expression of the atnhx1 gene in peanut to increase …

EXPRESSION OF THE AtNHX1 GENE IN PEANUT TO INCREASE SALT

TOLERANCE IN PEANUT PLANTS

by

MANOJ BANJARA, B.Tech.

A THESIS

IN

BIOLOGY

Submitted to the Graduate Faculty of Texas Tech University in Partial Fulfillment of the

Requirements for the Degree of

MASTER OF SCIENCE

Approved

Hong Zhang

Chairperson of the Committee

Megha N. Parajulee

Paxton Payton

Accepted

Fred Hartmeister

Dean of the Graduate School

August, 2010

©, Manoj Banjara, 2010

Texas Tech University, Manoj Banjara, August 2010

ii

ACKNOWLEDGEMENTS

This thesis would not have been possible without Dr. Hong Zhang's bringing me

into his laboratory. In addition to his philosophical guidance, unlimited encouragement,

and support from the initial to the final level on my research project, his contribution to

research and teaching encourage me to dedicate to science. I would also like to express

my gratitude to my committee members, Drs. Megha N. Parajulee and Paxton Payton

for their valuable help, suggestions, and time. I am indebted to Dr. Parajulee for

introducing me to Dr. Zhang and for his relentless support.

I offer my sincere gratitude to Dr. Guoxin Shen, Dr. Longfu Zhu, Sundaram

Kuppu, Yinfeng Zhu, Rongbin Hu, Jian Chen, Qiang Gu, Hua Qin, Pei Hou, and

Xiaoyun Qiu in Dr. Zhang’s lab for persistent help in experimental design and

management, and for letting me take part in scientific discussions. In addition, I am

grateful to my friends and colleagues in Dr. Rock, Dr. Xie, and Dr. Holaday’s

laboratories.

Lastly, and most importantly, I owe my deepest gratitude to my entire family

residing in US and in Nepal for their firm support, constant encouragement, and

guidance. Without the support from my family members, I would not be able to aspire to

get education in United States.


iii

TABLE OF CONTENTS

ACKNOWLEDGEMENTS ................................................................................................ ii

ABSTRACT ....................................................................................................................... vi

LIST OF FIGURES ......................................................................................................... viii

LIST OF ABBREVIATIONS ............................................................................................ ix

CHAPTER

I. INTRODUCTION ............................................................................................................1

1.1. Overview ...........................................................................................................1

1.2. The adverse effects of salinity stress ................................................................4

1.2.1. Effects of salinity on plant growth .....................................................4

1.2.2. Effects of salinity on water relations .................................................5

1.2.3. Effects of salinity on leaf anatomy and chloroplast ultrastructure ....6

1.2.4. Effects of salinity on photosynthesis, and photosynthetic pigments

and proteins .......................................................................................7

1.2.5. Effects of salinity on lipids ................................................................9

1.2.6. Effects of salinity on ion levels ........................................................10

1.2.7. Effects of salinity on antioxidative enzymes and antioxidants ........10

1.2.8. Effects of salinity on nitrogen metabolism ......................................11

1.2.9. Effects of salinity on malate metabolism .........................................12

1.3. Mechanisms of plant salt stress tolerance .......................................................13

1.3.1. Sodium compartmentalization into vacuoles ...................................14

1.3.2. Sodium extrusion via the plasma membrane ...................................15

1.3.3. Synthesis or accumulation of osmoprotectants ................................17


iv

1.3.4. Induction of antioxidative enzymes .................................................18

1.3.5. Induction of plant hormones ............................................................19

1.3.6. Change in photosynthetic pathway ..................................................20

1.4. Characteristics of sodium/proton antiporter ...................................................20

1.5. Strategy to make salt tolerant plants ...........................................................22

1.6. Basis for creating transgenic peanut with higher salt stress tolerance .........24

II. MATERIALS AND METHODS ..................................................................................27

2.1. Vector construction and peanut transformation ............................................27

2.2. Isolation of genomic DNA and PCR analysis of putative transformants .......29

2.3. Isolation of total RNAs and RNA blot analysis ..............................................30

2.4. Salt treatment .................................................................................................32

2.5. Plant growth and biomass measurement under salt treatment in greenhouse 33

2.6. Gas-exchange measurements ..........................................................................33

2.7. Total chlorophyll measurement ......................................................................34

2.8. Statistical analysis ...........................................................................................34

III. RESULTS ....................................................................................................................37

3.1. Creation of AtNHX1-expressing peanut ..........................................................37

3.2. Molecular analyses of AtNHX1-expressing transgenic peanut plants .............38

3.3. AtNHX1-expressing peanut plants are more salt tolerant ...............................41

3.4. AtNHX1-expressing peanut plants demonstrate higher gas exchange

parameters and biochemical parameters for photosynthesis than wild-type

plants under salinity conditions ......................................................................47

IV. DISCUSSION ..............................................................................................................54

4.1. Challenges of Agrobacerium-mediated transformation in peanut ..................57


v

REFERENCES ..................................................................................................................59


vi

ABSTRACT

Salinity and drought are two major environmental stresses that affect agricultural

productivity. To meet the food demand of an increasing population and a warming

environment, the need to generate salt and drought tolerant crops is apparent. High

salinity in the soil makes it harder for plant roots to extract water, and high concentration

of salts within plant cells can be toxic to the cellular enzymes. One approach to improve

salt tolerance in crops is to sequester excess sodium ion (Na+) into the large intracellular

vacuoles via the tonoplast membrane. Consequently, there is reduction of Na+ in

cytoplasm with the accumulation of compatible solutes that restore the correct osmolarity

to the intracellular milieu, which favors water uptake by plant root cells and improves

water retention in tissues under high soil salinity. This approach was successfully

demonstrated in several plants, where overexpression of the Arabidopsis gene AtNHX1

that encodes a vacuolar sodium/proton (Na+/H

+) antiporter resulted in a higher salt

tolerance phenotype.

Peanut (Arachis hypogaea L.) is an important crop of tropical and sub-tropical

regions of the world. To improve yield and quality under salinity stress conditions, the

Arabidopsis gene AtNHX1 was introduced into peanut through Agrobacterium-mediated

transformation. The AtNHX1-expressing peanut plants produced more biomass when

grown on up to 150 mM NaCl in greenhouse conditions. The increased growth of

AtNHX1-expressing peanut plants is likely due to the consequence of higher


vii

photosynthetic rates in the transgenic plants compared to wild-type plants under saline

conditions. The better performance of AtNHX1-expressing peanut lines compared to

wild-type plants under high salinity indicates that AtNHX1 can be used to enhance salt

tolerance in peanut.


viii

LIST OF FIGURES

1.1. Model for Na+ regulation in plant cell ...................................................................26

2.1. AtNHX1-overexpression construct used for peanut transformation.......................36

3.1. Analysis of putative AtNHX1-expressing peanut plants by PCR...........................39

3.2. Northern blot analysis of wild-type and AtNHX1-expressing peanut plants .........40

3.3. Phenotypes of wild-type and AtNHX1-expressing peanut plants after

150 mM NaCl treatment ........................................................................................43

3.4. Fresh biomass of wild-type and AtNHX1-expressing peanut plants after


3.5. Dry biomass of wild-type and AtNHX1-expressing peanut plants after


3.6. Relative amount of chlorophyll present in wild-type and AtNHX1-

expressing peanut plants after 150 mM NaCl treatment ........................................46

3.7. Gas-exchange performance of wild-type and AtNHX1-expressing peanut

plants after 150 mM NaCl treatment .....................................................................49

3.8. Estimation of photosynthetic parameters for wild-type and AtNHX1-


3.9. Estimation of photosynthetic characteristics for wild-type and AtNHX1-



ix

LIST OF ABBREVIATIONS

APX Ascorbate peroxidase

AtNHX1 Arabidopsis thaliana Na+/H

+ antiporter

ATPase H+

-adenosine triphosphatase

AVP1 Arabidopsis thaliana vacuolar H+-pyrophosphatase

BSA Bovine serum albumin

CAM Crassulacean acid metabolism

CAT Catalase

CO2 Carbon dioxide

DEPC Diethyl pyrocarbonate

EDTA Ethylenediaminetetracetic acid

GB Glycine betaine

GFP Green fluorescence protein

GR Glutathione reductase

ICDH Isocitrate dehydrogenase

IRGA Infra-red gas analyzer

LB Luria-Bertani

MDH Malate dehydrogenase

MOPS 4- morpholinepropanesulfonic acid

MS Murashige and Skoog


x

Na+/H

+ Sodium/proton

NaCl Sodium chloride

NADP Nicotinamide adenine dinucleotide phosphate

NHX Na+/H

+ exchanger

NR Nitrate reductase

PCR Polymerase chain reaction

PEG Proton electrochemical gradient

PEPC Phosphoenol pyruvate carboxylase

PPFD Photosynthetic photon flux density

PSII Photosystem II

PPase H+

-pyrophosphatase

RIM Root induction medium

ROS Reactive oxygen species

Rubisco Ribulose -1, 5 -bisphosphate carboxylase/oxygenase

RuBP Ribulose -1, 5 -bisphosphate

SDS Sodium dodecylsulfate

SEM Shoot elongation medium

SIM Shoot initiation medium

SOS Salt overly sensitive

T0 First transgenic plant directly induced from callus

T1 First generation of seeds and plants after self-cross on T0 plants


xi

TE Buffer solution containing 10 mM Tris and 1 mM EDTA


1

CHAPTER I

INTRODUCTION

1.1. Overview

About 20% of the world’s cultivated land and nearly half of all irrigated lands are

unsuitable for growing crops because of contamination with high levels of salt (Rhoades

and Loveday, 1990). More than 800 million hectares of land throughout the world are

salt affected (FAO, 2008). Soil salinity stresses plants in two different ways: high salinity

in the soil makes it harder for roots to extract water, and high concentration of salts

within the plant can be toxic (Munns and Tester, 2008). Salinity stress is one of the most

serious factors limiting the productivity of agricultural crops. Most salt affected land has

arisen from natural causes, from the accumulation of salts over long periods of time in

arid and semiarid zones (Rengasamy, 2002). Repetitive seawater invasion, incorrect

irrigation, and degradation of native saline parent rock are primarily responsible for

increasing soil salinity (Ashraf, 1994). Degradation of native saline rocks releases soluble

salt of various types mainly chlorides of sodium, calcium, and magnesium, and to a lesser

extent, sulfates and carbonates (Szabolcs, 1989). Sodium chloride is the most soluble and

abundant salt released in soil.

Salinity is a soil condition characterized by a high concentration of soluble salts.

The natural floras of highly saline soil are halophytes, which are able to maintain this

exclusion at higher salinities than glycophytes. Sea barley grass, Hordeum marinum, is an


2

example that excludes both Na+

and Cl- concentrations up to 450 mM NaCl (Garthwaite

et al., 2005). Since salinity is the common feature of arid and semiarid lands, plants of

this land have evolved mechanisms to tolerate the low soil water potential caused by

salinity as well as by drought, and their ability to tolerate to osmotic stress is a feature of

most glycophytes and halophytes. Salinity induces a change in the signals of root origin,

which changes the hormonal balance of the plant that affects root and shoot growth

(Lerner et al., 1994). Peanut (Arachis hypogaea L.) is a glycophytic plant whose growth

and yield are severely inhibited by high salinity.

Dry weather and irrigation water with high salt concentration are the main factors

that limit the yield of cotton and peanut, which are the major crops in West Texas. The

farmers in the Southwestern USA are constantly facing problems from salinity and

drought. Increasing peanut tolerance against drought and salt stresses would improve its

yield, which will have an enormous impact on the economy of peanut growing states in

America.

Peanut is an economically important legume crop, whose seeds contain 43% oil

and 25% protein. It also has significant impact in tropical and sub-tropical regions of

Asia, Africa, and North and South America (Sharma and Ortiz, 2000). It is the 12th

most

valuable cash crop grown in the United States with a farm value of over one billion US

dollars. American consumers eat more than 6 pounds or 2.7 kilograms of peanut products

each year, which are worth more than $2 billion at the retail level. Texas is ranked second

among the peanut growing states and it accounts for approximately 24% of overall

peanuts grown in the United States. (http://www.peanutsusa.com).


3

To improve peanut yield and quality, peanut tolerance to drought and salt

conditions must be enhanced. When Na+ accumulates to high levels in cytosol, it

becomes toxic to enzymes. Excess Na+ in cytosol could be removed by the active

mechanisms into the apoplastic space via plasma membrane or to the large intracellular

vacuole via the tonoplast membrane. In both of these circumstances, there is

accumulation of compatible solutes that restores correct osmolarity in the intracellular

milieu. Sodium ions flow through the Na+/H

+ antiport in the large vacuole membrane-

down to an electrochemical proton gradient generated by two vacuolar proton pumps and

accumulate inside the large intracellular vacuole (Apse et al., 1999).

Engineered transgenic Arabidopsis, tomato, rapeseed, cotton, tobacco, tall fescue,

and Petunia hybrida expressed higher levels of AtNHX1 protein and displayed an

increased vacuolar uptake of Na+ than wild-type plants, which is responsible for

increased salt tolerance (Apse et al., 1999; Zhang and Blumwald, 2001; Zhang et al.,

2001; He et al., 2005; Duan et al., 2009; Tian et al., 2006; Xu et al., 2009). Since the

overexpression of AtNHX1 in native and heterologous systems leads to the same

phenotype, i.e., increased salt tolerance, it suggests that this approach should work in

most plants including peanut. Therefore, this research project is an endeavor to

overexpress the Arabidopsis gene AtNHX1 in peanut to make them more salt tolerant.


4

1.2. The adverse effects of salinity stress

Salt suppress the growth of all plants, but the tolerance levels and the growth

retardation at high salt concentrations vary among the species of the plants. Generally,

soil salinity makes it harder for roots to extract water, reducing water potential, causes

ion imblance or disturbaces in ion homeostatis, and also causes ion toxicity, which

inhibits enzymatic functions of key biological processes (Zhang and Blumwald, 2001;

Blumwald et al., 2004; Munns and Tester, 2008). Additionally, secondary stresses, such

as oxidative damage, disrupts cellular homeostasis due to the high ion concentration (Dat

et al., 2000). Growth suppression is directly related to the total soluble salt concentration

or osmotic potential of soil water (Flowers et al., 1977; Greenway and Munns, 1980). All

the major processes such as growth, photosynthesis, protein synthesis, and energy and

lipid metabolism are affected by salt stress. High salinity stress affect various aspects of

crop production.

1.2.1. Effects of salinity on plant growth

The immediate response of plants to salt stress is reduction in the rate of leaf

surface expansion gradually leading to cessation of expansion with the increase in salt

concentration (Wang and Nil, 2000). There is also considerable decrease in the fresh and

dry weights of leaves, stems, and roots (Hernandez et al., 1995; AliDinar et al., 1999;

Chartzoulakis and Klapaki, 2000). High salinity significantly reduces the shoot weight,

plant height, number of leaves per plant, root length, and root surface area per plant in


5

tomatoes (Mohammad et al., 1998). Furthermore, increased NaCl results in significantly

decrease root, shoot, and leaf growth biomass and increase in root/shoot ratio in cotton

(Meloni et al., 2001). In Raphanus sativus, total dry weight decreases at higher salinities

and about 80% reduction of growth at high salinity was attributed to the reduction in leaf

area expansion. The small leaf area at high salinity is related to reduced specific leaf area.

The increased tuber/shoot weight ratio is attributed to the tuber formation starting at a

smaller plant size at high salinity (Marcelis and VanHooijdonk, 1999).

1.2.2. Effects of salinity on water relations

Increase in salinity makes water potential and osmotic potential of plants more

negative , whereas increasing salinity increases the turgor pressure (Morales et al., 1998;

Hernandez et al., 1999; Khan et al., 1999; Meloni et al., 2001; Khan, 2001;

Romeroaranda et al., 2001). Short term NaCl stress in jute decreases the relative water

content, leaf water potential, water uptake, transpiration rate, water retention, and water

use efficiency (Chaudhari and Choudhuri, 1997). There is no change in leaf relative water

content, but decrease in leaf water potential and evaporation rate with increased salt

concentration in the halophyte S. salsa (Lu et al., 2002). According to Rajasekaran et al.

(2001), plants under progressive or prolonged NaCl stress shows a great decline in the

osmotic potential as compared with total water potential leading to turgor maintenance

(Rajasekaran et al., 2001).


6

1.2.3. Effects of salinity on leaf anatomy and chloroplast ultrastructure

Epidermal thickness, mesophyll thickness, palisade cell length and diameter, and

spongy cell diameter in leaves of bean, cotton, and Atriplex increases with the increase in

salinity (Longstreth and Nobel, 1979). Also, salinity shrinks intracellular spaces in leaves

(Delphine et al., 1998). Salt stress causes (1) development of vacuole and partial swelling

of endoplasmic reticulum, (2) diminishing of mitochondrial cristase and swelling of

mitochondria, (3) vesiculation and fragmentation of tonoplast, and (4) cytoplasm

degradation by cytoplasmic and vacuolar matrices in leaves of potato (Mitsuya et al.,

2000). Additionally, salt stress causes rounding of cells, smaller intercellular spaces, and

a reduction in chloroplast in the leaves of potato (Bruns and Hecht-Buchhloz, 1990).

Salinity reduces leaf area and stomatal density in tomato (Romeroaranda et al., 2001).

In the plants treated with NaCl, electron microscopy reveals the disorganization of

thylakoidal structure of the chloroplasts, increases in the size and number of plastoglobuli,

and decreases in their starch content (Hernandez et al., 1995, 1999). Thylakoid

membranes of chloroplast are swollen and most of them are lost under high salt stress in

the mesophyll cells of sweet potato leaves (Mitsuya et al., 2000). Salinity reduces the

number and depth of the grana stacks, causes swelling of the thylakoid, and starch grains

becomes larger in the chloroplast in potato (Burns and Hecht-Buchholz, 1990).

Transmission electron microscopic analysis shows that the chloroplasts are aggregated,

the cell membranes are distorted and wrinkled, and there are no signs of swelling of grana

or thylakoid structures in the chloroplast of NaCl treated tomato leaves (Khavarinejad


7

and Mostofi, 1998). Also, a notable disorganization of the thylakoid structure of

chloroplasts are reported in leaves of B. paraviflora (Parida et al., 2003).

1.2.4. Effects of salinity on photosynthesis, and photosynthetic pigments and

proteins

The photosynthetic rate decreases in salt-treated plants due to several factors: (1)

dehydration of cell membranes that reduce permeability to CO2, (2) salt toxicity to

numerous photosynthetic enzymes, (3) CO2 assimilation reduction due to hydroactive

stomatal closure, (4) enhanced senescence induction, (5) changes in the activity of

enzymes which is induced by changes in their cytoplasmic structure, and (6) negative

feedback due to the reduction in sink activity (Iyengar and Reddy, 1996).

Plant growth as biomass production measures net photosynthesis. Most

environmental stresses that inhibits growth also affect photosynthesis. Salinity

dramatically decreases the rate of photosynthesis and arrests plant growth (Kawasaki et

al., 2001). Plants under high salinity shows reduction in carbon assimilation because of

the accumulation of salt in developing leaves (Munns and Termatt, 1986). High salt stress

inhibits PSII activity (Bongi and Loreto, 1989; Mishra et al., 1991; Masojidek and Hall,

1992; Belkhodja et al., 1994; Everard et al., 1994), whereas some other studies suggested

that it has no such negative effect on PSII (Robindon et al., 1983; Brugnoli and

Bjorkman, 1992; Morales et al., 1992). Several studies indicated that the rate of

photosynthesis may not always be slowed down by salinity and is even stimulated by low


8

salt concentration in some species (Rajesh et al., 1998; Kurban et al., 1999). Also, there

are several reports on supression of photosynthesis during salinity stress (Chaudhari and

Choudhuri, 1997; Soussi et al., 1998; AliDinar et al., 1999; Romeroaranda et al., 2001;

Kao et al., 2001). Reduction in leaf area reduces the assimilation of CO2 (Papp et al.,

1983; Munns et al., 2000), mesophyll conductance (Delfine et al., 1998), stomatal

conductance (Brugnoli and Lauteri, 1991; Ouerghi et al., 2000; Agastian et al., 2000;

Parida et al., 2003), and the efficiency of photosynthetic enzymes (Seemann and

Critchley, 1985; Yeo et al., 1985; Seemann and Sharkey, 1986; Brugnoli and Bjorkman,

1992; Reddy et al., 1992).

Salinity decreases the chlorophyll and total carotenoid contents of the leaves. In

leaves of alfalfa grown under high salinity, chlorophyll content and net photosynthetic

rate increases the respiration rate and CO2 compensation concentration, while there are

no notable changes in the carotenoid contents (Khavarinejad and Chapararzedeh, 1998).

Under the prolonged period of salt stress the older leaves start to develop chlorosis and

fall (Hernandez et al., 1995; Gadallah, 1999; Agastian et al., 2000). However, it is

reported that in Amaranthus, chlorophyll content increases under the conditions of

salinity (Wang and Nil, 2000). Salinity stress decreases the total chlorophyll content of

plant leaf by increasing the activity of chlorophyllase, which is a chlorophyll degrading

enzyme (Rao and Rao, 1981), inducing chloroplast destruction and pigment protein

complex instability (Singh and Dubey, 1995).

Salinity decreases the net CO2 assimilation rate and the ratio of ribulose -1, 5-

bisphosphate carboxylase oxygenase (Rubisco) activity to that of phosphoenol pyruvate


9

carboxylase (PEPC) in A. lentiformis because PEPC activity on a leaf area basis increases

linearly with salinity, whereas Rubisco activity remains relatively constant (Zhu and

Meinzer, 1999). Furthermore, salinity decreases the soluble protein content in leaves

(Alamgir and Ali, 1999; Gadallah, 1999; Wang and Nil, 2000; Parida et al., 2002). In

mulberry, the soluble protein increases at low salinity and decreases at high salinity

(Agastian et al., 2000).

1.2.5. Effects of salinity on lipids

Lipids acts as insulators of delicate internal organs, which are the most effective

sources of storage energy, and they play vital roles as the structural constituents of most

of the cellular membranes (Singh et al., 2002). Lipids have important roles in the

tolerance of various physiological stressors in a variety of organisms including

cyanobacteria. Phospholipid bilayers are responsible for the dessication tolerance, which

are stabilized during water stress or salt stress by sugars. In peanut the lipid content

increases at low concentration of NaCl (up to 45 mM) and decreases as its concentration

increases (Hassanein, 1999). Plasma membrane vesicles isolated from calli of tomato

tolerant to 100 mM NaCl shows evidence of higher phospholipid and sterol content and

lower phospholipid/free sterol ratio and lower saturated phospholipid fatty acids (Kerkeb

et al., 2001).


10

1.2.6. Effects of salinity on ion levels

High NaCl uptake competes with the uptake of other nutrient ions, mostly K+,

leading to K+

deficiency. In a number of plants, increased NaCl increases Na+ and Cl

- and

decreases Ca2+

, K+, and Mg

2+ levels (Khan et al., 1999, 2000; Khan, 2001). In Vicia faba,

salinity enhances the content of Na+, Ca

2+, and Cl

- and decreases the ratio of K

+/Na

+

(Gadallah, 1999). A report indicates a significant increase in Na+ and Cl

- content in

leaves, stem, and root of the mangrove B. parviflora without any considerable alteration

in the endogenous K+ and Fe

2+ level in leaves. Whereas there is decrease in Ca

2+ and

Mg2+

level in leaves upon salt accumulation, suggesting that there is an increase in

membrane stability and decline in chlorophyll content (Parida et al., 2004a).

1.2.7. Effects of salinity on antioxidative enzymes and antioxidants

High salinity causes water deficit as a result of osmotic effects on a wide variety

of metabolic activities in plants. This water deficit in turn results oxidative stress due to

the formation of reactive oxygen species such as superoxides and hydroxy and peroxy

radicals. These reactive oxygen species, which are the by-products of hyper-osmotic and

ionic stresses cause membrane disfunction and cell death (Bohnert and Jensen, 1996).

Plants can induce the activities of certain antioxidative enzymes such as catalase,

peroxidase, glutathione reductase, and superoxide dismutase to scavenge such reactive

oxygen species. In cotton, NaCl stress increases the activities of superoxide dismutase,

guaicol peroxidase, and glutathione reductase and decreases the activities of catalase and


11

ascorbate peroxidase (Gossett et al., 1994). Also, there is decrease in total ascorbate, total

glutathione, and α-tocopherol amounts. High salinity enhances the level of H2O2 and the

activities of superoxide dismutase, ascorbate peroxidase, and guaicol peroxidase,

although it decreases catalase activity in leaves of rice (Lee et al., 2001). In leaves of B.

parviflora, salt stress causes increase in ascorbate peroxidase, glutothine peroxidase,

glutothione reductase, and superoxide dismutase activity and decrease in catalase activity

(Parida et al., 2004b).

1.2.8. Effects of salinity on nitrogen metabolism

In nitrogen assimilation, the reduction of NO3-

to NO2-

is catalyzed by nitrate

reductase (NR), which is considered to be the rate-limiting step (Srivastava, 1990; Lea,

1997). In higher plants, protein phosphorylation and dephosphorylation can rapidly shift

the enzymes activity. In the dark, in presence of free Mg2+

, 14-3-3 proteins interact with

phosphorylated NR, resulting in a complete inactivation of NR (Kaiser et al., 1999).

Through this process, NR in leaves is rapidly inactivated in the dark and activated in the

light. It is assumed that salt stress may negatively affect both NR expression and

activation, which ultimately influence NR stability (Huber & Kaiser 1996). In many

plants, salt stress reduces the NR activity (AbdElBaki et al., 2000; Flores et al., 2000). In

addition to the direct effect of Cl- on the enzyme activity, its presence in the external

medium reduces NO3- uptake, which consequently lowers NO3

- concentration in the

leaves (Cram, 1973; Deane-Drummond and Glauss, 1982; Flores et al., 2000). Thus, the

decrease in NR activity and nitrate level in plant under salt stress may reduce the growth


12

and biomass production. Nicotinamide adenine dinucleotide phosphate isocitrate

dehydrogenase (NADP-ICDH) is a key cytosolic enzyme that links carbon and nitrogen

metabolism by supplying carbon skeletons for primary nitrogen assimilation in plants.

The activity of NADP-ICDH increases in leaves and decreases in roots of plants adopted

to high salinity, whereas the activity of ferredoxin-dependent glutamate synthase, which

is a key enzyme of nitrogen assimilation and biosynthesis of amino acids, decreases in

leaves in response to the high salinity (Popova et al., 2002). The nitrate and nitrate

reductase content of leaves decreases, but nitrate increases in roots of Zea mays under

high salinity condition (AbdElBaki et al., 2000). Soussi et al., 1999 reported that salinity

inhibits nitrogen fixation by reducing nodulation and nitrogenase activity in chick-pea.

1.2.9. Effects of salinity on malate metabolism

In the chloroplasts of higher plants, NADP-malate dehydrogenase (NADP-MDH)

reduces oxaloacetate to malate. Under salt stress, NADP-MDH decrease transiently in

leaves and then increase to levels greater than two fold higher than levels in unstressed

plants, while transcription levels in roots are extremely low and remain unaffected in the

chloroplasts of M. crystallinum. This salt-stress induced expression pattern of NADP-

MDH suggests its potential role in the CO2 fixation pathway during crassulacean acid

metabolism (CAM) (Cushman, 1993). In NaCl treated Eucalyptus citridora plants, the

malate content decreases in leaves, but the specific activities of NAD and NADP-malic

enzymes increases (DeAragao et al., 1997).


13

1.3. Mechanisms of plant salt stress tolerance

Plants battle a saline environment in two principal ways: either by excluding Na+

at the plasma membrane or by sequestering them in the large intracellular vacuole. In

both circumstances accumulation of compatible solutes restores the correct osmolarity to

the intracellular milieu. The Na+/H

+ antiport flow sodium ions in the large vacuole

membrane down an electrochemical proton gradient generated by two vacuolar proton

pumps and accumulate Na+ inside the large intracellular vacuole (Apse et al., 1999).

The toxic levels of sodium ion and the low osmotic potential of soil solution are

responsible for creating the unfavourable multiple effects on plant metabolism, growth

and development at molecular, biochemical and physiological levels (Munns, 2002;

Winicov, 1998; Tester and Devenport, 2003). Proper ion flux regulation is necessary for

cells to keep low toxic ionic concentration and to accumulate essential ions. Intracellular

K+

and Na+ homeostatis is essential for the activities of many cytosolic enzymes,

maintaining mambrane potential, and for the synthesis of osmoticum. Plant cell employ

H+-ATPase mediated primary active transport and channels, and co-transporters mediated

secondary transport. Under salt stress, Na+ enters to plant cells through several pathways

and Na+ stress disrupts K

+ uptake by root cells. These processes results in a decrease in

K+/Na

+ ratio in cytosol. When Na

+ accumulates to the higher level in cytosol, it becomes

toxic to the enzymes. Thus, the abilily of plants to keep low Na+

concentration in cytosol

is the decisive factor for salt tolerance (Yeo, 1998; Maathuis and Amtmann, 1999).

Excess Na+

in cytosol could be removed by the active mechanisms to apoplastic space via

plasma membrane or to vacuole via tonoplast membrane (Aspe et al., 1999; Shi et al.,


14

2002; Zhang and Blumwald, 2001). Also, there are several other mechanisms which

bolster plants to grow under soil salinity.

1.3.1. Sodium compartmentalization into vacuoles

The largest compartment of a mature plant cell is the central vacuole that occupy

about 80% of the total cell volume. Vacuolar Na+/H

+ antiportors are ubiquitous

membrane proteins that catalyze the exchange of Na+

for H+ across the membrane, which

resolves excessive Na+ in cytosol under saline conditions (Blumwald and Poole, 1985).

Na+/H

+ antiporters are involved in diverse physiological processes, such as salt tolerance,

pH regulation, cell volume, morphogenesis, and extruding the H+ generated during

metabolism (Waditee et al., 2006). These Na+/H

+ antiporters transfer Na

+ into vacuoles,

which are energized by the vacuolar PEG (Proton Electrochemical Gradient) generated

by the vacuolar ATPase (H+-adenosine triphosphatase) and PPase (H

+-pyrophosphatase)

(Blumward, 1987, Gaxiola et al., 2002, Horie and Schroeder, 2004). The consequence of

sequestering cytosolic Na+ into the vacuoles of plant cells is to maintain a low level of

Na+ in cytosol, which minimizes the Na

+ toxicity and injury to important enzymes in

cytosol. In the meantime, the high Na+ concentration in vacuoles would draw more water

into cell and maintain cell turgor (Glenn et al., 1999).

Under salt stress condition, AtNHX1-overexpressing Arabidopsis showed higher

vacuolar Na+/H

+ exchange activity and a salt-tolerant phenotype compared to wild-type

and sequestered more Na+ in plants (Apse et al., 1999), which provided convincing


15

evidence that Na+/H

+ antiporters in vacuoles play an important role in salt tolerance. In

addition to Arabidopsis gene AtNHX1, overexpression of its homologous genes GhNHX1

from cotton (Gossypium hirsutum), OsNHX1 from rice (Oryza sativa), and CgNHX1 from

Chenopodium glaucum in tobacco and rice also can lead to increase salt tolerance

(Fukuda et al., 2004; Wu et al., 2004; Li et al., 2009). These studies indicate that

overexpression of vacuolar Na+/H

+ antiporters can confer increased salt tolerance in

plants.

1.3.2. Sodium extrusion via the plasma membrane

Another strategy for plants to survive during salt stress is to eradicate cytosolic

Na+ out of the plant cells. Na

+ efflux across the plasma membrane is mediated by Na

+/H

+

antiportors (DuPont, 1992). In the plasma membrane of barley roots, K+-prompted Na

+

efflux was observed (Rather and Jacoby, 1976). The observation of change in pH

gradient across the plasma membrane in wheat and barley indicate the possibility of

having Na+/H

+ antiporter to transport Na

+ out of cytoplasm (Mennen et al., 1990).

Additionally, antiporter activity was observed in plasma membrane vesicles of wheat

(Allen et al., 1995), tomato (Wilson and Shannon, 1995), and cotton (Hassidim et al.,

1990). Na+/H

+ transporters and other cation/proton transporters at the plasma membrane

efflux Na+ and other cations out of the cell due to the establishment of proton motive

force across the plasma membrane by plasma membrane type ATPase (Schachtman and

Liu, 1999). The sequestration of Na+ out of the cell in apoplast through the Na

+/H

+

antiporter at the plasma membrane is an effective approach to maintain intracellular ion


16

homeostasis (Bartels and Nelson, 1994; Zhu, 2001). However, the energy expense is the

critical factor for the Na+ dismisal for salinity responses (Davenport and Tester, 2000).

The secondary active Na+/H

+ antiporters SOS (Salt Overly Sensitive) were

identified as crucial components in Na+ exclusion through the plasma membrane, which

are responsible for salt tolerance in Arabidopsis (Zhu, 2003). Jain-Kang Zhu and his co-

workers identified three components of a stress-signaling pathway SOS1, SOS2, and

SOS3, which controls ion homeostasis and salt tolerance (Hasegawa et al., 2000; Sanders,

2000; Zhu, 2000; 2001). SOS1 (AtNHX7) gene encodes a Na+/H

+ antiporter that has 12

hydrophobic transmembrane domains in the N-terminal and a long hydrophilic C-

terminal tail, and the SOS1-GFP (green fluorescence protein) fusion data suggests that

the SOS1 Na+/H

+ antiporter is localized on the plasma membrane (Shi et al., 2000). SOS3

(AtCBL4) gene encodes a Ca2+

binding protein capable of sensing the cytosolic Ca2+

signal elicited by salt stress (Liu and Zhu, 1998; Ishitani et al., 2000). If the Ca2+

-binding

capacity of SOS3 is reduced due to mutation, the mutant becomes hypersensitive to salt,

indicate its importance in salt stress signaling (Zhu, 2002). SOS2 (AtCIPK24) gene

encodes a serine/threonine protein kinase known as the CBL-interacting protein kinase

(CIPK) that interacts physically with SOS3 (Liu et al., 2000; Halfter et al., 2000). In a

calcium dependent manner, SOS3 activates the protein kinase activity of SOS2 (Mahajan

et al., 2006). Lower rate of Na+-stimulated proton transport occurred in plasma

membrane vesicles from sos1, sos2, and sos3 mutant plants in comparision to those of the

wild-type plants (Qiu et al., 2002). Several evidence suggests that SOS1 is one of the

target of SOS signal transduction pathway whose activity is controlled by SOS2/SOS3

(Guo et al., 2001; Qiu et al., 2002; Zhang et al., 2004). Therefore, the mechanism to


17

extrude excess Na+ from the cytosol via plasma membrane enables plants to grow under

high salt condition.

1.3.3. Synthesis or accumulation of osmoprotectants

Under excess Na+ concentration, either Na

+ is compartmentalized into the vacuole

or excluded out of the cell to keep optimum cytosolic Na+, the osmotic potential in the

cytoplasm must be stabilized with that in the vacuole and extracellular environments to

guarantee the maintenance of cell turgor and uptake of water for cell growth. This

requires an increase in osmolytes in the cytosol, either by uptake of soil solutes or by

synthesis of metabolically compatible solutes. These compatible solutes include largely

proline (Khatkar and Kuhad, 2000; Singh et al., 2000), glycine betaine (GB) (Rhodes and

Hanson, 1993; Khan et al., 2000; Wang and Nil, 2000), sugars (Kerepesi and Galiba,

2000; Bohnert and Jensen, 1996; Pilon-Smits et al., 1995), and polyols (Ford, 1984; Popp

et al., 1985; Orthen et al., 1994; Bohnert et al., 1995) that do not inhibit cellular

biochemical reactions. These solutes can also act as free-radical scavengers or chemical

chaperones, which directly stabilize membranes and/or proteins (Akashi et al., 2001;

Hare et al., 1998; Bohnert and Shen, 1999; McNeil et al., 1999; Diamant et al., 2001).

One of the osmoprotectants, polyols, functions in two ways: osmotic adjustment

and osmoprotection. In osmotic adjustment, they facilitate the retention of water in the

cytoplasm and allow Na+ sequestration to the vacuole or apoplast. These osmolytes have

H-bonding characteristics that allow them to interact with membranes, protein


18

complexes, or enzymes to protect macromolecules from the adverse effects of increasing

ionic strength in the surrounding media (Crowe et al., 1992). Under the salt stress,

carbohydrates such as sugars (glucose, fructose, sucrose, fructans) and starch accumulate

in the plant (Parida et al., 2002) and function on osmoprotection, osmotic adjustment,

carbon storage, and radical scavenging. It is demonstrated that the increase in compatible

solutes such as glycine betaine, sorbitol, mannitol, trehalose, and proline in engineered

plants improved the tolerance to drought stress, high salinity and cold stress (Chen and

Murata, 2002; He et al., 2007). Therefore, compatible solute biosynthesis is an important

mechanism to enable plants to survive under salinity.

1.3.4. Induction of antioxidative enzymes

Salt stress impose water deficit, which leads to the formation of reactive oxygen

species (ROS) like superoxide, hydrogen peroxide, hydroxyl radical and singlet oxygen

(Halliwell and Gutteridge, 1985; Elstner, 1987). These cytotoxic oxygen species can

seriously disturb the normal metabolism through the oxidative damage to lipids, proteins,

pigments, and nucleic acids (Fridovich, 1986; Wise and Naylor, 1987; Imlay and Linn,

1988). Chloroplast is prone to generate activated oxygen species, since there is high

internal oxygen in chloropast during photosynthesis (Asada and Takahashi, 1987).

Certain antioxidative enzymes such as catalase (CAT), ascorbate peroxidase (APX),

glaicol peroxidase (POD), glutathione reductase (GR), and superoxide dismutase (SOD)

scavenge such reactive oxygen species. The activities of the antioxidative enzymes such

as CAT, APX, POD, GR, and SOD increase under salt stress in plants whose actions


19

allow plants to survive under salt stress (Gossett et al., 1994; Hernandez et al., 1995,

2000; Sehmer et al., 1995; Kennedy and De Fillippis, 1999; Sreenivasulu et al., 2000;

Benavides et al., 2000; Lee et al., 2001; Mittova et al., 2002, 2003). The activities of

APX, CAT, and GR decrease, while SOD and reduced glutathione increase, and

malondialdehyde and total proteins remain constant in the root nodule of soybean under

high salinity (Comba et al., 1998). In B. gymnorrhiza, salt stress leads to the generation of

superoxide, which is scavenged by the oxygen-scavenging system of the cytosol and

contributes to the salt tolerance capacity (Takemura et al., 2002).

1.3.5. Induction of plant hormones

High salt concentration stimulates the synthesis of plant hormones like abscisic

acid (ABA) and cytokinins (Thomas et al., 1992; Aldesuquy, 1998; Vaidyanathan et al.,

1999). ABA regulates ion fluxes in guard cells and promotes stomatal closure under salt

stress condition. Also, ABA alters the expression of salt-stress-induced genes (de

Bruxelles et al., 1996), which are predicted to play an important role in the mechanism of

salt stress tolerance in rice (Gupta et al., 1998). Inhibitory effects of NaCl on

photosynthesis, growth, and translocation of assimilates were alleviated by ABA (Popova

et al., 1995).


20

1.3.6. Change in photosynthetic pathway

Reduction of water potential in salt stress inhibits photosynthesis. Thus, the main

aim of salt tolerance is to increase water use efficiency under salinity. Atriplex lentiformis

shift from the C3 to the C4 photosynthetic pathway to maximize photosynthesis under

salinity (Zhu and Meinzer, 1999). M. crystallinum shift to CAM from C3 photosynthetic

pathway and decrease transpiratory water loss under prolonged salinity condition

(Cushman et al., 1989).

1.4. Characteristics of sodium/proton antiporter

Na+/H

+ exchangers are ubiquitious membrane proteins, which catalyze the

exchange of Na+ for H

+ across membranes. These antiporters play important roles in salt

tolerance, cell volume, pH regulation, morphogenesis, and extruding the H+ generated

during the time of metabolism (Waditee et al., 2006). Arabidopsis genome sequencing

suggests the presence of more than 38 Na+/H

+ exchanger homologs, among which

vocuolar AtNHX1 and the plasma membrane SOS1 are two extensively studied

antiporters (Figure 1.1.).

The analysis of genes involved in cation detoxification in yeast led to the

identification of a Na+/H

+ antiport (NHX1). NHX1 was localized to a prevacuolar

compartment and showed a high degree of amino acid sequence similarity to Na+/H

+

antiports from Caenorhabditis elegans and human (NHE6, mitochondrial). The

Arabidopsis thaliana genome-sequencing allowed for the identification of a plant gene


21

AtNHX1, which is similar to bacterial, fungal, and mammalian homologous (Apse et al.,

1999; Frommer et al., 1999; Waditee et al., 2006).

The overexpression of vacuolar Na+/H

+ antiporters could serve as a good model

for the engineering of salt tolerant crops (Apse et al., 1999). The overexpression of a

single endogenous Arabidopsis thaliana gene AtNHX1 that encodes a vacuolar

membrane-bound Na+/H

+ antiport should possibly engineer a large spectrum of salt

tolerant crop plants, enabling them to tolerate relatively high salt conditions. Continuous

overexpression of AtNHX1 in transgenic Arabidopsis results in the salt-resistant

phenotype (Apse et al., 1999; Frommer et al., 1999).

Proton electrochemical gradient (PEG) establishment across the tonoplast drives

Na+ import from the cytosol to the vacuole via the Na

+/H

+ antiporter, which determines

the capicity of salt tolerance in plants (Blumwald, 2000). This antiporter protein consists

of 538 amino acids, which has several transmembrane domains, and an amiloride-binding

site (Gaxiola et al., 1999; Hamada et al., 2001). Topological analysis of AtNHX1

demonstrates that there are 9 transmembrane domains, 3 membrane-associated

hydrophobic domains, an N-terminus facing towards cytosol, and a hydrophilic C-

terminus dwelling in the vacuolar lumen, which regulates the exchange of Na+/H

+. C-

terminus deletion of AtNHX1 enhanced Na+/H

+, but lower K

+/H

+ exchange rate

(Yamaguchi et al., 2003).

Vacuolar Na+/H

+ antiporters encoded by NHX gene catalyze the exchange of Na

+

for H+

across the vacuolar membranes and compartmentalize Na+ into vacuoles (Nass et

al., 1997; Blumwald, 2000; Hasegawa et al., 2000). In plants, the sequestration of toxic


22

sodium ions into vacuoles through Na+/H

+ antiporters mainly results in salt tolerance

(Apse and Blumwald, 2002; Zhu, 2003; Tester and Davenport, 2003).

It is demonstrated that the expression of introduced NHX genes in transgenic

plants are responsive to NaCl treatment in most cases, and overexpression of the NHX

genes in the transgenic Arabidopsis, tomato, wheat, cabbage, rapeseed, cotton, rice,

tobacco, tall fescue, and Petunia hybrida expressed higher levels of NHX protein and

displayed an increased vacuolar uptake of Na+ than wild-type plants, which is responsible

for increased salt tolerance (Apse et al., 1999; Fukuda, 1999; Zhang and Blumwald,

2001; Zhang et al., 2001; He et al., 2005; Fukuda et. al., 2004; Duan et al., 2009; Tian et

al., 2006; Xu et al., 2009; Ohta et al., 2002; Wu et al., 2004; Xue et al., 2004).

1.5. Strategy to make salt tolerant plants

The major limiting factors in agricultural productivity are salinity and drought

(Boyer, 1982; Bartels and Sunkar, 2005), which are becoming more serious with global

warming (Gale, 2002; Grover et al., 2003). Even though better farm management

practices such as better irrigation, phase farming, intercropping and precision farming

could somewhat mitigate the salinity in soil (Munns, 2002), it takes huge amount of

money and very long time to improve soil quality suitable for crop growth. Thus, it is

essential for researchers to develop breeding strategies and advance technologies to make

crops more productive under high salinity conditions (Cushman and Bohnert, 2000).


23

Plant breeders were unsuccessful in generating salt tolerant varieties utilizing

genetic variation arising from restricted varietal germplasm and interspecific

hybridization to induce mutations and somaclonal variation of cell and tissue cultures

(Flowers and Yeo, 1995). Lacks of efficient selection techniques, complexity of salt

tolerance mechanisms and narrow genetic background have limited the development of

efficient conventional approach for the improvement of salt tolerant crops (Cushman and

Bohnert, 2000). However, the progress in the study of biochemical mechanisms of plant

stress responses and salt tolerance, molecular cloning of genes encoding major

components in the signal transduction and metabolic pathway that respond to salt stress,

and the development of genetic transformation technology for many crop species have

made it possible to generate salt-tolerant crops (Bohnert and Jensen, 1996; Winicov and

Bastola, 1997).

In opposition to traditional breeding, genetic engineering technique seems to be a

more efficient and rapid approach to introduce a small number of genes to improve salt

tolerance. Present engineering approaches rely on the transfer of one or several genes,

which are important in biochemical pathways or endpoints of signaling pathways. The

transgenic technology has great potential to generate plants that are capable of growing in

soil of high salinity and improving agricultural productivity by manipulating the

biosynthesis of compatible solutes to enhance ion homeostasis, increasing antioxidation

to diminish oxidative damage, overexpressing Na+/H

+ antiporter genes to reduce the Na

+

level in the cytoplasm (Apse et al., 1999; Zhang and Blumwald, 2001; Zhang et al.,

2001; Shi et al., 2003; Fukuda et al., 2004; Wu et al., 2004; Xue et al., 2004; Ashraf and

Harris, 2004).


24

1.6. Basis for creating transgenic peanut with higher salt stress tolerance

It is necessary to understand plants response to salinity and water deficit

conditions at the cellular and molecular level for the generation of transgenic crops with

improved stress tolerance (Wang et al., 2003; Zhang et al., 2004). Salinity tolerance is a

complex multigenic trait in which large number of genes are responsible for encoding

salt-stress proteins such as (1) genes that synthesize compatible solutes, (2) genes for

photosynthetic enzymes (3) genes that encode proteins to sequester Na+

into the vacuole

or efflux Na+ to the apoplast, and (4) genes for radical-scavenging enzymes (Parida and

Das, 2005). Glycophytic plants have sodium compartmentalization and exclusion

mechanisms to maintain low cytosolic sodium concentration.

A well known mechanism to transport sodium out of the cell is through the

operation of a secondary active Na+/H

+ antiporters, SOS1, which are responsible for salt

tolerance in Arabidopsis (Zhu, 2003; Shi et al., 2002). Furthermore, the efficient

compartmentalization of sodium is accomplished through the operation of vacuolar

Na+/H

+ antiporters that remove potentially harmful Na

+ from the cytosol into the large

tonoplast-bound vacuoles (Apse et al., 1999). Accumulation of ions in the vacuole acts as

an osmoticum to maintain water flow into the cell (Glenn et al., 1999; Gaxiola et al.,

2002).

Texas ranks second among the peanut producing states of US whose 70%

production relies on West Texas region. The productivity of this very important crop in

West Texas is negatively affected by low water and high salinity. Genetic engineering

techniques can be employed to generate transgenic peanuts to alleviate the loss of peanut


25

yield due to the harsh environmental factors. Therefore, the main goal of this study was

to introduce an Arabidopsis gene AtNHX1 into peanut for the generation of transgenic

peanut which would be more tolerant to high salinity because of its enhanced capability

to compartmentalize Na+ into vacuoles (Figure 1.1.). Accordingly, as a part of this project

I have achieved the following two aims: (1) Creation of AtNHX1-expressing peanut

plants, and (2) physiological and biochemical analysis of AtNHX1-expressing peanut

plants for salt tolerance in greenhouse.


26

Figure 1.1. Model for Na+ regulation in plant cell. A. Transporters regulating Na

+ levels

in a normal plant cell. B. Transporters regulating Na+ levels in an AtNHX1-expressing

plant cell.

A

B


27

CHAPTER II

MATERIALS AND METHODS

2.1. Vector construction and peanut transformation

The amplified full-length coding sequence of AtNHX1 from Arabidopsis cDNA

library was subcloned into the dephosphorylated Bam HI site of the intermediate vector

pRTL-2 (gift from James Carrington, Oregan State University) under the control of the

CaMV 35S promoter. Afterward, Hind III was used to digest the construct and the

fragment was ligated into the Hind III site of the binary vector pCGN-1578 that has the

neomycin phosphotransferase gene, Npt II, as the selective marker (McBride and

Summerfelt, 1990) (He, 2005). The overexpression construct (Fig. 2.1) was then

introduced into the Agrobacterium tumefaciens stain GV3101. These GV3101 harboring

pCGN-1578 were used to transform peanut plants following the methods described by

Sharma and Anjaiah (2000) with some modifications.

For co-cultivation, GV3101 Argobacterium stain with plasmid comprising

AtNHX1 was inoculated into 10 ml Luria-Bertani (LB) medium with antibiotics

kanamycin (50 µg/ml), rifampicin (50 µg/ml), and gentamycin (25 µg/ml), and grown

overnight at 30 ºC under constant shaking at 250 rpm, then centrifuged to separate

medium and diluted with MS (Murashige and Skoog) basal salt (2.15 mg/ml).

Runner-type (Flavor runner 458 variety) peanut seeds were surface sterilized by

soaking in 70% ethanol for 1 min, followed by rinsing with 0.1% (w/v) aqueous mercuric


28

chloride for 10 min, then the seeds were washed at least three times with sterile distilled

water, and soaked in sterile water for about 3 hr prior to use. After taking the seed coat

away from the soaked peanut seeds, the embryo axis was surgically removed and each

cotyledon was cut into vertical halves to obtain the cotyledon explants. The cotyledon

explants were submerged in the Agrobacterium solution for 1 min, blotted on sterile

paper towels, and were placed on the shoot induction medium (SIM) such that the cut

edges were embedded into the medium. The explants plated on plates with SIM medium

that was comprised of MS basal salt (4.3 mg/ml), N6-benzyladenine (6-BA) (5 µg/ml), 2,

4-dichlorophenoxyacetic acid (2, 4-D) (1 µg/ml), glucose (30 mg/ml), and agar (0.8

mg/ml) at pH 5.8 were incubated at 26 ºC for 3 days of co-cultivation in the dark. They

were then transferred to SIM plates containing MS basal salt (4.3 mg/ml), 6-BA (5

µg/ml), 2, 4-D (1 µg/ml), glucose (30 mg/ml), cefotaxime (250 µg/ml), and agar (0.8

mg/ml) at pH 5.8 and incubated at 26 ºC, 100 μmol m-2

s-1

for 15 days. The explants with

induced adventitious shoot buds were excised and transferred to selective SIM bottles

containing MS basal salt (4.3 mg/ml), 6-BA (5 µg/ml), 2, 4-D (1 µg/ml), glucose (30

mg/ml), kanamycin (100 µg/ml), cefotaxime (250 µg/ml), and agar (0.8 mg/ml) at pH 5.8

for 15 days. Then the explants bearing shoot buds were transferred to the shoot

elongation medium (SEM) having MS basal salt (4.3 mg/ml), 6-BA (0.5 µg/ml), 2, 4-D

(1 µg/ml), glucose (30 mg/ml), kanamycin (100 µg/ml), cefotaxime (250 µg/ml), and

agar (0.8 mg/ml) at pH 5.8 and subcultured every 15 days twice or three times for the

development of adventitious shoot buds. The elongated shoots were transferred to the

root induction medium (RIM) comprising MS basal salt (4.3 mg/ml), glucose (30 mg/ml),

α-naphthaleneacetic acid (NAA) (1 µg/ml), and phytagel (0.2 mg/ml) at pH 5.8 and


29

incubated at 26 ºC, 100 μmol m-2

s-1

until a good root system develop. The young

transgenic plants with good root system were then transplanted into soil in plastic pots.

Transgenic plants were allowed to adapt at low moisture in the growth chamber for few

weeks before transplanting them into big pots in greenhouse at 28 ± 2 ºC or in field. DNA

and RNA were extracted from the leaves of T0 plant (transgenic plant generated from

tissue culture) to identify true transgenic lines. Seeds harvested from T0 plants, T1 were

used for the subsequent experiments in greenhouse.

2.2. Isolation of genomic DNA and PCR analysis of putative transformants

The PowerplantTM

DNA isolation kit (MO BIO Laboratories, Inc., CA, USA) was

used to isolate genomic DNA from fresh leaves of greenhouse and field-growing peanut

plants. Concentration and purity of genomic DNA was determined by NanoDrop® (ND-

1000 spectrophotometer, NanoDrop Technologies, Wilmington, Delaware, USA).

Polymerase chain reaction (PCR) was carried out with thermacycler

(Mastercycler Gradient, Eppendorf, Hamburg, Germany) to amplify the AtNHX1 gene

using the EcnoTaq® DNA polymerase (Lucigen Corporation, Greenview Drive

Middleton, WI, USA). Primers were designed based on the known sequences of target

AtNHX1 gene. The 25 µl PCR reaction mixture contained 5 µl genomic DNA (~0.1

µg/µl), 2.5 µl 10X EconoTaq reaction buffer containing; 10 mM Tris-HCl (pH 9.0), 500

mM KCl, 15 mM MgCl2, and 1% Triton X-100, 2 µl dNTP (2.5 mM concentration for

each of the four different deoxyribonucleotides), 1µl forward primer (0.1 µg/µl, 5'-

TGATTGGGCTAGGCACTG -3'), 1µl reverse primer (0.1 µg/µl, 5'-


30

CAGCTTCGTGGTTTAGGTGA -3'), 0.25 µl thermo tolerant EconoTaq DNA

polymerase enzyme, and 13.25 µl H2O. The amplification reactions were carried out

under the following conditions: an initial denaturation at 94 °C for 4 min, followed by

35 denaturation cycles at 94 °C for 1 min, annealing at 52 °C for 30 sec, and extension at

72 °C for 30 sec, and a final extension at 72 °C for 10 min. The amplified products were

segregated by electrophoresis on 0.8% agarose gels with ethidium bromide (EtBr) and

visualized under UV-light.

2.3. Isolation of total RNAs and RNA blot analysis

All materials (mortar, pestle and buffers) used in this experiment were washed

with diethyl pyrocarbonate (DEPC) treated water. One gram of leaf tissues from each

sample (transgenic and wild-type peanut plants) were ground into fine powder using

mortar and pestle in liquid N2, then homogenized mixing with 1 ml of TRIzol reagent

(Invitrogen Corporation, Van Allen Way Carlsbad, CA, USA) in 1.5 ml microcentrifuge

tube. After incubating the sample at room temperature for 5 min, 200 µl chloroform was

added, followed by shaking and vortexing. The samples were again incubated at room

temperature for 3 min. Later on supernatant was transferred into a new tube, from the

sample centrifuged at 3,800 rpm for 20 min at 4 °C. Equal volume of isopropyl alcohol

was mixed to the sample and placed in -20 °C for 45 min, and then centrifuged for 20

min at 13,100 rpm at 4 °C. The supernatant was discarded and once the pellet was

washed with 1 ml of 75% ethanol, sample was air dried. The pellet was dissolved in 90 µl

of 0.5% sodium dodecyl sulfate (SDS) applying heat for 10 min at 55 °C. The samples


31

were then centrifuged at 1,200 rpm for 2 min at room temperature and the supernatant

was collected and transferred to a fresh tube and 1/10 sample volume of 3 M sodium

acetate along with 3 times ice-cold 100% alcohol was added. The sample were mixed by

inversion and placed in -80 °C for 2 hr then centrifuged at 13,100 rpm for 20 min at 4 °C.

The pellet was washed in 75% alcohol, air dried, and re-suspended in 0.5% SDS. It was

re-dissolved by heating at 55 °C for 10 min, then centrifuged for 2 min at 1,200 rpm and

supernatant was placed in new sterile microcentrifuge tube. The RNA concentration and

purity was measured using NanoDrop® (ND-1000 spectrophotometer, NanoDrop

Technologies, Wilmington, Delaware, USA). The ratio of A260/A280 ranged from 1.7 to

1.9 indicates the purity of RNA was enough for Northern blot.

Under the denaturing condition in 37% formaldehyde total RNA was resolved by

electrophoresis in a 1.2% agarose gel. Using the 4-morpholinepropanesulfonic acid

(MOPS) buffer system RNA was transferred to Biotrans™ nylon membrane (MP

Biomedicals, Inc., Irvine, California, USA) using capillary transfer method overnight

(Maniatis et al., 1982). RNA was cross-linked to the membrane using Fisher UV cross-

linker at the optimum setting and was air dried for 3 hr in room temperature on a piece of

towel-paper. The membrane was pre-hybridized in the pre-hybridizing buffer [1% bovine

serum albumin (BSA), 1 mM EDTA (pH 8.0), 0.5 mM NaHPO4 (pH 7.2) and 7% SDS]

for an hr at 64 °C. At 62 ºC, overnight hybridization to the denatured 32

P-labeled probe

was done in the hybridizing solution [1% BSA, 1 mM EDTA (pH 8.0), 0.5 mM

NaHPO4 (pH 7.2) and 7% SDS]. The random-priming method using DECA PrimeTM

II

kit (Ambion Inc., Woodward Street, Austin, TX, USA) was employed to make the


32

labeling probe (Feinberg and Vogelstein, 1983), which was mixed with hybridizing

solution before starting overnight hybridization. The membrane was washed first with

the concentrated washing solution [0.5% BSA, 1 mM EDTA (pH 8.0), 40 mM NaHPO4

(pH 7.2), and 5% SDS] for 5 min at room temperature, and at least two times with a

diluted solution [1 mM EDTA (pH 8.0), 40 mM NaHPO4 (pH 7.2), and 1% SDS] at 64

ºC for 5 min each in a water bath. The membrane was then wrapped by a plastic wrap

and exposed to the phosphor screen (Amersham Biosciences, Piscataway, NJ, USA)

for 5 hr. Radioactivity was detected scanning phosphor screen by the STORM860

scanner system (Amersham Biosciences 2002, Piscataway, NJ, USA). The membrane

was stripped using the stripping solution [2 mM Tris (pH 8.0), 2 mM EDTA (pH 8.0),

and 0.08% SDS] at least for two times at 74 ºC for 10 min each until the radioactivity is

completely lost. Then the membrane was used for next hybridization as described above.

2.4. Salt treatment

AtNHX1-expressing transgenic T1 and wild-type seeds of peanut were germinated

and grown in greenhouse for 21 days prior to salt treatment which was conducted in

increasing manner, starting from 30 mM NaCl for 6 days, followed by 60 mM, 90 mM,

120 mM, and 150 mM for 6 days, respectively. The temperature and humidity was

maintained at 28 ± 2 °C and 50 ± 10% respectively throughout the growth period in

greenhouse. The experiment was repeated two times.


33

2.5. Plant growth and biomass measurement under salt treatment in greenhouse

Fresh aboveground and underground biomass were determined after 150 mM

NaCl treatment. Roots were analyzed after gentle flushing of soil by water and drying

with paper towel. Subsequently, dry above and underground biomass was weighed after

drying shoots and roots for 15 days under light in greenhouse.

2.6. Gas-exchange measurements

Rate of photosynthesis, stomatal conductance, and rate of transpiration were

measured by using a portable photosynthesis system (Model LI-COR 6400, Li-Cor, Inc.,

Lincoln, NE, USA) at an ambient CO2 concentration of 400 μmol mol-1

, 60% relative

humidity, 28 °C, and a light intensity of 2000 μmol m-2

s-1

. Instrument was stabilized as

per manufacturer’s guidelines. Before taking measurements, steady state levels of

reference CO2 and reference H2O were observed and infra-red gas analyzers (IRGAs)

were matched manually. Mean of five measurements from each sample were taken for

analysis.

The same photosynthetic system was used to measure the response on CO2

assimilation rate (A) to the change in internal CO2 concentration (Ci) for the

characterization of photosynthetic performance of AtNHX1-expressing and wild-type

peanut plants. The ACi curves were conducted at saturated photosynthetic photon flux

density (PPFD) of 2000 μmol m-2

s-1

, where the reference and sample IRGAs were

matched automatically before taking each measurement. The curves were initiated at 0 Pa


34

CO2 and increased step-wise to 200 Pa CO2 as described in He et al. (2007). Photosyn

Assistant software (ver. 1.1.2; Dundee Scientific, UK) was used to estimate the

photosynthetic parameters such as Vcmax (the maximum rate of carboxylation by Rubisco),

and Jmax (the light-saturated rate of maximum electron transport). Afterward, these

parameters were used to estimate Asat (net photosynthesis at saturating PPFD), and Amax

(photosynthetic capacity at saturating PPFD and saturating atmospheric CO2) based on

the description provided in Van Gestel et al. (2005).

2.7. Total chlorophyll measurement

The relative amount of chlorophyll was measured by using a portable chlorophyll

meter SPAD-502PLUS (Konica Minolta, Japan), which calculates a numerical SPAD

value measuring the absorbance of leaves in the red and near-infrared regions, which is

proportional to the amount of chlorophyll present in leaves. At each evaluation the

content was measured at the center of each leaflets of every primary leaf and the average

was used for analysis.

2.8. Statistical analysis

Microsoft®

Office Excel 2007 was used for all statistical analysis, which was

performed using student’s t-test considering one tailed, two sample unequal variance. The

significance level was used in hypothesis testing. P values were calculated from the

comparison between wild-type plants and transgenic lines. P < 0.05 and P < 0.01 are two


35

significance levels, which indicates the probability of rejecting a hypothesis set at 5% and

1% respectively.


36

Figure 2.1. AtNHX1-expression construct used for peanut transformation. LB and RB are

the left and right border sequences of the Ti plasmid in the pCGN1578 binary vector. The

drawing is not in scale.


37

CHAPTER III

RESULTS

3.1. Creation of AtNHX1-expressing peanut

It has been demonstrated that vacuolar Na+/H

+ antiporter overexpressing plants

are more salt tolerant (Apse et al., 1999; Fukuda, 1999; Zhang and Blumwald, 2001;

Zhang et al., 2001; He et al., 2005; Fukuda et. al., 2004; Duan et al., 2009; Tian et al.,

2006; Xu et al., 2009; Ohta et al., 2002; Wu et al., 2004; Xue et al., 2004). Therefore, my

goal was to introduce the Arabidopsis thaliana gene AtNHX1 in peanut for the increased

expression of the vacuolar Na+/H

+ antiporter. My hypothesis behind the project was: (1)

Overexpression of AtNHX1 in peanut will enhance vacuolar Na+ sequestration, resulting

in decreased Na+ concentration in cytosol, and ultimately, improved salt stress tolerance;

(2) Increased Na+ concentration in vacuoles will result in decreased cellular water

potential and increase water uptake under salt conditions, increasing water retention in

peanut.

The AtNHX1 gene was introduced into the genome of peanut through the

Agrobacterium-mediated transformation (Sharma and Anjaiah, 2000). Seedlings

generated from the cotyledon explants were transferred to soil and once they were

acclimated in growth chamber, plants were moved to greenhouse or field. Eighty

independent transgenic lines were generated from tissue culture, but only fifteen lines

gave T1 seeds enough for subsequent physiological and biochemical tests due to the


38

unfavourable greenhouse and field conditions for peanut growth and seed formation in

our facility.

3.2. Molecular analyses of AtNHX1-expressing transgenic peanut plants

To confirm the insertion of AtNHX1 in the genome of putative transgenic peanut

plants, genomic DNA was extracted from the young leaves of 12 independent putative

transgenic lines and analyzed through PCR. PCR analysis data indicated that 11

independent transgenic lines contain the introduced AtNHX1 in their genome (Fig. 3.1).

Subsequently, RNA bolt analysis was performed to identify transgene transcript, which

showed that at least 3 out of 8 transgenic lines highly expressed AtNHX1 at the transcript

level (Fig. 3.2). These three lines together with other putative lines were then chosen for

later physiological analyses.


39

Figure 3.1. Analysis of putative AtNHX1-expressing peanut plants by PCR. Genomic

DNAs from wild-type plant and 12 putative transgenic lines were amplified by PCR

using AtNHX1-specific primers. WT, wild type peanut of Runner genotype; 4-12, 14 and

15, eleven independent transgenic peanut lines harboring AtNHX1; 13, independent

transgenic peanut line that does not contain AtNHX1.


40

Figure 3.2. RNA blot analysis of wild-type and AtNHX1-expressing plants. WT, wild-

type peanut of Runner genotype; 7, 11, 15, three independent transgenic lines expressing-

AtNHX1 transcripts. The 18S rRNA was used as the internal loading control. The genes

used as probes are listed on the right.

AtNHX1

18s rRNA


41

3.3. AtNHX1-expressing peanut plants are more salt tolerant

To test the salt tolerance of AtNHX1-expressing peanut plants, 8 independent lines

including three high expressing lines of transgenic plants were analyzed in greenhouse

under saline conditions. The 3 week-old seedlings were watered with 30 mM NaCl for 6

days, followed by 60 mM, 90 mM, 120 mM, and 150 mM NaCl each for 6 days,

respectively. When the NaCl concentration reached 150 mM NaCl, the phenotypic

differences were noticeable between wild-type and AtNHX1-expressing peanut plants.

After finishing the salt treatment, the growth of all plants was analyzed. The AtNHX1-

expressing peanut plants were bigger and bushier than the control wild-type plants (Fig.

3.3). Also, there were large numbers of chlorotic leaves in wild-type peanut plants

relative to AtNHX1-expressing transgenic plants. On the other hand, plants grown under

normal conditions had no apparent phenotypic differences between wild-type and

AtNHX1-expressing peanut plants (data not shown).

To quantify the phenotypic differences between wild-type and AtNHX1-

expressing lines, I measured the fresh and dry biomass of aboveground and underground

portion of peanut plants. The fresh shoot biomass of AtNHX1-expressing peanut plants

were 55% to 58% higher than that of wild-type plants (Fig. 3.4A). Similarly, root

biomass of transgenic lines were 59% to 70% more than wild-type, which is even higher

than shoot biomass (Fig. 3.4B). In addition to the fresh biomass, dry biomass analysis

also confirmed better shoot and root biomass in AtNHX1-expressing lines than wild-type

peanut plants (Fig. 3.5A and Fig. 3.5B). Due to the better root development and shoot


42

growth, better yield of peanut is anticipated with AtNHX1-expressing peanut plants under

salt conditions in the field.

To measure the greenness or relative chlorophyll content of leaves, SPAD values

were examined using the chlorophyll meter. SPAD reading indicates the plant nitrogen

status, which is important for growth, development, protein, and yield of plant. It is

demonstrated that the leaves of NaCl treated AtNHX1-expressing peanut plants has higher

nitrogen content and hence the amount of chlorophyll than wild-type peanut plants (Fig.

3.6), where as there is no such difference among the plants grown under normal

conditions (data not shown).


43

Figure 3.3. Phenotypes of wild-type and AtNHX1-expressing peanut plants after 150 mM

NaCl treatment. WT, wild-type peanut of Runner genotype; 7 and 11, two independent

AtNHX1-expressing peanut lines.


44

Figure 3.4. Fresh biomass of wild-type and AtNHX1-expressing peanut plants after 150

mM NaCl treatment. A. Fresh shoot weight. B. Fresh root weight. WT, wild-type peanut

of Runner genotype; 7 and 11, two independent AtNHX1-expressing peanut lines. Values

are mean ± SD (n = 4). ** statistically significant at P < 0.01.

A

B


45

Figure 3.5. Dry biomass of wild-type and AtNHX1-expressing peanut plants after 150

mM NaCl treatment. A. Dry shoot weight. B. Dry root weight. WT, wild-type peanut of

Runner genotype; 7 and 11, two independent AtNHX1-expressing peanut lines. Values


A

B


46

Figure 3.6. Relative amount of chlorophyll present in wild-type and AtNHX1-expressing

peanut plants after 150 mM NaCl treatment. WT, wild-type peanut of Runner genotype; 7

and 11, two independent AtNHX1-expressing peanut lines. Values are mean ± SD (n = 4).

** statistically significant at P < 0.01.


47

3.4. AtNHX1-expressing peanut plants demonstrate higher gas exchange parameters

and biochemical parameters for photosynthesis than wild-type plants under salinity

conditions

Increased growth of AtNHX1-expressing peanut plants compared to wild-type

plants could be the consequence of higher rates of photosynthesis in transgenic plants.

The photosynthetic performance of AtNHX1-expressing peanut plants was analyzed

under normal and salt stress conditions. Net CO2 assimilation rate, stomatal conductance,

and transpiration rate were examined using LI-COR 6400 photosynthesis system. There

were no significant difference in photosynthetic parameters between wild-type peanut

plants and transgenic lines expressing AtNHX1 under normal conditions (data not shown),

while AtNHX1-expressing peanut plants showed better photosynthetic rates (Fig. 3.7A),

stomatal conductance (Fig. 3.7B), and transpiration rates (Fig. 3.7C) under salt conditions.

To study the effects of salinity on photosynthetic parameters, CO2 assimilation

rates (A) with respect to internal CO2 concentrations (Ci) were obtained from AtNHX1-

expressing lines and wild-type plants grown under salt conditions (Table 3.1). For the

estimation of photosynthesis limiting parameters: Vcmax (the maximum rate of

carboxylation by Rubisco) and Jmax (the light-saturated rate of maximum electron

transport), the data from the CO2 response curves were applied to the Photosyn Assistant

software (ver. 1.1.2; Dundee Scientific, UK). Afterward, the characterization of

photosynthesis on wild-type and transgenic plants were performed by employing the data

derived from Photosyn Assistant software to estimate Asat (net photosynthesis at

saturating PPFD), and Amax (photosynthetic capacity at saturating PPFD and saturating


48

atmospheric CO2). The transgenic peanut lines grown under 150 mM NaCl have

significantly higher Vcmax, Jmax, Asat, and Amax than wild-type plants (Figs. 3.8A, 3.8B,

3.9A, 3.9B). Higher Vcmax of AtNHX1-expressing peanut plants indicates that at low CO2

photosynthesis of transgenic lines were less limited by the Rubisco activity than the wild-

type plants. Similarly, at high Ci, photosynthesis of transgenic lines were less limited by

the rate of regeneration of CO2 acceptor and RuBP compared to wild-type plants.


49

Figure 3.7. Gas-exchange performance of wild-type and AtNHX1-expressing peanut

plants after 150 mM NaCl treatment. A. Photosynthesis rate measurement. B. Stomatal

conductance measurement. C. Transpiration rate measurement. WT, wild-type peanut of

Runner genotype; 7 and 11, two independent AtNHX1-expressing peanut lines. Values


A


50

Figure 3.7. Continued

B

C


51

Table 3.1. CO2 assimilation rate (A) with respect to internal CO2 concentration (Ci) of

wild-type and AtNHX1-expressing peanut plants after 150 mM NaCl treatment. 7 and 11,

two independent AtNHX1-expressing peanut lines. Values are mean ± SD (n = 3).


52

Figure 3.8. Estimation of photosynthetic parameters for wild-type and AtNHX1-

expressing peanut plants after 150 mM NaCl treatment. A. Maximum carboxylation rate

by Rubisco (Vcmax). B. Light-saturated rate of maximum electron transport (Jmax). WT,

wild-type peanut of Runner genotype; 7 and 11, two independent AtNHX1-expressing

peanut lines. Values are mean ± SD (n = 3). ** statistically significant at P < 0.01; *

statistically significant at P < 0.05.

A

B


53

Figure 3.9. Estimation of photosynthetic characteristics for wild-type and AtNHX1-

expressing peanut plants after 150 mM NaCl treatment. A. CO2 saturated photosynthesis

(Asat). B. Maximum potential photosynthesis (Amax). WT, wild-type peanut of Runner

genotype; 7 and 11, two independent AtNHX1-expressing peanut lines. Values are mean

± SD (n = 3). ** statistically significant at P < 0.01; * statistically significant at P < 0.05.

A

B


54

CHAPTER IV

DISCUSSION

Drought and salinity are two major environmental stresses that affect the net yield

of various crops. Also, increasing population and warming environment are rising the

demand of agricultural productivity. Thus, it is necessary to generate salt and drought

tolerant crops to meet the increasing food demand. Along with traditional breeding

strategies, genetic engineering technologies can be employed to improve crops yield and

quality. The advancement in plant biotechnology made it possible to identify genes that

might be valuable in crops improvement (Wang et al., 2003; Chinnusamy et al., 2004)

and can be employed on the crop of our interest. AtNHX1 is one such gene, which allows

plant to grow under the salt conditions (Apse et al., 1999; Zhang and Blumwald, 2001;

Zhang et al., 2001; He et al., 2005; Duan et al., 2009; Tian et al., 2006; Xu et al., 2009).

Our lab has successfully expressed Arabidopsis genes AtNHX1 and AVP1 in

cotton plants, which are significantly tolerant to saline and water deficit conditions than

wild-type plants (He et al., 2005; Pasapula et al., 2010). The main objective of this

project is to express the same Arabidopsis gene AtNHX1 in peanut to improve peanut's

salt tolerance. Eighty independent transgenic lines of peanut expressing AtNHX1 were

generated by using Agrobacterium-mediated transformation technique. PCR analysis of

the genomic DNAs of transformed plants were used to confirm the incorporation of

AtNHX1 in the genome of peanut plants (Fig. 3.1). Also, RNA blot analysis was


55

performed to detect AtNHX1 transcript in peanut lines (Fig. 3.2). Transgenic lines with

high intensity bands in RNA blot assay showed better growth in greenhouse under salt

conditions.

Improved biomass production of AtNHX1-expressing transgenic lines than wild-

type peanut plants in 150 mM NaCl at greenhouse (Figs. 3.3 to 3.5) indicates that

AtNHX1-expressing peanut plants may produce better yield under salt conditions. When

plants expressing large number of vacuolar Na+/H

+ antiporters were grown under saline

conditions, their leaves contain also large amount of sodium ions due to the accumulation

of Na+ in vacuole to alleviate the toxic effect of Na

+ in cytosol, which is accountable for

better photosynthetic capacity (Zhang and Blumwald, 2001; Zhang et al., 2001) (Fig.

3.6A). The data we obtained are consistent with those obtained from Arabidopsis,

rapeseed, tomato, cotton, tobacco, tall fescue, and Petunia hybrid (Apse et al., 1999;

Zhang and Blumwald, 2001; Zhang et al., 2001; He et al., 2005; Duan et al., 2009; Tian

et al., 2006; Xu et al., 2009), which confirms our prediction of generating salt tolerant

peanut plants with the expression of AtNHX1.

The leaf area and leaf number of AtNHX1-expressing peanut plants are larger than

that of wild-type plants (data not shown). In addition to the increased photosynthetic

surface area, transgenic lines had high chlorophyll content than wild-type plants under

the salt conditions (Fig. 3.7), which determines the nitrogen availability in plant (Evans,

1983). Therefore, we can consider that the higher amount of biomass produced by

AtNHX1-expressing plants is due to the multiple effects of large photosynthetic surface

area, better photosynthetic rate, and higher chlorophyll content.


56

While A was measured with noted Ci values, A for AtNHX1-expressing peanut

plants had greater improvement than wild-type plants grown at 150 mM NaCl (Fig. 3.8).

Carboxylation efficiency by Rubisco and electron transport rate are two photosynthetic

characteristics, which were enhanced for the AtNHX1-expressing plants at low and high

CO2 respectively (Fig. 3.9A & 3.9B). Also, transgenic lines of peanut showed improved

photosynthesis at saturated light and saturated CO2 than wild-type plants under salt

stressed conditions (Fig. 3.10A & 3.10B).

Molecular and physiological data proved our hypothesis that expression of

AtNHX1 in peanut can indeed improve salt tolerance as it did in native Arabidopsis

system (Apse et al., 1999) or heterologous systems such as tomato, rapeseed, cotton,

tobacco, tall fescue, and Petunia hybrida systems (Zhang and Blumwald, 2001; Zhang et

al., 2001; He et al., 2005; Duan et al., 2009; Tian et al., 2006; Xu et al., 2009).

PEG generated by native proton pumps: vacuolar ATPase and PPase are

responsible to energize the highly expressed AtNHX1 to function properly in native and

heterologous systems. Therefore, PEG is the determining factor to limit salt tolerance of

AtNHX1-expressing peanut plants around 150 mM NaCl.

As mentioned earlier, our lab has created salinity and drought tolerant cotton

plants expressing another Arabidopsis gene AVP1 that encodes an H+ pump on vacuolar

membrane (Pasapula et al., 2010), where increased H+ pump activity leads to the increase

in PEG that potentially activates AtNHX1 on the vacuolar membrane to improve the

level of salt tolerance. Thus, double overexpression of AtNHX1 and AVP1 in cotton

generate significantly more salt and drought tolerance than the single expression


57

(unpublished Data). We could employ this idea to generate peanut plants suitable for the

low water containing soil of West Texas.

4.1. Challenges of Agrobacerium-mediated transformation in peanut

There are still quite a few challenges in the Agrobacterium-mediated

transformation in peanut. For example, low recovery of transformants, lack of efficient

and precise screening procedure, and lack of enough molecular knowledge are a few of

them existing in peanut transformation protocol. As reported previously, explants were

inoculated in the medium without selective antibiotics for 15 days to enhance

transformation efficiency (Nehra et al., 1990). Kanamycin selection was beneficial in

generating transgenic plants from cotolydon explant, even if we apply kanamycin after 2

weeks of cocultivation, but it could be the likely reason for the very low recovery of

transformants (Mathews et al., 1995; Sharma and Anjaiah, 2000).

Cultivated peanut is a tetraploid, although wild relatives are diploid. It is thought

to be evolved relatively recently through a single hybridization event between the

unreduced gametes of two diploid species (Kochert et al., 1996). Thus, nuclear genome

of cultivated peanut is very large, approximately 3 billion base pairs with short gene-rich

genomic sequences. The large non-expressing genomic region increases the probability

of integrating foreign gene into non-transcribing heterochromatin region, which could be

an another basis for the low recovery of transformants. Also, this could be a potential

factor behind low AtNHX1-expression level (Fig. 3.2).


58

Although 100 µg/ml kanamycin was useful for the selection of transgenic plants

from cotyledon explants, screening of transgenic lines is a potential problem since

kanamycin at high levels of 200 µg/ml restricted but did not always completely inhibited

the regeneration of plant from control wild-type seeds (Sharma and Anjaiah, 2000). Thus,

an efficient screening method for the selection of transgenic peanut is yet to develop.

This problem can be addressed through the modification of selection marker in the

overexpression vector.

It is believed that more than 90% of peanut sequences have close proximity with

the most other plants (Bennetzen, 2000). Genomic sequence analysis revealed that peanut

genome shares more similarity with other plants including Arabidopsis thaliana with 26.7%

sequence similarity (Jayashree et al., 2005). This could be the reason behind the existence

of weak band in wild-type peanut on RNA blot analysis (Fig. 3.2).

If we can overcome the problems that I listed above and come up with a better

protocol in transforming peanut, we will be able to efficiently create more transgenic

peanut lines with various agronomic traits that better suit the tropical and sub-tropical

region of the world including West Texas. Then our goal in creating drought tolerant and

salt tolerant peanut will be realized soon.


59

REFERENCES

Abd El Baki, G.K., Siefritz, F., Man, H.M., Welner, H., Kaldenhoff, R., and Kaiser,

W.M. (2000). Nitrate reductase in Zea mays L. under salinity. Plant Cell

Environ., 23, 15-521.

Agastian, P., Kingsley, S.J., and Vivekanandan, M. (2000). Effect of salinity on

photosynthesis and biochemical characteristics in mulberry genotypes.

Photosynthetica, 38, 287-290.

Akashi, K., Miyake, C., and Yokota, A. (2001). Citrulline, a novel compatible solute in

drought-tolerant wild watermelon leaves, is an efficient hydroxyl radical

scavenger. FEBS Lett., 508, 438-442.

Alamgir, A.N.M., and Ali, M.Y. (1999). Effect of salinity on leaf pigments, sugar and

protein concentrations and chloroplast ATPAase activity of rice (Oryza sativa L.).

Bangladesh J. Bot., 28, 145-149.

Aldesuquy, H.S. (1998). Effect of seawater salinity and gibberllic acid on abscisic acid,

amino acids and water-use efficiency of wheat plants. Agrochimica, 42, 147-157.

AliDinar, H.M., Ebert, G., and Ludders, P. (1999). Growth, chlorophyll content,

photosynthesis and water relations in guava (Psidium guajava L.) under salinity

and different nitrogen supply. Gartenbauwissenschaft, 64, 54-59.

Allen, G.J., Jones, R.G.W., and Leigh, R.A. (1995). Sodium transport in plasma

membrane vesicles isolated from wheat genotypes differing in K+/Na

+

discrimination traits. Plant Cell Environ., 18, 105-115.

Allen, J.A., Chambers, J.L., and Stine, M. (1994). Prospects for increasing salt tolerance

of forest trees: a review. Tree Physiol., 14, 843-853.

Apse, M.P., and Blumwald, E. (2002). Engineering salt tolerance in plants. Curr. Opin.

Biotechnol., 13, 146-150.

Apse, M.P., Aharon, G.S., Snedden, W.A., and Blumwald, E. (1999). Salt tolerance

conferred by overexpression of a vacuolar Na+/H

+ antiport in Arabidopsis.

Science, 285, 1256-1258.

Asada, K., and Takahashi, M. (1987). Production and scavenging of active oxygen

radicals in photosynthesis. In Kyle, D.J., Osmond, C.B., and Arntzen, C.J. (Eds.),

Photoinhibition (pp. 227-288). Amsterdam: Elsevier.


60

Ashraf, M. (1994). Breeding for salinity tolerance in plants. Crit. Rev. Plant Sci., 13, 17-

42.

Ashraf, M., and Harris, P.J.C. (2004). Potential biochemical indicators of salinity

tolerance in plants. Plant Sci., 166, 3-16.

Bartels, D., and Nelson, D. (1994). Approaches to improve stress tolerance using

molecular genetics. Plant Cell Environ., 17, 659-667.

Bartels, D., and Sunkar, R. (2005). Drought and salt tolerance in plants. Cri. Rev. Plant

Sci., 24, 23-58.

Belkhodja, R., Morales, F., Abadia, A., Gomez-Aparisi, J., and Abadia, J. (1994).

Chlorophyll fluorescence as a possible tool for salinity tolerance screening

in barley (Hordeum vulgare L.). Plant Physiol., 104, 667-673.

Benavides, M.P., Marconi, P.L., Gallego, S.M., Comba, M.E., and Tomaro, M.L. (2000).

Relationship between antioxidant defence systems and salt tolerance in Solanum

tuberosum. Aust. J. Plant Physiol., 27, 273-278.

Bennetzen, J.L. (2000). Comparative sequence analysis of plant nuclear genomes. Plant

Cell, 12, 1021-1030.

Blumwald, E. (2000). Salt transport and salt resistance in plants and other organisms.

Curr. Opin. Cell Biol., 12, 431-434.

Blumwald, E., and Poole, R. 1985. Na+/H

+-antiport in isolated tonoplast vesicles from

storage tissue of Beta vulgaris. Plant Physiol., 78, 163-167.

Blumwald, E., Grover, A., and Good, A.G. (2004). Breeding for abiotic stress resistance:

challenges and opportunities: New directions for a diverse planet, Proceedings of

the 4th

international crop science congress, Brisbane, Australia.

Blumward, E. (1987). Tonoplast vesicles as a tool in the study of ion-transport at the

plant vacuole. Physiol. Plant., 69, 731-734.

Bohnert, H.J., and Shen, B. (1999). Transformation and compatible solutes. Sci. Hortic.,

78, 237-260.

Bohnert, H.J., and Jensen, R.G. (1996). Strategies for engineering waterstress tolerance in

plants. Trends Biotechnol., 14, 89-97.

Bohnert, H.J., Nelson, D.E., and Jensen, R.G. (1995). Adaptations to environmental

stresses. Plant Cell, 7, 1099-1111.


61

Bongi, G., and Loreto, F. (1989). Gas-exchange properties of salt-stressed olive (Olea

europea L.) leaves. Plant Physiol., 90, 1408-1416.

Boyer, J.S. (1982). Plant productivity and environment. Science, 218, 443-448.

Brugnoli, E., and Bjorkman, O. (1992). Growth of cotton under continuous salinity

stress influence on allocation pattern, stomatal and non-stomatal components of

photosynthesis and dissipation of excess light energy. Planta, 187, 335-347.

Brugnoli, E., and Lauteri, M. (1991). Effects of salinity on stomatal conductance,

photosynthetic capacity and carbon isotope discrimination of salt-tolerant

(Gossypium hirsutum L.) and salt-sensitive (Phaseolus vulgaris L.) C3 non-

halophytes. Plant Physiol., 95, 628-635.

Bruns, S., and Hecht-Buchholz, C. (1990). Light and electron-microscope studies on the

leaves of several potato cultivars after application of salt at various developmental

stages. Potato Res., 33, 33-41.

Chartzoulakis, K. and Klapaki, G. (2000). Response of two green house pepper hybrids to

NaCl salinity during different growth stages. Sci. Hortic., 86, 247-260.

Chaudhuri, K., and Choudhuri, M.A. (1997). Effect of short-term NaCl stress on water

relations and gas exchange of two jute species. Biol. Plant., 40, 373-380.

Chen, T.H., and Murata, N. (2002). Enhancement of tolerance of abiotic stress by

metabolic engineering of betaines and other compatible solutes. Curr. Opin.

Plant Biol., 5, 250-257.

Comba, M.E., Benavides, M.P., and Tomaro, M.L. (1998). Effect of salt stress on

antioxidant defence system in soybean root nodules. Aust. J. Plant Physiol., 25,

665-671.

Cram, W.J. (1973). Internal factors regulating nitrate and chloride influx in plant cells. J.

Exp. Bot., 24, 328-341.

Crowe, J.H., Hoekstra, F.A., and Crowe, C.M. (1992). Anhydrobiosis. Annu. Rev. Plant

Physiol., 54, 579-599.

Cushman, J.C. (1993). Molecular-cloning and expression of chloroplast NADP-malate

dehydrogenase during crassulacean acid metabolism induction by salt stress.

Photosynth. Res., 35, 15-27.

Cushman, J.C., and Bohnert, H.J. (2000). Genomic approaches to plant stress tolerance.

Curr. Opin. Plant Biol., 3, 117–124.


62

Cushman, J.C., Meyer, G., Michalowski, C.B., Schmitt, J.M., and Bohnert, H.J. (1989).

Salt stress leads to differential expression of two isogenes of PEP Case during

CAM induction in the common Ice plant. Plant Cell, 1, 715-725.

Davenport, R.J., and Tester, M. (2000). A weakly voltage-dependent, nonselective

cation channel mediates toxic sodium influx in wheat. Plant Physiol., 122, 823-

834.

de Bruxelles, G.L., Peacock, W.J., Dennies, E.S., and Dolferus, R. (1996). Abscisic acid

induces the alcohol dehydrogenase gene in Arabidopsis. Plant Physiol., 111, 381-

391.

Deane-Drummond, C.E., and Glauss, A.D.M. (1982). Studies of nitrate influx into barley

roots by the use of 36ClO3 as a tracer for nitrate. Interactions with chloride and

other ions. Can. J. Bot., 60, 2147-2153.

DeAragao, M.E.F., Jolivet, Y., Lima, M.D., deMelo, D.F., and Dizengremel, P. (1997).

NaCl-induced changes of NAD(P) malic enzyme activities in Eucalyptus

citriodora leaves. Trees-Struct. Funct., 12, 66-72.

Delfine, S., Alvino, A., Zacchini, M., and Loreto, F. (1998). Consequences of salt stress

on conductance to CO2 diffusion, Rubisco characteristics and anatomy of spinach

leaves. Aust. J. Plant Physiol., 25, 395-402.

Diamant, S., Eliahu, N., Rosenthal, D., and Goloubinoff, P. (2001). Chemical

chaperones regulate molecular chaperones in vitro and in cells under combined

salt and heat stresses. J. Biol. Chem., 276, 39586-39591.

Duan, X.G., Song, Y.J., Yang, A.F., and Zhang, J.R. (2009). The transgenic pyramiding

tobacco with betaine synthesis and teterologous expression of AtNHX1 is more

tolerant to salt stress than either of the tobacco lines with betaine synthesis or

AtNHX1. Physiologia Plantarum, 135, 281-295.

Dupont, F. (1992). Salt-induced changes in ion transport: regulation of primary pumps

and secondary transporters. In Cooke, D., and Clarkson, D. (Eds.), Transport and

Receptor Proteins of Plant Membranes (pp. 91–100). New York: Plenum Press.

Elstner, E.F. (1987). Metabolism of activated oxygen species. In Davies, D.D. (Ed.), The

Biochemistry of Plants. (Vol. 2), Biochemistry of Metabolism (pp. 252-315). San

Diego, CA: Academic Press.

Evans, J.R. (1983). Nitrogen and photosynthesis in the flag leaf of wheat (Triticum

aestivum L.). Plant Physiol., 72, 297-302.


63

Everard, J.D., Gucci, R., Kann, S.C., Flore, J.A., and Loescher, W.H. (1994). Gas

exchange and carbon partitioning in the leaves of celery (Apium graveolens L.) at

various levels of root zone salinity. Plant Physiol., 106, 281-292.

FAO. (2008). FAO Land and Plant Nutrition Management Service.

http://www.fao.org/ag/agl/agll/spush

Feinberg, A.P., and Vogelstein, B. (1983). A technique for radiolabeling DNA

restriction endonuclease fragments to high specificity. Anal. Biochem., 132, 6-13.

Flores, P., Botella, M.A., Martinez, V., and Cedra, A. (2000). Ionic and osmotic effects

on nitrate reductase activity in tomato seedlings. J. Plant Physiol., 156, 552-557.

Flowers, T.J., and Yeo, A.R. (1995). Breeding for salinity resistance in crop plants:

where next? Aust. J. Plant Physiol., 22, 875-884.

Flowers, T.J., Troke, P.F., and Yeo, A.R. (1977). The mechanism of salt tolerance in

halophytes. Annu. Rev. Plant Physiol., 28, 89-121.

Ford, C.W. (1984). Accumulation of low molecular solutes in water stress tropical

legumes. Phytochem., 23, 1007-1015.

Frommer, W.F., Ludewig, U., and Rentsch, D. (1999). Taking transgenic plants with a

pinch of salt. Science, 285, 1222-1223.

Fridovich, I., (1986). Biological effects of the superoxide radical. Arch. Biochem.

Biophys., 247, 1-11.

Fukuda, A., Nakamura, A., and Tanaka, Y. (1999). Molecular cloning and expression of

the Na+/H

+ exchanger gene in Oryza sativa. Biochem. Biophys. Acta., 1446,

149-155.

Fukuda, A., Nakamura, A., Tagiri, A., Tanaka, H., Miyao, A., Hirochika, H., and

Tanaka, Y. (2004). Function, intracellular localization and the importance in salt

tolerance of a vacuolar Na+/H

+ antiporter from rice. Plant Cell Physiol., 45, 149-

159.

Gadallah, M.A.A. (1999). Effects of proline and glycinebetaine on Vicia faba response to

salt stress. Biol. Plant., 42, 249-257.

Gale, M. (2002). Applications of molecular biology and genomics to genetic

enhancement of crop tolerance to abiotic stress - a discussion document. In Isc

Secretariat, Food and Agriculture Organization of the United Nation. New York,

NY.


64

Garthwaite, A.J., von Bothmer, R., and Colmer, T.D. (2005). Salt tolerance in wild

Hordeum species is associated with restricted entry of Na+ and Cl

- into the shoots.

J. Exp. Bot., 56, 2365-78.

Gaxiola, R., Rao, R., Sherman, A., Grisafi, P., Alper, S.L., and Fink, G.R. (1999). The

Arabidopsis thaliana proton transporters, AtNhx1 and Avp1, can function in

cation detoxification in yeast. Proc. Natl. Acad. Sci., 96, 1480-1485.

Gaxiola, R.A., Fink, G.R., and Hirschi, K.D. (2002). Genetic manipulation of vacuolar

proton pumps and transporters. Plant Physiol., 129, 967-973.

Glenn, E.P., Brown, J.J., and Blumwald, E. (1999). Salt tolerance and crop potential of

halophytes. Crit. Rev. Plant Sci., 18, 227-256.

Gossett, D.R., Millhollon, E.P., and Lucas, M.C. (1994). Antioxidant response to NaCl

stress in salt tolerant and salt sensitive cultivars of cotton. Crop Sci., 34: 706-714.

Greenway, H., and Munns, R. (1980). Mechanisms of salt tolerance in non-halophytes.

Annu. Rev. Plant Physiol., 31, 149-190.

Grover, A., Aggarwal, P.K., Kapoor, A., Katiyar-Agarwal, S., Agarwal, M., and

Chandramouli, A. (2003). Addressing abiotic stresses in agriculture through

transgenic technology. Curr. Sci., 84, 355-367.

Guo, Y., Halfter, U., Ishitani, M., and Zhu, J.K. (2001). Molecular characterization of

functional domains in the protein kinase SOS2 that is required for plant salt

tolerance. Plant Cell, 13, 1383-1399.

Gupta, S., Chattopadhyay, M.K., Chatterjee, P., Ghosh, B., and SenGupta, D.N. (1998).

Expression of abscisic acid-responsive element binding protein in salt tolerant

indica rice (Oryza sativa L. cv. Pokkali). Plant Mol. Biol., 137, 629-637.

Halfter, U., Ishitani, M., and Zhu, J.K. (2000). The Arabidopsis SOS2 protein kinase

physically interacts with and is activated by the calcium-binding protein SOS3.

Proc. Natl. Acad. Sci. USA, 97, 3735-3740.

Halliwell, B., and Gutteridge, J.M.C. (1985). Free Radicals in Biology and Medicine.

Oxford: Clarendon Press.

Hamada, A., Shono, M., Xia, T., Ohta, M., Hayashi, Y., Tanaka, A., and Hayakawa, T.

(2001). Isolation and characterization of a Na+/H

+ antiporter gene from the

halophyte Atriplex gmelini. Plant Mol. Biol., 46, 35-42.


65

Hare, P.D., Cress, W.A., and van Staden, J. (1998). Dissecting the roles of osmolyte

accumulation during stress. Plant Cell Environ., 21, 535–553.

Hasegawa, P.M., Bressan, R.A., and Pardo, J.M. (2000). The dawn of plant salt to

tolerance genetics. Trends in Plant Sci., 5, 317-319.

Hassanein, A.M. (1999). Alterations in protein and esterase patterns of peanut in response

to salinity stress. Biol. Plant., 42, 241-248.

Hassidim, M., Braun, Y., Lerner, H.R., and Reinhold, L. (1990). Na+/H

+ and K

+/H

+

antiport in root membrane vesicles isolated from the halophyte Atriplex and the

glycophyte cotton. Plant Physiol., 94, 1795-1801.

He, C. (2005). Analysis of AtNHX1- expressing transgenic cotton under high salt

conditions and in the field. Doctorial Dissertation, Texas Tech University.

He, C., Shen, G., Pasapula, V., Venkataramani, S., Qiu, X., Kuppu, S., Kornyeyev, D.,

Holaday, A.S., Auld, D., Blumwald, E., and Zhang, H. (2007). Ectopic

expression of AtNHX1 in cotton (Gossypium hirsutum L.) increases proline

content and enhances photosynthesis under salt stress conditions. J. Cotton Sci.,

11, 266-274.

He, C., Yan, J., Shen, G., Fu, L., Holaday, A.S., Auld, D., Blumwald, E., and Zhang, H.

(2005). Expression of an Arabidopsis vacuolar sodium/proton antiportor gene in

cotton inproves photosynthetic performance under salt conditions and increases

fiber yield in the field. Plant Cell Physiol., 46, 1848-1854.

Hernandez, J., Jimenez, A., Mullineaux, P., and Sevilla, F. (2000). Tolerance of pea

plants (Pisum sativum) to long-term salt stress is associated with induction of

antioxidant defenses. Plant Cell Environ., 23, 853-862.

Hernandez, J.A., Campillo, A., Jimenez, A., Alacon, J.J., and Sevilla, F. (1999).

Response of antioxidant systems and leaf water relations to NaCl stress in pea

plants. New Phytol., 141, 241-251.

Hernández, J.A., Olmos, E.F., Corpas, J., Sevilla, F., and del Rio, L.A. (1995). Salt-

induced oxidative stress in chloroplasts of pea plants. Plant Sci., 105, 151-167.

Horie, T., and Schroeder, J.I. (2004). Sodium transporters in plants. Diverse genes and

physiological functions. Plant Physiol., 136, 2457-2462.

Huber, S.C., and Kaiser, W.M. (1996). 5-Aminoimidazole-4-carboxiamide riboside

activates nitrate reductase in darkened spinach and pea leaves. Physiol. Plant.,

98, 833-837.


66

Imlay, J.A., and Linn, S. (1988). DNA damage and oxygen radical toxicity. Science, 240,

1302-1309.

Ishitani, M., Liu, J., Halfter, U., Kim, C.S., Shi, W., and Zhu, J.K. (2000). SOS3

function in plant salt tolerance requires N-myristoylation and calcium binding.

Plant Cell, 12, 1667-1678.

Iyengar, E.R.R., and Reddy, M.P. (1996). Photosynthesis in highly salt tolerant plants. In

Pesserkali, M. (Ed.), Handbook of photosynthesis (pp. 897-909). Marshal Dekar,

Baten Rose, USA.

Jayashree, B., Ferguson, M., Ilut, D., Doyle, D., and Crouch, J.H. (2005). Analysis of

genomic sequences from peanut (Arachis hypogaea). Electronic J. of Biotechnol.,

8, 226-237.

Kaiser, W.M., Weiner, H., and Huber, S.C. (1999). Nitrate reductase in higher plants: a

case study for transduction of enironmental stimuli into control of catalytic

activity. Physiol. Plant., 105, 385-390.

Kao, W.Y., Tsai, H.C., and Tsai, T.T. (2001). Effect of NaCl and nitrogen availability on

growth and photosynthesis of seedlings of a mangrove species, Kandelia candel

(L.) Druce. J. Plant Physiol., 158, 841-846.

Kawasaki, S., Borchert, C., Deyholos, M., Wang, H., Brazille, S., Kawai, K., Galbraith,

D., and Bohnert, H.J. (2001). Gene expression profiles during the initial phase of

salt stress in rice. Plant Cell, 13, 889-905.

Kennedy, B.F., and De Fillippis, L.F. (1999). Physiological and oxidative response to

NaCl of the salt tolerant Grevillea ilicifolia and the salt sensitive Grevillea

arenaria. J. Plant Physiol. 155, 746-754.

Kerepesi, I., and Galiba, G. (2000). Osmotic and salt stress-induced alteration in soluble

carbohydrate content in wheat seedlings. Crop Sci., 40, 482-487.

Kerkeb, L., Donaire, J.P., and RodriguezRosales, M.P. (2001). Plasma membrane H+-

ATPase activity is involved in adaptation of tomato calli to NaCl. Physiol. Plant,

111, 483-490.

Khan, M.A. (2001). Experimental assessment of salinity tolerance of Ceriops tagal

seedlings and saplings from the Indus delta. Pakistan. Aquat. Bot., 70, 259-268.

Khan, M.A., Ungar, I.A., and Showalter, A.M. (1999). Effects of salinity on growth, ion

content, and osmotic relations in Halopyrum mocoronatum (L.) Stapf. J. Plant

Nutr., 22, 191-204.


67

Khan, M.A., Ungar, I.A., and Showalter, A.M. (2000). Effects of sodium chloride

treatments on growth and ion accumulation of the halophyte Haloxylon recurvum.

Commun. Soil Sci. Plant Anal., 31, 2763-2774.

Khatkar, D., and Kuhad, M.S. (2000). Short-term salinity induced changes in two wheat

cultivars at different growth stages. Biol. Plant, 43, 629-632.

Khavarinejad, R.A., and Mostofi, Y. (1998). Effects of NaCl on photosynthetic

pigments, saccharides, and chloroplast ultrastructure in leaves of tomato

cultivars. Photosynthetica, 35, 151-154.

Khavarinejad, R.A., and Chaparzadeh, N. (1998). The effects of NaCl and CaCl2 on

photosynthesis and growth of alfalfa plants. Photosynthetica, 35, 461-466.

Khavarinejad, R.A., and Mostofi, Y. (1998). Effects of NaCl on photosynthetic pigments,

saccharides, and chloroplast ultrastructure in leaves of tomato cultivars.


Kurban, H., Saneoka, H., Nehira, K., Adilla, R., Premachandra, G.S., and Fujita, K.

(1999). Effect of salinity on growth, photosynthesis and mineral composition in

leguminous plant Alhagi pseudoalhagi. Soil Sci. Plant Nutr., 45, 851-862.

Lea, P.J. 1997. Primary nitrogen metabolism. In Day, P.M., and Harborn, J.B. (Eds.),

Plant Biochemistry (pp. 273-313). New York: Academic Press.

Lee, D.H., Kim, Y.S., and Lee, C.B. (2001). The inductive responses of the antioxidant

enzymes by salt stress in the rice (Oryza sativa L.). J. Plant Physiol., 158, 737-

745.

Lerner, H.R., Amzallag, G.N., Friedman, Y., and Goloubinoff, P. (1994). The response of

plants to salinity: from turgor adjustments to genome modification. Israel J. Plant

Sci., 42, 285-300.

Li, J., He, X., Xu, L., Zhou, J., Wu, P., Shou, H., and Zhang, F. (2008). Molecular and

functional comparisons of the vacuolar Na+/H

+ exchangers originated from

glycophytic and halophytic species. J. Zhejiang Univ. Sci. B., 9, 132-140.

Liu, J., and Zhu, J.K. (1998). A calcium sensor homolog required for plant salt

tolerance. Science, 280, 1943-1945.

Liu, J., Ishitani, M., Halfter, U., Kim, C.S., and Zhu, J.K. (2000). The Arabidopsis

thaliana SOS2 gene encodes a protein kinase that is required for salt tolerance.

Proc. Natl. Acad. Sci. USA, 97, 3730-3734.


68

Longstreth, D.J., and Nobel, P.S. (1979). Salinity effects on leaf anatomy. Plant Physiol.,

63, 700-703.

Lu, C.M., Qiu, N.W., Lu, Q.T., Wang, B.S., and Kuang, T.Y. (2002). Does salt stress

lead to increased susceptibility of photosystem II to photoinhibition and changes

in photosynthetic pigment composition in halophyte Suaeda salsa grown

outdoors?. Plant Sci., 163, 1063-1068.

Maathuis, F.J.M., and Amtmann, A. (1999). K+

nutrition and Na+

toxicity: the basis of

cellular K+/Na

+ ratios. Ann. Bot., 84, 123-133.

Mahajan, S., Sopoy, S.K., and Tuteja, N. (2006). CBL-CIPK paradigm: Role in calcium

and stress signaling in plants. Proc. Indian Natn. Sci. Acad., 72, 63-78.

Maniatis, T., Fritsch, E.F., and Sambrook, J. (1982). Molecular Cloning: A Laboratory

Manual. New York: Cold Spring Harbor Laboratory Press.

Marcelis, L.F.M., and VanHooijdonk, J. (1999). Effect of salinity on growth, water use

and nutrient use in radish (Raphanus sativus L.). Plant Soil, 215, 57-64.

Masojidek, J., and Hall, D.O. (1992). Salinity and drought stresses are amplified by high

irradiance in sorghum. Photosynthetica, 27, 159-171.

Mathews, H., Wagoner, W., Kellogg, J., and Bestwick, R. (1995). Genetic transformation

of strawberry: stable integration of a gene to control biosynthesis of ethylene. In

Vitro Cell. Dev. Biol., 31, 36-43.

McNeil, S.D., Nuccio, M.L., and Hanson, A.D. (1999). Betaines and related

osmoprotectants. Targets for metabolic engineering of stress resistance. Plant

Physiol., 120, 945-949.

Meloni, D.A., Oliva, M.A., Ruiz, H.A., and Martinez, C.A. (2001). Contribution of

proline and inorganic solutes to osmotic adjustment in cotton under salt stress. J.

Plant Nutr., 24, 599-612.

Mennen, H., Jacoby, B., and Marschner, H. (1990). Is sodium proton antiport ubiquitous

in plant cells?. J. Plant Physiol., 137, 180-183.

Mishra, S.K., Subrahmanyam, D., and Singhal, G.S. (1991). Interrelationship between

salt and light stress on primary processes of photosynthesis. J. Plant Physiol.,

138, 92-96.


69

Mitsuya, S., Takeoka, Y., and Miyake, H. (2000). Effects of sodium chloride on foliar

ultrastructure of sweet potato (Ipomoea batatas Lam.) plantlets grown under light

and dark conditions in vitro. J. Plant Physiol., 157, 661-667.

Mittova, V., Tal, M., Volokita, M., and Guy, M. (2002). Salt stress induces up-regulation

of an efficient chloroplast antioxidant system in the salt-tolerant wild tomato

species Lycopersicon pennellii but not in the cultivated species. Physiol. Plant,

115, 393-400.

Mittova, V., Tal, M., Volokita, M., and Guy, M. (2003). Up-regulation of the leaf

mitochondrial and peroxisomal antioxidative systems in response to salt-induced

oxidative stress in the wild salt-tolerant tomato species Lycopersicon pennellii.

Plant Cell Environ., 26, 845-856.

Mohammad, M., Shibli, R., Ajouni, M., and Nimri, L. (1998). Tomato root and shoot

responses to salt stress under different levels of phosphorus nutrition. J. Plant

Nutr., 21, 1667-1680.

Morales, F., Abadia, A., Gomez-Aparis, J., and Abadia, J. (1992). Effects of combined

NaCl and CaCl2 salinity on photosynthetic parameters of barley grown in

nutrient solution. Physiol. Plant, 86, 419-426.

Morales, M.A., Sancheo-Blanco, M.J., Olmos, E., Torrechlas, A., and Alarcon, J.J.

(1998). Changes in the growth, leaf water relations and all ultrastructure in

Argyranthemum coronopifolium plants under saline conditions. J. Plant Physiol.,

153, 174-180.

Munns, R. (2002). Comparative physiology of salt and water stress. Plant Cell Environ.,

25, 239-250.

Munns, R., Guo, J., Passiora, J.B., and Cramer, G.R. (2000). Leaf water status controls

day-time but not daily rates of leaf expansion in salt-treated barley. Aust. J. Plant

Physiol., 27, 949-957.

Munns, R., James, R.A., and Lauchli, A. (2006). Approaches to increasing the salt

tolerance of wheat and other cereals. Exp. J. Bot., 57, 1025-1043.

Munns, R., and Termatt, A. (1986). Whole plant responses to salinity. Aust. J. Plant

Physiol., 13, 143-160.

Munns, R., and Tester, M. Mechanisms of salinity tolerance. (2008). Annu. Rev Plant

Biol., 59, 645-681.


70

Nass, R., Cunningham, K.W., and Rao, R. (1997). Intracellular sequestration of sodium

by a novel Na+/H

+ exchanger in yeast is enhanced by mutations in the plasma

membrane H+-ATPase. Insights into mechanisms of sodium tolerance. J. Biol.

Chem., 272, 26145-26152.

Nehra, N.S., Chibbar, R.N., Kartha, K.K., Datla, R.S.S., Crosby, W.L., and Stushnoff, C.

(1990). Agrobacterium-mediated transformation of strawberry calli and recovery

of transgenic plants. Plant Cell Rep., 9, 10-13.

Ohta, M., Hayashi, Y., Nakashima, A., Hamada, A., Tanaka, A., Nakamura, T., and

Hayakawa, T. (2002). Introduction of a Na+/H

+ antiporter gene from Atriplex

gmelini confers salt tolerance to rice. FEBS Lett., 532, 279-282.

Orthen, B., Popp, M., and Smirnoff, N. (1994). Hydroxyl radical scavenging properties of

cyclitols. Proc. R. Soc. Edinburg Sect. B, 102, 269-272.

Ouerghi, Z., Cornie, G., Roudani, M., Ayadi, A., and Brulfert, J. (2000). Effect of NaCl

on the photosynthesis of two wheat species (Triticum durum and Triticum

aestivum) differing in their sensitivity to salt stress. J. Plant Physiol., 15, 519-

527.

Papp, J.C., Ball, M.C., and Terry, N. (1983). A comparative study of the effects of NaCl

salinity on respiration, photosynthesis, and leaf extension growth in Beta

vulgaris L. (sugar beet). Plant Cell Environ., 6, 675-677.

Parida, A., Das, A.B., and Das, P. (2002). NaCl stress causes changes in photosynthetic

pigments, proteins and other metabolic component in the leaves of a true

mangrove, Bruguiera parviflora, in hydroponic cultures. J. Plant Biol., 45, 28-36.

Parida, A.K., and Das, A.B. (2005). Salt tolerance and salinity effects on plant: a review.

Ecotoxicology and Environmental Safety, 60, 324-349.

Parida, A.K., Das, A.B., Mittra, B. (2003). Effects of NaCl stress on the structure,

pigment complex compsition and photosynthetic activity of mangrove Bruguiera

parviflora chloroplasts. Photosynthetica, 41, 191-200.

Parida, A.K., Das, A.B., and Mittra, B. (2004a). Effects of salt on growth, ion

accumulation photosynthesis and leaf anatomy of the mangrove, Bruguiera

parviflora. Trees-Struct. Funct., 18, 167-174.

Parida, A.K., Das, A.B., and Mohanty, P. (2004b). Defense potentials to NaCl in a

mangrove, Bruguiera parviflora: differential changes of isoforms of some

antioxidative enzymes. J. Plant Physiol., 161, 531-542.


71

Pasapula, V., Shen, G., Kuppu, S., Paez-Valencia, J., Mendoza, M., Hou, P., Chen, J.,

Qin, X., Zhu, L., Zhang, X., Auld, D., Blumwald, E., Zhang, H., Gaxiola, R., and

Payton, P. (2010). Expression of an Arabidopsis vacuolar H+-pyrophosphatase

gene (AVP1) in cotton improves drought- and salt tolerance and increases fiber

yield in the field conditions. Plant Biotechnol. J. (In press).

Pilon-Smits, E.A.H., Ebskamp, M.J.M., Paul, M.J., Jeuken, M.J.W., Weisbeek, P.J., and

Smeekens, S.C.M. (1995). Improved performance of transgenic fructan-

accumulating tobacco under drought stress. Plant Physiol., 107, 125-130.

Popova, L.P., Stoinova, Z.G., and Maslenkova, L.T. (1995). Involvement of abscisic acid

in photosynthetic process in Hordeum vulgare L during salinity stress. J. Plant

Growth Regul., 14, 211-218.

Popova, O.V., Ismailov, S.F., Popova, T.N., Dietz, K.J., and Golldack, D. (2002). Salt-

induced expression of NADP-dependent isocitrate dehydrogenase and ferredoxin-

dependent glutamate synthase in Mesembryanthemum crystallinum. Planta, 215,

906-913.

Popp, M., Larther, F., and Weigel, P. (1985). Osmotic adaptation in Australian

mangroves. Vegetation, 61, 247-254.

Qiu, Q.S., Guo, Y., Dietrich, M.A., Schumaker, K.S., and Zhu, J.K. (2002). Regulation

of SOS1, a plasma membrane Na+/H

+ exchanger in Arabidopsis thaliana, by

SOS2 and SOS3. Proc. Natl. Acad. Sci., 99, 8436-8441.

Rajasekaran, L.R., Aspinall, D., Jones, G.P., and Paleg, L.G. (2001). Stress metabolism.

IX. Effect of salt stress on trigonelline accumulation in tomato. Can. J. Plant Sci.,

81, 487-498.

Rajesh, A., Arumugam, R., and Venkatesalu, V. (1998). Growth and photosynthetic

characteristics of Ceriops roxburghiana under NaCl stress. Photosynthetica, 35,

285-287.

Rao, G.G., and Rao, G.R. (1981). Pigment composition & chlorophyllase activity in

pigeon pea (Cajanus indicus Spreng) & Gingelley (Sesamum indicum L.) under

NaCl salinity. Indian J. of Exp. Biol., 19, 768-770.

Ratner, A., and Jacoby, B. (1976). Effects of K+, its counter anion, and pH on sodium

efflux from barley root tips. J. Exp. Bot., 27, 843-852.


72

Reddy, M.P., Sanish, S., and Iyengar, E.R.R. (1992). Photosynthetic studies and

compartmentation of ions in different tissues of Salicornia brachiata Roxb.

under saline conditions. Photosynthetica, 26, 173-179.

Rengasamy, P. (2002). Transient salinity and subsoil constraints to dry land farming on

Australian sodic soils: an overview. Aust. J. Exp. Agric., 42, 351-361.

Rhoades, J.D., and Loveday, J. (1990). Salinity in irrigated agriculture. In Stewart, B.A.

and Nielsen, D.R. (Eds.), Irrigation of Agricultural Crops. Agron. Monogr. 30

(pp. 1089-11). Madison, WI: ASA, CSSA, and SSSA.

Rhodes, D., and Hanson, A.D. (1993). Quaternary ammonium and tertiary sulphonium

compounds in higher plants. Annu. Rev. Plant Physiol. Plant Mol. Biol., 44, 357-

384.

Robinson, S.P., Downton, W.J.S., and Millhouse, J. (1983). Photosynthesis and ion

content of leaves and isolated chloroplasts of salt-stressed spinach. Plant

Physiol., 73, 238-242.

Romeroaranda, R., Soria, T., and Cuartero, J. (2001). Tomato plant-water uptake and

plant-water relationships under saline growth conditions. Plant Sci., 160, 265-272.

Sanders, D. (2000). Plant biology: The salty tale of Arabidopsis. Curr. Biol., 10, 486-

488.

Schachtman, D.P., and Liu, W. (1999). Molecular pieces to the puzzle of the interaction

between potassium and sodium uptake in plants. Trends Plant Sci., 4, 281-287.

Seemann, J.R., and Critchley, C. (1985). Effects of salt stress on the growth, ion content,

stomatal behaviour and photosynthetic capacity of a salt-sensitive species,

Phaseolus vulgaris L. Planta, 164, 151-162.

Seemann, J.R., and Sharkey, T.D. (1986). Salinity and nitrogen effects on

photosynthesis, ribulose-1,5-bisphosphate carboxylase and meta bolite pool size

in Phaseolus vulgaris L. Plant Physiol., 82, 555-560.

Sehmer, L., Alaoui-Sosse, B., and Dizengremel, P. (1995). Effect of salt stress on growth

and on the detoxyfying pathway of pedunculate oak seedlings (Quercus robur L.).

J. Plant Physiol., 147, 144-151.

Sharma, K.K., and Anjaiah, V. (2000). An efficient method for the production of

transgenic plants of peanut (Arachis hypogaea L.) through Agrobacterium

tumefaciens-mediated genetic transformation. Plant Sci., 159, 7-19.


73

Sharma, K.K., and Bhatnagar-Mathur, P. (2006). Peanut (Arachis hypogaea L.). In

Wang, K. (Ed.), Methods in Molecular Biology 434 (pp. 347-358). Totowa, NJ:

Humana Press Inc.

Sharma, K.K., and Oritz, R. (2000). Project for the application of genetic transformation

for crop improvement in the semi-arid tropics. In Vitro Cell. Dev. Biol.-Plant, 36,

83-92.

Shi, H., Ishitani, M., Kim, C., and Zhu, J.K. (2000). The Arabidopsis thaliana salt

tolerance gene SOS1 encodes a putative Na+/H

+ antiporter. Proc. Natl. Acad.

Sci., 97, 6896-6901.

Shi, H., Lee, B.H., Wu, S.J., and Zhu, J.K. (2003). Overexpression of a plasma

membrane Na+/H

+ antiporter gene improves salt tolerance in Arabidopsis

thaliana. Nat. Biotechnol., 21, 81-85.

Shi, H., Quintero, F.J., Pardo, J.M., and Zhu, J.K. (2002). The putative plasma membrane

Na+/H

+ antiporters SOS1 controls long distance Na

+ transporter in plants. Plant

cell, 14, 465-477.

Singh, A.K., and Dubey, R.S. (1995). Changes in chlorophyll a and b contents and

activities of photosystems 1 and 2 in rice seedlings induced by NaCl.


Singh, S.C., Sinha, R.P., and Hader, D.P. (2002). Role of lipids and fatty acids in stress

tolerance in cyanobacteria. Acta Protozool., 41, 2970-308.

Singh, S.K., Sharma, H.C., Goswami, A.M., Datta, S.P., and Singh, S.P. (2000). In vitro

growth and leaf composition of grapevine cultivars as affected by sodium

chloride. Biol. Plant., 43, 283-286.

Soussi, M., Lluch, C., and Ocana, A. (1998). Effects of salt stress on growth,

photosynthesis and nitrogen fixation in chick-pea (Cicer arietinum L.). J. Exp.

Bot., 49, 1329-1337.

Soussi, M., Lluch, C., and Ocana, A. (1999). Comparative study of nitrogen fixation and

carbon metabolism in two chick-pea (Ciser arietinum L.) cultivars under salt

stress. J. Exp. Bot., 50, 1701-1708.

Sreenivasulu, N., Grimm, B., Wobus, U., and Weschke, W. (2000). Differential response

of antioxidant compounds to salinity stress in salt-tolerant and salt-sensitive

seedlings of fox-tail millet (Setaria italica). Physiol. Plant, 109, 435-442.


74

Srivastava, H.S. (1990). Regulation of nitrate reductase activity in higher plants.

Phytochem., 19, 725-733.

Szabolcs, I. (1989). Salt-Affected Soils. Baco Raton, FL: CRC Press.

Takemura, T., Hanagata, N., Dubinsky, Z., and Karube, I. (2002). Molecular

characterization and response to salt stress of mRNAs encoding cytosolic Cu/Zn

superoxide dismutase and catalase from Bruguiera gymnorrhiza. Trees-Struct.

Funct., 16, 94-99.

Tester, M., and Davenport, R. (2003). Na+

tolerance and Na+

transport in higher plants.

Annu. Bot., 91, 503-527.

Thomas, J.C., McElwain, E.F., and Bohnert, H.J. (1992). Convergent induction of

osmotic stress-responses. Plant Physiol., 100, 416-423.

Tian, L., Huang, C., Yu, R., Liang, R., Li, Z., Zhang, L., Wang, Y., Zhang, X., and Wu,

Z. (2006). Overexpression of AtNHX1 confers salt-tolerance of transgenic tall

fescue. African J. Biotechnol., 5, 1041-1044.

Vaidyanathan, R., Kuruvilla, S., and Thomas, G. (1999). Characterization and expression

pattern of an abscisic acid and osmotic stress responsive gene from rice. Plant

Sci., 140, 21-30.

Volkmar, K.M., Hu, Y., and Steppuhn, H. (1998). Physiological responses of plants to

salinity: a review. Can. J. Plant Sci., 78, 19-27.

Waditee, R., Tanaka, Y., and Takabe, T. (2006). Na+/H

+ antiporters in plants and

cyanobacteria. In Rai, A.K. and Takabe, T. (Eds.), Abiotic stress tolerance in

plants (pp.163-175). Netherland: Springer.

Wang, Y., and Nil, N. (2000). Changes in chlorophyll, ribulose biphosphate carboxylase-

oxygenase, glycine betaine content, photosynthesis and transpiration in

Amaranthus tricolor leaves during salt stress. J. Hortic. Sci. Biotechnol., 75, 623-

627.

Wang,W., Vinocur, B., and Altman, A. (2003). Plant responses to drought, salinity and

extreme temperatures: Towards genetic engineering for stress tolerance. Planta,

218, 1-14.

Wilson, C., and Shannon, M.C. (1995). Salt-induced Na+/H

+ antiport in root plasma

membrane of a glycophytic and halophytic species of tomato. Plant Sci., 107,

147-157.


75

Winicov, I. (1998). New molecular approaches to improving salt tolerance in crop

plants. Annu. Bot., 82, 703-710.

Winicov, I., and Bastola, D.R. (1997). Salt tolerance in crop plants: New approaches

through tissue culture and gene regulation. Acta Physiol. Plant, 19, 435-449.

Wise, R.R., and Naylor, A.W. (1987). Chilling-enhanced photooxidation: evidence for

the role of singlet oxygen and endogenous antioxidants. Plant Physiol., 83, 278-

282.

Wu, C.A., Yang, G.D., Meng, Q.W., and Zheng, C.C. (2004). The cotton GhNHX1 gene

encoding a novel putative tonoplast Na+/H

+ antiporter plays an important role in

salt stress. Plant Cell Physiol., 45, 600-607.

Xu, K., Hong, P., Luo, L., and Xia, T. (2009). Overexpression of AtNHX1, a vacuolar

Na+/H

+ Antiporter from Arabidopsis thaliana, in Petunia hybrid enhances salt

and drought tolerance. J. Plant Biol., 52, 453-461.

Xue, Z.Y., Zhi, D.Y., Xue, G.P., Zhang, H., Zhao, Y.X., and Xia, G.M. (2004).

Enhanced salt tolerance of transgenic wheat (Tritivum aestivum L.) expressing a

vacuolar Na+/H

+ antiporter gene with improved grain yields in saline soils in the

field and a reduced level of leaf Na+. Plant Sci., 167, 849-859.

Yamaguchi, T., Apse, M.P., Shi, H., and Blumwald, E. (2003). Topological analysis of a

plant vacuolar Na+/H

+ antiporter reveals a luminal C terminus that regulates

antiporter cation selectivity. Proc. Natl. Acad. Sci., 100, 12510-12515.

Yeo, A. (1998). Molecular biology of salt tolerance in the context of whole-plant

physiology. J. Exp. Bot., 49, 915-929.

Yeo, A.R., Capon, S.J.M., and Flowers, T.J. (1985). The effect of salinity upon

photosynthesis in rice (Oryza sativa L): gas exchange by individual leaves in

relation to their salt content. J. Exp. Bot., 36, 1240-1248.

Zhang, H.X., and Blumwald, E. (2001). Transgenic salt-tolerant tomato plants

accumulate salt in foliage but not in fruit. Nat. Biotechnol., 19, 765-768.

Zhang, H.X., Hodson, J.N., Williams, J.P., and Blumwald, E. (2001). Engineering salt-

tolerant Brassica plants: characterization of yield and seed oil quality in

transgenic plants with increased vacuolar sodium accumulation. Proc. Natl.

Acad. Sci., 98, 12832-12836.


76

Zhang, J.Z., Creelman, R.A., and Zhu, J.K. (2004). From laboratory to field. Using

information from Arabidopsis to engineer salt, cold, and drought tolerance in

crops. Plant Physiol., 135, 615-621.

Zhu, J. K. (2001). Plant salt tolerance. Trends in Plant Sci., 6, 66-71.

Zhu, J. K. (2000). Genetic analysis of plant salt tolerance using Arabidopsis. Plant

Physiol., 124, 941-948.

Zhu, J. K. (2002). Salt and drought stress signal transduction in plants. Annu. Rev. Plant

Biol., 53, 247-273.

Zhu, J., and Meinzer, F.C. (1999). Efficiency of C4 photosynthesis in Atriplex lentiformis

under salinity stress. Aust. J. Plant Physiol., 26, 79-86.

Zhu, J.K. (2003). Regulation of ion homeostasis under salt stress. Curr. Opin. Plant

Biol., 6, 441-445.

expression of the atnhx1 gene in peanut to increase …

Documents