escape from therapy-induced accelerated cellular...

Escape from Therapy-Induced Accelerated Cellular Senescence in

p53-Null Lung Cancer Cells and in Human Lung Cancers

Rachel S. Roberson,1Steven J. Kussick,

3Eric Vallieres,

4Szu-Yu J. Chen,

1and Daniel Y. Wu

1,2

1Division of Medical Oncology, Department of Medicine, Veterans Administration Puget Sound Health Care System, Seattle Division;2Division of Medical Oncology, Department of Medicine; 3Department of Pathology; and 4Department of Surgery,University of Washington, Seattle, Washington

Abstract

Accelerated cellular senescence (ACS) has been described fortumor cells treated with chemotherapy and radiation. Follow-ing exposure to genotoxins, tumor cells undergo terminalgrowth arrest and adopt morphologic and marker featuressuggestive of cellular senescence. ACS is elicited by a variety ofchemotherapeutic agents in the p53-null, p16-deficient humannon–small cell H1299 carcinoma cells. After 10 to 21 days,infrequent ACS cells (1 in 106) can bypass replicative arrest andreenter cell cycle. These cells express senescence markers andresemble the parental cells in their transcription profile. Weshow that these escaped H1299 cells overexpress the cyclin-dependent kinase Cdc2//Cdk1. The escape from ACS can bedisrupted by Cdc2//Cdk1 kinase inhibitors or by knockdown ofCdc2//Cdk1 with small interfering RNA and can be promoted byexpression of exogenous Cdc2//Cdk1. We also present evidencethat ACS occurs in vivo in human lung cancer followinginduction chemotherapy. Viable tumors following chemother-apy also overexpress Cdc2//Cdk1. We propose that ACS is amechanism of in vivo tumor response and that mechanismsaberrantly up-regulate Cdc2//Cdk1 promotes escape from thesenescence pathway may be involved in a subset of tumors andlikely accounts for tumor recurrence//progression. (Cancer Res2005; 65(7): 2795-803)

Introduction

A requisite for immortalization of cancer cells is the bypass ofphysiologic programs of cellular senescence. Although the senes-cence program remains incompletely understood, the telomereparadigm suggests that cellular senescence is governed by telomerelength, which progressively shortens in the replicative life span ofsomatic cells (1, 2). A pivotal element to this hypothesis is p53,postulated to mediate replicative arrest in response to a DNAdamage signal produced by a sufficiently short telomere (3, 4).Through mechanisms both dependent and independent of pRb,p16INK4A has also been shown modulate this telomere length–dependent arrest of cell division (5). In human diploid fibroblasts,the replicative arrest occurs at 60 to 80 population doublings andhas been termed mortality stage 1 (M1; ref. 6). Indeed, thereplicative life span of normal human diploid cells can be extendedbeyond this limit by the inactivation of either the p53 or the p16-pRb pathway (7–9). Immortalized cancer cells seem to bypass theM1 restriction through mutational inactivation of these pathways

or through specific targeting by viral oncoproteins (6, 10, 11).Beyond M1, as cells further divide and telomeres shorten, a secondrestriction point (M2 or crisis) is encountered, at which timeaberrant expression of telomerase or alternative telomerase-independent mechanisms of telomere lengthening enables rarecells to traverse this restriction and become immortalized (12, 13).One of these two telomere maintenance mechanisms is believed tobe operating in nearly all immortalized tumor cell lines.In response to anticancer drugs, ionizing radiation, differentiating

agents, oxidative stress, or the presence of selective oncogenicmutations, immortalized cancers cells can undergo terminal growtharrest despite having bypassed both M1 and M2 (14–16). Thistelomere-independent response, termed accelerated cellular senes-cence (ACS), is believed to overlap with the physiologic cellularsenescence program and shares with it the replicative arrestphenotype. The phenotype includes morphologic alterations,such as enlarged and flattened shape with increased cytoplasmicgranularity, presence of polyploidy, and expression of the pH-restricted, senescence-associated h-galactosidase (SA-h-gal; refs.14, 17, 18). Both physiologic cellular senescence and ACS seem to bemodulated by p53 effector pathways not restricted to p21waf1/cip1

and p16 through its regulation of pRb (19, 20). The conditionalexpression of p53, p16, or p21 alone in neoplastic cell lines results inirreversible growth arrest and senescence phenotype (21–25).Recent investigations suggest that ACS occurs in vivo (26). The

presence of SA-h-gal was reported to occur in 41% of specimensfrom breast cancer patients who received induction chemotherapybut in only 10% of specimens from patients who underwent surgerywithout chemotherapy. In transgenic murine models using Bcl-2-overexpressing lymphomas, tumor response to cyclophosphamidewas shown to correlate to the amount of senescence response, andthe response was reduced with the accumulation of either p53 orp16 mutations (27). These findings collectively suggest that ACSleading to terminal growth arrest is a physiologic mechanism ofDNA damage response occurring in cancer therapy.Given that p53 is mutated in 50% of all solid tumors (28) and that

the response in solid tumors to chemotherapy is often transient, wepostulated that p53-defective solid tumors arrested in senescencefollowing chemotherapy can circumvent ACS and again replicate.We undertook this investigation to define p53-independent path-ways that regulate ACS and mechanisms by which senescent cellsmay circumvent the ACS program and reenter replicative cell cycle.Here, we show that p53-null human lung carcinoma H1299 cellsarrest in G2-M in response to chemotherapy using the ATM/ATRDNA damage response pathways. Following arrest, f1 in 106 cellsescape replicative arrest and reenter cell cycle. These cells expresssenescence markers and resemble the parental cells in theirtranscription profile. The H1299 cells that escape senescence doso by overexpressing the cyclin-dependent kinase Cdc2/Cdk1, andthe senescence escape can be disrupted by Cdc2 inhibitors, which

Requests for reprints: Daniel Y. Wu, Division of Medical Oncology, Department ofMedicine, Veterans Administration Puget Sound Health Care System, Seattle Division,111-ONC, 1660 South Columbian Way, Seattle, WA 98108. Phone: 206-764-2709; Fax:206-764-2598; E-mail: [email protected].

I2005 American Association for Cancer Research.

www.aacrjournals.org 2795 Cancer Res 2005; 65: (7). April 1, 2005

Research Article

Research. on May 24, 2018. © 2005 American Association for Cancercancerres.aacrjournals.org Downloaded from

http://cancerres.aacrjournals.org/

results in cell death of senescence escape cells, and promoted byexpression of exogenous Cdc2. Finally, we present preliminaryevidence that senescence responses occur in lung cancer patientsreceiving neoadjuvant chemotherapy. Our results suggest thatfurther understanding of senescence escape pathways may havesignificant influence on clinical outcome.

Materials and Methods

Cell culture. H1299 cells were maintained in RPMI 1640 supplemented

with 10% fetal bovine serum and 1% penicillin/streptomycin (BioWhittaker,

Walkersville, MD). Cells were treated with chemotherapy at indicatedconcentrations at 15% to 30% cell density for 1 to 3 days, rinsed with PBS,

and harvested or allowed to recover for the indicated time in full medium

before harvest. Serum-deprived cells were plated at 1% cell density. On the

next day, the cells were rinsed in PBS and a new medium containing 0.5%fetal bovine serum was added for 7 days. Caffeine and SB202190 were

added 2 hours before addition of the camptothecin. Cells were harvested 24

or 48 hours later and fixed in paraformaldehyde. Senescence escape cells

were directly treated with pharmacologic inhibitors or transfected withsmall interfering RNA (siRNA; SMARTpool, Upstate, Charlottesville, VA)

using Effectene (Qiagen, Valencia, CA) at concentrations indicated. Alamar

blue reduction assay was carried out following the manufacturer’s protocol(Biosource, Camarillo, CA).

PKH2 staining, paraformaldehyde fixation, and cell cycle profiling.Untreated H1299 and ACS cells following camptothecin were stained with

PKH2 following Chang et al. (14) and recovered in growth medium forindicated times. Cells were then harvested, fixed in 1% paraformaldehyde,

and analyzed on Becton Dickinson (San Diego, CA) FACScan flow

cytometer. For cell cycle profiling, cells were fixed in paraformaldehyde,

stored in 70% ethanol, and stained with propidium iodide (40 Ag/mL) beforefluorescence-activated cell sorting analysis.

Quantitative in situ SA-hh-gal. In situ SA-h-gal staining was done on

indicated cells after three PBS washes and fixation in 4% paraformaldehyde

with 1.7 mg/mL of 5-bromo-4-chloro-3-indolyl-h-galactoside at pH 6.0 (17).Tumor samples were freshly frozen within 30 minutes of surgery in Tissue-

Tek cryopreservation medium, cryostat sectioned, and stained as above.

RNase protection assays and statistical analyses. RNase protectionassays (RPA) were done as per instructions for Riboquant kits (PharMingen,

San Diego, CA) using the following probe sets: hCC-1, hCC-2, hCYC-1,

hCYC-2, hTS-1, hStress-1, hApo-1b, and h-Apo-3. Five to 10 Ag RNA were

used per lane, and samples were separated on 6% Tris-borate EDTA/ureagels in 1� Tris-borate EDTA buffer. Dried gels were analyzed using the

Cyclone scanner and Optiquant software (Pakard Bioscience, Billerica, MA).

Probe signals were normalized using the internal glyceraldehyde-3-

phosphate dehydrogenase (GAPDH) and L22 controls. Paired data wereentered into an online statistical program provided by Department of

Physics, College of Saint Benedict/Saint John’s University (Collegeville, MN;

http://www.physics.csbsju.edu/stats/t-test.html).Western blot analysis. Western analyses were done on h-actin

normalized cellular proteins (40 Ag) extracted with WE16 buffer

[50 mmol/L Tris (pH 7.5), 250 mmol/L NaCl, 5 mmol/L EDTA, 0.1% SDS,

1% NP40, 1% deoxycholate, 20% glycerol] supplemented with protease(Complete Mini-EDTA free, Roche, Indianapolis, IN) and phosphatase

inhibitors (P5726, Sigma, St. Louis, MO) following the manufacturer’s

recommended concentrations. The proteins were then separated by 10%

SDS-PAGE and transferred onto Immobilon-P membranes (Millipore,Bedford, MA). Immunodetection of the proteins was carried out following

the manufacturer’s suggested antibody concentrations and 1:10,000 for

horseradish peroxidase–conjugated secondary anti-mouse or anti-rabbitantibodies (Sigma). Lysates were normalized on a Western blot using

antibodies against h-actin antibody (1:5,000, clone AC-15, Sigma) and then

p16 (50.1), Rb (IF8), chk1 (G-4), Cdc25 (c-20), Cdc2/p34 (clone 17), cyclin B1

(H-433), survivin (D-8), cyclin D1 (A12), or phosphorylated Cdc2 (Tyr15, CellSignaling Technology, Beverly, MA; all other antibodies were from Santa

Cruz Biotechnology, Santa Cruz, CA) following the manufacturer’s

recommended concentration. Blots were visualized by enhanced chemilu-minescence with the ECL Plus kit (Amersham, Piscataway, NJ) following the

manufacturer’s recommendations.

Reverse transcription-PCR. RNA was prepared from appropriately

treated cells following the manufacturer’s protocol with the RNeasy kit

(Qiagen). Quantitative reverse transcription-PCR was done by reverse

transcription with random hexamer primers (N6) using Omni-Script RT

kit (Qiagen) and amplification of gene-specific signals with Cdc2/Cdk1

or GAPDH specific primers as reported previously in presence of

[a-32P]dATP (NEN, Boston, MA; ref. 29). Sequences of Cdc2/Cdk1 primers

were 5V-Cdc2/Cdk1-RT TACAGGTCAAGTGGTAGCCATGA and 3V-Cdc2/

Cdk1-RT CCAAGTATTTCTTCAGATCCATGGA. Cdc2/Cdk1 signals were

detected with the Cyclone PhosphorImager and normalized to the GAPDH

signals.

Colony escape assay. H1299 cells were plated at 10% cell density and

treated with 30 nmol/L camptothecin on the following day. After 3 days of

drug exposure, the plates were rinsed and allowed to recover for an

additional 4 days in fresh growth medium. After 4 days, the culture medium

was replaced every 5 to 7 days with growth medium alone or with medium

containing inhibitors (olomoucine, iso-olomoucine, roscovitine, and

PNU112455A, Calbiochem, San Diego, CA) at the indicated concentrations.

Colonies were scored from triplicate plates 14 to 21 days following

chemotherapy exposure.

Cdc2//Cdk1 and DN-Cdc2//Cdk1 cloning. Cdc2/Cdk1 was generated by

PCR from cDNA with primers 5V-R1-Cdc2/Cdk1 and 3V-Pst-Cdc2/Cdk1(see primer sequences below), introducing EcoRI and PstI sites at the 5Vand 3Vends of the fragment. The PCR product was digested and inserted into

the corresponding EcoRI and PstI sites in the pSG5(Fl)2 vector. The primers

5V-BamKozac and 3V-Pst-Cdc2/Cdk1 were used in PCR to generate the Cdc2/

Cdk1 fragment with a Kozac sequence and two flag tags upstream of the 5Vstart site. This was inserted into the pCRII vector with the topo-TA cloning

kit (Invitrogen, Carlsbad, CA) and subcloned into the pcDNA3.1 vector. The

DN-Cdc2/Cdk1 was generated through PCR mutagenesis using two

oligonucleotides that overlapped the mutation (5V-DN-Cdc2/Cdk1 and 3V-DN-Cdc2/Cdk1 primers). Plasmids were transfected into H1299 cells with

Effectene and stable transformants were selected in 600 Ag/mL G418.

Primers were 5V-R1-Cdc2/Cdk1 TTGAATTCATGGAAGATTATACCAAAATA-

GAGAAA, 3V-Pst-Cdc2/Cdk1 CCCTGCAGTTAAAATATGGATGATTCAGTGC-CAT, 5V-BamKozac CGGGATCCGCCGCCACCATGGACTACAAG, 5V-DN-

Cdc2/Cdk1 TAAACTGGCTAATTTTGGCCTTG, and 3V-DN-Cdc2/Cdk1GGCAAGGGCAAAATTAGCCAG.

Frozen section immunohistochemical staining. Cryostat sections of

normal or cancerous lung tissues were fixed in cold acetone for 5 minutes,

air dried, and incubated with a nonspecific antibody, the anti-Cdc2/p34

antibody (clone 17, Santa Cruz Biotechnology), or the anti-Ki-67 antibody

(MIB-1, DakoCytomation, Carpinteria, CA) for 40 minutes at room

temperature. Blocking with nonspecific antibodies was done for selected

antibodies. After two PBS rinses, immunolocalization was done via a

modified avidin-biotin immunoperoxidase technique with nickel chloride–

enhanced 3,3V-diaminobenzidine chromogen. Finally, sections were counter-

stained with hematoxylin.Image reproduction and processing. Images of gel and digital

photographs were generated with Adobe Photoshop 7.0 and Canvas 6.

Results

Escape from replicative arrest and ACS occurs spontane-ously in H1299 cells exposed to chemotherapeutic agents.H1299 cells (�p16INK4A/+pRb/deleted-p53) were selected for thesestudies, because p53 and p16 have been shown previously asbarriers to reversibility in cellular senescence (30). We have foundthat between 5% and 90% of viable H1299 cells will assumethe senescence phenotype after a 3-day exposure to moderateddoses (1-3 � IC50) of a variety of chemotherapeutic agents:cisplatin (10-30%), camptothecin (85-90%), etoposide (40-60%),

Cancer Research

Cancer Res 2005; 65: (7). April 1, 2005 2796 www.aacrjournals.org



paclitaxel (2-5%), and vindesine (20-40%). For example, 4 daysfollowing the release of camptothecin into fresh medium, nearly90% of the remaining cells show enlarged, flattened morphology,increased cytoplasmic granularity, and expression of the replicativesenescence marker SA-h-gal (see Fig. 1A , ACS). These cells(referred here as ACS cells) do not further divide as confirmedby the retention of PKH2 fluorescence signal for 4 days followinglabeling compared with 10-fold loss of fluorescent signal inproliferating H1299 cells (Fig. 1B).Importantly, when ACS cells are followed for 18 to 24 additional

days, infrequent cells reenter the cell cycle and replicate intocolonies. We estimate that this event occurs in 1 of 106 cells basedon colony formation from a known number of ACS cell. Undermicroscopy, the majority of these colonies consist of pleomorphiccell populations, with infrequent cells reassuming the senescencemorphology (Fig. 1A , SE10 and SE12). We postulated that a subset

of these colonies derived from ACS cells that have circumventedreplicative senescence. We have termed the cells in these coloniessenescence escape cells.Senescence escape cells do not manifest primary resistance

to camptothecin and have a gene expression profile moresimilar to ACS cells than to parental cells. We firstcharacterized the sensitivity of senescence escape cells tocamptothecin in Alamar blue reduction assays and found thatthe IC50 of four independent colonies ranges between 32 and 40nmol/L, insignificantly different from an IC50 of 35 nmol/L inuntreated H1299 cells. This finding suggests that the senescenceescape cells do not represent H1299 cells with primary campto-thecin resistance. We proceeded to characterize the expression ofSA-h-gal in these senescence escape cells (Fig. 1A , SE10 and SE12).SA-h-gal, which we have observed to be restricted to ACS cells andabsent in proliferating H1299 cells or cells arrested in low serum

Figure 1. Characterization of senescence escape H1299 cells. A, light microscopy of untreated H1299 cells, ACS cells (4-day recovery following camptothecintreatment), and two senescence escape colonies cells stained with 5-bromo-4-chloro-3-indolyl-h-galactoside at pH 6.0. B, density plot of untreated H1299 cells orACS cells labeled with PKH2 followed for 4 days. Red, immediately following PKH2; blue, 4 days following PKH2. C, RPAs were carried out on total RNA from untreatedH1299 cells (H ), cells arrested in 0.5% serum (SA), cells following 1 day treatment with camptothecin (PA ), ACS cells, and cells derived from three senescenceescape colonies (SE9 , SE10 , and SE12). Protected signals against specific probes (indicated) are normalized with respect to both GAPDH and L22 signals. D, pairedStudent’s t test comparing cumulative RNA levels of 66 genes in the indicated cells with respect to those in ACS cells. Means (n) and 95% confidence intervals(bars ) of the differences. *, P < 0.05, two-tailed.

Escape from Accelerated Cellular Senescence




concentration, was found to be present in 2% to 5% of cells derivedfrom several colonies. The unexpected presence of SA-h-gal furthersupports that these senescence escape cells derived from pre-viously arrested ACS cells.We next used gene expression profiling based on quantitative

RPAs to determine whether the senescence escape cells resemblethe ACS cells. In designing these assays, we asked whether stress-responsive and cell cycle–related genes are differentiallyexpressed among the senescence escape and other H1299 cellpopulations. We selected eight sets of RPA probes targeting 66genes for this analysis (listed in Material and Methods). The RPAsignals were normalized against the GAPDH and L22 RNA levels.For each of these 66 genes, the RNA levels in three individualsenescence escape colonies (SE9, SE10, and SE12) were comparedwith the RNA levels in the following H1299-derived populations:(a) untreated cells; (b) cells arrested in low serum concentration;(c) cells following 1 day of camptothecin treatment (pulse arrest);and (d) cells arrested in ACS. The results for 8 of the 66 genes aredisplayed in Fig. 1A . The statistical analysis of these data wasdone based on paired two-tailed Student’s t test comparisonsbetween the RNA profiles of these 66 genes using an onlinestatistical program (see Materials and Methods). The geneexpression levels of ACS cells were used as standard for thesecomparisons. The results of these statistical comparisons aredepicted in Fig. 1D . The expression profiles of cells derived fromall three senescence escape colonies closely resembled the profileof ACS cells, with SE9 and SE10 reaching statistical significancebased on the 95% confidence intervals around the cumulativemean differences (P < 0.05). The expression profile of the pulse-arrested cells also resembles that of ACS cells but does not reachstatistical significance. In contrast, profiles from untreated cells(H1299) and from cells arrested in low serum medium did notresemble the profile of ACS cells. When taken together with theirACS-like morphology, their ectopic expression of SA-h-gal, andthe unaltered camptothecin IC50, the RNA expression dataprovide additional evidence that senescence escape cells origi-nated from ACS cells and infer that senescence escape cells havebypassed the terminal arrest program. Of note, the senescenceescape cells can be reinduced into ACS by camptothecin albeit tolesser extent (30-50%). They are also prone to cell death bymitotic catastrophe (data not shown).H1299 cells respond to camptothecin through a caffeine-

sensitive G2-M cell cycle arrest and up-regulate Cdc2/Cdk1protein level on escape from ACS. H1299 cells arrest at G2-M inresponse to treatment by camptothecin (Fig. 2A , left). The G2-Marrest of these cells by camptothecin is mediated by ATM/ATR asindicated by the ability of caffeine pretreatment (5 mmol/L) torelieve the camptothecin-induced G2-M cell cycle block (Fig. 2A ,right). In contrast, pretreatment of H1299 cells with the selectiveinhibitor of p38MAPK SB203580 had no effect on the G2-M arrest(data not shown).To examine the known downstream effectors of the ATM/ATR

pathway, Western blot analysis was carried out to determine thelevels of Chk1, Cdc25, Cdc2/Cdk1, and phosphorylated Cdc2/Cdk1(Y15; Fig. 2B). Chk1 and Cdc25 levels did not differ significantly inuntreated cells (lane H), low serum–arrested cells, or cells thatwere at 1, 2, or 4 days following 3 days of camptothecin treatment.Phosphorylated Cdc2/Cdk1, indicative of the inactive kinase, wasfound to be up-regulated on day 1 following camptothecin andslowly diminished over the subsequent 3 days, suggesting thatphosphorylation mediates the early inactivation of Cdc2/Cdk1. The

overall Cdc2/Cdk1 protein level eventually declined to a nadir levelin the ACS cells. In contrast to the overall levels of Cdc2/Cdk1 inACS cells, we found a significant increase in the overall levels ofCdc2/Cdk1 in senescence escape cells. This increase was observedin 4 of senescence escape colonies in an initial experiment (Fig. 2B)and in 12 of 13 colonies in a follow-up experiment (Fig. 2C). In thefollow-up experiment, Cdc2/Cdk1 was found to be 3- to 15-foldincreased in the senescence escape cells relative to the level ineither untreated H1299 or ACS cells. The Cdc2/Cdk1 kinase activitywas measured in selected clones and found to be 2.5- to 3-fold and7.5- to 9-fold higher relative to untreated H1299 and ACS cells,respectively (Fig. 2C).Cyclin B1, the principle activator of Cdc2/Cdk1 kinase, was

increased 1- to 3-fold and 2- to 6-fold in senescence escape cellscompared with untreated H1299 and ACS cells, suggesting that theobserved increase in Cdc2/Cdk1 kinase activity may also reflect thecyclin B1 level (Fig. 2D). Cyclin D1 and Cdk2 levels were notsignificantly altered in the senescence escape cells, indicating thata global increase in the cell division kinases does not occur. Finally,levels of the tumor suppressor proteins p16 and p21 remainedundetectable and unchanged in these cells (data not shown). Insummary, these results suggest that the selective overexpression ofCdc2/Cdk1 and the deregulation of the G2 damage pathway mayrepresent mechanisms through which ACS programs are bypassedin the senescence escape cells.Cdc2//Cdk1 protein overexpression is mediated by both

transcriptional and post-transcriptional processes. We pro-ceeded to determine the Cdc2/Cdk1 RNA level in these cells byquantitative reverse transcription-PCR (Fig. 3). Cdc2/Cdk1 RNAlevels were found to be 2.8- to 6.5-fold higher in the senescenceescape cells than in the ACS cells; however, they were 1- to 2.4-foldhigher than replicating H1299 cells despite much higher Cdc2/Cdk1protein levels (Fig. 2B). Northern blot and RPA analyses corroborat-ed with this result (data not shown). These findings suggest that theobserved increase of Cdc2/Cdk1 in senescence escape cells iscontrolled by both transcription and post-transcription processes.Inhibition of Cdc2//Cdk1 kinase arrests senescence escape

cells and disrupts escape of ACS cells. If the aberrant expressionof Cdc2/Cdk1 kinase enables ACS cells to bypass the G2-Mcheckpoint and to reenter the cell cycle, we postulate that theselective inhibition of Cdc2/Cdk1 kinase would cause senescenceescape cells to rearrest. To address this possibility, we treated H1299and senescence escape cells with Cdc2/Cdk1 inhibitor olomoucineand its inactive isomer iso-olomoucine (Fig. 4A-C). Forty-eight to72 hours following exposure to 100 Amol/L olomoucine, thesenescence escape cells from two independent clones (SE21 andSE26) were found to rapidly rearrest and die (Fig. 4C) from amechanism unrelated to apoptosis (data not shown; absence ofchromatin fragmentation, terminal deoxynucleotidyl transferase–mediated dUTP nick end labeling, and Annexin V stain).Morphologically, the rearrested cells detach and form cell clumpswith indistinct cytoplasmic borders (Fig. 4A , 50 and 100 Amol/L).Their cell cycle profile was difficult to characterize due toaggregation in the fluorescence-activated cell sorting analyzer. Incontrast to its effect on senescence escape cells, olomoucine at thesame concentrations induces growth retardation over at least 7 dayswithout affecting their viability (Fig. 4C). Neither H1299 norsenescence escape cells treated with iso-olomoucine exhibitedreplicative arrest or morphologic alteration. We determined thepercentage of cells that express SA-h-gal in response to thesevarious treatments 36 hours following the treatment with

Cancer Research




olomoucine when nearly 100% of cells remain viable (Fig. 4B). In situSA-h-gal assay was done by scoring 500 to 3,000 cells from six toeight consecutive microscopy fields. Olomoucine profoundlyincreased the percentage of SA-h-gal-expressing senescence escapecells while minimally altered the SA-h-gal expression in H1299 cells.Because olomoucine may also have activity against Cdk2 and

extracellular signal-regulated kinase, we also used the siRNAapproach to selectively inhibit Cdc2/Cdk1 expression (Fig. 4D). Wetransfected senescence escape cells with 100 nmol/L of a mixtureof siRNA directed against either the bacterial h-gal (LacZ) or theCdc2/Cdk1 RNA. Forty-eight hours following transfection, senes-cence escape cells transfected with Cdc2/Cdk1-siRNA, but not withLacZ-siRNA, were found to exhibit the same morphologicalteration as olomoucine-treated senescence escape cells. Thisresult confirms the selective effect of Cdc2/Cdk1 inhibition in cellsthat have bypassed ACS.Senescence escape cells can be reinduced into ACS with

camptothecin. To examine if reinduced senescence can bepromoted by the down-regulation of Cdc2/Cdk1, we transfected

cells from two independent senescence escape colonies with Cdc2/Cdk1-siRNA and LacZ-siRNA. Thirty-six hours following transfec-tion, the cells were treated with camptothecin for 3 days and scoredfor both viability and SA-h-gal expression following 4-day recovery(Fig. 4E ). The protein level of Cdc2/Cdk1 was determined

Figure 2. Mechanism of H1299 arrest by camptothecin and escape from ACS. A, cell cycle profile of untreated H1299 cells (H1299) or cells 48 hours followingtreatment with 60 nmol/L camptothecin (Campto ), 5 mmol/L caffeine, or a combination of camptothecin and caffeine. B, Western blot analysis of indicated proteinexpression in untreated cells, cells arrested in 0.5% serum, cells 1 or 2 days following camptothecin (1d or 2d), ACS cells, and four independent senescenceescape colonies (7 , 9 , 10 , and 12). Similar levels of h-actin immunoreactivity indicate similar amounts of protein loaded in each lane. C, Cdc2/Cdk1 protein expressionand kinase activity (bottom of each lane ) in untreated cells, ACS cells, and 13 unselected senescence escape colonies. D, levels of cyclin B1, cyclin D1, andCdk2 in untreated cells, 1 day pulse-treated cells (P), ACS cells, and senescence escape colonies (7 , 9 , 10 , and 12).

Figure 3. Quantitative reverse transcription-PCR of Cdc2/Cdk1 RNA level inuntreated H1299 cells, ACS cells, and senescence escape colonies 7, 9, 10, 12,and 21.





immediately before camptothecin and was found to be knockeddown specifically by Cdc2/Cdk1-siRNA in a concentration-dependent manner (bottom). Both percentages of viable and SA-h-gal expression cells were found to be similarly reduced 4 daysfollowing chemotherapy recovery. At 100 nmol/L Cdc2/Cdk1-siRNA, phenotypically viable ACS cells were rarely found. LacZ-siRNA had no effect on the viability or the SA-h-gal or proteinexpression of the senescence escape cells. These results suggest thatthe senescence escape cells depend on the activity of Cdc2/Cdk1 forviability and that down-regulation of Cdc2/Cdk1 does not promotetherapy-induced senescence but rather elicits cell death.Activities of Cdc2//Cdk1 modulate escape from ACS. We also

hypothesized that escape from ACS could be modulated bymanipulation of Cdc2/Cdk1 activity or level. To examine thepossibility that inhibition of Cdc2/Cdk1 in senescent cells coulddisrupt escape from the terminal arrest, we exposed camptothecin-treated cells to various pharmacologic compounds 4 days followingtheir release into unmodified medium. The number of senescence

escape colonies was quantified (Fig. 5A) and expressed as a percent-age of colonies formed in camptothecin-treated cells receiving noother drugs. Concentration-dependent reduction of senescenceescape colony formation was observed with Cdc2/Cdk1 inhibitors,olomoucine and roscovitine, but not with DMSO, iso-olomoucine,and PNU112455A, a selective inhibitor of Cdk2/Cdk5. The resultshere confirm that inhibitors of Cdc2/Cdk1 could disrupt escape fromthe ACS program triggered by chemotherapy likely throughmediating cell death in senescence escape cells (Fig. 4C and E).We further examined the effect of ectopic expression of Cdc2/

Cdk1 on senescence escape colony formation. We isolated H1299cells stably transfected with blank plasmids or plasmids encodingeither FLAG-tagged Cdc2/Cdk1 or kinase-defective (DN) Cdc2/Cdk1 mutant (D146N). Antibiotic-resistant cells were characterizedfor their Cdc2/Cdk1 expression and tested for colony formationfollowing camptothecin treatment (Fig. 5B). Ectopic Cdc2/Cdk1overexpression promoted colony formation by f50% in threeindependent experiments. The expression of D146N Cdc2/Cdk1,

Figure 4. Rearrest of senescenceescape cells in the presence of Cdc2/Cdk1inhibitor olomoucine or transfected withsiRNA. A, representative morphologyof H1299 cells and cells from twosenescence escape colonies treatedwith 100 Amol/L iso-olomoucine (Iso-Olo )or 50 or 100 Amol/L olomoucine (Olo)for 48 hours. B, percentages ofSA-h-gal-expressing cells amongparental H1299 cells and fiveindependent senescence escapecolonies treated with DMSO (the diluentfor iso-olomoucine and olomoucine), 100Amol/L iso-olomoucine, or 50 or 100 Amol/Lolomoucine. C, viability cell countof H1299 (5 and n), SE21 (o and .),and SE26 (4 and E) cells untreated(5, o, and 4) or following treatmentwith 100 Amol/L olomoucine (n, ., and E).Cells (1 � 105) were plated per plateand followed for 7 days. D, morphologyof untransfected senescence escapecells (untreated) or transfected with100 nmol/L siRNA against either LacZor Cdc2/Cdk1 sequences. Transfectionsof two independent senescence escapeclones with siRNA against Cdc2/Cdk1.E, effect of transfected siRNA againstCdc2/Cdk1 or LacZ on the viability andSA-h-gal expression after 4 days ofrecovery from camptothecin treatment.Percentages of total cells plated beforesiRNA transfection. Camptothecin (30nmol/L) is added 36 hours following siRNAtransfection. Bottom, protein levelsof Cdc2/Cdk1 and h-actin in siRNAtransfected SE27 and SE30 cellsimmediately before siRNA transfection.

Cancer Research




which is consistently lower in the stable transformed cells, modestlyreduced the colony formation by f25%. Olomoucine effectivelydisrupted escape from ACS of all H1299 transformants.ACS occurs in vivo in patients treated with chemotherapy.

We undertook a preliminary pathologic investigation to determinewhether ACS occurs in non–small cell lung cancer patientsreceiving chemotherapy. Six patients were enrolled in SouthwestOncology Group Study 9900 and randomized either to receivethree cycles of neoadjuvant chemotherapy carboplatin and taxolbefore surgery or to undergo surgery alone without prior therapy.We collected matched normal lung and tumor specimens at thetime of surgery. The samples were freshly frozen and analyzed forthe expression of SA-h-gal and Cdc2/Cdk1. The immunohistologyof samples from a patient receiving chemotherapy and a patientwho underwent surgery alone is shown in Fig. 6. A summary ofclinical variables, outcome, and expression of SA-h-gal ispresented in Table 1.We have found that samples from two of three patients treated

with neoadjuvant chemotherapy intensely expressed SA-h-gal. Noneof the three samples from untreated patients or normal lungspecimens significantly expressed the enzyme. Rare scattered h-gal-positive cells were detectable in normal lung in both patient groups.One single treated patient (patient 1) achieved complete clinicalremission at the time of surgery and his specimen did not contain

tumor. We also tested for the expression of Cdc2/Cdk1 in a subset ofthese samples (see Fig. 6). Interestingly, nuclear Cdc2/Cdk1 stainwas significantly elevated in tumor cells relative to their normal lungcells in patients 2 and 3 (patient 2 shown). In both of these patients,the tumors have reduced mildly in size following chemotherapy andthe cancer cells can be assumed to be growth arrested. In twountreated patients (patient 5 shown), the Cdc2/Cdk1 expression wasmainly confined to the basal epithelial layer of the tumor specimenwhere the cells are proliferating rapidly and not in all cell layers ofthe tumor. In general, we have observed a correlation between theexpression of Cdc2/Cdk1 expression pattern and that of Ki-67expression pattern (data not shown), suggesting that Cdc2/Cdk1-expressing cells are resuming cell proliferation. Although this studyis preliminary, it shows that ACS is an in vivo response tochemotherapy in lung cancer.

Discussion

ACS is induced in H1299 cells despite the absence of p53 andp16, the primary modulators of physiologic and therapy-relatedsenescence. An abbreviated exposure to a moderate dose ofcamptothecin arrests H1299 cells at G2-M through biphasicregulation of Cdc2/Cdk1, initially a transient inhibitory phosphor-ylation within the first 2 days and then a more sustained reductionof its mRNA and protein (Figs. 2 and 3). Recently, intact p53 functionwas found to be necessary for topoisomerase I–induced G2-M arrestand ACS in immortalized and primary glioblastoma cell lines (31).In this study, arrest and senescence was restricted to cells withintact p53, where Cdc2/Cdk1 regulation in the first 7 days seems tobe biphasic as well. Apoptosis was the dominant response when p53was inactivated either through E6 expression or by mutation. In thep53-dysfunctional cells, Cdc2/Cdk1 regulation was primarilymediated through sustained inhibitory phosphorylation, whereasCdc2/Cdk1 protein remained at a relatively constant level. Insenescent fibroblasts and in doxorubicin-arrested HCT116 cells,reduction of Cdc2/Cdk1 by both transcription and proteinregulation has also been observed (32, 33). These studies raise thepossibility that sustained down-regulation of Cdc2/Cdk1 proteinlevel may be required for prolonged cell cycle arrest and possibly forthe senescence response. In contrast to the study discussed above,our finding here suggests that p53 is not the sole determinant forprolonged cell cycle arrest in lung cancer cells and that other p53-independent mechanisms can mediate ACS through Cdc2/Cdk1. Inthe glioblastoma model, it is noteworthy that therapy-inducedarrest was also reversible despite the presence of p53, suggestingthat p53 does not irreversibly reenforce ACS.This and other studies show that prolonged cell cycle arrest and

ACS can be reversible for a subset of cells (31). In our system, ACScells can escape through up-regulation of Cdc2/Cdk1. Remarkably,our data suggest that the senescence escape cells are uniquelydependent on the Cdc2/Cdk1 kinase activity, such that selectiveinhibition of the Cdc2/Cdk1 kinase by pharmacologic inhibitors orthrough siRNA knockdown results in cell death, hence reducingescape. These effects were not observed in untreated H1299 cells.We therefore postulate the presence of survival mechanisms thatmay be directly coupled to Cdc2/Cdk1 such that these survivalpathways enable rare ACS cells to remain viable and escape. Assuch, in senescence escape cells, elevated Cdc2/Cdk1 activates thesesurvival mechanisms and the inhibition of Cdc2/Cdk1 results in celldeath. One candidate of this mechanism is the survival checkpointmediated by survivin, known to be regulated by Cdc2/Cdk1 through

Figure 5. Cdc2/Cdk1 activity and level modulates escape from ACS. A, effect ofvarious concentrations of DMSO, iso-olomoucine, olomoucine, PNU112455A(PNU ), and roscovitine on escape colony formation. Percentage of coloniesformed by H1299 cells following camptothecin treatment in the absence of anypharmacologic agent (C ) from triplicate plates. B, H1299 cells stably transfectedwith vector alone (V), Cdc2/Cdk1, or D146N-Cdc2/Cdk1 expression vectorswere assayed for their ability to form senescence escape colonies followingcamptothecin treatment in the presence of DMSO, 100 Amol/L iso-olomoucine,or olomoucine. Percentages of colonies formed by H1299 cells followingcamptothecin treatment in the presence of DMSO (C ) from triplicate plates.





phosphorylation (34, 35). Survivin, a homologue of the baculovirusinhibitor of apoptosis, is overexpressed in many human cancers(36) and survivin interferes with caspase-9-dependent apoptosisat mitosis (34). Another candidate is the phosphatidylinositol 3V-kinase/AKT pathway, which regulates cyclin B1 expression andCdc2/Cdk1 activation (37). The phosphatidylinositol 3V-kinase/AKTactivation has been shown to mediate cell proliferation and survival(38). Geranylgeranyltransferase I inhibitors, currently being studiedin human cancer, has been shown recently to target both phospha-tidylinositol 3V-kinase/AKTand survivin pathways as possible mech-anisms of its proapoptotic activity (39).Defects in cell cycle regulatory proteins have been shown to be a

frequent feature of human cancers. Rearrangement, amplification,and overexpression of cyclin D1, E, or A occur in both hematopoieticand somatic cancers (40). Elevated expression of Cdc2/Cdk1 variablycorrelating to cyclin B1 has been reported in nodal non-Hodgkin’slymphomas, primary colorectal cancer, thyroid carcinomas, malig-

nant breast lesions, and transformingHelicobacter pylori–associatedmucosal lymphomas (41–45). The induction of Cdc2/Cdk1 may alsobe associated with therapy resistance (44). In a recent study, theinactivation of Cdc2/Cdk1 kinase was shown to be a requisite forp53-mediated G2-M arrest in EJ bladder carcinoma cells (46). Theoverexpression of a constitutively activated Cdc2/Cdk1 kinase couldoverride the p53-mediated effect. In our ACS model, the over-expression of wild-type Cdc2/Cdk1 kinase, but not the dominant-negative kinase, promotes escape from ACS in H1299 cells (Fig. 5B),suggesting that deregulated Cdc2/Cdk1 activity may confer asurvival advantage to cancer cells by permitting the traversal ofthe senescence checkpoint. The absence of p16 in our system mayalso contribute to escape from ACS, because p16 is a dominantsecond barrier to the reversibility of cellular senescence in humanfibroblast (30). In the glioblastoma cell lines, however, p16 status wasfound to be neither necessary nor sufficient for initiation and/ormaintenance of topoisomerase I–induced ACS (31).

Figure 6. Immunohistology of matched normal andtumor samples from patients with lung cancertreated with either neoadjuvant chemotherapy beforesurgery (patient 2) or surgery alone (patient 5).H&E, SA-h-gal, and anti-Cdc2/Cdk1 antibody stainswere all done on frozen sections. Cdc2/Cdk1expression (brown immunoreactivity).

Table 1. Clinical parameters and outcome of patient who underwent neoadjuvant chemotherapy prior to surgery versussurgery alone

Patient no. TMN staging Neoadjuvant therapy Tumor pathology SA-h-gal Follow-up

Lung Tumor

1 T2N0M0 Carboplatin/taxol � 3 Complete response +/� NA No evidence of disease/18 mo2 T3N1M0 Carboplatin/taxol � 3 Viable tumor +/� ++++ Deceased/recurrent disease/14 mo

3 T3N0M0 Carboplatin/taxol � 3 Viable tumor +/� +++ No evidence of disease/11 mo

4 T3N0M0 None Viable tumor � � No evidence of disease/16 mo5 T2N0M0 None Viable tumor +/� +/� No evidence of disease/13 mo

6 T2N0M0 None Viable tumor � � No evidence of disease/11 mo

NOTE: +/�, scant/spotty positive.

Cancer Research




The demonstration of the senescence marker SA-h-gal in treatedbreast cancers (26) and lung cancers (Fig. 6) implies that therapy-induced ACS is an in vivo mechanism of treatment response.Although its clinical significance remains to be understood, themodel of tumor growth arrest via ACS following therapy correlateswell with the clinical sequelae of chemotherapy treatment for solidtumors. For most somatic cancers, induction chemotherapywithout concurrent radiation produces a 20% to 40% diseaseresponse rate, with >95% of these responses being partial tumorvolume reduction (47, 48). For lung cancers, chemotherapy typicallyresults in mild to moderate reduction in tumor volume with initialtreatments before the tumor progression despite further therapy.We propose that growth arrest as a result of ACS accounts for thepartial tumor response due to therapy. Clinical progression isencountered when a subset of the tumor cells are able to bypass the

ACS program. Inhibitors of Cdc2/Cdk1 are presently being studiedin the preclinical and clinical settings as antitumor agents (49, 50).The present study suggests that these agents need to be used insequence with conventional chemotherapy agents or as amaintenance therapy. Further understanding of mechanisms ofACS and escape mechanisms will lead to novel targets foranticancer therapy.

Acknowledgments

Received 4/12/2004; revised 1/7/2005; accepted 1/16/2005.Grant support: Department of Veterans Affairs (VA Merit Review) and NIH grant

K08CA71928 (D.Y. Wu).The costs of publication of this article were defrayed in part by the payment of page

charges. This article must therefore be hereby marked advertisement in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.

References1. Harley CB, Futcher AB, Greider CW. Telomeresshorten during ageing of human fibroblasts. Nature1990;345:458–60.

2. Harley CB. Telomere loss: mitotic clock or genetic timebomb? Mutat Res 1991;256:271–82.

3. Vaziri H, West MD, Allsopp RC, et al. ATM-dependenttelomere loss in aging human diploid fibroblasts andDNA damage lead to the post-translational activation ofp53 protein involving poly(ADP-ribose) polymerase.EMBO J 1997;16:6018–33.

4. Chin L, Artandi SE, Shen Q, et al. p53 deficiencyrescues the adverse effects of telomere loss andcooperates with telomere dysfunction to acceleratecarcinogenesis. Cell 1999;97:527–38.

5. Kiyono T, Foster SA, Koop JI, et al. Both Rb/p16INK4A

inactivation and telomerase activity are required toimmortalize human epithelial cells. Nature 1998;396:84–8.

6. Wright WE, Pereira-Smith OM, Shay JW. Reversiblecellular senescence: implications for immortalization ofnormal human diploid fibroblasts. Mol Cell Biol 1989;9:3088–92.

7. Bond JA, Wyllie FS, Wynford-Thomas D. Escape fromsenescence in human diploid fibroblasts induceddirectly by mutant p53. Oncogene 1994;9:1885–9.

8. Rogan EM, Bryan TM, Hukku B, et al. Alterations inp53 and p16INK4 expression and telomere lengthduring spontaneous immortalization of Li-Fraumenisyndrome fibroblasts. Mol Cell Biol 1995;15:4745–53.

9. Wei W, Herbig U, Wei S, Dutriaux A, Sedivy JM. Loss ofretinoblastoma but not p16 function allows bypass ofreplicative senescence in human fibroblasts. EMBO Rep2003;4:1061–6.

10. Shay JW, Pereira-Smith OM, Wright WE. A role forboth RB and p53 in the regulation of human cellularsenescence. Exp Cell Res 1991;196:33–9.

11. Bond JA, Haughton MF, Rowson JM, et al. Control ofreplicative life span in human cells: barriers to clonalexpansion intermediate between M1 senescence andM2 crisis. Mol Cell Biol 1999;19:3103–14.

12. Kim NW, Piatyszek MA, Prowse KR, et al. Specificassociation of human telomerase activity with immortalcells and cancer. Science 1994;266:2011–5.

13. Bryan TM, Englezou A, Dalla-Pozza L, Dunham MA,Reddel RR. Evidence for an alternative mechanism formaintaining telomere length in human tumors andtumor-derived cell lines. Nat Med 1997;3:1271–4.

14. Chang BD, Broude EV, Dokmanovic M, et al.A senescence-like phenotype distinguishes tumor cellsthat undergo terminal proliferation arrest after expo-sure to anticancer agents. Cancer Res 1999;59:3761–7.

15. Roninson IB. Tumor cell senescence in cancertreatment. Cancer Res 2003;63:2705–15.

16. Groth A, Weber JD, Willumsen BM, Sherr CJ, RousselMF. Oncogenic Ras induces p19ARF and growth arrestin mouse embryo fibroblasts lacking p21Cip1 and p27Kip1

without activating cyclin D-dependent kinases. J BiolChem 2000;275:27473–80.

17. Dimri GP, Lee X, Basile G, et al. A biomarker thatidentifies senescent human cells in culture and in agingskin in vivo . Proc Natl Acad Sci U S A 1995;92:9363–7.

18. Campisi J. Cellular senescence as a tumor-suppressormechanism. Trends Cell Biol 2001;11:S27–31.

19. Chang BD, Xuan Y, Broude EV, et al. Role of p53 andp21waf1/cip1 in senescence-like terminal proliferationarrest induced in human tumor cells by chemothera-peutic drugs. Oncogene 1999;18:4808–18.

20. Elmore LW, Rehder CW, Di X, et al. Adriamycin-induced senescence in breast tumor cells involvesfunctional p53 and telomere dysfunction. J Biol Chem2002;277:35509–15.

21. Sugrue MM, Shin DY, Lee SW, Aaronson SA. Wild-type p53 triggers a rapid senescence program in humantumor cells lacking functional p53. Proc Natl Acad SciU S A 1997;94:9648–53.

22. Wang Y, Blandino G, Oren M, Givol D. Induced p53expression in lung cancer cell line promotes cellsenescence and differentially modifies the cytotoxicityof anti-cancer drugs. Oncogene 1998;17:1923–30.

23. Wang Y, Blandino G, Givol D. Induced p21waf

expression in H1299 cell line promotes cell senescenceand protects against cytotoxic effect of radiation anddoxorubicin. Oncogene 1999;18:2643–9.

24. Fang L, Igarashi M, Leung J, et al. p21Waf1/Cip1/Sdi1

induces permanent growth arrest with markers ofreplicative senescence in human tumor cells lackingfunctional p53. Oncogene 1999;18:2789–97.

25. Dai CY, Enders GH. p16INK4A can initiate an autono-mous senescence program. Oncogene 2000;19:1613–22.

26. te Poele RH, Okorokov AL, Jardine L, Cummings J,Joel SP. DNA damage is able to induce senescence intumor cells in vitro and in vivo . Cancer Res 2002;62:1876–83.

27. Schmitt CA, Fridman JS, Yang M, et al. A senescenceprogram controlled by p53 and p16INK4A contributes tothe outcome of cancer therapy. Cell 2002;109:335–46.

28. Hollstein M, Sidransky D, Vogelstein B, Harris CC. p53mutations in human cancers. Science 1991;253:49–53.

29. Nakamura Y, Tokino T. PCR primers for detectinghuman GAPDH. Gen Bank E14134 and E14235, 1997.

30. Beausejour CM, Krtolica A, Galimi F, et al. Reversal ofhuman cellular senescence: roles of the p53 and p16pathways. EMBO J 2003;22:4212–22.

31. Wang Y, Zhu S, Cloughesy TF, Liau LM, Mischel PS.p53 disruption profoundly alters the response of humanglioblastoma cells to DNA topoisomerase I inhibition.Oncogene 2004;23:1283–90.

32. Chang BD, Swift ME, Shen M, et al. Moleculardeterminants of terminal growth arrest induced intumor cells by a chemotherapeutic agent. Proc NatlAcad Sci U S A 2002;99:389–94.

33. Richter KH, Afshari CA, Annab LA, et al. Down-regulation of cdc2 in senescent human and hamstercells. Cancer Res 1991;51:6010–3.

34. O’Connor DS, Grossman D, Plescia J, et al. Regulationof apoptosis at cell division by p34cdc2 phosphorylationof survivin. Proc Natl Acad Sci U S A 2000;97:13103–7.

35. O’Connor DS, Wall NR, Porter AC, Altieri DC. Ap34(cdc2) survival checkpoint in cancer. Cancer Cell2002;2:43–54.

36. Altieri DC. Survivin, versatile modulation of celldivision and apoptosis in cancer. Oncogene 2003;22:8581–9.

37. Roberts EC, Shapiro PS, Nahreini TS, et al. Distinctcell cycle timing requirements for extracellular signal-regulated kinase and phosphoinositide 3-kinase signal-ing pathways in somatic cell mitosis. Mol Cell Biol2002;22:7226–41.

38. Osaki M, Oshimura M, Ito H. PI3K-Akt pathway: itsfunctions and alterations in human cancer. Apoptosis2004;9:667–76.

39. Dan HC, Jiang K, Coppola D, et al. Phosphatidylino-sitol-3-OH kinase/AKT and survivin pathways as criticaltargets for geranylgeranyltransferase I inhibitor-inducedapoptosis. Oncogene 2004;23:706–15.

40. Vermeulen K, Van Bockstaele DR, Berneman ZN. Thecell cycle: a review of regulation, deregulation andtherapeutic targets in cancer. Cell Prolif 2003;36:131–49.

41. Kawamoto H, Koizumi H, Uchikoshi T. Expression ofthe G2-M checkpoint regulators cyclin B1 and cdc2 innonmalignant and malignant human breast lesions:immunocytochemical and quantitative image analyses.Am J Pathol 1997;150:15–23.

42. Kim JH, Kang MJ, Park CU, et al. Amplified CDK2 andcdc2 activities in primary colorectal carcinoma. Cancer1999;85:546–53.

43. Ito Y, Yoshida H, Nakano K, et al. Expression of G2-Mmodulators in thyroid neoplasms: correlation of cyclinA, B1 and cdc2 with differentiation. Pathol Res Pract2002;198:397–402.

44. Jin YH, Park CK. Expression of cyclin B1 and cdc2 innodal non-Hodgkin’s lymphoma and its prognosticimplications. J Korean Med Sci 2002;17:322–7.

45. Banerjee SK, Weston AP, Zoubine MN, Campbell DR,Cherian R. Expression of cdc2 and cyclin B1 inHelicobacter pylori -associated gastric MALT and MALTlymphoma: relationship to cell death, proliferation, andtransformation. Am J Pathol 2000;156:217–25.

46. Park M, Chae HD, Yun J, et al. Constitutive activationof cyclin B1-associated cdc2 kinase overrides p53-mediated G2-M arrest. Cancer Res 2000;60:542–5.

47. Bunn PA Jr. Chemotherapy for advanced non-small-cell lung cancer: who, what, when, why? J Clin Oncol2002;20:23–33S.

48. Van Cutsem E, Haller D, Ohtsu A. The role ofchemotherapy in the current treatment of gastriccancer. Gastric Cancer 2002;5 Suppl 1:17–22.

49. Bloom J, Pagano M. Butyrolactone: more than akinase inhibitor? Cell Cycle 2002;1:117–8.

50. Fischer PM, Gianella-Borradori A. CDK inhibitors inclinical development for the treatment of cancer.Expert Opin Investig Drugs 2003;12:955–70.





2005;65:2795-2803. Cancer Res Rachel S. Roberson, Steven J. Kussick, Eric Vallieres, et al. Lung CancersSenescence in p53-Null Lung Cancer Cells and in Human Escape from Therapy-Induced Accelerated Cellular

Updated version

http://cancerres.aacrjournals.org/content/65/7/2795

Access the most recent version of this article at:

Cited articles

http://cancerres.aacrjournals.org/content/65/7/2795.full#ref-list-1

This article cites 48 articles, 20 of which you can access for free at:

Citing articles

http://cancerres.aacrjournals.org/content/65/7/2795.full#related-urls

This article has been cited by 16 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. (CCC)Click on "Request Permissions" which will take you to the Copyright Clearance Center's

.http://cancerres.aacrjournals.org/content/65/7/2795To request permission to re-use all or part of this article, use this link



http://cancerres.aacrjournals.org/content/65/7/2795.full#ref-list-1

http://cancerres.aacrjournals.org/content/65/7/2795.full#related-urls

http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]



escape from therapy-induced accelerated cellular...

Documents