engineering plants for the phytoremediation of rdx...

Engineering plants for the phytoremediation of RDX inthe presence of the co-contaminating explosive TNT

Elizabeth L. Rylott1, Maria V. Budarina1, Ann Barker1, Astrid Lorenz1, Stuart E. Strand2 and Neil C. Bruce1

1CNAP, Department of Biology, University of York, PO Box 373, York YO10 5YW, UK; 2Department of Civil and Environmental Engineering,

University of Washington, Box 355014, Seattle, WA 98195-5014, USA

Author for correspondence:Neil C. Bruce

Tel: +44 01904 328777

Email: [email protected]

Received: 11 March 2011

Accepted: 21 May 2011

New Phytologist (2011) 192: 405–413doi: 10.1111/j.1469-8137.2011.03807.x

Key words: 2,4,6-trinitrotoluene,Arabidopsis, hexahydro-1,3,5-trinitro-1,3,5-triazine, RDX, remediation, TNT.

Summary

• The explosive compounds hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) and

2,4,6-trinitrotoluene (TNT) are widespread environmental contaminants com-

monly found as co-pollutants on military training ranges. TNT is a toxic carcinogen

which remains tightly bound to the soil, whereas RDX is highly mobile leaching

into groundwater and threatening drinking water supplies. We have engineered

Arabidopsis plants that are able to degrade RDX, whilst withstanding the phyto-

toxicity of TNT.

• Arabidopsis thaliana (Arabidopsis) was transformed with the bacterial RDX-

degrading xplA, and associated reductase xplB, from Rhodococcus rhodochrous

strain 11Y, in combination with the TNT-detoxifying nitroreductase (NR), nfsI,

from Enterobacter cloacae.

• Plants expressing XplA, XplB and NR remove RDX from soil leachate and grow

on soil contaminated with RDX and TNT at concentrations inhibitory to XplA-only

expressing plants.

• This is the first study to demonstrate the use of transgenic plants to tackle two

chemically diverse organic compounds at levels comparable with those found on

contaminated training ranges, indicating that this technology is capable of remedi-

ating concentrations of RDX found in situ. In addition, plants expressing XplA

and XplB have substantially less RDX available in aerial tissues for herbivory and

potential bioaccumulation.

Introduction

The explosive compounds hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) and 2,4,6-trinitrotoluene (TNT) are signifi-cant environmental pollutants, contaminating an estimated16 million hectares of military land in the USA alone (USDefense Science Board Task Force, 1998; US GeneralAccounting Office 2004). Contamination on trainingranges mainly arises from incomplete detonation ofmunitions. The concentration of explosive pollutants isheterogeneous, with hot spots of between 100 and1000 mg kg)1 (Talmage et al., 1999; Jenkins et al., 2006),although the majority is below this level. Pollution has alsohistorically arisen from the manufacture and storage ofexplosives. Although RDX is less toxic than TNT (Woodyet al., 1986; Burdette et al., 1988; Kucukardali et al.,2003), it is still classified as a possible human carcinogen bythe Environmental Protection Agency (EPA). Within the

soil, RDX is highly mobile and readily leaches into ground-water with the potential to pollute subsequent waterways.This route of pollution has led to the contamination ofa sole source aquifer below Massachusetts MilitaryReservation on Cape Cod (USA) (Clausen et al., 2004).

Studies have shown that RDX is readily taken up andtranslocated to the aerial tissues of plants (Vila et al., 2007),and is reduced to hexahydro-1-nitroso-3,5-dinitro-1,3,5-triazine and hexahydro-1,3-nitroso-5-nitro-1,3,5-triazine inthe leaf, with subsequent mineralization of the heterocyclicring requiring light (Van Aken et al., 2004). However, despitehigh uptake rates, plants have inherently low abilities todegrade RDX (Best et al., 1999; Winfield et al., 2004).Microorganisms with the ability to degrade RDX have beenisolated, including Rhodococcus rhodochrous strain 11Y (Seth-Smith et al., 2002). The RDX-degrading ability of this bacte-rium, encoded by xplA, has been shown to be the result of acytochrome P450, which catalyses the aerobic degradation of

NewPhytologist Research

� 2011 The Authors

New Phytologist � 2011 New Phytologist Trust

New Phytologist (2011) 192: 405–413 405www.newphytologist.com

RDX to 4-nitro-2,4-diazabutanal (NDAB), nitrite and form-aldehyde, whereas, anaerobically, methylenedinitramine isproduced instead of NDAB (Jackson et al., 2007) (Fig. 1a).Arabidopsis thaliana (Arabidopsis) plants expressing XplAhave been shown to remove RDX from a saturating(180 lM) solution (Rylott et al., 2006). This concentrationis more than three times that measured in wastewater frommanufacturing sites (Jackson et al., 1978), suggesting that thisapproach could be successfully incorporated into a phyto-remediation programme. Soil studies have demonstratedthat plant biomass is enhanced in XplA-expressing plantsgrowing on RDX-contaminated soil compared with uncon-taminated soil, indicating that XplA-expressing plants canutilize the nitrite released from the degradation of RDX as anitrogen source for growth (Rylott et al., 2006). Plants co-expressing XplA and XplB, the partnering reductase forXplA in Rhodococcus, exhibited an additional, up to 30-fold,increase in the rate of RDX removal (Jackson et al., 2007).

Commonly used alongside RDX in military munitions,TNT is toxic to all organisms tested so far, including plants(Rosenblatt, 1980; Pavlostathis et al., 1998; Robidouxet al., 2003; Rocheleau et al., 2006), and is listed by theEPA as a possible human carcinogen. Unlike RDX, TNTbinds tightly to the humic fraction of the soil, reducing bio-logical availability (Hundal et al., 1997; Thorn & Kennedy,2002). TNT is most commonly biotransformed in soil bytype I bacterial nitroreductases (NRs) to hydroxylamino di-nitrotoluenes (HADNTs) with subsequent reduction toamino dinitrotoluenes (ADNTs) (Fig. 1b). Within theplant, TNT is restricted predominantly to the root tissuesand, although plant enzymes have been shown to transformand conjugate TNT in vivo, plants have only a limited abil-ity to detoxify TNT (Gandia-Herrero et al., 2008; Rylott& Bruce, 2009). To overcome this, bacterial genes confer-ring TNT detoxification activity have been engineered intoplants. The onr gene encoding pentaerythritol tetranitratereductase and nfsI gene encoding a NR from Enterobactercloacae have both been independently expressed inNicotiana tabacum (tobacco) (French et al., 1999; Hanninket al., 2001). The resultant plant lines exhibited increasedcapacities for tolerating and detoxifying TNT. The NRenzyme transforms TNT by preferentially reducing thenitro group at the four position to produce 4-nitroso-2,6-dinitrotoluene (4-NODNT) and then 4-hydroxylamino-di-nitrotoluene (4-HADNT), which is subsequently reducedby the plant to 4-amino-2,6-dinitrotoluene (4-ADNT).These reduced TNT products are then glycosylated andstudies suggest they then become bound to the plant cell wall(Gandia-Herrero et al., 2008). In soil studies, NR-expressingtobacco plants were able to tolerate levels of TNT contami-nation toxic to untransformed plants (Hannink et al., 2001).

The high mobility of RDX means that it needs to beintercepted on military ranges before it migrates into thegroundwater. Plants, with their extensive root systems, offera potentially viable and sustainable means of attenuatingthis pollutant. As both RDX and TNT are often found oncontaminated sites together, if RDX is to be effectivelyremoved from contaminated sites, plants need to be engi-neered to tolerate the toxicity of the co-polluting TNT.Here, we present data showing that this can be achieved inArabidopsis under laboratory conditions by engineeredXplA-NR and XplA-XplB-NR transgenic plant lines.

Materials and Methods

RDX and TNT were provided by the Defence Science andTechnology Laboratory (DSTL) (Fort Halstead, Kent, UK).

The xplA gene was cloned into the binary vectorpMLBart (Gleave, 1992), which confers resistance to theherbicide Basta, to produce the vector pMLBart-xplA. ThexplB gene was cloned into pART27 (Gleave, 1992), whichconfers resistance to kanamycin, to produce the vector

Fig. 1 Detoxification pathways of 2,4,6-trinitrotoluene (TNT) andhexahydro-1,3,5-trinitro-1,3,5-triazine (RDX). (a) Proposedpathway of RDX degradation by Rhodococcus rhodochrous strain11Y (Jackson et al., 2007, Copyright (2007) National Academy ofSciences, USA). Dotted lines indicate cleavage sites; compounds inparentheses are hypothetical. (b) Reduction of the 4-NO2 of TNT bynitroreductases (Hannink et al., 2007).

406 Research

NewPhytologist



New Phytologist (2011) 192: 405–413

www.newphytologist.com

pART27-xplB. The nfsI gene, encoding NR activity, wascloned into pART27 (Gleave, 1992) to create pNITRED3(Hannink et al., 2001), and separately into pJo530, apBIN19 derivative (Bevan, 1984) which confers resistanceto hygromycin, to create pJo530-nfsI. All constructsexpressed xplA, xplB and nfsI under the control of theCaMV35S promoter and ocs terminator. Approximately 50independent Arabidopsis thaliana (L.) Heynh (Arabidopsis)ecotype Columbia 0 background transformants were gener-ated for each construct using Agrobacterium-mediated floraldipping. Independent homozygous lines expressing xplAwere as characterized previously (Rylott et al., 2006). Threeto five independent homozygous lines containing the xplBor nfsI constructs were used for further study. These lineswere selected because they had segregation ratios indicativeof single insertion events and relatively high rates of RDX(for XplA and XplA-XplB) (Rylott et al., 2006; Jacksonet al., 2007) or TNT (for NR-expressing) removal fromliquid culture. XplA-NR plants were generated by crossingthe pNITRED3 NR-expressing line with the highest rate ofTNT removal from liquid culture (line B7) with the XplA-expressing line exhibiting the highest RDX removal ratefrom liquid culture (line 10). The triple XplA-XplB-NR lineswere generated firstly by transforming line 35S::XPLA-10(Rylott et al., 2006) with the pART27-xplB construct. TheXplAB lines with the highest rates of RDX removal fromliquid culture, XplAB-2 and XplAB-27 (Jackson et al., 2007),were re-transformed with pJo530-nfsI to generate XplA-XplB-NR lines. The presence of the transgenes was confirmed in alllines using PCR analysis (results not shown). Seven XplAB-2

derived homozygous lines, independently transformed withnfsI, were selected for further analyses based on the criteria out-lined above. A summary of the plant lines used in this study ispresented in Table 1.

Transgene expression analysis

Rosette leaves of 6-wk-old soil-grown plants were harvestedand ground in liquid nitrogen. For transcript analysis,mRNA was extracted individually from five plants per lineusing the RNAesy kit and treated with DNAse to removegenomic DNA (Qiagen). One microgram of total RNA wasthen used to synthesize cDNA using oligo(dT) 12–18 prim-ers (Invitrogen) and SuperScript III Reverse Transcriptase(Invitrogen). Real-time reverse transcription-polymerasechain reaction (RT-PCR) was performed with an ABI7300real-time PCR detection system using SYBR green (Bio-Rad, Veenendaal, the Netherlands). Primer sequences wereforward TACAGTGTCTGGATCGGTGGTT and reverseCGGCCTTGGAGATCCACAT for ACTIN2, forwardCGACGAGGAGGACATGAGATG and reverse GCA-GTCGCCTATACCAGGGATA for xplA, forward CAC-CGCAATCGGTTTCG and reverse GTACAGGCCCGG-AGCAAGA for xplB and forward ACACGCCGGAAG-CCAAA and reverse GGTGCATGTCGGCGAAGTA fornfsI. Relative expression values were calculated using ACTINmRNA as an internal reference.

For Western analysis, 10 lg of crude protein extract fromrosette leaves was loaded per lane. Antibodies to the XplAprotein, as used in Rylott et al. (2006), and NR protein

Table 1 Summary of plant lines, binary vectors and transgenes described in this study

Plant line Parent line(s) Construct(s)

Marker gene(s) Transgene present

Sourcebar hptII nptII nsfI xplA xplB

Wild type ecotype Col0 - - - - - - - - NASC (line N1094)

35S:XPLA-10 - pMLBart-xplA 4 - - - 4 - Rylott et al. 2006

B7 - pNITRED - - 4 4 - -

2G - pNITRED - - 4 4 - -

D2 - pNITRED - - 4 4 - -

XplA-NR 35S:XPLA-10 pMLBart-xplA 4 - - - 4 -B7 pNITRED - - 4 4 - -

XplAB-2 35S:XPLA-10 pMLBart-xplA 4 - - - 4 - Jackson et al. 2007- pART27-xplB - - 4 - - 4

XplA-XplB-NR XplAB-2 pMLBart-xplA 4 - - - 4 -- pART27-xplB - - 4 - - 4

- pJo530-nfsI - 4 - 4 - -

bar, encodes resistance to the herbicide bialaphos; hptII, hygromycin phosphotransferase encodes resistance to hygromycin; nptII, neomycinphosphotransferase, encodes resistance to kanamycin.

NewPhytologist Research 407





were raised in rabbit, and a goat, anti-rabbit alkaline phos-phatase conjugate was used as secondary antibody.

Liquid culture experiments

Liquid culture experiments were performed as described previ-ously (Rylott et al., 2006), with the exception in the XplA-XplB-NR lines where eight, 3-wk-old plants per flask were used.Briefly, 200 1-d-old seedlings grown on agar plates containinghalf-strength Murashige and Skoog medium were transferredto 100-ml conical flasks containing 20 ml of half-strengthMurashige and Skoog medium and 20 mM sucrose. Plantswere grown under 20 lmol m)2 s)1 light on a rotary shaker.

Soil experiments

Soil leachate studies were performed as described previously(Jackson et al., 2007). For the contaminated soil studies,30 mg ml)1 TNT and RDX solutions in acetone werealiquoted onto 50 g of dry sand in 2-l polypropylene tubs.For uncontaminated soil, a volume of acetone equivalent tothat used for soil contaminated with the highest level ofTNT and RDX was applied. The acetone was evaporatedovernight, a 35-mm glass marble was added to each tub toaid mixing and the tubs were placed on a rotating mixer for1 h; 450 g soil (Levington’s F2 compost) was added andthe tubs were mixed overnight. Equal amounts of soil wereweighed into 5-cm-high plastic pots and 5-d-old seedlingsgrown on agar plates containing half-strength Murashigeand Skoog medium were planted into the soil and grownfor 8 wk at 180 lmol m)2 s)1 light with a 12-h photope-riod with 18�C dark and 21�C light temperatures.

RDX extraction

Levels of RDX and TNT in plant extracts were determinedusing EPA Method 8330 (US Environmental ProtectionAgency 1994). Briefly, RDX and TNT were extracted fromground, freeze-dried plant tissue (maximum, 2.6 g freshweight) using 2 · 10-ml volumes of methanol. Followingsolvent evaporation in a rotary vacuum, samples were resus-pended in 4 ml of water : methanol (50 : 50) and analysedby HPLC (2695 Separations Module and 2996 PhotodiodeArray Detector; Waters, Milford, MA, USA) using aTechsphere C18 column (250 mm · 4.6 mm), isocraticconditions with water : methanol (50 : 50) and a flow rate of1 ml min)1. RDX and TNT elutions were monitored at 230nm, and integrations were performed using Empower software.

For statistical analysis, a one-way ANOVA followed byDunnett’s test was used to compare the results for each ofthe transgenic lines against parental or wild-type lines.

Sequence data from this article can be found inGenBank ⁄ EMBL data libraries under the following accessionnumbers: xplA and xplB (AF449421) and nfsI (M63808).

Results

Ability of XplA-NR plants to remove RDX and TNTfrom liquid culture

The DNA construct originally used to create the NR-expressingtobacco plants, pNITRED3 (Hannink et al., 2001), wastransformed into Arabidopsis and five independent homo-zygous lines were selected for further characterization. Aspredicted, these lines exhibited enhanced tolerance to TNTand increased uptake of TNT from liquid medium, with lineB7 showing the highest rate of TNT uptake from liquidmedium Fig. 2. The plant line B7 was genetically crossedinto the previously published XplA-expressing line with thehighest RDX uptake rate (Rylott et al., 2006) to create plantsexpressing both XplA and NR activities. To test whether the

Fig. 2 Uptake of 2,4,6-trinitrotoluene (TNT) by Arabidopsis

thaliana grown in liquid culture. Levels of TNT in liquid mediumcontaining 200 10-d-old wild-type (WT) and nitroreductase (NR)-expressing plants dosed with (a) 100, (b) 250 and (c) 500 lM TNT.WT, open circles; NR, closed circles. Results are the mean ± SE offive replicate flasks.

408 Research

NewPhytologist





XplA-NR plants could remove both RDX and TNT fromliquid culture, the XplA-NR plants were grown in liquidculture and dosed with 180 lM RDX and a range of TNTconcentrations (75, 100, 125, 150 and 175 lM). Withincreasing concentrations of TNT, the rate of RDX uptakedecreased, with RDX only taken up following the depletionof TNT to below 60 lM in the medium (Fig. 3a,b).Fig. 3(c) shows the corresponding levels of the TNT trans-formation product ADNT in the medium, which mirror theTNT depletion rates. During the course of the experiment,the photosynthetic tissues of the XplA-NR plants exhibitedincreased yellowing, followed by bleaching and biomassreductions, which correlated with increasing TNT concen-tration (Fig. 3d,e). Despite this inhibition, the XplA-NRplants were still significantly more tolerant to TNT thaneither XplA-only expressing plants or wild-type untrans-formed plants, both of which were killed by TNTconcentrations of 175 lM and above (results not shown).Fig. 3(f) shows that the XplA-NR plants retained the capac-ity to remove RDX from liquid culture, in the absence ofTNT, at a rate similar to that of the parental XplA-expressingline. Studies were then performed to monitor the tolerance ofXplA-NR plants to TNT contamination in soil.

Ability of XplA-NR plants to grow in RDX- and TNT-contaminated soil

Plants were grown in soil contaminated with either 250 or500 mg kg)1 of RDX and TNT for 6 wk. In uncontami-

nated soil, the XplA-NR plants produced similar shootbiomasses and appearances to untransformed XplA and NRplants (Fig. 4a,d). In the presence of RDX and TNT, thegrowth of all the plants was reduced significantly. Asexpected, the NR-expressing plants had higher shootbiomasses than wild-type plants: three- and seven-foldhigher at 250 and 500 mg kg)1 concentrations, respectively(Fig. 4b,c). However, the shoot biomasses of the NR-XplAplants were significantly higher than those of the NR-expressing lines: six-fold higher at the 250 mg kg)1 concen-tration (Fig. 4b). At these concentrations, only the NR- andXplA-NR-expressing plants produced sufficient biomass tosupport seed set (results not shown).

Ability of XplA-XplB-NR lines to remove RDX and TNTfrom liquid culture

We have shown previously that the expression of theRhodococcal reductase, XplB, together with XplA inArabidopsis increases RDX uptake from liquid culture by30-fold (Jackson et al., 2007). To produce Arabidopsis plantswith this ability, in concert with increased tolerance to TNT,we transformed the previously published XplA-XplB line thathad the fastest RDX removal rate (line 2; Jackson et al.,2007) with the nfsI gene to produce XplA-XplB-NR lines.Seven lines, homozygous for all three transgenes, were subse-quently characterized for RDX uptake and ability to grow inthe presence of TNT. When the plant lines were grown inliquid culture and dosed with RDX and TNT together, the

(a) (d)

(e)

(f)

(b)

(c)

Fig. 3 Uptake of hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) and 2,4,6-trinitrotoluene (TNT) by XplA-NR-expressingArabidopsis thaliana grown in liquid culture.Levels of (a) RDX, (b) TNT and (c) aminodinitrotoluene (ADNT) in liquid mediacontaining 10-d-old XplA-NR-expressingplants dosed with 180 lM RDX and a rangeof TNT concentrations. (d) Appearance and(e) fresh weight (FW) of XplA-NR plants 7 dpost-dosing. (f) Levels of RDX in liquid mediacontaining 10-d-old WT, XplA- andXplA-NR-expressing plants dosed with180 lM RDX only. WT, wild-type; NR,nitroreductase. Results are the mean ± SE offive replicate flasks with 200 seedlings perflask. *Significantly different (P < 0.05)from value for untreated plants.






XplA-XplB-NR plants removed all the RDX from the med-ium within 3 d, whereas the XplA-XplB parental lineremoved only two-thirds of the RDX in this time (Fig. 5a).The XplA-XplB-NR lines also removed TNT more quicklythan the XplA-XplB lines. Fig. 5(c) demonstrates that, 17 hafter dosing, four of the five XplA-XplB-NR lines tested hadremoved significantly more TNT from the medium than theXplA-XplB parental line.

Characterization of XplA-XplB-NR lines

To monitor transgene transcript levels, quantitative real-time PCR was conducted on the XplA-XplB-NR-expressingArabidopsis lines. Lines 7 and 16 had xplA and xplBtranscript levels comparable with those of the parentalXplA-XplB line, whereas the remaining XplA-XplB-NRlines exhibited two- to ten-fold increases in xplA and xplBtranscripts relative to the parental line XplA-XplB. The NR

(a)

(b)

(c)

(d)

Fig. 4 Growth of XplA-NR-expressing Arabidopsis thaliana plantsin hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX)- and 2,4,6-trinitrotoluene (TNT)-contaminated soil. Shoot fresh weights (FW)of 6-wk-old plants grown in (a) uncontaminated soil, (b)250 mg kg)1 RDX and TNT and (c) 500 mg kg)1 RDX and TNT. (d)Appearance of plants after 6 wk of growth in soil contaminated withboth RDX and TNT. WT, wild-type; NR, nitroreductase. Results arethe mean ± SE of five replicate pots.

(a)

(b)

(c)

Fig. 5 Uptake of hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) and2,4,6-trinitrotoluene (TNT) by XplA-XplB-NR-expressingArabidopsis thaliana plants grown in liquid culture. Plants weredosed with 180 lM RDX and 250 lM TNT. Levels of (a) RDX and(b) TNT in the culture medium. (c) Levels of TNT in the medium17 h after dosing. NPC, no plant control; WT, wild-type; NR,nitroreductase; n ⁄ d, not detected. Results are the mean ± SE of fourreplicate flasks. *Significantly different (P < 0.05) from value forXplA-XplB plants.

410 Research

NewPhytologist





(nfsI) transcript levels were more variable, with expressionlevels between one and 585-fold higher than XplA-XplB-NR line 4, the line with the lowest nfsI expression(Supporting Information Fig. S1a). The results aredescribed in more detail in Supporting Information.

The results of the Western blot analysis (Fig. S1b andNotes S1) broadly matched the results of quantitative real-time PCR. Levels of XplA in the XplA-XplB-NR lines werefurther enhanced relative to the XplA-XplB parental line andthe levels of NR protein varied in the triple transgenic lines,as expected for lines independently transformed with nfsI.We were unable to measure XplA or NR activities in plantextracts; however, to investigate the relative contribution ofthe bacterial NR to TNT transformation in the XplA-XplB-NR lines, we measured the levels of the 2- and 4-ADNT isomersin the shoots from the plants grown in soil contaminatedwith 100 mg kg)1 TNT. The bacterial NR favours thereduction of the 4-nitro group, producing predominantlythe 4-ADNT isomer, whereas the combined endogenous NRactivities in Arabidopsis result in no isomer bias. The ratiosof 4-ADNT to 2-ADNT were 0.9 for the wild-type and 0.7for XplA-XplB, but much higher (16.1) for the NR line B7.The XplA-XplB-NR lines exhibited ratios intermediate(0.6–6.1) between those of the wild-type and NR line, indi-cating that the bacterial NR was active in these lines.

Ability of XplA-XplB-NR lines to remove RDX fromcontaminated soil leachate

To test whether the XplA-XplB-NR lines were able toremove RDX migrating through the soil column, soil leach-ate levels of plants watered with RDX were measured(Fig. 6). The decrease in RDX levels observed in theunplanted controls can be attributed to differences in soilproperties in the absence of plant roots, enabling liquid totravel more quickly through the soil column. All the XplA-XplB-NR lines, with the exception of line 5, removed RDXfrom soil leachate at rates comparable with the XplA-XplBparental line. The concentration of RDX in the soil leachateafter 7 d from pots in which XplA-XplB-NR and XplA-XplB lines were growing was significantly less (P < 0.001)than the level of RDX in leachate from pots in which wild-type plants were growing (Fig. 6a). To examine whether theXplA-XplB-NR lines were still able to remove RDX fromsoil leachate in the presence of the co-pollutant and phyto-toxin, TNT, the soil leachate experiment was repeatedusing plants grown in soil contaminated with 100 mg kg)1

TNT (Fig. 6b). Seven days after dosing, the level of RDXin the soil leachate from pots containing the XplA-XplB-NR lines was significantly less (P > 0.001) than the level ofRDX in soil leachate from wild-type plants.

To test whether the expression of xplA and xplB in theshoots, the site of RDX accumulation (Vila et al., 2007),reduced the amount of RDX in the shoot, the XplA-XplB-

NR plants were grown in uncontaminated soil and soil con-taminated with 100 or 200 mg kg)1 RDX and TNT.Measurements on the aerial parts of the plants (Fig. 7a,b)revealed that the levels of RDX in the XplA-XplB plantshoots were dramatically reduced compared with those inthe wild-type and NR-only expressing plants: 34- to 94-foldless than the wild-type for the XplA-XplB-NR lines grownin soil contaminated with 100 mg kg)1 RDX and TNT,and between 38- and 115-fold less in soil containing200 mg kg)1 RDX and TNT.

Discussion

To effectively phytoremediate RDX from soil and ground-water on military training ranges, plants need to be able towithstand the phytotoxic effects of the co-contaminantTNT. With this aim, we engineered XplA and XplA-XplB-expressing plants with TNT-detoxifying NR activity by theintroduction of the nfsI gene. In liquid culture, the uptake ofRDX by XplA-NR and XplA-XplB-NR plants was reducedin the presence of TNT, a known inhibitor of XplA activity(Jackson et al., 2007). However, once the transgenic plant

(a)

(b)

Fig. 6 Levels of hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) in soilleachate from 6-wk-old Arabidopsis thaliana plants watered with180 lM RDX. Leachate was collected following watering (t = 0,closed bars), and then plants were flushed with an equal volume ofwater after 7 d (t = 7, open bars). Plants were grown in (a)uncontaminated soil or (b) soil contaminated with 100 mg kg)1

TNT. NPC, no plant control; WT, wild-type; NR, nitroreductase. Forall groups, the results are the mean ± SE of eight replicate pots.






lines had removed the TNT, they were able to take up anddegrade the RDX. Furthermore, because the TNT-detoxifyingability conferred by the NR in the XplA-XplB-NR linesenabled them to remove TNT significantly more quicklythan either wild-type or XplA-XplB control lines, the XplA-XplB-NR lines were also able to remove RDX significantlymore quickly than the control lines from liquid culture. It isknown that, following uptake, TNT is localized almostentirely within the root tissues, whereas RDX is taken up tothe aerial parts of the plant (Vila et al., 2007). Thus, in liquidculture, where the aerial parts of the submerged plant areexposed to TNT, inhibition of RDX degradation by XplA-expressing plants is not unexpected. Given that the growth ofplants in liquid culture is far removed from more naturalgrowth conditions, studies were performed to measure theremoval of RDX by plants from soil contaminated withTNT. These studies demonstrated that the XplA-XplB-NRplants were able to remove significantly more RDX from soilleachate than either wild-type or NR-only plants. In addi-tion, XplA-NR plants grown in soil contaminated with bothRDX and TNT had higher biomasses than plants expressingNR alone, indicating that RDX can be utilized as a nitrogensource by XplA-expressing plants.

In this study, we have demonstrated the first successfuluse of transgenic plants to withstand the toxicity of TNTand remediate RDX, two chemically diverse organic com-

pounds. The levels of TNT and RDX contamination testedhere also reflect the concentrations found on contaminatedtraining ranges (Talmage et al., 1999; Jenkins et al., 2006),and indicate that this technology is capable of remediatingconcentrations of RDX found in situ. In addition to theobvious benefits of remediating RDX and TNT from soiland groundwater, our studies show that the levels of RDXin the shoot tissue of transgenic plants expressing XplA weredramatically lower (34- to 94-fold less) than in wild-type,untransformed tissue. This would reduce the availability ofthis toxin for herbivory and subsequent bioaccumulation inthe food chain (Sarrazin et al., 2009; Zhang et al., 2009).Furthermore, the remediation of TNT-contaminated soilby plants expressing NR has been shown to significantlyincrease microbial community biomass and genetic diversityin the soil rhizosphere (Travis et al., 2007).

These studies were performed in Arabidopsis, an annualplant species with a relatively small root system penetratingonly the top few centimetres of soil, and unsuitable forphytoremediation application. Perennial grass species, suchas wheatgrass species (Pascopyrum smithii, Elymus trachycaulusand Agropyron fragile), which are native to military trainingranges in temperate regions and produce dense root systemsextending over a metre below the soil surface (Frank & Bauer,1991), would be suitable. In addition, these species are lowgrowing, fire resistant and capable of withstanding and recov-ering rapidly from disruption by heavy equipment (Asay et al.,2001; Palazzo et al., 2005), all traits advantageous for thephytoremediation of explosives from military training ranges.

Acknowledgements

This work was funded by the Strategic EnvironmentalResearch and Development Program of the US Departmentof Defense.

References

Asay KH, Horton WH, Jensen KB, Palazzo AJ. 2001. Merits of native

and introduced Triticeae grasses on semiarid rangelands. CanadianJournal of Plant Science 81: 45–52.

Best EP, Sprecher SL, Larson SL, Fredrickson HL, Bader DF. 1999.

Environmental behavior of explosives in groundwater from the Milan

Army Ammunition Plant in aquatic and wetland plant treatments. Uptake

and fate of TNT and RDX in plants. Chemosphere 39: 2057–2072.

Bevan M. 1984. Binary Agrobacterium vectors for plant transformation.

Nucleic Acids Research 12: 8711–8721.

Burdette LJ, Cook LL, Dyer RS. 1988. Convulsant properties of

cyclotrimethylenetrinitramine (RDX): spontaneous audiogenic, and

amygdaloid kindled seizure activity. Toxicology and AppliedPharmacology 92: 436–444.

Clausen J, Robb J, Curry D, Korte N. 2004. A case study of contaminants

on military ranges: Camp Edwards, Massachusetts, USA. EnvironmentalPollution 129: 13–21.

Frank AB, Bauer A. 1991. Rooting activity and water use during vegetative

development of crested and western wheatgrass. Agronomy Journal 83:

906–910.

(a)

(b)

Fig. 7 Levels of hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) inshoot tissue of Arabidopsis thaliana plants grown in RDX- and2,4,6-trinitrotoluene (TNT)-contaminated soil: (a) 100 mg kg)1 and(b) 200 mg kg)1 of both RDX and TNT. DW, dry weight; WT, wild-type; NR, nitroreductase; n ⁄ d, not detected. Results are themean ± SE of five replicate measurements.

412 Research

NewPhytologist





French CE, Rosser SJ, Davies GJ, Nicklin S, Bruce NC. 1999.

Biodegradation of explosives by transgenic plants expressing

pentaerythritol tetranitrate reductase. Nature Biotechnology 17: 491–494.

Gandia-Herrero F, Lorenz A, Larson T, Graham IA, Bowles DJ, Rylott

EL, Bruce NC. 2008. Detoxification of the explosive 2,4,6-

trinitrotoluene in Arabidopsis – discovery of bifunctional O- and C-

glucosyltransferases. Plant Journal 56: 963–974.

Gleave AP. 1992. A versatile binary vector system with a T-DNA

organisational structure conducive to efficient integration of cloned

DNA into the plant genome. Plant Molecular Biology 20: 1203–1207.

Hannink NK, Rosser SJ, French CE, Basran A, Murray JA, Nicklin S, Bruce

NC. 2001. Phytodetoxification of TNT by transgenic plants expressing a

bacterial nitroreductase. Nature Biotechnology 19: 1168–1172.

Hannink NK, Subramanian M, Rosser SJ, Basran A, Murray JA, Shanks

JV, Bruce NC. 2007. Enhanced transformation of TNT by tobacco

plants expressing a bacterial nitroreductase. International Journal ofPhytoremediation 9: 385–401.

Hundal LS, Shea PJ, Comfort SD, Powers WL, Singh J. 1997. Long-term

TNT sorption and bound residue in soil. Journal of EnvironmentalQuality 26: 896–904.

Jackson M, Green JM, Hash RL, Lindsten DC, Tatyrek AF. 1978.

Nitramine (RDX-HMX) wastewater treatment at the Holston ArmyAmmunition Plant. Dover, NJ, USA: US Army Armament Research and

Development Command. Report ARLCD-77013.

Jackson RG, Rylott EL, Fournier D, Hawari J, Bruce NC. 2007.

Exploring the biochemical properties and remediation applications of

the unusual explosive-degrading P450 system XplA ⁄ B. Proceedings of theNational Academy of Sciences, USA 104: 16822–16827.

Jenkins TF, Hewitt AD, Grant CL, Thiboutot S, Ampleman G, Walsh

ME, Ranney TA, Ramsey CA, Palazzo AJ, Pennington JC. 2006.

Identity and distribution of residues of energetic compounds at army

live-fire training ranges. Chemosphere 63: 1280–1290.

Kucukardali Y, Acar HV, Ozkan S, Nalbant S, Yazgan Y, Atasoyu EM,

Keskin O, Naz A, Akyatan N, Gokben M et al. 2003. Accidental oral

poisoning caused by RDX (cyclonite): a report of 5 cases. Journal ofIntensive Care Medicine 18: 42–46.

Palazzo AJ, Jensen KB, Waldron BL, Cary TJ. 2005. Effects of

tank tracking on range grasses. Journal of Terramechanics 42: 177–191.

Pavlostathis SG, Comstock KK, Jacobson ME, Sauders FM. 1998.

Transformation of 2,4,6-trinitrotoluene by the aquatic plant Myriophyllumspicatum. Environmental Toxicology and Chemistry 17: 2266–2273.

Robidoux PY, Bardai G, Paquet L, Ampleman G, Thiboutot S, Hawari J,

Sunahara GI. 2003. Phytotoxicity of 2,4,6-trinitrotoluene (TNT) and

octahydro-1,3,5,7-tetranitro-1,3,5,7-tetrazocine (HMX) in spiked

artificial and natural forest soils. Archives of EnvironmentalContamination and Toxicology 44: 198–209.

Rocheleau S, Kuperman RG, Martel M, Paquet L, Bardai G, Wong S,

Sarrazin M, Dodard S, Gong P, Hawari J et al. 2006. Phytotoxicity of

nitroaromatic energetic compounds freshly amended or weathered and

aged in sandy loam soil. Chemosphere 62: 545–558.

Rosenblatt DH. 1980. Toxicology of explosives and propellants. In: Kaye

SM, ed. Encyclopedia of explosives and related items. Dover, NJ, USA: US

Army Armament Research and Development Committee, 332–345.

Rylott EL, Bruce NC. 2009. Plants disarm soil: engineering plants for the

phytoremediation of explosives. Trends in Biotechnology 27: 73–81.

Rylott EL, Jackson RG, Edwards J, Womack GL, Seth-Smith HM,

Rathbone DA, Strand SE, Bruce NC. 2006. An explosive-degrading

cytochrome P450 activity and its targeted application for the

phytoremediation of RDX. Nature Biotechnology 24: 216–219.

Sarrazin M, Dodard SG, Savard K, Lachance B, Robidoux PY, Kuperman

RG, Hawari J, Ampleman G, Thiboutot S, Sunahara GI. 2009.

Accumulation of hexahydro-1,3,5-trinitro-1,3,5-triazine by the

earthworm Eisenia Andrei in a sandy loam soil. Environmental Toxicologyand Chemistry 28: 2125–2133.

Seth-Smith HM, Rosser SJ, Basran A, Travis ER, Dabbs ER, Nicklin S,

Bruce NC. 2002. Cloning, sequencing, and characterization of the

hexahydro-1,3,5-trinitro-1,3,5-triazine degradation gene cluster from

Rhodococcus rhodochrous. Applied Environmental Microbiology 68:

4764–4771.

Talmage SS, Opresko DM, Maxwell CJ, Welsh CJ, Cretella FM, Reno

PH, Daniel FB. 1999. Nitroaromatic munition compounds:

environmental effects and screening values. Reviews of EnvironmentalContamination & Toxicology 161: 1–156.

Thorn KA, Kennedy KR. 2002. 15N NMR investigation of the covalent

binding of reduced TNT amines to soil humic acid, model compounds,

and lignocellulose. Environmental Science and Technology 36: 3787–3796.

Travis ER, Hannink NK, Van der Gast CJ, Thompson IP, Rosser SJ,

Bruce NC. 2007. Impact of transgenic tobacco on trinitrotoluene

(TNT) contaminated soil community. Environmental Science andTechnology 41: 5854–5861.

US General Accounting Office. 2004. Department of Defense OperationalRanges. More reliable cleanup cost estimates and a proactive approach toidentifying contamination are needed. Report to Congressional Requesters.

US Defense Science Board Task Force. 1998. Unexploded ordnance (UXO)clearance, active range UXO clearance, and explosive ordnance disposal(EOD) programs. Washington DC, USA: Office of the Undersecretary

of Defense for Acquisition and Technology.

US Environmental Protection Agency. 1994. Test methods for evaluatingsolid waste – physical ⁄ chemical methods. SWS Update II Method 8330

Washington DC, USA: Office of Solid Waste and Emergency Response.

Van Aken B, Yoon JM, Just CL, Schnoor JL. 2004. Metabolism and

mineralization of hexahydro-1,3,5-trinitro-1,3,5-triazine inside poplar

tissues (Populus deltoides · nigra DN-34). Environmental Science andTechnology 38: 4572–4579.

Vila M, Lorber-Pascal S, Laurent F. 2007. Fate of RDX and TNT in

agronomic plants. Environmental Pollution 148: 148–154.

Winfield LE, Rodgers JH Jr, D’Surney SJ. 2004. The responses of selected

terrestrial plants to short (<12 days) and long term (2, 4 and 6 wk)

hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) exposure. Part I: Growth

and developmental effects. Ecotoxicology 13: 335–347.

Woody RC, Kearns GL, Brewster MA, Turley CP, Sharp GB, Lake RS.

1986. The neurotoxicity of cyclotrimethylenetrinitramine (RDX) in a

child: a clinical and pharmacokinetic evaluation. Journal of Toxicology –Clinical Toxicology 24: 305–319.

Zhang B, Pan X, Cobb GP, Anderson TA. 2009. Uptake,

bioaccumulation, and biodegradation of hexahydro-1,3,5-trinitro-1,3,5-

triazine (RDX) and its reduced metabolites (MNX and TNX) by the

earthworm (Eisenia fetida). Chemosphere 76: 76–82.

Supporting Information

Additional supporting information may be found in theonline version of this article.

Fig. S1 Transgene expression analysis.

Notes S1 Additional information about the transgeneexpression analysis.

Please note: Wiley-Blackwell are not responsible for thecontent or functionality of any supporting informationsupplied by the authors. Any queries (other than missingmaterial) should be directed to the New Phytologist CentralOffice.






engineering plants for the phytoremediation of rdx...

Documents