Ã–rn, A., Pattengale, P. K., Jansson. M.. Wigzell, H., and Nilsson, K. 28-

Natural killer cells kill tumor cells at a given stage of differentiation. Nature (Lond.),292: 848-850, 1981.

3. Slingluff. C. L.. Jr., Cox, A. L.. Henderson, R. A.. Hunt. D. F., and Engelhard. V. H. 29.Recognition of human melanoma cells by HLA-A2.1-restricted cytotoxic T-lymphocytes is mediated by at least six shared peptide epitopes. J. Immunol., 750: 2955-

2963. 1993.4. Storkus. W. J.. Zeh. H. J.. III. Maeurer. M. J.. Satler, R. D., and Lotze. M. T. 30.

Identification of human melanoma peptides recognized by class I restricted tumorinfiltrating T lymphocytes. J. Immunol., 151: 3719-3727. 1993. 31.

5. Peoples, G. E., Goedegebuure, P. S.. Smith. R.. Linehan, D. C.. Yoshino. L, andEberlein. T. J. Breast and ovarian cancer-specific cytotoxic T-lymphocytes recognizethe same HER2/neu-derived peptide. Proc. Nati. Acad. Sci. USA. 92: 432-436, 1995. 32.

6. Traversari. C., van der Bruggen, P.. Luescher. I. F.. Lurquin. C.. ChÃ´mez. P.. Van Pel.A., De Plaen, E.. Amar-Costesec. A., and Boon. T. A nonapeptide encoded by humangene MAGE-1 is recognized on HLA-A1 by cytotoxic T-lymphocytes directed against 33.tumor antigen MZ2-E. J. Exp. Med., 176: 1453-1457, 1992.

7. Cox, A. L.. Skipper. J.. Chen, Y.. Henderson, R. A., Darrow, T. L.. Shabanowitz, J..Engelhard. V. H.. Hunt. D. F.. and Slingluff. C. L.. Jr. Identification of a peptiderecognized by five melanoma-specific human cytotoxic T cell lines. Science (Wash- 34.ington DC). 264: 716-719. 1994.

8. Kawakami, Y., Eliyahu. S., Sakaguchi. K., Robbins. P. F.. Rivoltini. L.. Yannelli,J. R.. Appela. E., and Rosenberg, S. A. Identification of the immunodominantpeptides of the MART-1 human melanoma antigen recognized by the majority of 35.HLA-A2-restricted tumor infiltrating lymphocytes. J. Exp. Med.. ISO: 347-352,

1994.9. Fleming. K. A.. McMichael. A.. Morton, J. A.. Woods, J.. and McGee. J. Distribution

of HLA class I antigens in normal human tissue and in mammary cancer. J. Clin. 36.Pathol. (Lond.), 34: 779-784. 1981.

10. Lampson. L. A., Fisher. C. A., and Whelan. J. P. Striking paucity of HLA-A, -B, -C,and ÃŸ2-microglobulin on human neuroblastoma cell lines. J. Immunol., 130: 2471- 37.

2478. 1983.11. Doyle. A.. Martin, W. J.. FuÃ±a,K., Gazdar, A., Carney, D., Martin, S. E., Linnoila,

I., Cuttitta, F.. Mulshine. J.. Bunn, P., and Minna. J. Markedly decreased expression 38.of class I histocompatibility antigens, protein, and mRNA in human small-cell lungcancer. J. Exp. Med.. 767: 1135-1151. 1984.

12. Stem. P.. Gidlund. M., Ã–rn.A., and Wigzell, H. Natural killer cells mediate lysis of 39.embryonal carcinoma cells lacking MHC. Nature (Lond.). 285: 341-342. 1982.

13. Brooks. C. G. Reversible induction of natural killer cell activity in cloned murinecytotoxic T-lymphocytes. Nature (Lond.), 305: 155-158, 1983.

14. Brooks. C. G.. Holscher, M., and Urdal, D. Natural killer activity in cloned cytotoxicT-lymphocytes: regulation by interleukin 2, imerferon. and specific antigen. J. Immunol.. 735: 1145-1152, 1985. 40.

15. Koide. J.. Rivas, A., and Engleman. E. G. Natural killer (NK)-like cytotoxic activityof allospecific T-cell receptor-y. 8* T-cell clones: distinct receptor-ligand interac

tions mediate NK-like and allospecific cytotoxicity. J. Immunol.. 142: 4161-4168. 41.

1989.16. Moretta. A.. Pantaleo. G., Mingari, M. C.. Melioli, G., Moretta, L.. and Cerottini, J-C.

Assignment of human natural killer (NK)-like cells to the T-cell lineage. Singleallospecific T-cell clones lyse specific or NK sensitive target cells via distinctrecognition structures. Eur. J. Immunol.. 14: 121-125. 1984. 42.

2373

Mazzocchi. A., Anichini, A.. Castelli. C.. Sensi. M.. Poli. F.. Russo. C., and Parmiani.G. T lymphocytes can mediate lysis of autologous melanoma cells by multiplemechanisms: evidence with a single T-cell clone. Cancer Immunol. Immunother.. 32:13-21, 1990.Darrow. T. L.. Slingluff. C. L., Jr.. and Seigier, H. F. The role of HLA class I antigensin recognition of melanoma cells by tumor-specific cytotoxic T-lymphocytes. Evidence for shared tumor antigens. J. Immunol.. 142: 3329-3335. 1989.

Crowley, N. J.. Slingluff, C. L.. Jr.. Darrow. T. L., and Seigier. H. F. Generation ofhuman autologous melanoma-specific cytotoxic T cells using HLA-A2-matchedallogeneic melanomas. Cancer Res., 50: 492-498. 1990.

Hayashi. H., Ennis, P. D.. Ariga. H.. Salter. R. D., Parham. P.. Kano. K., andTakiguchi, M. HLA-B51 and HLA-Bw52 differ by only two amino acids which arein the helical region of the al domain. J. Immunol.. 142: 306-311, 1989.Sanger. F.. Nicklen. S.. and Coulson, A. R. DNA sequencing with chain-terminatinginhibitors. Proc. Nati. Acad. Sci. USA. 74: 5463-5467. 1977.

Choi. Y.. Kotzin. B.. HerrÃ³n.L.. Callahan. J.. Marrack, P.. and Kappler. J. Interactionof Sraph\lococcus aiireus toxin "superantigens" with human T cells. Proc. Nati. Acad.

Sei. USA, 86: 8941-8945, 1989.Oksenberg. J. R.. Stuart. S., Begovich. A. B.. Bell. R. B.. Erlich, H. A.. Steinman. L.,and Bernard, C. C. A. Limited heterogeneity of rearranged T-cell receptor Vatranscripts in brains of multiple sclerosis patients. Nature (Lond.), 345: 344-346.

1990.Robinson. M. A. The human T-cell receptor ÃŸ-chaingene complex contains at least57 variable gene segments. Identification of six VÃŸgenes in four new gene families.J. Immunol.. 746: 4392-4397, 1991.Gublar. Y.. and Hoffman. B. J. A simple and very efficient method for generatingcDNA libraries. Gene (Amst.), 25: 263-269, 1983.Obata. F.. and Kashiwagi. N. Sequence analyses of the T-cell receptors utilized forrecognition of HLA-class II molecules. In: K. Tsuji. M. Aizawa, and T. Sasazuki(eds.), HLA 1991. Vol 1.. p. 865. Oxford. United Kingdom: Oxford University Press,1992.Bamstable. C. J.. Bodmer. W. F.. Brown, G.. Galfre, G.. Milstein, C.. Williams, A. F.,and Ziegel. A. Production of monoclonal antibodies to group A erythrocytes. HLA,and other human cell surface antigens: new tools for genetic analysis. Cell. 14: 9-20,

1979.Brodsky, F. M.. Parham. P.. Barnstable. C. J.. Crumpton. M. J., and Bodmer, W. F.Monoclonal antibodies for analysis of the HLA system. Immunol. Rev., 47: 3-61,

1979.Shimazu. Y.. Geraghty. D. E., Koller. B. H.. Orr, H. T., and DeMars, R. Transfer andexpression of three cloned human non-HLA-A. -B. -C class I major histocompatibilitycomplex genes in mutant lymphoblastoid cells. Proc. Nati. Acad. USA. 85: 227-231.

1988.Lampson. L. A., and Levy, R. Two populations of la-like molecules on a human Bcell line. J. Immunol., 25: 293-299, 1980.WÃ¶lfel.T.. Klehmann, E.. MÃ¼ller.C.. Schutt, K-H., BÃ¼schenfelde.M. Z., and Knuth,A. Lysis of human melanoma cells by autologous cytolytic T-cell clones. J. Exp.Med., 170: 797-810. 1989.Kariyone. A.. Tanabe. M.. Juji, T.. Kano. K.. and Takiguchi. M. Functional expression of HLA-C blank antigens on human blood lymphocytes. J. Immunol., 145:3714-3718, 1990.Littaua, R. A.. Oldstone. M. B. A.. Takeda, A.. Debouck, C.. Wong. J. T., Tuazon.C. U.. Moss, B., Kievits, F.. and Ennis, F. A. An HLA-C-restricted CD8+ cytotoxicT-lymphocyte clone recognizes a highly conserved epitope on human immunodeficiency virus type 1 gag. J. Virol.. 65: 4051-4056. 1991.Faber, L. M.. van Luxemburg-Heijs. S. A. P.. Willemze. R.. and Falkenburg. J. H. F.Generation of leukemia-reactive cytotoxic T-lymphocyte clones from the HLA-identical bone marrow donor of a patient with leukemia. J. Exp. Med.. 176: 1283-

1289. 1992.Sakai. K., Takiguchi. M.. Mori. S., Kobori, O.. Morioka, Y., Inoko. H.. Sekiguchi. M.,and Kano. K. Expression and function of class II antigens on gastric carcinoma cellsand gastric epithelia: differential expression of DR, DQ. and DP antigens. J. Nati.Cancer Inst.. 79: 923-932. 1987.Weyand. C. M.. Goronzy. J.. and Fathman. C. G. Human T-cell clones used to define

functional epitopes on HLA class II molecules. Proc. Nati. Acad. Sci. USA. 83:762-766, 1986.

Ritz, J., Schmidt, R. E., Michon, J., Hercend, T., and Schlossman. S. F. Characterization of functional surface structure on human natural killer cells. Adv. Immunol..42: 181-211. 1988.Roberts. T. E., Shipton. U.. and Moore. M. Role of MHC class-I antigens and the CD3complex in the lysis of autologous human tumours by T-cell clones. Int. J. Cancer. _?Â°;436-441. 1987.

Sensi. M., Salvi, S., Castelli, C., Maccalli, C.. Mazzocchi. A., Mortarini. R., Nicolini.G.. Herlyn. M., Parmiani, G., and Anichini, A. T- cell receptor (TCR) structure ofautologous melanoma-reactive cytotoxic T- lymphocyte (CTL) clones: tumor-infil

trating lymphocytes overexpress in vivo the TCR ÃŸchain sequence used by anHLA-A2-restricted and melanocyte-lineage-specific CTL clone. J. Exp. Med.. 178:1231-1246. 1993.

Brichard. V., Pel, A. V.. WÃ¶lfel,T.. WÃ¶lfel.C., Plaen, E. D., Leihe. B.. Coulie, P., andBoon. T. The tyrosinase gene codes for an antigen recognized by autologous cytolyticT-lymphocytes on HLA-A2 melanomas. J. Exp. Med., 178: 489-495, 1993.Stevens. E. J.. Jacknin. L.. Robbins, P. F.. Kawakami. Y., El-Gamil. M.. Rosenberg,S. A., and Yannelli. J. R. Generation of tumor-specific CTLs from melanoma patientsby using peripheral blood stimulated with allogeneic melanoma tumor cell lines: finespecificity and MART-1 melanoma antigen recognition. J. Immunol.. 154: 762-771,

1995.Rivoltini. L.. Kawakami. Y.. Sakaguchi, K.. Southwood. S., Sette, A., Robbins. P. F..




Marincola. F. M., Salgaller, M. L., Yannelli, J. R.. Appella, E., and Rosenberg, S. A.Induction of tumor-reactive CTL from peripheral blood and tumor-infiltrating lym

phocytes of melanoma patients by in vitro stimulation with an immunodominantpeptide of the human melanoma antigen MART-1. J. Immunol., 154: 2257-2265,1995.

43. Kawakami. Y.. Eliyahu. S., Jennings, C, Sakaguchi, K.. Kang, X., Southwood, S.,Robbins, P. F.. Sette. A., Appella, E., and Rosenberg, S. A. Recognition of multipleepitope in the human melanoma antigen gplOO by tumor-infiltrating T lymphocytesassociated with in vivo tumor regression. J. Immunol., 154: 3961-3968, 1995.

44. Sensi, M., Traversar!, C., Radrizzani. M., Salvi, S.. Maccalli, C., Mortarini. R..Rivellini. L., Farina, C., Nicolini. G., WÃ¶lfel.T.. Brichard, V.. Boon, T., Bordignon,C.. Anichini. A., and Parmiani, G. Cytotoxic T-lymphocyte clones from differentpatients display limited T-cell-receptor variable-region gene usage in HLA-A2 restricted recognition of the melanoma antigen Melan-A/M ART-1. Proc. Nati. Acad.Sci. USA, 92: 5674-5678, 1995.

45. Tanabe, M.. Takiguchi. M., Vaniamolo, J.. Hayashi, H., and Kano, K. Analysis ofxenoantigenicity of HLA class I molecules by a complele series of human-mousehybrid genes. Transplanlation (Baltimore), 48: 135-140, 1989.

46. Harel-Bellan. A.. Quillet. A.. Marchio!, C.. DeMars. R.. Tursz. T., and Fradelizi, D.Natural killer susceptibility of human cells may be regulated by genes in the HLAregion on chromosome 6. Proc. Nati. Acad. Sci. USA, 83: 5688-5692, 1986.

47. Lanier, L. L., Le, A. M., Civin. C. I., token, M. R., and Phillips, J. H. The relationshipof CD16 (Leu-11) and Leu-19 (NKH-I) antigen expression on human peripheralblood NK cells and cytotoxic T-lymphocytes. J. Immunol.. 136: 4480-4486, 1986.

48. Davodeau. F., Peyrat. M-A.. Houde, !.. Hallet, M-M.. Libero, G. Dâ€žVie, H., and

Bonneville, M. Surface expression of two distinct functional antigen receptors onhuman yS T cells. Science (Lond.), 260; 1800-1802. 1993.

49. Padovan. E., Casorati. G.. Dellabona, P.. Meyer. S.. Brockhaus. M.. andLanzavecchia. A. Expression of two T-cell receptor a chains: dual receptor T cells.Science (Lond.), 262: 422-424. 1993.

50. Davodeau. F., Peyrat, M-A., RomagnÃ©,F., Necker, A., Hallet, M-M.. Vie, H.. andBonneville. M. Dual T-cell receptor ÃŸchain expression on human T lymphocytes. J.Exp. Med., 181: 1391-1398, 1995.

51. loannides. C. G.. Fisk. B., Jerome, K. R., Irimura, T.. Wharton, J. T., and Finn, O. J.Cytotoxic T cells from ovarian malignant tumors can recognize polymorphic epithelial mucin core peptides. J. Immunol., 151: 3693-3703, 1993.

52. Storkus, W. J.. Howell, D. N., Salter, R. D., Dawson, J. R., and Cresswell, P. NKsusceptibility varies inversely with target cell class I HLA antigen expression. J.Immunol., 138: 1657-1659, 1987.

53. Ljunggren, H-G., and Karre, K. In search of the "missing self: MHC molecules and

NK cell recognition. Immunol. Today, //: 237-244, 1990.54. Yokoyama. W. M. Natural killer cell receptors specific for major histocompatibility

complex class I molecules. Proc. Nati. Acad. Sci. USA, 92: 3081-3085, 1995.55. Colonna. M., and Samaridis, J. Cloning of immunoglobulin-superfamily members

associated with HLA-C and HLA-B recognition by human natural killer cells. Science(Lond.), 268: 405-408, 1995.

56. Wagtmann. N., Biasson, R., Cantoni, C.. Verdiani. S., Malnati, M. S., Vitale, M..Bottino. C.. Moretta, L.. Moretta. A., and Long, E. O. Molecular clones of the p58 NKcell receptor reveal immunoglobulin-related molecules with diversity in both theextra- and intracellular domains. Immunity. 2: 439-449, 1995.

57. Phillips, J. H., Gumperz, J. E., Parham, P., and Lanier, L. L. Superantigen-dependent,cell-mediated cytotoxicity inhibited by MHC class I receptors on T lymphocytes.Science (Lond.). 268: 403-405, 1995.

58. Mingan, M. C., Vitale, C., Cambiaggi, A.. Schiavetti. F.. Melioli, G.. Ferrini. S., andPoggi. A. Cytolytic T-lymphocytes displaying natural killer (NK)-like activity: expression of NK-related functional receptors for HLA class I molecules (p58 andCD94) and inhibitory effect on the TCR-mediated target cell lysis or lymphokineproduction. Int. Immunol.. 7: 697-703, 1995.

59. Nakajima, H., Tomiyama, H., and Takiguchi. M. Inhibition of yo T-cell recognitionby receptors for MHC class I molecules. J. Immunol., 155: 4139-4142, 1995.

2374



1996;56:2368-2374. Cancer Res Hitomi Kubo, Jun Abe, Fumiya Obata, et al. Melanoma AntigensDual Recognition of a Human Cytotoxic T-Cell Clone for

Updated version

http://cancerres.aacrjournals.org/content/56/10/2368

Access the most recent version of this article at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/56/10/2368To request permission to re-use all or part of this article, use this link



http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]



dual recognition of a human cytotoxic t-cell clone for ... · and by nk cells (1, 2)....

Documents