727

http://journals.tubitak.gov.tr/biology/

Turkish Journal of Biology Turk J Biol(2016) 40: 727-735© TÜBİTAKdoi:10.3906/biy-1506-36

Enhanced salt tolerance of transgenic tobacco expressing a wheat salt tolerance gene

Musa KAVAS1,*, Mehmet Cengiz BALOĞLU2, Ayşe Meral YÜCEL3, Hüseyin Avni ÖKTEM3

1Department of Agricultural Biotechnology, Ondokuz Mayıs University, Samsun, Turkey 2Department of Genetics and Bioengineering, Kastamonu University, Kastamonu, Turkey

3Department of Biological Sciences, Middle East Technical University, Ankara, Turkey

* Correspondence: musa.kavas@omu.edu.tr

1. IntroductionSalt stress is among the major abiotic stresses that interfere with osmotic balance, resulting in specific ion toxicity and/or nutritional disorders. The deleterious effects of high salinity, such as suppression of seed germination and root-shoot growth, can be seen in the initial phase of growth. At the whole-plant level, flowering and fruiting are severely affected, which results in a decrease in agricultural productivity (Sairam and Tyagi, 2004). Under high salt concentrations the water uptake ability of plants is reduced. This metabolic change is similar to those caused by water stress. The first effect of salinity is growth retardation, which happens quickly, within minutes. Excessive amounts of salt then enter the plant, and salt concentration increases to toxic levels in the older leaves, leading to plant salt toxicity. As a result, premature senescence and reduction in the photosynthetic leaf area occur, which affects the overall carbon balance necessary to sustain growth (Munns, 2002).

Many families of transcription factors, such as DREB, NAC, WRKY, CBF, MYB, bZIP, and zinc-finger families, have been well characterized as playing crucial roles in plant stress responses (He et al., 2011). Expression profiling of DREB1/CBF genes under various abiotic stress conditions has been extensively examined in different

plant species (Akhtar et al., 2012). A number of transgenic plants have been reported to overexpress DREB1/CBF-type transcription factor genes, such as DREB1A/CBF3 from Lolium perenne (Li et al., 2011), BrCBF from Brassica rapa (Jiang et al., 2011), MbDREB1 from Malus domestica (Yang et al., 2011), OsDREB1F from Oryza sativa (Wang et al., 2008), VviDREB1 from Vaccinium vitis-idaea (Wang et al., 2010), and HsDREB1A from wild barley (James et al., 2008). These transgenics were reported in transgenic plants. They showed responses to different abiotic stresses, including cold, high salt stress, drought, and exogenous abscisic acid (ABA) treatment. Baloglu et al. (2012) examined wheat NAC-type transcription factor genes TaNAC69-1 and TtNAMB-2 under drought, salt, cold, and heat stress conditions in wheat and showed that both genes were strongly expressed under salt stress conditions. Wu et al. (2008) identified 15 wheat cDNAs belonging to WRKY proteins. Expression profiles revealed that eight of them responded to low or high temperature and salt or drought treatment. Liu et al. (2011) identified a new MYB gene, namely TaPIMP1 from wheat (Triticum aestivum L.). They showed that transgenic tobacco plants expressing TaPIMP1 exhibited improved tolerance to drought and salt stress. Over the years, many stress-signaling components have also been identified. For example, overexpression of

Abstract: Soil salinity is one of the most important limiting factors of agricultural productivity in the world. The Triticum aestivum salt tolerance-related gene (TaSTRG) possesses a functional response to salt and drought stress conditions. A variety of stress factors, such as salt, drought, abscisic acid, and cold, may induce the expression of TaSTRG in wheat. In this study, the TaSTRG gene was transferred to tobacco via Agrobacterium-mediated transformation. Overexpression of TaSTRG in transgenic tobacco plants indicated higher salt tolerance and mediated more vigorous growth than in wild-type plants. Under salt stress conditions, the transgenic tobacco plants had higher germination and survival rates and longer root length than the control plants. Under salt treatments (200–250 mM), TaSTRG-overexpressing tobacco plants accumulated a higher amount of proline and had significantly lower malondialdehyde content than wild-type plants. Furthermore, transgene inheritance followed Mendelian laws, indicating the stability of TaSTRG in transgenic tobacco plants. These results indicated that the wheat TaSTRG gene plays an important role in responding to salt stress.

Key words: Gateway cloning, salt resistance, TaSTRG, tobacco, wheat

Received: 11.06.2015 Accepted/Published Online: 09.10.2015 Final Version: 21.06.2016

Research Article

KAVAS et al. / Turk J Biol

728

the AtNHX1 gene in Arabidopsis showed that transgenic plants were more tolerant to salt stress than wild-type (WT) plants, with the help of the activity of the sodium hydrogen antiporter protein located on the tonoplast (Apse, 1999). This study provided reliable data showing that sodium hydrogen antiporters have an important function in the salt tolerance of plants. In the literature, there are many salt-tolerant transgenic plants expressing AtNHX1, such as canola, tomato, wheat, soybean, tobacco, and groundnut (Zhang et al., 2001; Xue, 2004; Li et al., 2011; Zhou et al., 2011; Asif et al., 2011). The ionic signaling pathway is controlled by the salt overly sensitive (SOS) pathway, which is the union of SOS3, SOS2, and SOS1 components forming a signaling pathway to transfer the Ca2+ signal. As a result, the plant can maintain ion homeostasis during salt stress (Zhu, 2003).

The cloning of stress-related genes and the identification of their functions are important for obtaining plants that are tolerant to different stresses. Zhou et al. (2009) identified the Triticum aestivum salt tolerance-related gene (TaSTRG) according to a microarray analysis of the salt-tolerant wheat mutant RH8706-49 under salt stress. Overexpression of TaSTRG in transgenic rice plants showed higher salt and drought tolerance than in the control plants. He et al. (2011) cloned a similar gene, TaSRG (Triticum aestivum salt response gene), whose expression was affected by salt, drought, cold, ABA, and other stress conditions. Arabidopsis with overexpression of the TaSRG gene showed higher salt tolerance compared to the WT plants. A different salt-induced gene from wheat was identified as the TaST (Triticum aestivum salt-tolerant) gene, and transgenic Arabidopsis plants overexpressing this gene showed higher salt tolerance than the WT controls. RT-PCR analysis showed that overexpression of the TaST gene in transgenic Arabidopsis caused an increase in the expression of many stress-related genes (Huang et al., 2012). The identification and characterization of new salt-tolerant genes and the study of the relationships between them have become a top priority. In this study, TaSTRG (Accession No. EF599631) was custom-synthesized and cloned into a Gateway-compatible plant overexpression vector (pIPKb004). Overexpression of TaSTRG in transgenic tobacco plants indicated higher salt tolerance than in the WT controls. Several physiological tests, including a germination test under stress conditions, and malondialdehyde (MDA) and proline assays, were performed to show the development of salt tolerance in transgenic tobacco plants.

2. Materials and methods2.1. Plant material and in vitro culture conditionsTobacco seeds (Nicotiana tabacum ‘Petit Havana’) were surface-sterilized with 20% hypochloride for 20 min in

Eppendorf tubes and shaken. After washing the seeds with sterile distilled water, they were germinated under aseptic conditions on Murashige and Skoog (MS) medium (Murashige and Skoog, 1962) containing 20 g/L sucrose and 2.8 g/L Phytagel, pH 5.8. Leaf discs of 20-day-old seedlings were used for tobacco transformation. They were kept at 25 °C under an 8 h/16 h photoperiod for germination.

Shoot induction from transformed tobacco leaves was achieved by using RMOP medium (Svab et al., 1990) containing 4.4 g/L MS, 30 g/L sucrose, 100 mg/L myo-inositol, 2.8 g/L Phytagel, 1 mg/L BA, 0.1 mg/L NAA, and 1 mg/L thiamine hydrochloride supplemented with selective agent. The resistant shoots were transferred to MS medium prepared with 1% sucrose without hormones to obtain transgenic tobacco plants. The shooting and rooting conditions were the same as the germination conditions.2.2. Construction of plant transformation vector pIPKb004 Custom synthesis of the Triticum aestivum salt tolerant-related gene, TaSTRG (Accession No. EF599631), was performed by GenScript (USA). The pENTR Directional TOPO Cloning Kit (Invitrogen, UK) was used for cloning the TaSTRG gene into the plant transformation vector. TaSTRG was firstly cloned into the pENTR/D-TOPO vector. This enabled directional cloning of double-stranded DNA using TOPO-charged oligonucleotides by adding 3’ overhang to the incoming DNA. In this system, the forward primer contains CACC, which provides directional cloning of the PCR product into the pENTR/D-TOPO vector. The 879-bp open reading frame of the TaSTRG gene cDNA copy was amplified by PCR using the forward primer 5’-CACCATGGAACTCCTCTCCTACGC-3’ and the reverse primer 5’- GGCCCGGGATCCGATAAGCT-3’. The amplified product was purified and cloned into the pENTR/D-TOPO vector according to the manufacturer’s protocol.

The pIPKb004 (Accession No. EU161570) plant overexpression vector was provided by the Leibniz Institute of Plant Genetics and Crop Plant Research (IPK), Germany. pIPKb004, which is a Gateway-based binary destination vector, was developed by Himmelbach et al. (2007) for foreign gene overexpression in dicot plants. pIPKb004 contains suitable recombination sites (attR1 and attR2) for LR reaction, integrated downstream of a double-enhancer version of the CaMV35S promoter. This destination vector also includes a bacterial toxin gene, which provides negative force during clone selection in order to eliminate nonrecombinant bacteria and hygromycin resistance genes for plant selection. Gateway LR Clonase II enzyme mix (Invitrogen, UK) was used for LR reaction between the entry vector, pENTR/D-TOPO with TaSTRG, and the binary destination

KAVAS et al. / Turk J Biol

729

vector, pIPKb004. Site-specific recombination occurs between attL and attR recombination sites. As a result of LR reaction, an attB-containing expression clone is generated and called pMAK28 (pIPKb004-TaSTRG; Figure 1). To select recombinant plasmids, colony PCR was carried out by using a NOS terminator gene reverse primer (5’-TTATCCTAGTTTGCGCGCTA-3’) and TaSTRG gene-specific forward primer (5’- AATCGTCTGCCCCACGTCCT -3’). Recombinant plasmids were transformed into A. tumefaciens strain AGL1 via MicroPulser electroporation (Bio-Rad, USA).2.3. Plant transformation Tobacco leaves were transformed using the Agrobacterium tumefaciens AGL1 strain harboring pMAK28. In this context, Agrobacterium cells were grown in MG/L (Tingay et al., 1997) medium supplemented with 100 mg/L carbenicillin and 100 mg/L spectinomycin in a shaking incubator (Gallenkamp, UK) at 250 rpm until the cells reached OD600 of 0.7–0.9. Tobacco leaf disks were inoculated with an overnight culture of AGL1 strain for 10 min, blotted semidry, and then cocultivated for 2

days on RMOP medium. After cocultivation, explants were washed with liquid MS medium supplemented with 160 mg/L Timentin for 20 min. Then explants were transferred to the RMOP medium containing antibiotics, 50 mg/L hygromycin, and 160 mg/L Timentin for selecting transformed shoots and to restrict the growth of A. tumefaciens, respectively. Shoots that emerged on RMOP medium after 6–8 weeks of incubation were transferred to a rooting medium supplemented with the same antibiotics. The rooted shoots were multiplied for keeping clones under in vitro conditions and some of them were transferred to a greenhouse for acclimatization.2.4. Molecular analyses of transgenic tobacco plantsTotal genomic DNA was isolated from the leaves of the hygromycin-resistant tobacco plants as well as the untransformed control plants. The presence of a transgene in putative transgenic plants was detected by PCR using primers hptII, aadA, and TaSTRG gene-specific primers. The aadA (a gene related to spectinomycin/streptomycin resistance in bacteria) primers were used to determine whether there was Agrobacterium contamination or not. Primer sequences are shown in Table 1. The PCR reactions (25 µL) were denatured at 94 °C for 3 min, followed by 30 cycles at 94 °C for 1 min, 55–60 °C for 45 s, and 72 °C for 1 min for 1 kb, with a final extension cycle of 72 °C for 5 min.

In order to perform Mendelian segregation analysis, seeds belonging to putative transgenic and WT tobacco plants were germinated on MS medium with 50 mg/L hygromycin after surface sterilization. The number of surviving plantlets on the hygromycin medium was counted to calculate the Mendelian inheritance pattern after 4 weeks of incubation. The expected 3:1 ratio of Mendelian inheritance was evaluated by using chi-square analysis with P (χ2 ≤ 3.841) = 0.95.2.5. Physiological analysis of transgenic tobacco plants expressing TaSTRGIn order to evaluate the expression of the TaSTRG gene under salt stress conditions, physiological analyses, including seed germination test, root length, and MDA and proline assays, were performed. Seeds belonging

Table 1. Primer sequences used for screening putative transgenic tobacco plants.

Primer name Sequence Product size (bp) Melting temperature (°C)

aadA forward TATGGCTCGTGAAGCGGTTATCG 789 63

aadA reverse TTATTTGCCAACTACCTTAGTGATCTCG 789 64

hpt forward CGAAAAGTTCGACAGCGTC 469 60

hpt reverse GGTGTCGTCCATCACAGTTTG 469 59

TaSTRG forward CTCCTCTCCTACGCTGCCAT 700 60

TaSTRG reverse AATCGTCTGCCCCACGTCCT 700 62

pMAK281 2647 bp

spec

hpt

TaSTRG

Intron 1

LB

RB

Ubi1

35S

RO2

RO1

NOS35S

Figure 1. Plasmid map of pMAK28.

KAVAS et al. / Turk J Biol

730

to six transgenic tobacco T1 lines and untransformed control plants were first surface-sterilized and placed on MS medium supplements with two different NaCl concentrations, 150 mM and 200 mM. MS medium without NaCl was used as the control. Seeds were then maintained at 25 °C in the dark. Germination was scored every day. The germination rate of 25-day-old plantlets was calculated. Three biological replicates per line per treatment were performed for this test. Plantlets germinated on MS medium containing 200 mM NaCl were used for root length analysis. For this purpose, the roots of WT and transgenic line 8 plantlets were measured and used for statistical analysis. The MDA content, which reflects the level of lipid peroxidation, was measured for the evaluation of membrane damage caused by salt stress applications. The MDA content of stress and control plants was determined according to the method of Ohkawa et al. (1979). Shoot tissues were freshly collected from plantlets that had been exposed to 200 mM NaCl for 4 weeks. About 0.2 g of tissue was ground with liquid nitrogen and then 1 mL of 5% trichloroacetic acid (TCA) was added to the homogenate. This homogenate was centrifuged at 13,000 × g for 15 min at room temperature with a Microfuge 22R Centrifuge (Beckman Coulter, USA). Freshly prepared 0.5% thiobarbituric acid in 20% TCA and an equal volume of supernatant were transferred to new tubes and incubated for 25 min at 96 °C. For cooling, the tubes were transferred to an ice bath and then centrifuged at 9000 × g for 5 min. Finally, absorbance was measured at 532 nm and 600 nm for correction of nonspecific turbidity. MDA contents were calculated using an extinction coefficient of 155 mM–1 cm–1.

Assessment of free proline content was performed according to the method of Bates et al. (1973). About 0.3 g of leaf tissues from both control and treated plants was powdered with liquid nitrogen and suspended in 1 mL of 3% sulfosalicylic acid. The homogenate was centrifuged at 1000 × g for 5 min at 4 °C. Supernatant (0.1 mL) was transferred to a new tube, and 0.2 mL of acid ninhydrin, 0.2 mL of 96% acetic acid, and 0.1 mL of 3% sulphosalicylic acid were added. After 1 h of incubation at 96 °C, 1 mL of toluene was mixed and the contents were further centrifuged at 1000 × g for 5 min at 4 °C. The upper phase of the supernatant was collected and the absorbance was read at 520 nm. The proline amounts were detected using an extinction coefficient of 0.9986 mM–1 cm–1, which was a derivation of the proline standard curve. Values are expressed as µmol proline g–1 leaf FW.2.6. Statistical analysisAll physiological analyses were performed using a completely randomized design with 4 replicates. The statistical significance was determined by calculation at a 95% confidence interval with one-way analysis of variance (ANOVA) in Minitab 15.

3. Results and discussion3.1. Generation and molecular characterization of TaSTRG tobacco plantsIn order to evaluate the physiological function of TaSTRG, 22 independent transgenic tobacco lines overexpressing TaSTRG under the control of the cauliflower mosaic virus 35S promoter were generated by using Agrobacterium tumefaciens-harboring pMAK28. To confirm the presence of transgenes, PCR analyses were performed with hptII and TaSTRG gene-specific primers by using 9 randomly selected putative transgenic lines. The results of PCR performed with TaSTRG gene-specific primers showed the presence of the 879-bp amplified fragment belonging to TaSTRG in 7 selected independent transgenic lines (Figure 2A).

Second PCR analyses were performed with hptII gene (Hygromycin phosphotransferase II)-specific primers. In this step, only positive lines confirmed with PCR by using TaSTRG primers were selected for analysis. Amplification of the hptII gene was observed on agarose gel for all selected lines, except for line 9 (Figure 2B). Although the presence of hygromycin-resistant plants can provide sufficient evidence that a regenerated plant is transformed by the introduced DNA, it fails to show that partial or no transfer may occur within the population of primary transformants (Worrall, 1998). Another PCR reaction was performed by using aadA gene primers in order to confirm that there was no Agrobacterium tumefaciens contamination. According to the PCR results, there was no band with all the transgenic lines (data not shown). 3.2. Evaluation of transgenic tobacco plants for stress tolerance The expression of TaSTRG in putative T0 transgenic tobacco plants was evaluated by using rooting medium supplemented with 200 mM NaCl and 250 mM NaCl. T0 transgenic tobacco plants and tissue culture-grown WT tobacco plants were cultured in these media. After 4 weeks, WT plants were pale, whereas putative transgenic plants showed a resistance to a high concentration of salt with healthy root formation (Figure 3A).

The root length of the plants was also measured to show the effect of salt stress on transgenic and WT plants. Seeds were germinated on MS medium and supplemented with 200 mM NaCl for 6 weeks for root length measurement analysis (Figure 3B). Data were collected in triplicate from line 8 and the control plants. Our findings indicated that the roots of transgenic plants were longer than those of the WT (control) plants (Figures 3C and 4). This result suggested that the salt tolerance of the transgenic plants was remarkably developed compared to the WT control plants, which is supported by another transgenic study (Xu et al., 2010). The transgenic plants generated in this study showed longer shoot and root lengths compared to the

KAVAS et al. / Turk J Biol

731

control plants under salt stress conditions. Furthermore, longer roots developed under salt stress were evaluated as positive evidence of salt stress tolerance as a consequence of TaSTRG expression in transgenic plants. To identify the role of TaSTRG in salt tolerance, we observed the seed germination of transgenic and WT plants. No

significant differences among the transgenic lines grown on MS medium containing 150 mM NaCl were observed. However, WT plants had a lower germination rate than their transgenic counterparts (Figure S1). Similar results were observed in the second germination test, performed with MS medium supplemented with 200 mM NaCl (Figure

Figure 2. PCR amplification of the (A) TaSTRG gene (879 bp) and (B) hptII gene (495 bp) in T1 transgenic tobacco plants.

Figure 3. Stress tolerance of transgenic tobacco plants under in vitro conditions. (A) Expression of TaSTRG in putative T0 transgenic tobacco plants under (i) 200 mM NaCl and (ii) 250 mM NaCl; (B) germination test with MS medium containing 50 mg/L hygromycin; (C) root length of transgenic and WT plants (6 weeks old) germinated on MS medium supplemented with 200 mM NaCl.

KAVAS et al. / Turk J Biol

732

5). We found that the seed germination and growth of the seedlings of the transgenic plants were superior to those of the WT control plants. Except for line 5, all the transgenic lines had higher germination rates compared to the control lines. The best responding lines to salt stress were transgenic lines 3 and 8, with germination percentages of 76% and 79%, respectively (Figure 5). The above results suggest that TaSTRG overexpression conferred increased salt tolerance in transgenic tobacco. Huang et al. (2012) showed that overexpression of the TaST gene in transgenic Arabidopsis plants resulted in a higher seed germination rate and better growth of transgenic seedlings when compared to those of the WT control.

The phenotypic ratio of hygromycin-resistant and -sensitive seedlings was evaluated by counting the number of survivors on selective media after 4 of weeks of incubation. The expected 3:1 ratio of Mendelian inheritance was evaluated by using chi-square analysis. The seeds obtained from transgenic tobacco plants with the TaSTRG gene were tested for their germination in the presence of 50 mg/L hygromycin. The seeds of the transgenic tobacco plants showed a segregation ratio hygromycin resistance of 3:1, as expected, confirming Mendelian inheritance when they were germinated in

the presence of hygromycin (Table 2). A chi-square test indicated that the observed data/ratio was consistent with Mendelian segregation. We conclude that there was no significant difference between the observed and expected ratio and the accepted null hypothesis. This result is consistent with that obtained by Kalenahalli et al. (2013), who showed Mendelian inheritance in transgenic tobacco plants expressing hepatitis B surface antigen. Similar results were obtained by Srivastava et al. (1996) in wheat, Chen et al. (1998) in rice, Perret et al. (2003) in oat, Zhang et al. (2006) in soybean, and Shrawat et al. (2007) in barley. Mendelian segregation has not been verified for most transformed lines because of transgene instability (Parrott, 2010). However, the results described here show that transgene inheritance followed Mendelian laws, indicating the stability of the transgene in transgenic tobacco plants.3.3. MDA and proline amounts in transgenic plants under salt stressTo prove the improvement of salt tolerance in transgenic lines, we also measured changes in proline and MDA content in WT and transgenic tobacco plants. MDA is accepted as a measure of the amount of lipid peroxidation in biomembranes, giving an idea about the free radical damage that occurred in the cell. For this purpose, lines

0

1

2

3

4

5

6

RMOP RMOP-200mM NaCl

Root

leng

th (c

m)

WT

Line 8

0

20

40

60

80

100

WT line 1 line 2 line 3 line 5 line 6 line 8

)%( noitani

mreG

Figure 4. Root length under normal and salt stress conditions. Figure 5. Percent germination of control and transgenic tobacco plants under 200 mM NaCl treatment.

Table 2. Segregation of hygromycin resistance in T1 progeny plants of transgenic tobacco lines.

T1 transgenic plant lines Total seed numbers Germinated/nongerminated seed numbers Ratio χ2

1 90 75/15 3:1 3.33

2 92 78/14 3:1 3.52

3 94 76/18 3:1 1.7

5 80 67/13 3:1 3.26

6 102 83/19 3:1 2.20

8 110 88/22 3:1 1.46

KAVAS et al. / Turk J Biol

733

2 and 8 were selected, since they were phenotypically the best lines under salt stress in the preliminary studies. Seeds belonging to transgenic lines and WT plants were germinated on MS medium supplemented with 200 mM and 250 mM NaCl for 6 weeks. According to the MDA results, the transgenic lines were less affected than the control plants under salt stress, since they produced less MDA than the control plants. Additionally, the difference in MDA contents of transgenic versus WT plants was significant for both salt concentrations tested (Figure 6). However, there was no significant difference between transgenic lines under two different salt stress conditions. The data suggested that overexpression of TaSTRG plays a role in decreasing lipid peroxidation under salt stress conditions. The role of TaSTRG was also evaluated in rice by Zhou et al. (2009) under salt stress. Their results correlate with our results. Similar results were obtained by Xu et al. (2010), who also produced transgenic tobacco plants overexpressing the V-ATPase subunit c (LbVHA-c1) gene, and Yang et al. (2011), indicating expression of SeNHX1, a vacuolar Na+/H+ antiporter gene in transgenic tobacco plants. An et al. (2011) reported that transgenic

tobacco lines expressing the ThZFL gene had significantly less MDA when compared to the control plants under salt stress conditions. In this study, transgenic plants had significantly lower MDA contents when compared to WT tobacco plants after different salt stress treatments. This indicated that lipid peroxidation in the biomembranes of the TaSTRG-transformed plants was slightly damaged under salt stress treatments.

By adjusting the accumulation of utilizable nitrogen, proline protects plant cells in response to salt stress, which contributes to membrane stability and alleviates

the detrimental effect of NaCl (Yadav et al., 2012). Proline content was measured in transgenic (lines 2 and 8) and WT plants grown under two different salt stress conditions, 200 mM and 250 mM NaCl. We found that the proline content of both transgenic lines was significantly higher than that of the control plants. In the presence of 250 mM NaCl, both transgenic lines had the highest proline content (Figure 7). Relative abundance of compatible solutes, including proline, is an important protective factor for plants under salt stress (Ashraf and Harris, 2004). Yang et al. (2011) reported that transgenic tobacco lines expressing SeNHX1 had higher proline content, proportionate to the WT plants under salt stress conditions. Huang et al. (2012) also obtained similar results, indicating that transgenic Arabidopsis plants overexpressing the salt-induced gene TaST accumulated more proline under salt stress. Li et al. (2013) identified a new salt-induced gene called LcSAIN2, whose overexpression in Arabidopsis enhanced salt tolerance of transgenic plants by accumulating soluble sugars and free proline.

In summary, the overexpression of the TaSTRG gene can markedly improve the salt tolerance of tobacco plants. TaSTRG gene inheritance followed Mendelian laws, which indicates the stability of the transgene in transgenic tobacco plants. Under conditions of salt stress, proline accumulation was significantly increased in transgenic plants compared to WT plants. In addition, transgenic tobacco plants had lower MDA content under salt stress conditions. Therefore, it can be concluded that the results obtained from this study confirm and support the potential application of TaSTRG in plant biotechnological studies to develop salt-tolerant cultivars.

a a

b

b

c

c

0

0.2

0.4

0.6

0.8

1

1.2

1.4

200 mM 250 mM

Prol

ine

(µm

ol/g

FW)

WT

Line 2

Line 8

Figure 7. Comparison of proline amount between transgenic and WT tobacco plants under salt stress treatments. Different letters show significant difference (P < 0.05) from WT plants.

aa

b b

bb

0123456789

200 mM 250 mM

MD

A a

mou

nt (n

mol

/gFW

)

WT Line 2 Line 8

Figure 6. Comparison of MDA levels between transgenic and WT tobacco plants under salt stress treatments. Different letters show significant difference (P < 0.05) from WT plants.

KAVAS et al. / Turk J Biol

734

References

Akhtar M, Jaiswall A, Taj G, Jaiswall P, Qureshi MI, Singh NK (2012). DREB1/CBF transcription factors: their structure, function and role in abiotic stress tolerance in plants. J Genet 91: 385-395.

An Y, Wang Y, Zheng T, Lou L, Qu GZ (2011). A novel zinc-finger-like gene from Tamarix hispida is involved in salt and osmotic tolerance. J Plant Res 124: 689-697.

Apse MP (1999). Salt tolerance conferred by overexpression of a vacuolar Na+/H+ antiport in Arabidopsis. Science 285: 1256-1258.

Ashraf M, Harris PJ (2004). Potential biochemical indicators of salinity tolerance in plants. Plant Sci 166: 3-16.

Asif MA, Zafar Y, Iqbal J, Iqbal MM, Rashid U, Ali GM, Arif A, Nazir F (2011). Enhanced expression of AtNHX1 in transgenic groundnut (Arachis hypogaea L.) improves salt and drought tolerance. Mol Biotechnol 49: 250-256.

Baloglu MC, Oz MT, Oktem HA, Yucel M (2012). Expression analysis of TaNAC69-1 and TtNAMB-2, wheat NAC family transcription factor genes under abiotic stress conditions in durum wheat (Triticum turgidum). Plant Mol Biol Rep 30: 1246-1252.

Bates LS, Waldren RP, Teare ID (1973). Rapid determination of free proline for water-stress studies. Plant Soil 39: 205-207.

Chen L, Marmey P, Taylor NJ, Brizard JP, Espinoza C, D’Cruz P, Huet H, Zhang S, de Kochko A, Beachy RN et al. (1998). Expression and inheritance of multiple transgenes in rice plants. Nat Biotechnol 16: 1060-1064.

He X, Hou X, Shen Y, Huang Z (2011). TaSRG, a wheat transcription factor, significantly affects salt tolerance in transgenic rice and Arabidopsis. FEBS Lett 585: 1231-1237.

Himmelbach A, Zierold U, Hensel G, Riechen J, Douchkov D, Schweizer P, Kumlehn J (2007). A set of modular binary vectors for transformation of cereals. Plant Physiol 145: 1192-1200.

Huang X, Wang G, Shen Y, Huang Z (2012). The wheat gene TaST can increase the salt tolerance of transgenic Arabidopsis. Plant Cell Rep 31: 339-347.

James VA, Neibaur I, Altpeter F (2008). Stress inducible expression of the DREB1A transcription factor from xeric, Hordeum spontaneum L. in turf and forage grass (Paspalum notatum Flugge) enhances abiotic stress tolerance. Transgenic Res 17: 93-104.

Jiang F, Wang F, Wu Z, Li Y, Shi G, Hu J, Hou X (2011). Components of the Arabidopsis CBF cold-response pathway are conserved in non-heading Chinese cabbage. Plant Mol Biol Rep 29: 525-532.

Kalenahalli YN, Raghavendra G, Hanumanthegowda RP (2013). Stability and inheritance analysis of transgenic tobacco expressing hepatitis B surface antigen. Aust J Crop Sci 7: 1010-1015.

Li X, Cheng X, Liu J, Zeng H, Han L, Tang W (2011). Heterologous expression of the Arabidopsis DREB1A/CBF3 gene enhances drought and freezing tolerance in transgenic Lolium perenne plants. Plant Biotechnol Rep 5: 61-69.

Li X, Gao Q, Liang Y, Ma T, Cheng L, Qi D, Liu H, Xu X, Chen S, Liu G (2013). A novel salt-induced gene from sheepgrass, LcSAIN2, enhances salt tolerance in transgenic Arabidopsis. Plant Physiol Biochem 64: 52-59.

Liu H, Zhou X, Dong N, Liu X, Zhang H, Zhang Z (2011). Expression of a wheat MYB gene in transgenic tobacco enhances resistance to Ralstonia solanacearum and to drought and salt stresses. Funct Integr Genomic 11: 431-443.

Munns R (2002). Comparative physiology of salt and water stress. Plant Cell Environ 25: 239-250.

Murashige T, Skoog F (1962). A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant 15: 473-497.

Ohkawa H, Ohishi N, Yagi Y (1979). Assay of lipid peroxides in animal tissue by thiobarbituric acid reaction. Anal Biochem 95: 351-358.

Parrott W (2010). Genetically modified myths and realities. N Biotechnol 30: 545-551.

Perret SJ, Valentine J, Leggett JM, Morris P (2003). Integration, expression and inheritance of transgenes in hexaploid oat (Avena sativa L.). J Plant Physiol 160: 931-943.

Sairam RK, Tyagi A (2004). Physiology and molecular biology of salinity stress tolerance in plants. Curr Sci 86: 407-421.

Shrawat AK, Becker D, Lörz H (2007). Agrobacterium tumefaciens-mediated genetic transformation of barley (Hordeum vulgare L). Plant Sci 172: 281-290.

Srivastava V, Vasil V, Vasil IK (1996). Molecular characterization of the fate of transgenes in transformed wheat. Theor Appl Genet 92: 1031-1037.

Svab Z, Hajdukiewicz P, Maliga P (1990). Stable transformation of plastids in higher plants. P Natl Acad Sci USA 87: 8526-8530.

Tingay S, McElroy D, Kalla R, Fieg S, Wang M, Thornton S, Brettell R (1997). Agrobacterium tumefaciens-mediated barley transformation. Plant J 11: 1369-1376.

Wang Q, Guan Y, Wu Y, Chen H, Chen F, Chu C (2008). Overexpression of a rice OsDREB1F gene increases salt, drought, and low temperature tolerance in both Arabidopsis and rice. Plant Mol Biol 67: 589-602.

Wang QJ, Xu KY, Tong ZG, Wang SH, Gao ZH, Zhang JY, Zong CW, Qiao YS, Zhang Z (2010). Characterization of a new dehydration responsive element binding factor in central arctic cowberry. Plant Cell Tiss Organ Cult 101: 211-219.

Worrall D (1998). PCR analysis of transgenic tobacco plants. In: Foster GD, Taylor SC, editors. Plant Virology Protocols. New York, NY, USA: Humana Press, pp. 417-423.

Wu H, Ni Z, Yao Y, Guo G, Sun Q (2008). Cloning and expression profiles of 15 genes encoding WRKY transcription factor in wheat (Triticum aestivum L.). Prog Nat Sci 18: 697-705.

Xu C, Zheng L, Gao C, Wang C, Liu G, Jiang J, Wang Y (2010). Overexpression of a vacuolar H+-ATPase c subunit gene mediates physiological changes leading to enhanced salt tolerance in transgenic tobacco. Plant Mol Biol Rep 29: 424-430.

KAVAS et al. / Turk J Biol

735

Xue Z (2004). Enhanced salt tolerance of transgenic wheat (Triticum aestivum L.) expressing a vacuolar Na+/H+ antiporter gene with improved grain yields in saline soils in the field and a reduced level of leaf Na+. Plant Sci 167: 849-859.

Yadav NS, Shukla PS, Jha A, Agarwal PK, Jha B (2012). The SbSOS1 gene from the extreme halophyte Salicornia brachiata enhances Na+ loading in xylem and confers salt tolerance in transgenic tobacco. BMC Plant Biol 12: 188.

Yang W, Liu XD, Chi XJ, Wu CA, Li YZ, Song LL, Liu XM, Wang YF, Wang FW, Zhang C et al. (2011). Dwarf apple MbDREB1 enhances plant tolerance to low temperature, drought, and salt stress via both ABA-dependent and ABA-independent pathways. Planta 233: 219-229.

Yang XL, Ji J, Wang G, Yang SH, Zhao Q, Josine TL (2011). Over-expressing Salicornia europaea (SeNHX1) gene in tobacco improves tolerance to salt. Afr J Biotechnol 10: 16452-16460.

Zhang HX, Hodson JN, Williams JP, Blumwald E (2001). Engineering salt-tolerant Brassica plants: characterization of yield and seed oil quality in transgenic plants with increased vacuolar sodium accumulation. P Natl Acad Sci USA 98: 12832-12836.

Zhang Y, Yang BY, Chen SY (2006). Inheritance analysis of herbicide-resistant transgenic soybean lines. J Genet Genomics 33: 1105-1111.

Zhou S, Zhang Z, Tang Q, Lan H, Li Y, Luo P (2011). Enhanced V-ATPase activity contributes to the improved salt tolerance of transgenic tobacco plants overexpressing vacuolar Na+/H+ antiporter AtNHX1. Biotechnol Lett 33: 375-380.

Zhou W, Li Y, Zhao BC, Ge RC, Shen YZ, Wang, G, Huang ZJ (2009). Overexpression of TaSTRG gene improves salt and drought tolerance in rice. J Plant Physiol 166: 1660-1671.

Zhu JK (2003). Regulation of ion homeostasis under salt stress. Curr Opin Plant Biol 6: 441-445.