Melittin–glutathione S-transferase fusion protein exhibitsanti-inflammatory properties and minimal toxicity

Jamie E. Rayahin a, Jason S. Buhrman a, Richard A. Gemeinhart a,b,c,⇑a Department of Biopharmaceutical Sciences, University of Illinois, Chicago, IL 60612-7231, USAb Department of Bioengineering, University of Illinois, Chicago, IL 60607-7052, USAc Department of Ophthalmology and Visual Sciences, University of Illinois, Chicago, IL 60612-4319, USA

a r t i c l e i n f o

Article history:Received 7 June 2014Received in revised form 9 September 2014Accepted 10 September 2014Available online 21 September 2014

Keywords:MelittinInflammationFusion proteinMacrophageGlutathione S-transferaseProtein therapeutic

a b s t r a c t

Although potent, proteins often require chemical modification for therapeutic use. Immunogenicity, dif-ficult synthesis, and scale-up of these modifications are all engineering obstacles that stand in the way ofexpanding the use of these therapeutics. Melittin, a peptide derived from bee venom, has been shown tomodulate inflammation. Although potentially therapeutic, the native peptide causes cell lysis and toxicitysignificantly hindering therapeutic application. Based upon the knowledge of the pore formationmechanism, we examined the toxicity and therapeutic effect of a melittin fusion protein withglutathione-S-transferase. The fusion of melittin and glutathione S-transferase results in diminished toxicityof the peptide and retained anti-inflammatory properties at doses that exceed toxic concentration ofnative melittin. Our results suggest that fusion proteins, particularly those of glutathione-S-transferase,may be facile modifications to control protein activity.

! 2014 Elsevier B.V. All rights reserved.

1. Introduction

Utilization of venoms has a long history in complementary andalternative medicine (Hodgson, 2012). Although sometimes effec-tive in homeopathic doses, and with few exceptions (Cooper,1996), these venoms act as toxins and cannot be used safely in atherapeutic setting. Of these, the honey bee’s venom has drawnparticular attention. Since its discovery, melittin, the major compo-nent of bee venom, has been examined for its potent properties(Bechinger, 1997; Buhrman et al., 2013b; Kwon et al., 2002; Leeet al., 2004; Park et al., 2004) Due to its cell-lytic property, melittinhas been examined as a candidate for anti-cancer (Buhrman et al.,2013b; Orsolic, 2012) and anti-bacterial therapies (Asthana et al.,2004; Buhrman et al., 2013b). Melittin’s pharmacologic mecha-nism of action is considered to be pore-formation and subsequentnecrotic cell death (Bechinger, 1997; Bechinger and Lohner, 2006;Klocek et al., 2009; Pratt et al., 2005; Santo and Berkowitz, 2012;Yang et al., 2001). Unexpectedly, melittin has also demonstratedsignificant anti-inflammatory properties (Kwon et al., 2002; Leeet al., 2004; Park et al., 2004).

The inflammatory reaction is a Janus-faced process withthe potential for both protective and adverse outcomes. Acute

inflammation is necessary for local trauma or infection to resolve(Medzhitov, 2008; Serhan and Savill, 2005). However, persistentand chronic activation of the immune response can result in tissuedamage and pathology (Medzhitov, 2008; Serhan and Savill, 2005).Both exogenous and endogenous stimuli can promote an inflam-matory response. In either case, the reaction is a very intricate pro-cess with an elaborate array of cytokines and chemical mediators,such as nitric oxide, tumor necrosis factor alpha (TNF-a), and pros-taglandins that control its course (Medzhitov, 2008; Nathan, 2002).Dysregulation of any of these signals can cause inflammation andis associated with disease (Karin et al., 2006; Krishnamoorthyand Honn, 2006; Nathan, 2002). The inflammatory responserecruits several cell types, however, macrophages are the mainimmune cells that ubiquitously control the production and releaseof biochemical signals of inflammation (Mosser and Edwards,2008). Modification of the macrophage response holds great poten-tial in modulating inflammation (Gordon and Taylor, 2005).

Protein therapeutics have been widely investigated to modulatethe inflammatory response of macrophages (Feldmann and Maini,2003). There are limitations, specifically toxicity, systemic distri-bution, and limited half-life, that warrant improvements to achieveoptimal performance. Modifications of protein therapeutics caninfluence the mechanism of action, toxicity, and efficacy and often-times results in highly efficacious drugs.

Current technologies focus on chemical modifications of theparent protein. These modifications include PEGylation, modifica-

http://dx.doi.org/10.1016/j.ejps.2014.09.0120928-0987/! 2014 Elsevier B.V. All rights reserved.

⇑ Corresponding author at: 833 South Wood Street (MC865), Chicago, IL 60612-7231, USA.

E-mail address: rag@uic.edu (R.A. Gemeinhart).

European Journal of Pharmaceutical Sciences 65 (2014) 112–121

Contents lists available at ScienceDirect

European Journal of Pharmaceutical Sciences

journal homepage: www.elsevier .com/ locate /ejps

tion of side chains or reactive groups, and chemical crosslinking(Means and Feeney, 1990). Practical constraints of these modifica-tions, such as immunogenicity of the modification, feasibility, andscale-up, often limit the engineering and medicinal potential ofthese therapeutics (Basle et al., 2010). Fusion proteins are easy toexpress and offer another avenue of protein modification. Severalbiologic therapies have shown improved function and modifiedactivity as fusion proteins, especially in therapeutics modifyingthe immune system or macrophage function (Boulianne et al.,1987; Czajkowsky et al., 2012; Mohit and Rafati, 2012; Morrisonet al., 1984; Sadelain et al., 2013; Shin and Morrison, 1989).

With this in mind, we sought to explore whether a fusion pro-tein of melittin and glutathione S-transferase (GST), a commonfusion partner, would maintain anti-inflammatory properties ofthe peptide, while abrogating its cell-lytic properties, based uponthe disruption of protein association and assembly that result incell lysis (van den Bogaart et al., 2008; Yang et al., 2001). To ourknowledge, there have been no studies that demonstrate modifica-tions of the melittin peptide to control its toxicity and maintain itsanti-inflammatory properties. Herein, we compare toxicity andanti-inflammatory properties of GST-melittin fusion protein tonative melittin on lipopolysaccharide (LPS) induced inflammationof mouse macrophages. We show, in these studies, that GST-melit-tin is a non-toxic alternative to native melittin that achieves anti-inflammatory action without lethal response of the native peptide.

2. Materials and methods

2.1. Expression and purification of recombinant proteins

GST-melittin was purified by a method previously described(Buhrman et al., 2013c). The expression of both GST and GST-mel-ittin was induced in the Rosetta strain (Novagen/EMD Millipore,Billerica, MA). Escherichia coli was grown in LB broth at 37 "C. Afterthe bacterial density was sufficient, i.e. the absorbance at 600 nmreached 0.4–0.6, bacterial cells were removed to 25 "C and inducedovernight (16 h) with 0.1 mM isopropyl b-D-1-thiogalactopyrano-side (IPTG). Cells were then centrifuged (3600!g) for 20 min beforebeing resuspended in lysis buffer (50 mM NaH2PO4 and 300 mMNaCl at pH 8.0) and lysed by addition of 1 mg lysozyme followedby freezing and thawing 3 times. Lysates were sonicated 3 timesin 15-s intervals at 40% intensity and centrifuged (11,300!g for30 min) to separate soluble and insoluble proteins. GST was puri-fied from the soluble fraction by Ni–NTA agarose (Qiagen, Venlo,NLD) according to the manufacturer’s instructions. GST-melittinwas extracted from the insoluble fraction by the acidic extractionmethod previously reported (Buhrman et al., 2013c, 2012). Briefly,the insoluble lysate was washed with 70 mM TCEP (Thermo-FisherScientific) in PBS (pH = 2.3), and GST-melittin was then extractedin PBS with 70 mM TCEP and 1% tween 20 (Thermo-Fisher Scien-tific). The pH of the extracted protein was raised to 7.4, and theextracted GST-melittin was purified with Ni–NTA (Qiagen) usingmanufacturer’s recommended methods.

2.2. Cell culture

J774A.1 murine macrophages (ATCC) were cultured in Dul-becco’s modified Eagle’s medium (DMEM; Hyclone, Logan, UT,USA) supplemented with 10% (v/v) fetal bovine serum (FBS; Gem-ini, Calabasas, CA, USA) at 37 "C in 5% CO2. Macrophages were har-vested by scraping and used between passage 2 and 7.Macrophages were stimulated through treatment with c-irradi-ated LPS derived from E. coli serotype 055:B5 (Sigma–Aldrich, StLouis, MO, USA).

2.3. Macrophage viability

The effects of native melittin, GST-melittin, cleaved GST-melit-tin, and GST on cell viability both with and without LPS stimulationwas investigated using CellTiter 96 AQueous One Solution Assay(Barltrop et al., 1991; Cory et al., 1991) of cellular proliferation(Promega, Madison, WI, USA). GST-melittin was cleaved by throm-bin (2U) incubation (37 "C) for 7 h. J774A.1 cells were plated at adensity of 2 ! 104 cells in a 96-well flat-bottom plate and allowedto adhere for 24 h. After this incubation period, cells were treatedwith GST, GST-melittin, cleaved GST-melittin, or native melittin(Sigma Aldrich, St Louis, MO, USA) for one hour after which theappropriate groups were challenged with LPS (2 lg/mL). After 4 hthe number of viable cells was measured according to the manu-facturer’s instructions.

2.4. Membrane permeability

J774A.1 cells were plated at a density of 2 ! 104 cells in a 96-well flat-bottom plate and allowed to adhere for 24 h. After thisincubation period, cells were treated with 10 ng/lL propidiumiodide, a cell membrane impermeable nuclear dye, and the speci-fied protein. Phase contrast and epifluorescence micrographs werecaptured over the course of one hour on an Olympus IX70 invertedmicroscope.

2.5. Nitric oxide (NO) formation

J774A.1 murine macrophages were plated at a density of5 ! 105 cells/mL in a 24 well plate and allowed to adhere over-night, after which the culture medium was replaced with 500 lLphenol-free DMEM (Hyclone, Logan, UT, USA) with 10% FBS. Vary-ing concentrations of GST-melittin, native melittin, or GST wereadded to the culture medium. Cells were pre-treated with eachof these components for one hour, after which they were stimu-lated with LPS (2 lg/mL). Supernatant media was collected after24-h incubation period and nitrite measured using the Griessreagent (Promega, Madison, WI, USA) according to manufacturer’sinstructions.

2.6. Quantification of inflammatory gene expression

Total RNA was isolated from J774A.1 murine macrophagesusing TRIzol (Invitrogen, Carlsbad, CA, USA). The absorbance ratioat 260 and 280 nm for each sample was determined spectrophoto-metrically, and if the ratio was greater than 1.8, the RNA wasreverse transcribed into cDNA (Applied Biosystems, Carlsbad, CA,USA). Real time PCR assay was carried out on an Applied Biosys-tems StepOnePlus™ PCR machine using SYBR# Green PCR MasterMix (Applied Biosystems, Carlsbad, CA, USA). A melting curve anal-ysis was performed after each run to confirm product specificity.All primers were designed to span exon–exon junctions (Table 1).Transcripts of b-glucuronidase were quantified and used as endog-enous control (Schenborn and Groskreutz, 1999). Relative quanti-ties were estimated by the delta-delta-Ct method (Schmittgenand Livak, 2008). The expression of each gene was normalized tountreated cells as control.

2.7. Effect of peptides on LPS binding to macrophages

J774A.1 murine macrophages were plated at a density of1 ! 106 cells/mL in a 12 well plate and allowed to adhere over-night. After which, the culture medium was replaced with 1 mLfresh DMEM (Hyclone, Logan, UT, USA) with 10% FBS. Varying con-centrations of GST-melittin (0.3 lM or 3 lM) or native melittin(0.3 lM) were added to the culture medium for one hour. Follow-

J.E. Rayahin et al. / European Journal of Pharmaceutical Sciences 65 (2014) 112–121 113

ing this, the macrophages were stimulated with 10 lg/mL FITC-labeled LPS (Sigma Aldrich, St. Louis, MO, USA). Supernatant mediawas collected after a 4-h incubation period and fluorescence wasmeasured at excitation and emission wavelengths of 490 and550 nm on Turner Quantech fluorometer. LPS binding was com-pared to that of cells treated with FITC-labeled LPS, but not withthe proteins, to determine the extent of inhibition of LPS binding.

2.8. Protein localization

BSA and GST were amine-labeled with the Alexa-Fluor 430succinimidyl ester (Invitrogen) according to manufacturer’s rec-ommendation. Stoichiometry was set at 1 dye molecule per twoprotein molecules. GST-melittin labeled on free carboxylic acidsusing lissamine rhodamine ethylenediamine (Sigma Aldrich) cou-pled with 1-ethyl-3-[3-dimethylaminopropyl] carbodiimidehydrochloride (EDC, Pierce). The stoichiometry was 1:1 protein:EDC and 2:1 protein:rhodamine. Each reaction was allowed to pro-ceed for 2 h at room temperature, and the resulting labeled pro-teins were purified from un-reacted dye by Ni–NTA selection.Protein yields were quantified with SDS–PAGE.

J774A.1 murine macrophages were plated at a density of2 ! 105 cells/mL in a total volume of 250 lL per chamber in a 4-chamber glass bottom dish (In Vitro Scientific). One day after plat-ing, macrophages were treated with labeled bovine serum albumin(BSA), labeled GST, labeled GST mixed with (unlabeled) melittin, orlabeled GST-melittin at a concentration of 0.3 lM. After a 24-htreatment period in the presence of the labeled proteins, macro-phages were washed twice with warm phosphate buffered saline(PBS) and fresh media was re-applied. The nuclei were stained withHoechst 33,258 for 5 min prior to confocal laser scanning micros-copy (CLSM) imaging. CLSM images were acquired using a ZeissLSM 510 META (Carl Zeiss, Germany) with a water immersion63 ! objective. Excitation wavelengths were 405 nm (Diode 405),488 nm (argon laser) and 543 nm (HeNe laser) for Hoechst33258, Alexa Flour# 430, and rhodamine, respectively.

2.9. Statistical analyses

ANOVA was used to test all groups, and post hoc Tukey analysiswas utilized if ANOVA suggested significant differences betweenthe groups. In all cases a less than or equal to 0.05 was consideredsignificant.

3. Results

3.1. GST-melittin has no effect on macrophage survival; native melittinkills macrophages at nanomolar concentrations

To address the effect of GST-melittin and native melittin on mac-rophage survival, J774A.1 macrophages were incubated with arange of concentrations (0–30 lM) of either GST-melittin or nativemelittin. Native melittin caused significant reduction in cell metabo-lism, interpreted as reduced cell viability/cell death, at concentrations

as low as 1 lM and significant inhibition at concentrations belowthis (Fig. 1A). We approximated the IC50 for native melittin to be450 nM (Fig. 1A). Conversely, GST-melittin alone had no effect oncell survival after a four-hour incubation at concentrations as highas 30 lM (Fig. 1B) and an IC50 could not be calculated.

Cellular viability after introduction of inflammatory stimulus,LPS, was also investigated with all treatment groups. Cells werepre-treated with either GST-melittin or native melittin then subse-quently treated with LPS (2 lg/mL) for four hours. Cells treated withGST-melittin show no significant change in viability over four hourswith LPS. In contrast, cells treated with native melittin exhibitreduced IC50 of 300 nM when treated with LPS indicating thatinflamed macrophages have a slightly greater sensitivity to the toxin.

Phenotypic evidence supports these observations (Fig. 2). Nativemelittin’s toxicity toward macrophages is detectable within min-utes as membrane permeabilization, apparent in the fluorescencemicrographs, and cell detachment, swelling, and burst, visible inphase contrast images (Fig. 2). There is no phenotypic evidence oftoxicity or cell permeability when cells were treated with GST-melittin (Fig. 2). Both of these findings suggest that GST-melittinhas latent cell-lytic properties compared to the native peptide.

3.2. GST-melittin is equivalent to native melittin in attenuating nitricoxide synthesis

Following the serendipitous observation of the reduced toxicityof GST-melittin compared to native melittin and the knowledge ofprevious reports of anti-inflammatory properties of melittin, webecame interested in the ability of GST-melittin to act as an anti-inflammatory agent (Kwon et al., 2002; Lee et al., 2004; Parket al., 2007). Therefore, we examined if GST-melittin and nativemelittin had equivalent effects at reducing nitric oxide synthesis.We chose the approximate IC50 dose of native melittin with LPS,300 nM, as our highest concentration comparing these concentra-tions to molar equivalent concentrations of GST–melittin.

Nitric oxide synthesis was measured with and without LPSstimulation as total nitrite after twenty-four hours using the Griessreagent. Both GST-melittin and melittin had comparable effects indecreasing nitric oxide synthesis over the treatment period (Fig. 3).At the same concentration, native melittin and GST–melittin haveequal effect at decreasing nitric oxide synthesis in LPS stimulatedmacrophages (p > 0.05). At toxic levels of the native peptide, GST-melittin has the ability to decrease NO production to a greaterextent (p < 0.001) while not eliciting any toxicity. Both the GST-melittin and the native melittin had no significant effect on nitricoxide synthesis on macrophages that had not been stimulated,with little detectable nitrite measured for unstimulated macro-phages (Fig. 3).

3.3. GST-melittin inhibits inflammatory gene expression in stimulatedmacrophages

Because GST-melittin decreased production of the inflamma-tory mediator, nitric oxide, we explored its effect on the expression

Table 1Genes and primers used for quantitative real time PCR.

Gene Protein Acronym Primers (50 ? 30) Accession No.

gusb Glucuronidase, beta GUSB FW:GCAAGACATCGGGCTGGTGA NM_010368.1REV:TGGCACTGGGAACCTGAAGT

nos2 Nitric oxide synthase 2, inducible iNOS FW:AGCCCCGCTACTACTCCATC NM_010927.3REV:GCCACTGACACTTCGCACAA

tnf Tumor necrosis factor TNF-a FW:AACTTCGGGGTGATCGGTCC NM_001278601.1REV:TGGTTTGTGAGTGTGAGGGTCT

ptgs2 Prostaglandin-endoperoxide synthase 2 Cox-2 FW:CATGGGTGTGAAGGGAAATAAGGA NM_011198.3REV:GGTGAAGTGCTGGGCAAAGA

114 J.E. Rayahin et al. / European Journal of Pharmaceutical Sciences 65 (2014) 112–121

of inflammatory proteins, iNOS, Cox-2 and TNF-a, at the mRNAlevel. Melittin and GST-melittin each decrease inflammatory geneexpression compared to untreated, unstimulated macrophages.At equal doses (300 nM), inflammatory gene expression after 4 his significantly reduced relative to LPS stimulated macrophagesthat have not been treated (Fig. 4A–C). In both iNOS (Fig. 4A) andTNF-a expression (Fig. 4B), a significant difference in expressionof these genes was observed between the GST-melittin treatedgroup and the native protein treated groups, suggesting equiva-lence of both proteins in this regard. Although stimulated cellstreated with GST-melittin have a slightly increased Cox-2 expres-sion compared to those treated with the native peptide, Cox-2expression is still significantly reduced from the untreated group(Fig. 4C). These findings suggest that GST-melittin is as efficaciousas the native peptide in decreasing iNOS and TNF-a gene expres-sion in J774A.1 macrophages and shows significant decreases inCox-2 expression from untreated cells. All other treatment groupsshowed no statistical differences with the untreated, unstimulatedmacrophages.

3.4. GST-melittin maintains anti-inflammation at toxic concentrationsof native melittin

Because we saw equivalence of the GST-melittin and nativemelittin in decreasing inflammatory gene expression and nitricoxide formation at non-toxic dose of native melittin, we exploredwhether or not GST-melittin would maintain anti-inflammationat a 10-fold dose increase. At a 3 lM native melittin dose, macro-phages do not maintain viability with or without LPS stimulation(Fig. 1A). GST-melittin, on the other hand, maintains cellular viabil-ity (Fig. 1B) and GST-melittin also decreases nitric oxide formationat this concentration (Fig. 3). At toxic concentrations of the nativepeptide, GST-melittin continues to decrease inflammatory geneexpression compared to untreated inflamed cells (Fig. 5A–C). Com-pared to LPS treated macrophages, macrophages transcribedreduced levels of inflammatory genes (p < 0.001). For concentrationsup to 3 lM in unstimulated macrophages, there were detectable

levels of inflammatory gene mRNA, but these levels were not sig-nificantly different from cells in the unstimulated state (Fig. 5A–C).

3.5. GST and melittin must be fused to maintain survival and anti-inflammation over increased doses

The differences in toxicities and viability of the cells treatedwith GST-melittin compared to those treated with the native pep-tide warranted investigation of the effect of fusion of the proteins.After cleavage of the GST from the melittin via a thrombin-cleav-able site (Buhrman et al., 2013b,c), we show decreases in cellularviability, interpreted as cell death, similar to the native peptideat these concentrations (Fig. 1C). Similarly, we show that nativepeptide with the addition of free GST maintains ability to kill(Fig. 1D). GST alone has no effect on cellular viability with or with-out LPS treatment (Fig. 1E). These findings suggest that the activityover increased concentrations of GST-melittin is due to the fusionof these proteins and not the activity after cleavage, which wouldhave resulted in reduced cellular viability, which was not observed.

3.6. GST-melittin has a reduced ability to inhibit LPS binding to cellscompared to native peptide

Mechanistically, it has been shown that cationic anti-microbialpeptides, such as melittin, have a unique ability to bind anionic LPSand prevent it from interacting with cells (Asthana et al., 2004;Hancock and Diamond, 2000; Srivastava et al., 2012). With thisin mind, we investigated the potential of this interaction withthe fusion protein. When incubated with FITC-LPS, we confirmedthat the native melittin peptide inhibits LPS binding to cells(Fig. 6). However, at the same concentration and the elevated con-centration examined throughout this manuscript, GST-melittin hassignificantly reduced ability to bind LPS with no statistical signifi-cant difference from LPS binding to cells (Fig. 6). This suggests thatthe fusion of the peptide to the GST may be inhibiting melittinfrom neutralizing LPS. LPS neutralization appears to be presentto a small degree, but the anti-inflammatory effect is more

Fig. 1. GST-melittin has no effect on macrophage survival while melittin kills macrophages at nanomolar concentrations. Viability of J774A.1 macrophages, as assessed by theMTS assay and presented as the experimental group relative to untreated control. Macrophages were treated in the absence (d) or presence (j of 2 lg/mL lipopolysaccharide(LPS) stimulation and various proteins: (A) native melittin, (B) GST-melittin, (C) GST-melittin pre-cleaved with thrombin, (D) GST mixed with equimolar native melittin, and(E) GST. Each point represents the mean plus or minus (±) the standard error of the mean of three independent experiments.

J.E. Rayahin et al. / European Journal of Pharmaceutical Sciences 65 (2014) 112–121 115

pronounced than would be expected for this level of LPSneutralization.

3.7. GST-melittin, but not GST, is taken up by macrophages

Native melittin has been shown to interact with the cell mem-brane (Dempsey, 1990b; Shai, 1999), but has also been shown tofacilitate intracellular uptake of small molecules and proteins,due to membrane insertion and pore-formation (Pan et al., 2011,2012, 2013, 2010). With this in mind, we investigated whetherthe fusion protein was localized intracellularly or on the mem-brane after 24 h of treatment. Macrophages internalized thefusion-protein, GST-melittin, but not GST alone or BSA (Fig. 7). Thissuggests that unlike the native peptide, the fusion protein actsintracellularly to exert its anti-inflammatory effects. Interestingly,fusion of both melittin and GST is necessary to elicit such high

amounts of protein uptake within the macrophage. While thereis uptake of GST, when macrophages are simultaneously treatedwith native melittin and labeled GST, it is minimal compared tothat of the fusion protein (Fig. 7).

4. Discussion

It is well known that melittin is a cell-lytic and toxic peptidethat has anti-inflammatory properties (Esmaeili et al., 2008). Ithas been shown that melittin, in its native form, at concentrationsunder 3 lM has anti-inflammatory properties, but validation of thetoxicity at these concentrations toward the cell-lines was notapparent (Mosser and Edwards, 2008; Park et al., 2004, 2007).We have observed that melittin, in its native form, has toxicity atconcentrations in the nanomolar range in macrophages havingpreviously shown similar toxicity in bacteria and cancer lines

Fig. 2. GST-melittin has no effect on macrophage permeability while native melittin permeates macrophages at nanomolar concentrations. Representative matched phasecontrast (top rows) and epifluorescence (bottom rows) micrographs of J774A.1 macrophages at varying times (columns) indicating morphology and permeability topropidium iodide. Untreated cells are presented for comparison (untreated; 2 top rows). Cells treated with GST-melittin (GST-melittin; middle 2 rows) do not show typicalsigns of permeability over one hour. Macrophage permeability and morphology change after treatment with the native melittin (melittin; bottom 2 rows) within 15 min oftreatment.

116 J.E. Rayahin et al. / European Journal of Pharmaceutical Sciences 65 (2014) 112–121

(Buhrman et al., 2013a,b,c, 2012). This is consistent with severalstudies in other cell types (Nah et al., 2007; Nishikawa andKitani, 2011; Soman et al., 2009). But melittin pore-formationcapabilities are dependent on membrane characteristics, whichcan vary by cell type (Dempsey, 1990a; Gordon-Grossman et al.,2012; Raghuraman and Chattopadhyay, 2004; Talbot et al.,1987), suggesting that toxicity will vary between cell types.

For macrophages, the observed overlap between toxicity andanti-inflammatory response for the native peptide makes itan unfavorable pharmacologic modulator of immune response.

Therefore, we sought to explore methods to improve the therapeuticresponse of the melittin peptide while maintaining its therapeuticeffects. While examining the use of GST-GSH interactions for con-trolling the release of melittin (Buhrman et al., 2013b,c, 2012), weobserved the diminished toxicity of GST-melittin fusion protein.We validated this finding in macrophages at fusion protein concen-trations up to 30 lM. Our ability to increase the non-toxic concen-trations of this peptide by two logs suggests that melittin as afusion protein may be more therapeutically applicable than thenative peptide, and so we sought to explore this idea further byexamining GST-melittin’s ability to modulate inflammation inJ774A.1 macrophages.

Macrophages are the workhorse of the inflammatory responseand create and modulate a multitude of signals to respond to stim-uli and control pathogenesis (Mosser and Edwards, 2008). Macro-phages can release potent chemical signals upon stimulation, oneof which, nitric oxide, can lead to excessive tissue toxicity anddamage when persistently released (Korhonen et al., 2005). Weshow that GST-melittin can significantly decrease the release ofthis potent chemical signal in macrophages that have been stimu-lated with LPS. GST-melittin can maintain this inhibition of NOproduction at toxic doses of the native peptide, reducing NO levelsto baseline.

The inhibition of the chemical mediator, NO, can be largely dueto the reduced expression of its production machinery, iNOS(Korhonen et al., 2005). We show that GST-melittin has the abilityto downregulate expression of this enzyme to the same extent asthe native peptide. Additionally, GST-melittin can downregulateexpression to near homeostatic levels at increased concentrations,unattainable by the native peptide due to its cell-lytic toxicity. Theability of GST-melittin to downregulate iNOS expression is excep-tionally significant, as once the inducible form of this enzyme has

Fig. 3. Nitric oxide synthesis of J774A.1 macrophages treated with native melittinand GST-melittin. Nitric oxide produced over 24 h after treatment was measured asits major oxidative metabolite, nitrite. All values are presented as mean plus orminus (±) the standard error of three independent experiments where ! reflects astatistically significant difference (p < 0.001) compared to LPS stimulated, untreated(no protein) macrophages and " reflects a statistically significant difference(p < 0.001) compared to unstimulated (LPS free), untreated (no protein)macrophages.

Fig. 4. Inflammatory gene expression in J774A.1 macrophages treated with native melittin or GST-melittin. Expression of inflammatory markers, iNOS (A), TNF-a (B), andCox-2 (C), in macrophages treated with 300 nM native melittin, GST-melittin, or no protein with and without inflammatory stimulus (LPS). mRNA levels were normalized tothe expression of the endogenous reference gene, b-glucuronidase. Values are presented as mean plus or minus (±) standard error of the mean of three independentexperiments where ! reflects a statistically significant difference (p < 0.001) compared to LPS stimulated, untreated (no protein) macrophages and " reflects a statisticallysignificant difference (p < 0.001) compared to unstimulated (LPS free), untreated (no protein) macrophages.

Fig. 5. Inflammatory gene expression in J774.1 macrophages treated with GST-melittin. Expression of inflammatory markers, iNOS (A), TNF-a (B), and Cox-2 (C), in J774A.1macrophages treated with no protein, 300 nM GST-melittin, or 3 lM GST-melittin with and without inflammatory stimulus (LPS). mRNA levels were normalized to theexpression of the endogenous reference gene b-glucuronidase. Values are presented as mean plus or minus (±) standard error of the mean of three independent experiments.Statistical significance where ! reflects a statistically significant difference (p < 0.001) compared to LPS stimulated, untreated (no protein) macrophages and " reflects astatistically significant difference (p < 0.001) compared to unstimulated (LPS free), untreated (no protein) macrophages.

J.E. Rayahin et al. / European Journal of Pharmaceutical Sciences 65 (2014) 112–121 117

been upregulated, it can synthesize significantly more NO thanphysiologic concentrations produced by the constitutive enzymesover longer periods of time (Moncada, 1999).

Other potent chemical mediators in inflammation due to LPS,such as prostaglandins, are produced by the Cox-2 enzymes(Simon, 1999). Cox-2 is significantly upregulated in macrophagesthat have been provoked, and results in the majority of prostaglan-din synthesis. In turn, the substantial over-production of prosta-glandins can result in tissue damage and pain (Davies et al.,1984; Ferreira, 1972). We show that GST-melittin can maintaindownregulated Cox-2 expression levels (relative to stimulatedcells) at several concentrations. This downregulated Cox-2 expres-sion suggests a potential role of GST-melittin in modulating notonly inflammation, but also, the wound healing process as wellas pain.

As a third significant marker of inflammation, we explored TNF-a, which is a central regulator in the inflammatory response(Bradley, 2008). We show that GST-melittin, like the native pep-tide, has the ability to downregulate expression of the TNF-a gene,to near baseline levels. TNF-a is widespread in pathogenesis of dis-eases beyond just inflammation, and has therefore been an effec-tive target for many diseases (Feldmann and Maini, 2003;Palladino et al., 2003; Tracey and Cerami, 1993).

We have chosen to look at these genes because they areexpressed to a large degree in inflammation. However, the implica-tions of the findings of this study are much wider than just inflam-mation. The mediators and genes studied have roles in other majorpathologies, including rheumatic disease and cancer (Dolcet et al.,2005; Tak and Firestein, 2001). Our observations warrant theinvestigation of the utility of GST-melittin in these pathologies aswell.

It is important to note that in the expression of the genes andthe production of NO, GST-melittin is only efficacious at higherconcentrations when linked as a chimeric fusion protein. Whenthe proteins have been cleaved from one another, the cell-lyticproperty of melittin is rescued. The fusion of the GST protein ontothe melittin peptide is thought to inhibit the aggregation of melit-tin due to steric hindrance of peptide association. This inhibits for-mation of secondary alpha-helical structure, which is necessary forpore formation and subsequent cell lysis (Lee et al., 2013; Lin andBaumgaertner, 2000). Our findings suggest that fusion proteins canbe used to modify toxicity and action of their parent proteins.Additionally, this poses significant potential in engineering offusion proteins of toxic peptides with disease specific cleavablesites to potentially controllably balance their toxic and therapeutic

properties. Because melittin and other cationic peptides have beenshown to bind LPS and prevent subsequent interaction with cells,we explored this avenue as a potential mechanism for ameliorationof the inflammatory response with our fusion protein.

When macrophages are treated with native melittin, there is,indeed, significant inhibition of LPS from interaction with macro-phages (Fig. 6). However, at the same concentration as the nativepeptide, GST-melittin has a significantly reduced inhibition of LPSfrom interaction with the cells. Since the LPS is well above the con-centration necessary for stimulation (Sweet and Hume, 1996), theapproximate 5% reduction in binding resulting from treatmentwith GST-melittin (0.3 lM) is not expected to account in wholefor the reduced inflammatory response. In fact, this inhibition ofLPS, is less than that of the native peptide (at the same concentra-tions) and not significantly different from cells treated with justthe FITC-LPS. However, GST-melittin remains as potently anti-inflammatory as the native peptide. Furthermore, although wesee similar inhibition of LPS binding with the native melittin(0.3 lM) and a higher concentration of GST-melittin (3 lM), thereis a significantly more potent anti-inflammatory response exhib-ited with treatment of the GST-melittin. This suggests that inhibi-tion of LPS binding to the cells is not the sole factor involved inameliorating the inflammatory response.

Macrophage internalization of GST-melittin but not of GST orBSA (Fig. 7) suggests that fusion of the GST to melittin may aid intherapeutic uptake of both melittin and GST into the cell. Althoughwe were focused on the melittin peptide, GST as a therapeutic pro-tein should not be ignored. It has been demonstrated that GST doeshave anti-inflammatory potential (Bentz et al., 2012; Yang et al.,2008). Additionally, when fused to other cargo, melittin has beenshown to facilitate cellular uptake (Pan et al., 2011, 2012, 2013,2010). Therefore, because macrophages selectively uptake theGST-melittin fusion protein, it is possible that GST may have a dualrole in prohibiting melittin’s pore-forming capability and simulta-neously aiding in the anti-inflammatory response. This could eluci-date the similar observed functional response between the nativepeptide and GST-melittin, but the decrease in inhibition of LPSinteraction with cells with the fusion protein.

Other mechanistic hypotheses focus on melittin as the activeanti-inflammatory agent. Melittin has traditionally been thoughtto act within the membrane and through cell membrane-based sig-naling and has been used to escape endocytosis (Hou et al., 2013;Ogris et al., 2001). It is clear that the cell-permeabilization isdiminished with the GST-melittin fusion protein. Other hypothesesthat remain as to the mechanism of action and our future studies:(1) melittin-fusion protein monomers within the membrane havethe ability to signal through a mechanism similar to the melittinpeptide or (2) intracellular melittin signaling through a yet-unknown mechanism. Desipte evidence demonstrating the cellularuptake of glutathione S-transferases (Morris et al., 2011; Namikiet al., 2003), our results clearly show that GST is not taken up bycells when melittin is not part of the protein. Further insight intothe sub-cellular localization of GST-melittin may more clearly elu-cidate the role of the fusion protein in protection against toxicity ofthe peptide. Delineating the mechanisms for cell entry will allowfor the rational design of fusion proteins for intracellular delivery.

Although our findings are promising, they are not without cer-tain potential in vivo limitations. Exogenously administered pro-tein therapeutics, such as the GST-melittin, can be immunogenic,which could lead to neutralizing the immunomodulatory activityof GST-melittin. Preliminary antibody testing to the fusion proteinas a whole or parts of the fusion protein (either GST or melittin)will be necessary before administration to avoid a potentiallyimmunogenic reaction. Purification of the protein in eukaryoticcells, such as Chinese hamster ovary (CHO) cells, may also reducelikelihood of potential immunogenicity. Careful in vitro stability

Fig. 6. Inhibition of LPS interaction with J774A.1 macrophages. Cells were treatedwith FITC-LPS after functional concentrations of native melittin (300 nM; Green)and GST-melittin (300 nM, dark blue, and 3 lM, light blue). FITC-LPS in solutionwas measured. All values are presented as the mean FITC-LPS remaining in thebuffer plus or minus (±) the standard error of three independent experimentswhere ! reflects a statistically significant difference (p < 0.05) compared to FITC-LPStreated native melittin treated macrophages, and "" reflects a statistically signif-icant difference (p < 0.01) compared to FITC-LPS (no protein) treated macrophages.(For interpretation of the references to colour in this figure legend, the reader isreferred to the web version of this article.)

118 J.E. Rayahin et al. / European Journal of Pharmaceutical Sciences 65 (2014) 112–121

testing as well as immunogenicity testing will help avoid manypotential pitfalls of in vivo administration of this protein.

5. Conclusions

Utilization of native melittin for anti-inflammation has metchallenges due to its toxic properties. Our results demonstratedthat compared to the native peptide, GST-melittin has reducedpore-forming capabilities. The reduction in its toxicity has no effecton its anti-inflammatory properties. We have confirmed that GST-melittin and native melittin have similar anti-inflammatory prop-erties at sub-lytic concentrations. The reduced toxicity of thefusion protein allows the use of concentrations of the protein inexcess of at least two logs. Anti-inflammatory properties of theprotein are augmented at higher concentrations, too toxic to usewith the native peptide. Our investigation warrants further mech-

anistic exploration, but suggests that fusion proteins of other cell-lytic peptides may act similarly. We conclude that GST-melittin is anon-toxic alternative to native melittin for use in macrophage-mediated inflammation due to LPS.

Acknowledgements

This investigation was conducted in a facility constructed withsupport from Research Facilities Improvement Program Grant (C06RR15482) from the National Centre for Research Resources (NCRR)of the National Institutes of Health (NIH). This research has beenfunded, in part, by the University of Illinois at Chicago Center forClinical and Translational Science (CCTS) award supported by theNCRR (UL1 TR000050, RAG, JSB). JER and JSB were partially fundedby the Chancellor’s Graduate Research Fellowship. Additionally,the authors thank Dr. Debra A. Tonetti for use of equipment, Yu

Fig. 7. GST-melittin is internalized by J774A.1 macrophages after 24 h. Representative pseudocolored confocal micrographs of macrophages treated with BSA (green), GST(green), GST (green) and native melittin, or GST-melittin (green) after 24 exposure. The nuclei (blue; left column), protein (green, middle column), and the pseudocoloredcomposite image (right column) were labeled to indicate their presence within the cells. The scale bar in each image is 10 lm. (For interpretation of the references to colour inthis figure legend, the reader is referred to the web version of this article.)

J.E. Rayahin et al. / European Journal of Pharmaceutical Sciences 65 (2014) 112–121 119

Zhang for technical assistance, and the anonymous reviewers fortheir suggestions significantly improving the manuscript.

References

Asthana, N., Yadav, S.P., Ghosh, J.K., 2004. Dissection of antibacterial and toxicactivity of melittin: a leucine zipper motif plays a crucial role in determining itshemolytic activity but not antibacterial activity. J. Biol. Chem. 279, 55042–55050.

Barltrop, J.A., Owen, T.C., Cory, A.H., Cory, J.G., 1991. 5-(3-carboxymethoxyphenyl)-2-(4,5-dimethylthiazolyl)-3-(4-sulfophenyl)tetrazolium, inner salt (Mts) andrelated analogs of 3-(4,5-dimethylthiazolyl)-2,5-diphenyltetrazolium bromide(Mtt) reducing to purple water-soluble formazans as cell-viability indicators.Bioorg. Med. Chem. Lett. 1, 611–614.

Basle, E., Joubert, N., Pucheault, M., 2010. Protein chemical modification onendogenous amino acids. Chem. Biol. 17, 213–227.

Bechinger, B., 1997. Structure and functions of channel-forming peptides:magainins, cecropins, melittin and alamethicin. J. Membr. Biol. 156, 197–211.

Bechinger, B., Lohner, K., 2006. Detergent-like actions of linear amphipathic cationicantimicrobial peptides. Biochim. Biophys. Acta 1758, 1529–1539.

Bentz, M., Zaouter, C., Shi, Q., Fahmi, H., Moldovan, F., Fernandes, J.C., Benderdour,M., 2012. Inhibition of inducible nitric oxide synthase prevents lipidperoxidation in osteoarthritic chondrocytes. J. Cell. Biochem. 113, 2256–2267.

Boulianne, G.L., Isenman, D.E., Hozumi, N., Shulman, M.J., 1987. Biological propertiesof chimeric antibodies. Interaction with complement. Mol. Biol. Med. 4, 37–49.

Bradley, J.R., 2008. TNF-mediated inflammatory disease. J. Pathol. 214, 149–160.Buhrman, J.S., Cook, L.C., Rayahin, J.E., Federle, M.J., Gemeinhart, R.A., 2013a. Active,

soluble recombinant melittin purified by extracting insoluble lysate ofEscherichia coli without denaturation. Biotechnol. Prog. 29, 1150–1157.

Buhrman, J.S., Cook, L.C., Rayahin, J.E., Federle, M.J., Gemeinhart, R.A., 2013b.Proteolytically activated anti-bacterial hydrogel microspheres. J. Control.Release 171, 288–295.

Buhrman, J.S., Rayahin, J.E., Cook, L.C., Federle, M.J., Gemeinhart, R.A., 2013c. Active,soluble recombinant melittin purified by extracting insoluble lysate ofEscherichia coli without denaturation. Biotechnol. Prog. 29, 1150–1157.

Buhrman, J.S., Rayahin, J.E., Köllmer, M., Gemeinhart, R.A., 2012. In-housepreparation of hydrogels for batch affinity purification of glutathione S-transferase tagged recombinant proteins. BMC Biotechnol. 12, 63.

Cooper, D.K., 1996. Xenotransplantation – state of the art. Front. Biosci. 1, d248–d265.

Cory, A.H., Owen, T.C., Barltrop, J.A., Cory, J.G., 1991. Use of an aqueous solubletetrazolium formazan assay for cell-growth assays in culture. Cancer Commun.3, 207–212.

Czajkowsky, D.M., Hu, J., Shao, Z., Pleass, R.J., 2012. Fc-fusion proteins: newdevelopments and future perspectives. EMBO Mol. Med. 4, 1015–1028.

Davies, P., Bailey, P.J., Goldenberg, M.M., Ford-Hutchinson, A.W., 1984. The role ofarachidonic acid oxygenation products in pain and inflammation. Annu. Rev.Immunol. 2, 335–357.

Dempsey, C.E., 1990a. The actions of melittin on membranes. Biochim. Biophys.Acta 1031, 143–161.

Dempsey, C.E., 1990b. The actions of melittin on membranes. Biochim. Biophys.Acta 1031, 143–161.

Dolcet, X., Llobet, D., Pallares, J., Matias-Guiu, X., 2005. NF–kB in development andprogression of human cancer. Virchows Arch. 446, 475–482.

Esmaeili, F., Ghahremani, M.H., Esmaeili, B., Khoshayand, M.R., Atyabi, F., Dinarvand,R., 2008. PLGA nanoparticles of different surface properties: preparation andevaluation of their body distribution. Int. J. Pharm. 349, 249–255.

Feldmann, M., Maini, R.N., 2003. Lasker clinical medical research award. TNFdefined as a therapeutic target for rheumatoid arthritis and other autoimmunediseases. Nat. Med. 9, 1245–1250.

Ferreira, S.H., 1972. Prostaglandins, aspirin-like drugs and analgesia. Nat. New Biol.240, 200–203.

Gordon, S., Taylor, P.R., 2005. Monocyte and macrophage heterogeneity. Nat. Rev.Immunol. 5, 953–964.

Gordon-Grossman, M., Zimmermann, H., Wolf, S.G., Shai, Y., Goldfarb, D., 2012.Investigation of model membrane disruption mechanism by melittin usingpulse electron paramagnetic resonance spectroscopy and cryogenictransmission electron microscopy. J. Phys. Chem. B 116, 179–188.

Hancock, R.E., Diamond, G., 2000. The role of cationic antimicrobial peptides ininnate host defences. Trends Microbiol. 8, 402–410.

Hodgson, E., 2012. Toxins and venoms. Prog. Mol. Biol. Transl. Sci. 112, 373–415.Hou, K.K., Pan, H., Ratner, L., Schlesinger, P.H., Wickline, S.A., 2013. Mechanisms of

nanoparticle-mediated siRNA transfection by melittin-derived peptides. ACSNano 7, 8605–8615.

Karin, M., Lawrence, T., Nizet, V., 2006. Innate immunity gone awry: linkingmicrobial infections to chronic inflammation and cancer. Cell 124, 823–835.

Klocek, G., Schulthess, T., Shai, Y., Seelig, J., 2009. Thermodynamics of melittinbinding to lipid bilayers. Aggregation and pore formation. Biochemistry 48,2586–2596.

Korhonen, R., Lahti, A., Kankaanranta, H., Moilanen, E., 2005. Nitric oxide productionand signaling in inflammation. Curr. Drug Targets Inflamm. Allergy 4, 471–479.

Krishnamoorthy, S., Honn, K.V., 2006. Inflammation and disease progression. CancerMetastasis Rev. 25, 481–491.

Kwon, Y.B., Lee, H.J., Han, H.J., Mar, W.C., Kang, S.K., Yoon, O.B., Beitz, A.J., Lee, J.H.,2002. The water-soluble fraction of bee venom produces antinociceptive andanti-inflammatory effects on rheumatoid arthritis in rats. Life Sci. 71, 191–204.

Lee, J.D., Kim, S.Y., Kim, T.W., Lee, S.H., Yang, H.I., Lee, D.I., Lee, Y.H., 2004. Anti-inflammatory effect of bee venom on type II collagen-induced arthritis. Am. J.Chin. Med. 32, 361–367.

Lee, M.T., Sun, T.L., Hung, W.C., Huang, H.W., 2013. Process of inducing pores inmembranes by melittin. Proc. Nat. Acad. Sci. USA 110, 14243–14248.

Lin, J.H., Baumgaertner, A., 2000. Stability of a melittin pore in a lipid bilayer: amolecular dynamics study. Biophys. J. 78, 1714–1724.

Means, G.E., Feeney, R.E., 1990. Chemical modifications of proteins: history andapplications. Bioconjug. Chem. 1, 2–12.

Medzhitov, R., 2008. Origin and physiological roles of inflammation. Nature 454,428–435.

Mohit, E., Rafati, S., 2012. Chemokine-based immunotherapy: delivery systems andcombination therapies. Immunotherapy 4, 807–840.

Moncada, S., 1999. Nitric oxide: discovery and impact on clinical medicine. J. Roy.Soc. Med. 92, 164–169.

Morris, M.J., Liu, D., Weaver, L.M., Board, P.G., Casarotto, M.G., 2011. A structuralbasis for cellular uptake of GST-fold proteins. PLoS ONE 6, e17864.

Morrison, S.L., Johnson, M.J., Herzenberg, L.A., Oi, V.T., 1984. Chimeric humanantibody molecules: mouse antigen-binding domains with human constantregion domains. Proc. Nat. Acad. Sci. USA 81, 6851–6855.

Mosser, D.M., Edwards, J.P., 2008. Exploring the full spectrum of macrophageactivation. Nat. Rev. Immunol. 8, 958–969.

Nah, S.S., Ha, E., Lee, H.J., Chung, J.H., 2007. Inhibitory effects of melittin on theproduction of lipopolysaccharide-induced matrix metalloproteinase 3 in humanosteoarthritic chondrocytes. Toxicon 49, 881–885.

Namiki, S., Tomida, T., Tanabe, M., Iino, M., Hirose, K., 2003. Intracellular delivery ofglutathione S-transferase into mammalian cells. Biochem. Biophys. Res.Commun. 305, 592–597.

Nathan, C., 2002. Points of control in inflammation. Nature 420, 846–852.Nishikawa, H., Kitani, S., 2011. Gangliosides inhibit bee venom melittin cytotoxicity

but not phospholipase A(2)-induced degranulation in mast cells. Toxicol. Appl.Pharmacol. 252, 228–236.

Ogris, M., Carlisle, R.C., Bettinger, T., Seymour, L.W., 2001. Melittin enables efficientvesicular escape and enhanced nuclear access of nonviral gene delivery vectors.J. Biol. Chem. 276, 47550–47555.

Orsolic, N., 2012. Bee venom in cancer therapy. Cancer Metastasis Rev. 31, 173–194.Palladino, M.A., Bahjat, F.R., Theodorakis, E.A., Moldawer, L.L., 2003. Anti-TNF-alpha

therapies: the next generation. Nat. Rev. Drug. Discov. 2, 736–746.Pan, H., Ivashyna, O., Sinha, B., Lanza, G.M., Ratner, L., Schlesinger, P.H., Wickline,

S.A., 2011. Post-formulation peptide drug loading of nanostructures for meteredcontrol of NF-kappaB signaling. Biomaterials 32, 231–238.

Pan, H., Marsh, J.N., Christenson, E.T., Soman, N.R., Ivashyna, O., Lanza, G.M.,Schlesinger, P.H., Wickline, S.A., 2012. Postformulation peptide drug loading ofnanostructures. Methods Enzymol. 508, 17–39.

Pan, H., Myerson, J.W., Hu, L., Marsh, J.N., Hou, K., Scott, M.J., Allen, J.S., Hu, G., SanRoman, S., Lanza, G.M., Schreiber, R.D., Schlesinger, P.H., Wickline, S.A., 2013.Programmable nanoparticle functionalization for in vivo targeting. FASEB J. 27,255–264.

Pan, H., Myerson, J.W., Ivashyna, O., Soman, N.R., Marsh, J.N., Hood, J.L., Lanza, G.M.,Schlesinger, P.H., Wickline, S.A., 2010. Lipid membrane editing with peptidecargo linkers in cells and synthetic nanostructures. FASEB J. 24, 2928–2937.

Park, H.J., Lee, S.H., Son, D.J., Oh, K.W., Kim, K.H., Song, H.S., Kim, G.J., Oh, G.T., Yoon,D.Y., Hong, J.T., 2004. Antiarthritic effect of bee venom: inhibition ofinflammation mediator generation by suppression of NF-kappaB throughinteraction with the p50 subunit. Arthritis Rheum. 50, 3504–3515.

Park, H.J., Son, D.J., Lee, C.W., Choi, M.S., Lee, U.S., Song, H.S., Lee, J.M., Hong, J.T.,2007. Melittin inhibits inflammatory target gene expression and mediatorgeneration via interaction with IkappaB kinase. Biochem. Pharmacol. 73, 237–247.

Pratt, J.P., Ravnic, D.J., Huss, H.T., Jiang, X., Orozco, B.S., Mentzer, S.J., 2005. Melittin-induced membrane permeability: a nonosmotic mechanism of cell death. InVitro Cell. Dev. Biol. Anim. 41, 349–355.

Raghuraman, H., Chattopadhyay, A., 2004. Interaction of melittin with membranecholesterol: a fluorescence approach. Biophys. J. 87, 2419–2432.

Sadelain, M., Brentjens, R., Riviere, I., 2013. The basic principles of chimeric antigenreceptor design. Cancer Discov. 3, 388–398.

Santo, K.P., Berkowitz, M.L., 2012. Difference between magainin-2 and melittinassemblies in phosphatidylcholine bilayers: results from coarse-grainedsimulations. J. Phys. Chem. B 116, 3021–3030.

Schenborn, E., Groskreutz, D., 1999. Reporter gene vectors and assays. Mol.Biotechnol. 13, 29–44.

Schmittgen, T.D., Livak, K.J., 2008. Analyzing real-time PCR data by the comparativeC(T) method. Nat. Protoc. 3, 1101–1108.

Serhan, C.N., Savill, J., 2005. Resolution of inflammation: the beginning programsthe end. Nat. Immunol. 6, 1191–1197.

Shai, Y., 1999. Mechanism of the binding, insertion and destabilization ofphospholipid bilayer membranes by alpha-helical antimicrobial and cell non-selective membrane-lytic peptides. Biochim. Biophys. Acta 1462, 55–70.

Shin, S.U., Morrison, S.L., 1989. Production and properties of chimeric antibodymolecules. Methods Enzymol. 178, 459–476.

Simon, L.S., 1999. Role and regulation of cyclooxygenase-2 during inflammation.Am. J. Med. 106, 37S–42S.

120 J.E. Rayahin et al. / European Journal of Pharmaceutical Sciences 65 (2014) 112–121

Soman, N.R., Baldwin, S.L., Hu, G., Marsh, J.N., Lanza, G.M., Heuser, J.E., Arbeit, J.M.,Wickline, S.A., Schlesinger, P.H., 2009. Molecularly targeted nanocarriers deliverthe cytolytic peptide melittin specifically to tumor cells in mice, reducing tumorgrowth. J. Clin. Invest. 119, 2830–2842.

Srivastava, R.M., Srivastava, S., Singh, M., Bajpai, V.K., Ghosh, J.K., 2012.Consequences of alteration in leucine zipper sequence of melittin in itsneutralization of lipopolysaccharide-induced proinflammatory response inmacrophage cells and interaction with lipopolysaccharide. J. Biol. Chem. 287,1980–1995.

Sweet, M.J., Hume, D.A., 1996. Endotoxin signal transduction in macrophages. J.Leukoc. Biol. 60, 8–26.

Tak, P.P., Firestein, G.S., 2001. NF-kappaB: a key role in inflammatory diseases. J.Clin. Invest. 107, 7–11.

Talbot, J.C., Faucon, J.F., Dufourcq, J., 1987. Different states of self-association ofmelittin in phospholipid bilayers. A resonance energy transfer approach. Eur.Biophys. J. 15, 147–157.

Tracey, K.J., Cerami, A., 1993. Tumor necrosis factor, other cytokines and disease.Annu. Rev. Cell Biol. 9, 317–343.

van den Bogaart, G., Guzman, J.V., Mika, J.T., Poolman, B., 2008. On the mechanismof pore formation by melittin. J. Biol. Chem. 283, 33854–33857.

Yang, L., Harroun, T.A., Weiss, T.M., Ding, L., Huang, H.W., 2001. Barrel-stave modelor toroidal model? A case study on melittin pores. Biophys. J. 81, 1475–1485.

Yang, Y., Xu, Y., Lick, S.D., Awasthi, Y.C., Boor, P.J., 2008. Endothelial glutathione-S-transferase A4-4 protects against oxidative stress and modulates iNOSexpression through NF-kappaB translocation. Toxicol. Appl. Pharmacol. 230,187–196.

J.E. Rayahin et al. / European Journal of Pharmaceutical Sciences 65 (2014) 112–121 121