Virus Research 98 (2003) 105–116

Establishment and characterisation of two cDNA-derived strains ofclassical swine fever virus, one highly virulent and one avirulent

Daniel Mayer, Travis M. Thayer, Martin A. Hofmann, Jon-Duri Tratschin∗

Institute of Virology and Immunoprophylaxis, CH-3147 Mittelhäusern, Switzerland

Received 18 April 2003; received in revised form 30 July 2003; accepted 12 August 2003

Abstract

The virulence of classical swine fever virus (CSFV) strains including established laboratory strains as well as field isolates ranges fromavirulent to highly virulent. Here, we describe the construction and characterisation of two cDNA-derived CSFV strains, each correspondingto one of these extremes. The recombinant virus vEy-37 caused acute disease indistinguishable from that provoked by infection with thehighly virulent parent strain Eystrup. In contrast, vRiems-3, a molecular clone of the CSFV vaccine strain Riems, was avirulent and inducedprotective immunity in pigs. After repeated passage of vEy-37 in porcine kidney SK-6 cells adaptive mutations in the Erns gene were observed.The respective reconstructed mutant virus grew to titres that were almost 4 log units higher when compared to vEy-37. The mutation in theErns gene had only a minor effect on the virulence of the virus.

The complete genomic sequences of the two CSFV strains, Eystrup and Riems, have been deposited in GenBank (accession numberAF326963 for CSFV Eystrup, AY259122 for CSFV Riems/IVI).© 2003 Elsevier B.V. All rights reserved.

Keywords:Classical swine fever virus; Molecular clone; Virulence

1. Introduction

Classical swine fever virus (CSFV) is the etiological agentof a highly contagious disease of pigs. Together with bovineviral diarrhoea virus and border disease virus CSFV be-longs to the genusPestiviruswithin the family Flaviviridae.The other two genera of the family areFlavivirus andHep-acivirus (van Regenmortel et al., 2000).

The virulence of CSFV including established laboratorystrains as well as field isolates ranges from completely aviru-lent to highly virulent in a continuous spectrum.van Oirschot(1988)proposed a classification into avirulent, low virulent,moderately virulent, and highly virulent strains. Avirulentstrains are completely non-pathogenic but induce a protec-tive immunity, whereas highly virulent strains cause acutedisease resulting in 100% mortality within less than 10 days,irrespective of age and weight of the infected pigs. CSFV

∗ Corresponding author. Tel.:+41-31-8489211; fax:+41-31-8489222.E-mail addresses:daniel.mayer@gmx.ch (D. Mayer),

travis.thayer@ivi.admin.ch (T.M. Thayer), martin.hofmann@ivi.admin.ch(M.A. Hofmann), jon-duri.tratschin@ivi.admin.ch (J.-D. Tratschin).

strains classified as virulent or moderately virulent gener-ally cause subacute or chronic disease. The acute form ofclassical swine fever (CSF) is a haemorrhagic disease withan incubation period of 3–5 days which is characterised byleukopenia, constipation followed by diarrhoea, petechialhaemorrhages, skin cyanosis and neurological symptoms(Mittelholzer et al., 2000; Moennig, 2000). In subacute andchronic forms of CSF similar but milder symptoms are ob-served (van Oirschot, 1994). We have proposed a classifi-cation of virulence based on body temperature and clini-cal score in experimentally infected specified pathogen-free(SPF) pigs. To determine the clinical score a system was es-tablished which accounts for 10 typical symptoms of CSF(Mittelholzer et al., 2000).

The genetic determinants responsible for the varying vir-ulence in CSFV remain to be determined. Comparison ofstrains at the level of the genomic nucleotide sequence didnot reveal a correlation between virulence and primary se-quence. Multiple duplications of uridine nucleotides in the3′ nontranslated region (NTR) of the genome of several lap-inized CSFV strains also do not correlate with virulencesince other vaccine strains lack such insertions (Bjorklund

0168-1702/$ – see front matter © 2003 Elsevier B.V. All rights reserved.doi:10.1016/j.virusres.2003.08.020

106 D. Mayer et al. / Virus Research 98 (2003) 105–116

et al., 1998). Attenuation of CSFV by site-directed mutage-nesis of cloned viral cDNA has been obtained in at least twocases. By mutagenesis of the active site of the RNAse resid-ing in the viral glycoprotein Erns Meyers et al. (1999)gener-ated mutant CSFV that was fully competent for replication incell culture. This virus was avirulent and induced protectiveimmunity in pigs. Similarly, we have shown that mutants ofthe moderately virulent strain Alfort/187 as well as of thehighly virulent strain Eystrup which lacked the Npro genereplicated in cell culture to similar titres as the parent virusbut were avirulent in pigs. Virulence was rescued by rein-troduction of the Npro gene derived from an avirulent strain.Thus, the presence but not the origin of Npro was critical forvirulence (Mayer et al., 2003), indicating that Npro is notresponsible for the varying virulence between CSFV strainsbut has a function in the induction of CSF in pigs. This is fur-ther corroborated by the finding that CSFV Npro deletion mu-tants, as opposed to the respective wild type viruses, inducedtype I interferon (IFN) in porcine macrophages (Ruggli et al.,2003).

Hulst et al. (2000)have studied adaptive mutations in theErns gene occurring by cell culture passage of the highly vir-ulent CSFV strain Brescia. The virus mutants grew to highertitres in swine kidney SK-6 cells and acquired the capac-ity to attach to the surface of these cells by Erns-mediatedinteraction with heparan sulphate molecules on the cell sur-face. The altered phenotype was the result of a change ofa Ser to an Arg residue in the C-terminal part of Erns.As cell culture-selected mutants of foot-and-mouth diseasevirus and of Sindbis virus that are able to bind to heparansulphate have been reported to be attenuated (Sa-Carvalhoet al., 1997; Klimstra et al., 1998), it was assumed that therespective CSFV mutants might also be attenuated. How-ever, introduction of the respective Ser to Arg mutationinto the Erns protein of a virulent Brescia clone did notreduce the virulence of the respective virus (Hulst et al.,2001).

It has also been proposed that in addition to genetic de-terminants the outcome of CSF might depend on other fac-tors (Dahle and Liess, 1995). Thus, age and health statusof the individual pig, the route of infection, the presenceof other pestiviruses in the inoculum, and its origin (beingeither virus obtained directly from diseased animals or bycell culture passage) could play a role. Finally, breed-relatedfactors have been suggested to influence the severity of CSF(Depner et al., 1997). In our hands, highly virulent CSFVssuch as strains Eystrup or Koslov always cause lethal CSFwithin 8–10 days when SPF pigs of approximately 30 kgbodyweight were infected (Mittelholzer et al., 2000).

The cDNA-derived CSFV described so far range in theirvirulence from avirulent (Moormann et al., 1996; Hulst et al.,2000) to virulent (Meyers et al., 1996; Ruggli et al., 1996;Hulst et al., 2001). However, a recombinant CSFV strain,which is able to kill experimentally infected pigs withinless than 10 days and, therefore, can be classified as highlyvirulent, has not been reported yet.

Here, we describe the construction and characterisationof cDNA clones of the highly virulent CSFV strain Eystrupand of the avirulent vaccine strain Riems/IVI. We show thatboth recombinant viruses maintain their respective pheno-type after infection of pigs. These clones will serve as a viruspair for detection and analysis of genetically determined vir-ulence factors in CSFV.

2. Material and methods

2.1. Cells

The swine kidney cell line SK-6 (Kasza et al., 1972),kindly provided by M. Pensaert (Faculty of VeterinaryMedicine, Ghent, Belgium), was grown in minimal essen-tial medium (Gibco) containing Earle’s salts (EMEM) and7% horse serum (Gibco). To obtain foetal swine nasal ep-ithelial (FSNE) cells nasal epithelial tissue excised fromSPF foetuses was treated with 1.2 U/ml dispase II (Roche)in phosphate buffered saline, pH 7.2 (PBS). After treatmentfor 30 min to 1 h the individualised cells were seeded at aconcentration of 2×105 cells/ml in EMEM/7% horse serum.Low passages of FSNE cells were used for subsequent exper-iments. Monocyte-derived macrophages (M�) were isolatedfrom peripheral blood mononuclear cells of SPF pigs byculturing monocytes at 4×106 cells/ml for 2 h in Dulbecco’smodified Eagle medium (DMEM), 10% (v/v) porcineserum, 2 mMl-glutamine and 25 mM HEPES as described(Knoetig et al., 1999). The adherent cells were washed oncewith PBS and cultured in the above medium for at least72 h to allow differentiation into M� (McCullough et al.,1999).

2.2. Viruses

CSFV strain Riems, provided by G. Schirrmeier, RiemserArzneimittel GmbH, Insel Riems, Germany, was passagedonce in SK-6 cells. It is referred to as Riems/IVI in the fol-lowing to differentiate from another Riems strain (referredto as Riems/Giessen) for which the sequence has been de-posited (GenBank accession number U45477). CSFV strainEystrup contained in the serum of an experimentally infectedpig and obtained from H.-J. Thiel, Justus-Liebig-Universität,Giessen, Germany, was passaged three times in SK-6 cells.

2.3. RNA extraction, reverse transcription and PCR

Viral RNA was obtained by Trizol (Invitrogen) ex-traction of cells infected with the respective viruses andreverse-transcribed using Expand Reverse Transcriptase(Roche Diagnostics) and either of the two followingoligonucleotide primers designed on the basis of the se-quence of CSFV strain Alfort/187 (Ruggli et al., 1996): PR1(5′-CCT CAG GTT AGA TGG ATC CTC-3′) complemen-

D. Mayer et al. / Virus Research 98 (2003) 105–116 107

tary to nucleotides (nts) 6454–6434, and URSX1 (5′-TTCCTC GAG CCCGGGCCG TTA GGA AAT TAC CTT-3′).URSX1 is complementary to the 21, 3′-terminal nts of thegenome (underlined) and contains 12 additional 5′-terminalnts including anSrfI restriction site (italics).

The cDNA was purified on MicroSpin S-400 columns(Amersham Biosciences) and amplified by PCR using eitherthe expand LT PCR kit (Roche Diagnostics) or Pfu Turbopolymerase (Stratagene). PCR products were visualised byagarose gel electrophoresis before extraction and purificationwith the QIAquick Gel Extraction kit (Qiagen).

2.4. Sequencing and assembly of full-lengthcDNA clones

Fragments obtained by reverse transcription (RT)-PCRwere cloned into the pCR-TopoXL vector (Invitrogen).The respective inserts were sequenced with the ThermoSequenaseTM DYEnamic direct cycle sequencing kit(Amersham Biosciences) and analysed on a LI-COR 4200sequencer using e-Seq and AlignIR software (LI-CORBiosciences). Subclones were assembled to the respectivefull-length clones termed pEy-37 and pRiems-3 in the lowcopy number plasmid pACNR1180 (Ruggli et al., 1996) byligation of appropriate restriction endonuclease fragmentsand assembly PCR.

2.5. Analysis of 5′ and 3′ ends of the genome

The 5′ end was amplified by ligation-anchored PCR es-sentially as described byTroutt et al. (1992). Briefly, theoligonucleotide PEST2 (Wirz et al., 1993) served as a primerfor RT. To the 3′ end of the cDNA the 5′-phosphorylatedDNA oligonucleotide RT7G (5′-CTA TAG TGA GTCGTA TTA AGA TCT GTC GAC GCG TC-3′) was lig-ated. The sense primer LT7G, partially complementary toRT7G (5′-CGC GTC GAC AGA TCT TAA TAC GACTCA CTA TAG-3′) and the antisense primer GR1 (5′-AAACTG CAG CCC AGT TCG GCC GTC-3′) containing thesequence complementary to nts 95–79 of the genome (un-derlined) were used to perform 40 cycles of PCR on theextended cDNA.

In analogy to the ligation-anchored PCR describedabove a ligation-anchored RT-PCR was designed to deter-mine the sequence of the 3′ end of the viral genome. Theoligodeoxynucleotide Ey3′ligext (5′-ATA ACT CTA ACTTCG GAC GCA CGG-3′) was ligated to the full-length vi-ral RNA and RT was performed with the primer Ey3′ligRT(5′-CCG TGC GTC CGA AGT TAG AGT-3′), whichis partially complementary to Ey3′ligext. The resultingcDNA was subjected to 50 cycles of PCR using theprimers ACL12200 (5′-ACC TCA WGT TAC CAC ACTAC-3′, nts 12200–12219 of the genome) and Ey3′ligRT.The respective PCR fragments containing either of theends of the genome were cloned into pCR-TopoXL andsequenced.

2.6. Alignment and phylogenetic analysis of CSFVsequences

The following full-length genome sequences of 14CSFV strains obtained from GenBank were aligned withthe sequences of strain Eystrup and Riems/IVI usingthe GeneWorks package (IntelliGenetics, Mountain View,CA, USA): ALD (accession number D49532), Alfort 187(X87939), Alfort A19 (U90951), Alfort/Tübingen (J04358),Brescia/IVI (AF091661), Brescia/Lelystad (M31768),CAP (X96550), C strain (Z46258), Glentorf (U45478),GPE- (D42109), HCLV (AF091507), P97 (L49347),Riems/Giessen (U45477), Shimen (AF092448). The PAUP4.0 program (Sinauer Associates Inc. Publishers, Sunder-land, MA, USA) was used to obtain a phylogenetic treeby the neighbour-joining method (Saitou and Nei, 1987)including the Jukes and Cantor correction for multiple basechanges (Jukes and Cantor, 1969). To test the reliability ofthe branches in the tree a bootstrap analysis (1000 repli-cates) was performed using the same software. For drawingof the tree the TreeView software (Page, 1996) was used.

2.7. In vitro synthesis of viral RNA, transfection of SK-6cells and virus rescue

The cDNA clones pEy-37 and pRiems-3 were linearisedwith restriction endonucleaseSrfI (Stratagene) cleaving ex-actly at the 3′ end of the viral genome. The reactions wereextracted with phenol/chloroform and the DNA precipitatedwith ethanol. Authentic viral RNA was obtained by runofftranscription with the T7 MEGAscript kit (Ambion) from theT7 RNA polymerase promoter contained in the respectiveclones. After DNase I digestion, transcripts were purifiedthrough a MicroSpin S-400 column and quantified photo-metrically using an Ultrospec 2100pro UV-Vis Spectropho-tometer (Amersham Biosciences). RNA-specific infectivitywas measured by an infectious centre assay as described byMendez et al. (1998). The specific infectivity was expressedas focus forming units (FFU)/�g RNA.

For transfection of in vitro synthesised RNA, SK-6 cellswere washed twice with cold PBS, 0.9 mM CaCl2, 0.5 mMMgCl2 and resuspended in the same buffer to a density of2 × 107 cells/ml. One microgram of the RNA was trans-fected by electroporation using a Gene Pulser (Bio Rad)and a 2 mm cuvette containing 400�l of the cell suspen-sion (8×106 cells) by applying two electric pulses (500�F,200 V, no pulse controller). Cells were allowed to recoverfor 5 min at room temperature, resuspended in EMEM/7%horse serum and seeded in appropriate cell culture plates orflasks. The medium was replaced after overnight incubationat 37◦C. Virus was rescued from the cells between 48 and72 h after transfection by two cycles of freeze–thawing. Thecell lysates were used as inoculum for virus passage, titra-tion, replication kinetics and experimental infection of pigs.

108 D. Mayer et al. / Virus Research 98 (2003) 105–116

2.8. Virus titration

For titration, cells (SK-6, M� or FSNE) were infectedwith 10-fold dilutions of the respective virus. The titre wascalculated 48 post infection (p.i.) by staining the cells withthe monoclonal antibody (mAb) HC/TC 26 directed againstglycoprotein E2 (Greiser-Wilke et al., 1990) in an indirectimmunoperoxidase assay (IPA) (Mittelholzer et al., 1997) forSK-6 and FSNE cells or by an indirect immunofluorescenceassay (Ruggli et al., 1996) for M�.

2.9. Virus replication kinetics

For the characterisation of the replication kinetics of thecDNA-derived viruses SK-6 cells seeded in 24-well plateswere infected at a multiplicity of infection of 0.1. Cells wereincubated for 1 h at 37◦C before washing and incubation infresh medium. At the indicated times p.i. the respective cellcultures were frozen to stop virus replication and the virustitrated in SK-6 cells.

2.10. Characterisation of virulence

SPF pigs of approximately 35 kg bodyweight were in-fected with 104.0 TCID50 (titrated in SK-6 cells) of CSFVEystrup, vEy-37 or vRiems-3 per pig or with 107.5 ofvEy-ErnsRI, respectively. Virus used for inoculation wasdiluted in 5 ml EMEM and one half of the dose was admin-istered each, intranasally and orally. For each virus to betested three littermates of SPF pigs kept in separate isolationunits were infected. Body temperature and clinical scorewere daily monitored. Twice a week whole blood was col-lected for serum preparation, EDTA blood for white bloodcell count and for preparation of leukocytes (Summerfieldet al., 1998).

2.11. Quantification of peripheral blood leukocytes (PBLs)and identification of B- and T-lymphocytes

An aliquot of EDTA blood was diluted in TÜRK’s solu-tion (Merck), and PBLs were counted in a Bürker’s count-ing chamber. For phenotyping of B- and T-lymphocytesthe following mAbs were used (reviewed inSaalmüller,1996): anti-SWC1 (mAb 11/8/1, kindly provided by Dr. A.Saalmüller, BFAV Tübingen, Germany), anti-SWC3 (mAb74-22-15, VMRD Inc., Pullmann, WA, USA), anti-SWC8(mAb MIL3, Serotec), and anti-CD3 (3E8, VMRD). For theidentification of B-lymphocytes, a SWC1/SWC8/ SWC3triple immunofluorescence analysis was performed. B-cellswere identified as SWC1-SWC3-SWC8high cells. In a sep-arate immunofluorescence analysis T-lymphocytes weredefined CD3+ cells (Summerfield et al., 2001).

Indirect mAb labelling for triple immunofluores-cence was performed in a three-step procedure, us-ing isotype-specific conjugates (goat anti-mouse IgG,F(ab′)2 fragments, conjugated with FITC, phycoery-

thrin or biotin; Southern Biotechnology Associates),and streptavidin-spectralred for fluorescence-3 (SouthernBiotechnology Associates;Summerfield and McCullough,1997). For the acquisition of data a FACScan flow cy-tometer was used and the CellQuest programme for sub-sequent analysis (both Becton Dickinson, Mountain View,CA, USA).

2.12. Virus isolation and serology

For virus isolation sera obtained from infected animalswere diluted threefold in EMEM and used to inoculateSK-6 cells. Cell culture supernatants were collected at 48 hp.i. and cells stained for CSFV-specific E2 antigen by IPA.Positive sera were titrated in SK-6 cells. Alternatively,virus contained in serum samples was quantified by mea-suring the CSFV-specific RNA by real time TaqMan PCR(Hofmann, in press). CSFV-specific serum antibody titreswere determined using an E2 capture ELISA (Moser et al.,1996).

3. Results

3.1. Nucleotide sequence of the CSFV Eystrup andRiems/IVI genome

For both CSFV strains, Eystrup and Riems/IVI, the com-plete consensus sequence was obtained by sequencing atleast three individual clones of each fragment generated bythree independent RT-PCRs (Fig. 1). Sequencing of the endsof the two genomes revealed that each of the 21 termi-nal nucleotides of the 5′ and the 3′ ends were identical forboth virus strains as well as for CSFV Alfort/187 (Ruggliet al., 1996). Therefore, corresponding primers designedfrom the Alfort/187 sequence were used to amplify the ter-minal fragments of the respective genomes. The completegenomic sequences of CSFV Eystrup and CSFV Riems/IVIwere compared at the nucleotide level to a total of 14 se-quences of genotypes I and II strains available in GenBank.The phylogenetic tree obtained by the neighbour-joiningmethod is drawn inFig. 2. Strain Eystrup was found to bemost closely related to strain ALD (98.6% nucleotide se-quence identity), another highly virulent genotype I strainand most distantly related to strain P97 (85.5%), a mod-erately virulent strain belonging to genotype II. The se-quence we have determined for the strain Riems/IVI shows99.6% identity with the published sequence for the vac-cine strain referred to as Riems/Giessen, whereas the strainP97 again shows the lowest sequence identity. The sequenceidentity between strains Eystrup and Riems/IVI is 96.2%.The overall length of the genomes of the Eystrup virus(12,301 nt) and the Riems/IVI virus (12,289 nt) differs onlyin the 3′ NTR (234 nt versus 222 nt) whereas the 5′ NTR(373 nt) and the open reading frame (11,694 nt) are identi-cal in length. The difference in the 3’ NTRs is due to the

D. Mayer et al. / Virus Research 98 (2003) 105–116 109

genome SrfI CTAACGGCCCGGGC

0 1 2 3 4 5 6 7 8 9 10 11 12 kb

Cp7

Npro E25‘NTR

E1 NS3Erns NS2NS4A

NS5A NS5BNS4B3‘NTR

(C)

Ngo

MIV

(244

0)

Bam

HI

(643

7)

Sp

eI(1

1867

)

Bp

uMI

(952

1)

Ass

embl

yP

CR

(B)

vRiems-3

Bam

HI

(643

7)

Ngo

MIV

(244

0)

T7 promoter genomeTACGACTCACTATAGTATAC

(A)

vEy-37

Fig. 1. Cloning strategy for cDNA clones of CSFV strain Eystrup (A) and strain Riems/IVI (B). Overlapping cDNA fragments were assembled by ligationof appropriate restriction fragments or by assembly PCR as indicated. The T7 RNA polymerase promoter located immediately upstream of the 5′ end ofthe genome as well as theSrfI site (bold) at the 3′end of the genome are only shown for vEy-37. The genome sequences are underlined (A); numberscorrespond to the nucleotide position on the CSFV genome. The organisation of the CSFV genome including a scale in kilobases (kb) is depicted in(C). Nontranslated regions (NTR) and viral genes with their respective encoded proteins are indicated.

varying length of the uridine (U)-rich region composed ofseveral poly-U stretches and adenine-uridine (AUn) motifs(Fig. 3A).

3.2. Construction of full-length cDNA clones andgeneration of recombinant virus

Based on the consensus sequences including the terminiof the viral genomes, cloning strategies were applied toassemble the respective complete cDNA clones by DNAligation using suitable restriction endonuclease sites or byassembly PCR (Fig. 1). The clones were designed exactlyas described for pA187-1 (Ruggli et al., 1996), i.e. theviral cDNA linked at the 5′ end to a T7 RNA polymerasepromoter for in vitro transcription of authentic viral RNAwas cloned in the low copy number plasmid pACNR1180.At the 3′ end of the viral DNA anSrfI restriction sitewas introduced allowing the generation of authentic viralRNA by runoff transcription. The assembled full-lengthcDNA plasmid clones were termed pEy-37 and pRiems-3,respectively.

Electroporation into SK-6 cells of viral RNA transcribedin vitro gave rise to synthesis of infectious progeny virus.The respective titres were 103.9 TCID50/ml for the virusvEy-37 derived from pEy-37, and 103.7 TCID50/ml forthe virus vRiems-3 derived from pRiems-3. The specific

infectivities of the RNAs determined in an infectious cen-tre assay were 6.2 × 106 and 5.9 × 106 FFU/�g RNA,respectively.

3.3. Recombinant vEy-37 is as virulent as the parentCSFV strain Eystrup

The virulence of vEy-37 (Fig. 4A) was compared to that ofthe parent Eystrup virus (Fig. 4E) in experimental infectionsof groups of three pigs with 104.0 TCID50 of the respectivevirus per pig. For both viruses all animals developed severeCSF within 6 days including fever of over 40◦C and severeleukopenia (Fig. 4B and F). The blood of the animals in-fected with vEy-37 was analysed for T- and B-lymphocytes(Fig. 4C and D). Absolute T- and B-lymphocyte countsdropped to 10–15% within 4 days p.i. All animals showedpronounced central nervous symptoms like staggering andconvulsions of the head. One of the vEy-37-infected animalsdied on day 4 p.i. after blood sampling from the jugular vein(Fig. 4A). Such casualties have been occasionally observedin animals experimentally infected with highly virulent CS-FVs after having developed severe thrombocytopenia andleukopenia, as was the case in the respective pig (our un-published observations). Apart from the signs of acute CSF,necropsy of this animal revealed extended haemorrhagesin the throat region. All other animals infected with either

110 D. Mayer et al. / Virus Research 98 (2003) 105–116

Fig. 2. Neighbour-joining phylogenetic tree of full-length CSFV sequences. The tree was constructed by comparison of the genomic sequences of CSFVEystrup and Riems/IVI with 14 full-length sequences of CSFV deposited in GenBank (seeSection 2). The phylogenetic distance between the respectiveviruses is indicated at the bottom. Bootstrap values above 90% obtained from 1000 replicates are shown at the respective branch points. Highly virulentstrains (shaded), moderately virulent strains (framed), and avirulent strains (no symbol) are indicated.

vEy-37or the parent Eystrup strain had to be sacrificed in amoribund state on day 7 p.i. when clinical scores of 16–20were reached (Fig. 4A and E).

3.4. Recombinant vRiems-3 induces protective immunity inpigs

The animals infected with 104.0 TCID50 vRiems-3 didnot show any clinical signs at any time of the trial (Fig. 4G).Initially, the PBL count even increased and only slightleukopenia was observed (Fig. 4H). Whereas the absoluteT-lymphocyte count did not markedly decrease or even in-creased (Fig. 4I), B-lymphocyte counts dropped temporarilybut recovered on day 7 p.i. (Fig. 4J). All animals developedantibody titres against CSFV between 2 and 3 weeks p.i.(Fig. 4H). To assess whether a protective immunity had beeninduced a challenge infection with vEy-37 was performed21 days after inoculation with vRiems-3. No clinical signswere observed after challenge infection (Fig. 4G) but in twoanimals an increase in the anti-E2 antibody titre indicatinga booster effect was recorded (Fig. 4H). PBL counts for

these animals were always within the physiological range(Fig. 4H).

3.5. Erns adaptive mutants of vEy-37 obtained in SK-6cells replicate to higher titres

To assess the genetic stability of vEy-37 rescued fromcells transfected with pEy-37-derived RNA, the virus waspassaged 10 times in SK-6 cells (vEy-37 VP10). Surpris-ingly, after two to four passages virus titres were recordedthat were approximately 100 times higher when comparedto the virus titre before passage. In the following passages,the titres remained stable. RT-PCR on RNA extracted fromvEy-37 VP10 using the same primers as for cloning theEystrup genome was performed, and the resulting PCR frag-ments covering the entire viral genome were sequenced. Toproperly determine the length of the poly-U tract localisedin the 3′ NTR and for later construction of recombinantviruses, the PCR fragments representing this region of thegenome were cloned in pCR-TopoXL. Nucleotide sequenceanalysis revealed two base changes in the Erns gene which

D. Mayer et al. / Virus Research 98 (2003) 105–116 111

Fig. 3. Nucleotide sequence alignment of the poly-uridine tract region located in the 3′ NTR and partial amino acid alignment of glycoprotein Erns.Sequences of selected CSFV strains obtained from GenBank were aligned to the sequences of the strains Eystrup, vEy-37 VP10 and Riems/IVI. Thevarying length of the poly-uridine tract region in the 3′ NTR is emphasized (A). Heterogeneity of the Erns amino acid sequence at position 476/477 ofthe viral polyprotein is marked with bold letters (B).

caused the replacement of amino acid residues Ser/Thr (ST)to Arg/Ile (RI) at positions 476/477 of the viral polyprotein(Fig. 3B). In addition, the aforementioned poly-U tract waselongated due to insertion of between 2 and 4 U (Fig. 3A,three additional U shown). No other mutations were foundin the entire genome of the virus that had been passaged 10times in SK-6 cells.

To determine whether the mutant Erns had an effect onthe viability and/or the virulence of the virus, the muta-tion found in vEy-37 VP10 was introduced into pEy-37resulting in pEy-ErnsRI. Synthetic RNA obtained fromlinearised pEy-ErnsRI was transfected into SK-6 cells. Itsspecific infectivity was similar to that of the RNA obtainedfrom pEy-37 (data not shown). Titration of the progenyvirus vEy-ErnsRI in SK-6 cells resulted in a titre of 107.5

TCID50/ml. In contrast, the titre obtained for vEy-37 wasonly 103.7 TCID50/ml (Table 1). Titres for virus obtaineddirectly from transfected SK-6 cells were also determined

in M� and in FSNE cells. The results listed inTable 1show that in these cells the titres were similar for the twoviruses. Furthermore, viral RNA contained in the extracts oftransfected SK-6 cells was quantified by real time RT-PCR.Again, no significant difference was detected for the twoviruses (data not shown). These findings suggest that af-ter transfection of the respective RNAs into SK-6 cells

Table 1Titration in different cell types of vEy-37 and vEy-ErnsRI obtained fromtransfected SK-6 cells

log TCID50/ml after titration in

M� SK-6 FSNE

vEy-37 6.5 3.7 5.3vEy-ErnsRI 6.5 7.5 5.5

Numbers indicate mean values from two experiments.

112D

.M

aye

re

ta

l./Viru

sR

ese

arch

98

(20

03

)1

05

–1

16

Fig. 4. Experimental infection of pigs with cDNA-derived viruses vEy-37 and vRiems-3. Three animals each were infected with either vEy-37 (A–D), vRiems-3 (G–J), or the parent Eystrup virus (E and F)for comparison. Body temperature (closed symbols) and clinical score (open symbols) were recorded daily (A, E and G). Peripheral blood leukocytes (PBL) were counted twice weekly (B, F and H). Forpigs infected with either vEy-37 or vRiems-3, B- (D and J) and T-lymphocyte counts (C and I) were determined by FCM analysis. CSFV-specific immunity of pigs inoculated with vRiems-3 was challengedon day 21 p.i. by infection with vEy-37 (G and H; arrows). Antibody titres against viral glycoprotein E2 for these three pigs are drawn. Values above thedashed line are considered positive (H; bars).

D. Mayer et al. / Virus Research 98 (2003) 105–116 113

0

1

2

3

4

5

6

7

8

0 12 22 38 46hours post infection

log

TC

ID50

/ml

vEy-37vEy-ErnsRIvEy-37 VP10vRiems-3

Fig. 5. Replication kinetics of vEy-37, vEy-37 VP10, vEy-ErnsRI and vRiems-3. SK-6 cells seeded in 24-well plates were infected at a multiplicity ofinfection of 0.01. Virus was harvested at the indicated hours post infection by freeze–thawing of the cultures and titrated in SK-6 cells. The data wereobtained in one experiment in which all four viruses were analysed in parallel. Virus titres are shown as log TCID50/ml. A dashed line indicates thedetection limit.

the efficiency of viral replication was similar for the twoviruses.

The kinetics of viral replication for vEy-37, vEy-ErnsRIand vRiems-3 obtained directly from transfected cells aswell as for vEy-37 VP10 were determined in SK-6 cells(Fig. 5). The results show similar growth characteristicsfor vEy-37 VP10 and the corresponding reconstructedvirus vEy-ErnsRI. These viruses that are of the ErnsRI-typeclearly grew more efficiently when compared to vEy-37and vRiems-3, which are of the ErnsST-type and showed apronounced delay in replication. Final titres reached at 46 hp.i. were 106.9 and 106.5 TCID50/ml for the Erns mutantsvEy-ErnsRI and vEy-37 VP10, respectively. For vEy-37and vRiems-3 corresponding values of 105.7 and 105.1

TCID50/ml were recorded.

days post infection

vEy-ErnsRI

35.0

36.0

37.0

38.0

39.0

40.0

41.0

42.0

-3 0 3 6 9 12 15 18 21 24 27 30 330

5

10

15

20

25

30

body

tem

pera

ture

˚C

clin

ical

sco

re

35 x 106

0

2

46

8

1012

14

1618

20

0 4 7 11 14 18 21 25 28 32

106

PB

L / m

l blo

od

0

40

80

120

160

antib

ody

titre

(%

rea

ctiv

ity)

(A) (B)

Fig. 6. Experimental infection of pigs with vEy-ErnsRI. Three animals each were infected with vEy-ErnsRI. Clinical scores (open symbols) and rectaltemperature (closed symbols) were recorded daily (A). Peripheral blood leukocyte (PBL) counts were determined twice weekly. Antibody titres againstviral glycoprotein E2 of the two surviving pigs are presented as bars. Values above the dashed line are considered positive (B).

3.6. Assessment of virulence of vEy-ErnsRI

To assess the virulence of vEy-ErnsRI three pigs were in-fected each with 106.5 TCID50 of the virus obtained fromtransfected SK-6 cells and titrated in M�. This dosage cor-responds to that used in the experimental infection withvEy-37 (Fig. 4A–D), when M� instead of SK-6 cells wereused to determine the titre (see alsoTable 1). All three ani-mals developed severe CSF with clinical scores of up to 17around day 9 (Fig. 6A). One animal died after blood sam-pling on day 4 p.i. Surprisingly, the other two animals re-covered from the disease, but one of them remained in awasting state until final slaughtering on day 35 p.i. Similarto animals infected with vEy-37, PBL counts dropped butrecovered quickly in the two surviving animals (Fig. 6B).

114 D. Mayer et al. / Virus Research 98 (2003) 105–116

One animal showed a very strong increase of blood lym-phocytes on day 21 p.i. which probably was due to bacterialsuperinfection of the skin, since it developed generalised py-odermia. E2 antibody titres scored positive on day 11 p.i. inboth surviving animals (Fig. 6B).

4. Discussion

To establish authentic cDNA clones of two strains repre-senting a highly virulent as well as an avirulent CSFV, theconsensus sequence was determined for the strain Eystrupand for the vaccine strain Riems/IVI. Comparative phylo-genetic analysis including the complete genomic sequencesof a total of 16 CSFV strains of varying virulence did notreveal any genetic clustering related to virulence (Fig. 2).Also, focusing on the 3′ NTR, where an extended poly-Utract has been reported for several vaccine strains, providedno evidence for a grouping of virulent and avirulent strainsconfirming published data (Bjorklund et al., 1998). Inter-estingly, Riems/IVI was found to have a shorter U-rich re-gion than any of the other strains for which the completesequence is known (see examples inFig. 3A). It lacks 6 ofthe AUn motifs found in the other strains, yet it has a U26sequence interrupted by one single cytidine. A similar motifis found in the 3′ NTR of the C-strain (U18 interrupted bytwo cytidines).

After experimental infection of pigs, the recombinantvirus vEy-37 proved to be as virulent as the parent Eystrupvirus strain (Fig. 4A–F). All three animals infected withvEy-37 were moribund within 8 days after oronasal infec-tion (Fig. 4A). Previously, virulent viruses rescued frommolecular clones have been reported for the strains CSFVAlfort/Tübingen (Meyers et al., 1999) and Brescia (Hulstet al., 2001). Although these viruses caused CSF they didnot meet the main criterion for a highly virulent strainrepresenting the ability to induce lethal disease within lessthan 10 days after infection (van Oirschot, 1988). The onlymolecularly cloned CSFV, vA187-1, we had available sofar was derived from the strain Alfort/187 (Ruggli et al.,1996). It consistently caused clinical signs but no lethaldisease in SPF pigs (Mittelholzer et al., 2000).

To obtain a recombinant CSFV representing the oppositephenotype of vEy-37 with regard to virulence, a cDNA cloneof the vaccine strain Riems/IVI was established. The virusderived from this clone, vRiems-3, did not cause any signsof disease but induced a distinct antibody response and com-plete protection from disease after challenge with vEy-37(Fig. 4). Similarly, deSmit et al. (2000)have reported acDNA clone derived from the C-strain, an established CSFVvaccine, which also retained its phenotypic characteristicsincluding absence of virulence and immunogenic properties.

Although vEy-37 and vRiems-3 display completely op-posite phenotypes, depletion of B-lymphocytes occurred inanimals infected with either of the two viruses, whereasT-lymphocytes seemed not to be affected in animals infected

with vRiems-3 (Fig. 4). Summerfield et al. (2001)reportedfor both, the highly virulent CSFV strain Brescia and forthe moderately virulent strain Uelzen, that B- as well asT-lymphocytes were rapidly depleted before viraemia wasdetected in infected pigs. For the moderately virulent CSFVstrain Alfort it was reported that depletion occurred predom-inantly for B-lymphocytes (Susa et al., 1992). These and ourfindings suggest that B-lymphocytes might be very vulner-able in CSFV-infection, even when a vaccine strain is used(Fig. 4J). Furthermore, the fact that viraemia was never ob-served in the animals inoculated with vRiems-3 supports theassumption that depletion of B-lymphocytes is not due totheir infection with CSFV (Summerfield et al., 2001).

Passage of vEy-37 in SK-6 cells led to a significant in-crease in virus titre. Sequence analysis of the entire genomeof the virus obtained after 10 passages (vEy-37 VP10) re-vealed mutations at only two locations. One was an inser-tion of between 2 and 4 uridines in the 3′ NTR (Fig. 3A),the other a mutation of 2 nts in the Erns coding sequencewhich caused a shift from ST to RI at position 476/477 inthe Erns glycoprotein (Fig. 3B). By introduction of this dou-ble amino acid change into pEy-37 the virus vEy-ErnsRIwas generated. Titration in SK-6 cells of vEy-ErnsRI recov-ered from SK-6 cells transfected with the respective RNAresulted in a titer that was almost 4 log units higher whencompared to that of vEy-37 (Table 1). Analysis of the kinet-ics of virus replication in SK-6 cells revealed that vEy-37VP10 and vEy-ErnsRI grew faster and to higher titres thanvEy-37 and vRiems-3, thus confirming the advantage of theErnsRI-mutants in SK-6 cells (Fig. 5).

Hulst et al. (2000)reported the same change of a Serresidue to an Arg residue at position 476 of the viral polypro-tein after passage of cDNA-derived CSFV Brescia in SK-6cells. In analogy to our findings, this Erns mutant also grewto higher titres in SK-6 cells. These authors showed that theamino acid change in the Erns glycoprotein from Ser to Argresulted in a newly acquired capability of the virus to usemembrane-associated heparan sulphate (HS) as receptor onSK-6 cells. Although M� are supposed to express HS ontheir cell surface, this phenomenon was not observed in thelatter cells, indicating that infection of M� with CSFV pro-ceeds by an HS-independent mechanism (Hulst et al., 2001).

Titration in porcine M� and FSNE cells of vEy-37 andvEy-ErnsRI obtained after tranfection of SK-6 cells (Table 1)and quantification of the respective viral RNA by real timeRT-PCR indicated, that similar amounts of progeny viruswere produced in SK-6 cells for either of the two virus vari-ants. Considering the data ofHulst et al. (2000), this sug-gests that the increase in replication efficiency we observedfor the mutant vEy-ErnsRI in SK-6 cells is due to the use ofHS as cell surface receptor rather than to impaired replica-tion of vEy-37.

The virulence of the Erns mutant vEy-ErnsRI was assessedby experimental infection of SPF pigs (Fig. 6). The animalsdeveloped severe CSF but two of them recovered. This is inaccordance to infections with a molecular clone of CSFV

D. Mayer et al. / Virus Research 98 (2003) 105–116 115

Brescia, where one of three pigs infected with the ErnsR mu-tant survived, whereas the ErnsS wt virus killed all animals(Hulst et al., 2001). However, in the latter experiment theinoculated dose for both viruses was based on SK-6 cellstitres, and thus probably 100 times less pig infectious doseswere used for animals infected with ErnsR mutant comparedto the ErnsS wt virus. In our experiment with the EystrupRI-mutant, we observed the slightly attenuated phenotypeeven though infectious doses calculated on the basis of M�

titres were used, which probably better mirrors the situa-tion in an animal infection. We conclude that the mutationfrom ST to RI in the Erns glycoprotein of the highly viru-lent CSFV strain Eystrup has only a weak attenuating effect.The fact that the vaccine strain Riems/IVI is of the ErnsSTtype but is completely avirulent (Figs. 3 and 4), also sup-ports the assumption that this mutation in the Erns gene doesnot contribute to the attenuation and therefore is certainlynot a major determinant of virulence in CSFV. The anti-body response induced by vRiems-3, which is derived froma classical vaccine strain, was detectable in one animal onday 14 p.i. and in the others on day 21 p.i., whereas sera ofthe surviving animals infected with vEy-ErnsRI scored pos-itive already on day 11 p.i. (Fig. 5A). Obviously, a virulentCSFV like vEy-ErnsRI causes viraemia and induces an earlyspecific antibody response in surviving animals.

In summary, we have generated a cDNA clone of a highlyvirulent CSFV strain, which maintains its phenotype. Wehave also established a cDNA clone of the vaccine strainRiems/IVI and shown that the derived virus is able to protectpigs from CSF. These two cDNA clones provide the basisfor the construction of chimeric viruses and will be usefultools to elucidate the genetic determinants of virulence inCSFV which remain to be established.

Acknowledgements

We thank H.-J. Thiel and G. Schirrmeier for providingvirus strains, A. Summerfield and M. Horn for the help withthe FCM analysis. This work was supported by the SwissFederal Veterinary Office and the Swiss National ScienceFoundation (grant 31-56719.99).

References

Bjorklund, H.V., Stadejek, T., Vilcek, S., Belak, S., 1998. Molecularcharacterisation of the 3′ noncoding region of classical swine fevervirus vaccine strains. Virus Genes 16, 307–312.

deSmit, A.J., vanGennip, H.G.P., Miedema, G.K.W., vanRijn, P.A., Terp-stra, C., Moormann, R.J.M., 2000. Recombinant classical swine fever(CSF) viruses derived from the Chinese vaccine strain (C-strain) ofCSF virus retain their avirulent and immunogenic characteristics. Vac-cine 18, 2351–2358.

Dahle, J., Liess, B., 1995. Comparative study with cloned classical swinefever virus strains Alfort and Glentorf: clinical, pathological, virologi-cal and serological findings in weaner pigs. Wien. Tierärztl. Monatss-chr. 62, 1–6.

Depner, K.R., Hinrichs, U., Bickhardt, K., Greiser-Wilke, I., Pohlenz, J.,Moennig, V., Liess, B., 1997. Influence of breed-related factors on thecourse of classical swine fever virus infection. Vet. Rec. 140, 506–507.

Greiser-Wilke, I., Moennig, V., Coulibaly, C.O., Dahle, J., Leder, L.,Liess, B., 1990. Identification of conserved epitopes on a hog choleravirus protein. Arch. Virol. 111, 213–225.

Hofmann, M.A. Construction of an infectious chimeric classical swinefever virus containing the 5’UTR of bovine viral diarrhea virus, andits application as a universal internal positive control in real-timeRT-PCR. J. Virol. Methods, in press.

Hulst, M.M., vanGennip, H.G.P., Moormann, R.J.M., 2000. Passage ofclassical swine fever virus in cultured swine kidney cells selects virusvariants that bind to heparan sulphate due to a single amino acidchange in envelope protein E-rns. J. Virol. 74, 9553–9561.

Hulst, M.M., vanGennip, H.G.P., Vlot, A.C., Schooten, E., deSmit, A.J.,Moormann, R.J.M., 2001. Interaction of classical swine fever viruswith membrane-associated heparan sulphate: role for virus replicationin vivo and virulence. J. Virol. 75, 9585–9595.

Jukes, T.H., Cantor, C.R., 1969. Evolution of protein molecules. In: Munro,H.N. (Ed.), Mammalian Protein Metabolism. Academic Press, NewYork, pp. 21–132.

Kasza, L., Shadduck, J.A., Christofinis, G.J., 1972. Establishment, viralsusceptibility and biological characteristics of a swine kidney cell lineSK-6. Res. Vet. Sci 13, 46–51.

Klimstra, W.B., Ryman, K.D., Johnston, R.E., 1998. Adaptation of Sindbisvirus to BHK cells selects for use of heparan sulphate as an attachmentreceptor. J. Virol. 72, 7357–7366.

Knoetig, S.M., Summerfield, A., Spagnuolo-Weaver, M., McCullough,K.C., 1999. Immunopathogenesis of classical swine fever: role ofmonocytic cells. Immunology 97, 359–366.

Mayer, D., Hofmann, M.A., Tratschin, J.D., 2003. Attenuation of classicalswine fever virus by deletion of the viral Npro gene. Vaccine, in press.

McCullough, K.C., Basta, S., Knoetig, S., Gerber, H., Schaffner, R., Kim,Y.B., Saalmuller, A., Summerfield, A., 1999. Intermediate stages inmonocyte-macrophage differentiation modulate phenotype and suscep-tibility to virus infection. Immunology 98, 203–212.

Mendez, E., Ruggli, N., Collett, M.S., Rice, C.M., 1998. Infectious bovineviral diarrhea virus (strain NADL) RNA from stable cDNA clones: acellular insert determines NS3 production and viral cytopathogenicity.J. Virol. 72, 4737–4745.

Meyers, G., Thiel, H.J., Rümenapf, T., 1996. Classical swine fever virus:recovery of infectious viruses from cDNA constructs and generationof recombinant cytopathogenic defective interfering particles. J. Virol.70, 1588–1595.

Meyers, G., Saalmüller, A., Büttner, M., 1999. Mutations abrogating theRNase activity in glycoprotein E(rns) of the pestivirus classical swinefever virus lead to virus attenuation. J. Virol. 73, 10224–10235.

Mittelholzer, C., Moser, C., Tratschin, J.D., Hofmann, M.A., 1997. Gen-eration of cytopathogenic subgenomic RNA of classical swine fevervirus in persistently infected porcine cell lines. Virus Res. 51, 125–137.

Mittelholzer, C., Moser, C., Tratschin, J.D., Hofmann, M.A., 2000. Anal-ysis of classical swine fever virus replication kinetics allows differ-entiation of highly virulent from avirulent strains. Vet. Microbiol. 74,293–308.

Moennig, V., 2000. Introduction to classical swine fever: virus, diseaseand control policy. Vet. Microbiol. 73, 93–102.

Moormann, R.J., van Gennip, H.G., Miedema, G.K., Hulst, M.M., vanRijn, P.A., 1996. Infectious RNA transcribed from an engineeredfull-length cDNA template of the genome of a pestivirus. J. Virol. 70,763–770.

Moser, C., Ruggli, N., Tratschin, J.D., Hofmann, M.A., 1996. Detection ofantibodies against classical swine fever virus in swine sera by indirectELISA using recombinant envelope glycoprotein E2. Vet. Microbiol.51, 41–53.

Page, R.D.M., 1996. TreeView: an application to display phylogenetictrees on personal computers. Comput. Appl. Biosci. 12, 357–358.

116 D. Mayer et al. / Virus Research 98 (2003) 105–116

Ruggli, N., Tratschin, J.D., Mittelholzer, C., Hofmann, M.A., 1996. Nu-cleotide sequence of classical swine fever virus strain Alfort/187 andtranscription of infectious RNA from stably cloned full-length cDNA.J. Virol. 70, 3478–3487.

Ruggli, N., Tratschin, J.D., Schweizer, M., McCullough, K.C., Hofmann,M.A., Summerfield, A., 2003. Classical swine fever virus interfereswith cellular antiviral defense: evidence for a novel function of Npro.J. Virol. 77, 7645–7654.

Sa-Carvalho, D., Rieder, E., Baxt, B., Rodarte, R., Tanuri, A., Mason,P.W., 1997. Tissue culture adaptation of foot-and-mouth disease virusselects viruses that bind to heparin and are attenuated in cattle. J.Virol. 71, 5115–5123.

Saalmüller, A., 1996. Characterisation of swine leukocyte differentiationantigens. Immunol. Today 17, 352–354.

Saitou, N., Nei, M., 1987. The neighbor-joining method: a new methodfor reconstructing phylogenetic trees. Mol. Biol. 4, 406–409.

Summerfield, A., McCullough, K.C., 1997. Porcine bone marrow myeloidcells: phenotype and adhesion molecule expression. J. Leukoc. Biol.62, 176–185.

Summerfield, A., Knoetig, S.M., McCullough, K.C., 1998. Lym-phocyte apoptosis during classical swine fever: implication ofactivation-induced cell death. J. Virol. 72, 1853–1861.

Summerfield, A., McNeilly, F., Walker, I., Allan, G., Knoetig, S.M., Mc-Cullough, K.C., 2001. Depletion of CD4(+) and CD8(high+) T-cells

before the onset of viraemia during classical swine fever. Vet. Im-munol. Immunopathol. 78, 3–19.

Susa, M., Konig, M., Saalmuller, A., Reddehase, M.J., Thiel, H.J., 1992.Pathogenesis of classical swine fever: B-lymphocyte deficiency causedby hog cholera virus. J. Virol. 66, 1171–1175.

Troutt, A.B., McHeyzer-Williams, M.G., Pulendran, B., Nossal, G.J.,1992. Ligation-anchored PCR: a simple amplification technique withsingle-sided specificity. Proc. Natl. Acad. Sci. U.S.A. 89, 9823–9825.

van Oirschot, J.T., 1988. Description of the virus infection. In: Liess,B. (Ed.), Classical swine fever and related viral infections. MartinusNijhoff Publishing, Boston, Dordrecht, Lancaster, pp. 1–25.

van Oirschot, J.T., 1994. Hog cholera virus. In: Webster, R.G., Granoff,A. (Eds.), Encyclopedia of Virology. Academic Press, London, SanDiego, pp. 649–654.

van Regenmortel, M.H.V., Fauquet, C.M., Bishop, D.H.L., Carstens, E.B.,Estes, M.K., Lemon, S.M., Maniloff, J., Mayo, M.A., McGeoch, D.J.,Pringle, C.R., Wickner, R.B., 2000. Virus Taxonomy. The Classifica-tion and Nomenclature of Viruses. The Seventh Report of the Inter-national Committee on Taxonomy of Viruses. Academic Press, SanDiego, 1162 pp.

Wirz, B., Tratschin, J.D., Muller, H.K., Mitchell, D.B., 1993. Detectionof hog cholera virus and differentiation from other pestiviruses bypolymerase chain reaction. J. Clin. Microbiol. 31, 1148–1154.