Gut 1993; 34: 1593-1597

Expression of intercellular adhesion molecule 1

(ICAM-1, CD54) in colonic epithelial cells

W Dippold, B Wittig,W Schwaeble, W Mayet, K-H Meyer zum Buschenfelde

AbstractThe expression of intercellular adhesionmolecule-I (ICAM-1, CD54) was examined in16 surgically removed colonic tumours and twocolonic carcinoma cell lines. Immunohisto-chemistry showed a varying percentage ofICAM-1 positive colonic carcinoma cells in9/16 tissue specimens, while normal colonictissue (apart from a slight reactivity of endo-thelial cells) was not stained. The presence ofthe ICAM-1 niolecule on the cell surface andthe expression ofICAM-1 mRNA were investi-gated for two colonic carcinoma cell lines. Itwas possible to enhance the expression ofICAM-1 considerably by incubating the cellsin the presence of inflammatory cytokines inHT-29 and CaCo-2 cells. The responsivenessto either interferon a (IFN-a), tumour necrosisfactor a (TNF-a), or interleukin ,13 (IL-12)treatment was different in each cell line.Interestingly, ICAM-1 is shed by colonic car-cinoma cells because soluble sICAM-1 wasdetected in the cell culture supernatants. Incomparison with normal serum samples, themean value of sICAM-1 in 63 samples ofpatients with colonic carcinoma and in 20cases of active inflammatory bowel disease israised about twofold. It remains to be clarifiedwhat part both forms of ICAM-1 play in thecourse of colonic cancer, ulcerative colitis,and Crohn's disease.(Gut 1993; 34: 1593-1597)

I Medizinische Klnik undPoliklinik, Johannes-Gutenberg-Universitat,Mainz, GermanyW DippoldB WittigW SchwaebleW MayetK-H Meyer zum

BuschenfeldeCorrespondence to:Professor DrW Dippold,I Medizinische Klinik,Johannes-Gutenberg-Universitat,Langenbeckstrafie 1, D-6500Mainz, Germany.Accepted for publication26 March 1993

ICAM-1, the intercellular adhesion molecule-Irepresents a cell surface bound glycoprotein of70 to 110 kilodaltons (kDa). It mediates adhesiondependent cell to cell interactions and isexpressed on haematopoietic cells such as tissuemacrophages, monocytes, B-cells, activatedT-cells, germinal centre dendritic cells in tonsils,lymph nodes, and Peyer's patches, as well as on

non-haematopoietic cells such as vascular endo-thelial cells, thymic epithelial cells, certainother epithelial cells, and fibroblasts. ' Theexpression of ICAM- 1 and two of its counterreceptors, the lymphocyte function associatedantigen-I (LFA-1, CDlla/CD18) and thecomplement receptor type-3 (CR-3, MAC-1,CD1lb/CD18) was shown to be essential formost of the lymphocyte/lymphocyte, lympho-cyte/phagocyte, and leucocyte/endothelial cellinteractions in the immune response.2 Moreover,ICAM-1 participates in the transient adhesion ofleucocytes to the vascular endothelium andmediates, in part, granulocyte extravasation.Previous reports on fibroblasts and monocytictumour cell lines, for example, have shown thatinflammatory cytokines such as interleukin 1B(IL-i 13) , tumour necrosis factor a (TNF-a), and

interferon y (INF-y) induce or enhance theexpression of ICAM-1.3 In inflammatory boweldisease an increased expression of ICAM-1 onmucosal mononuclear phagocytes on colonicbiopsy specimens was shown to be associatedwith the maintenance of chronic inflammation4and the induction of ICAM-1 expression hasbeen seen on bile duct epithelium, endothelium,and hepatocytes of liver allografts undergoingacute rejection.5 In previous reports an expres-sion of ICAM- 1 was seen on neoplastic cells ofvarious origins including gastric and pancreaticcarcinoma.'3 A considerable expression ofICAM-1 was also seen on fibrous tissue in thevicinity of carcinoma cells and on tumour infil-trating lymphoid cells.'4 For melanoma, it hasbeen shown that the de novo expression ofICAM- 1 correlates with an increased risk ofmetastasis.'0Most recently, a soluble form of the usually

membrane bound ICAM-1 molecule wasdetected in human serum samples.'5 The cellularsource of soluble ICAM- 1 (sICAM-1) in samplesof healthy blood donors seemed to be frommononuclear cells, because sICAM- 1 was onlydetectable in cell culture supernatants oflymphoid cell lines and peripheral blood mono-nuclear cell cultures. Raised values of sICAM-1have been reported in samples of patients withmelanoma,'6 rheumatoid arthritis, systemiclupus erythematosus, metastatic cancer, andacute urolithiasis.'7

In this study, we show that de novo expressionof ICAM-1 occurs in association with coloniccarcinoma and that colonic carcinoma cellsexpress both forms of ICAM-1, the usualmembrane bound ICAM-1 on their cell surfaceand the soluble sICAM-1 as detected in the cellculture supernatants of colonic carcinomacell lines. Enhanced sICAM- 1 values were foundin serum samples of patients with coloniccarcinoma and active inflammatory boweldisease.

Materials and methods

CELL LINES, MEDIUM, REAGENTS, CYTOKINES,ANTIBODIES, AND SICAM-I ELISAThe colonic carcinoma cell lines HT-29 andCaCo-2 were donated by Dr L Old, MemorialSloan-Kettering Cancer Center New York,USA, and Dr Franke, Deutsches Krebsfor-schungszentrum Heidelberg, Germany.

All cell lines were cultured in CLICK-RPMI1640 (CMRL) medium containing 10% basalmedium supplement, Seromed (Berlin,Germany). Basal medium supplement is amedium supplement that contains definedamounts of salt, aminoacids, D-glucose,

1593

on August 19, 2021 by guest. P

rotected by copyright.http://gut.bm

j.com/

Gut: first published as 10.1136/gut.34.11.1593 on 1 N

ovember 1993. D

ownloaded from

Dippold, Wittig, Schwaeble, Mayet, MeyerzumBuschenfelde

vitamins, peptides, and growth factors asdescribed in the company's catalogue. Recom-binant IFN-y was supplied by Boehringer(Mannheim, Germany); recombinant IL-1l3from Behring (Marburg, Germany), and recom-binant TNF-a from Thomae (Biberach,Germany). All three cytokines were expressionproducts purified from recombinant Escherichiacoli (E coli) strains. Incubation time and concen-tration of cytokines were chosen according tooptimal responses known for the ICAM-1upregulation on other tumour cell lines.'7 18Monoclonal anti-ICAM-1 antibody mAB 7F7was kindly provided by Dr M P Dierich(Innsbruck, Austria); as an additional control weused a different anti-ICAM-1 antibody, mAB84H10, which was purchased from Dianova(Hamburg, Germany). The sICAM-1 enzymelinked immunosobent assay (ELISA) used todetermine sICAP4-l in the cell culture super-natants, in serum samples of healthy blooddonors and patients was supplied by Bender MedSystems (Vienna, Austria). Diluted samples aswell as undiluted and concentrated cell culturesupernatants were assayed according to theprotocol enclosed. Monoclonal antibody mAbR-24'9 recognising the ganglioside GD3 onmalignant melanoma cells was used as a negativecontrol. Monoclonal antibody mAb W6/32 aspositive control reactive with human histocom-patibility antigen determinants was purchasedfrom Sera Laboratories (Crawley Down, UK).For immunofluorescence, we used the GAM-FITC antibody 6602159 from Coulter Immun-ology (Hialeah, USA). The tests were performedin LAB-TEK slides as described earlier.20

IMMUNOSTAINING OF ICAM- 1 ON TISSUES ANDCELLSCryostat sections and cells were tested byindirect immunoperoxidase assays usingrabbit anti-mouse antibody P260 Dakopatts(Hamburg, Germany) and the substrate3-amino-9-ethylcarbazol Sigma (Deisenhofen,Germany) as an indicator system as describedelsewhere.2' Normal colonic tissue and tissuesfrom inflammatory bowel disease and colorectaltumours were obtained from the department ofsurgery at our university.To investigate the cell surface expression of

ICAM-1 on colonic cancer cell lines, cells weredetached from confluent cultures by 0 05%ethylenediaminetetraacetic acid in phosphatebuffered saline, washed once with CMRLmedium, resuspended in CMRL mediumsupplemented with 10% basal medium supple-ment, and adjusted to 105 cells per ml medium,as described elsewhere.20 CMRL medium (200p1), containing 2x 104 cells per well, was platedon LAB-TEK no 4808 tissue culture slides fromVWR Scientific (Naperville, USA) in the pres-ence or absence of the tested cytokines, andcultured for 24 hours at 370C/5%C02 and highhumidity. Cell surface expression was tested onunfixed cells and was performed according to themethod described above.

RIBONUCLEIC ACID EXTRACTION AND NORTHERNBLOT ANALYSISTotal ribonucleic acid was prepared fromexponentially growing cells according to standardmethods,22 assessed by measuring the absorbanceat 260 nm, separated on a formaldehyde contain-ing agarose gel, and blotted to nylon filters.

Agarose gel electrophoresis, ribonucleic acidtransfer, and hybridisation of blots were per-formed by standard techniques.23 The filterswere probed with a 1 2 kb long Xba-1/Pst-1restriction fragment ofcDNA clone pICAM-1,24kindly supplied by Dr B Seed (Boston, USA).The complementary DNA (cDNA) was labelledwith P32-dATP using the random primingmethod25 and used at a concentration of 5 x 106cpm of labelled cDNA per millilitre hybridisa-tion solution. Hybridisation was performed at65°C without formamide. The washing of thenorthern blots was carried out according tostandard methods.23 The last washing step wasperformed in 0 3xSSC/0 1% SDS for one hourat 65°C. As previously described, the northernblot results were normalised by rehybridising thefilters with a P32-labelled oligonucleotide(5'AACGATCAGAGTAGTGGTATTTCACC3') that corresponds with the 28s ribosomalribonucleic acid.26 This probe had been shown tobe better than actin as a control for the amountand quality of total ribonucleic acid loaded.Kinase labelling, hybridisation, and washing ofthe blots was performed at 42°C according tostandard procedures.23

~~i7~~~ SF o;4 V Ehb*f--5

Figure 1: Expression ofICAM-1 on normal colon, carcinoma, and ulcerative colitis. Cryostat sections were stained by mAb7F7. (A) Colonic cancer: immunostaining oftumour cells, most prominent at the basement membrane. (B) Normal colon: noICAM-1 staining. (C) Ulcerative colitis: immunostaining ofinflammatory phagocytic cells.

1594

on August 19, 2021 by guest. P

rotected by copyright.http://gut.bm

j.com/

Gut: first published as 10.1136/gut.34.11.1593 on 1 N

ovember 1993. D

ownloaded from

Expression ofintercellular adhesion molecule 1 (ICAM-1, CDS4) in colonic epithelial cells

1 2 3 4 5 6 7 8

_

.| .0 D h

B

4 9.5n 7.5

4 4.4

24

41.4

024 kb

1 28s rRNA

Figure 2: Northern blot analysis of total ribonucleic acid preparedfrom HT-29 and CaCo-2cells after culturingfor 24 hours in presence ofIFN-y (100 Ulml), IL-If3 (100 Ulml), TNF-a(10 nglml) or in absence ofcytokines (0). For each lane 20 pg oftotal ribonucleic acid wereloaded. (A) 1, HT-29 (0); 2, HT-29 (TNF-a); 3, HT-29 (IFN-y); 4, HT-29 (IL-1p); 5,CaCo-2 (0); 6, Ca-Co-2 (TNF-ct); 7, CaCo-2 (IFN-y), CaCo-2 (IL-1 1). (B)Normalisationofthe above shown northern blot using an oligonucleotide probe corresponding to 28s rRNA.

SERUM SAMPLESSerum samples were obtained from healthyblood donors, patients with metastatic colorectalcarcinoma without evidence of infection, andfrom patients with inflammatory bowel disease.The BEST index27 was used to evaluate activityand severity of Crohn's disease. It contains eightindices such as abdominal pain, number ofliquid stools, score of general well being, andothers. This index estimates predominantlypatients' complaints (BEST>150=activedisease).

Results

DE NOVO EXPRESSION OF ICAM- 1 IN COLONICTISSUESThe expression of ICAM-1 was examined oncolonic epithelial tissues, cryostat sections ofnormal colon (i2 specimens), ofulcerative colitis(2) and Crohn's disease (2), and 16 tumourtissues of patients with primary colorectalcarcinoma were stained with both antibodies,mAb 7F7 and mAb 84H10. As shown in FigureIA, a varying percentage (10-70%) of coloniccarcinoma cells showed a strong staining at thebasement membrane site ofthe tumour cells withboth antibodies. In contrast, normal colon tissue(beside a marginal staining of the blood vesselendothelium) did not react with antibodiesdirected against ICAM-1 (Fig 1C). In tissuespecimens of chronic inflammatory boweldisease ICAM-1 expression (Fig iB) was onlydetectable on the inflammatory mononuclearcells, but not close to epithelial cells.

DETECTION OF ICAM-1 mRNA IN COLONCARCINOMA CELL LINESTotal ribonucleic acid preparations from the twocolonic tumour cell lines were subjected tonorthern blot analysis to investigate whetherthey expressed mRNA for ICAM-1. Figure 2Ashows that ICAM-1 mRNA was abundantlyexpressed in untreated HT-29 and CaCo-2colonic cancer cells.To find out whether cytokine treatment would

modulate ICAM-1 expression in HT-29 andCaCo-2 cells, each of the cell lines was incubatedfor 24 hours in the absence or presence of IFN-y(100 U/ml), IL-1,B (100 U/ml), or TNF-ct (10 ng/ml). The highest abundance of mRNA forICAM-1 was obtained with IFN-y in HT-29cells. Figure 2A, representing one of threenorthern blot experiments performed, showsthat a response to the cytokine treatment couldbe seen by the enhancement of ICAM-1 mRNAexpression. In all ribonucleic acid preparationsof ICAM-1 expressing cells, we always saw twohydridisation signals, a major signal at about3.3 kb and a minor signal at about 2-4 kb,indicating the expression of the two previouslyreported ICAM-1 mRNA species. Whenever theexpression of the 3-3 kb mRNA was enhanced,the 2-4 kb mRNA was changed to the sameextent.

DETECTION OF ICAM-1 ON THE CELL SURFACE OFCOLONIC CARCINOMA CELL LINESTo examine if the expression of mRNA wasfollowed by the expression of the ICAM- 1molecule on the cell surface, cytokine treatedand untreated HT-29 and CaCo-2 cells were

Lm, e~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~.....

Figure 3: Expression ofICAM-1 on the surface of the colonic

carcinoma cell line HT-29 shown by immunoperoxidase with

mAb 7F7. (A) Immunostaining with mAb 7F7

(B) Immunostaining with mAb R-24 (negative control).

A

1595

on August 19, 2021 by guest. P

rotected by copyright.http://gut.bm

j.com/

Gut: first published as 10.1136/gut.34.11.1593 on 1 N

ovember 1993. D

ownloaded from

Dippold, Wittig, Schwaeble, Mayet, MeyerzumBuschenfelde

1800 A1700

15001 B* 1400

1300*

* 1200_ 1100'E~1000'0~ ~~~0

* CD.00 C 900'

. r' 800'

. u< 700'.. * en 600

500400

300200100

0

Serum from colorectalcarcinoma patients

Active disease Inactive disease

Figure 4: (A) Enhanced sICAM-1 serum concentrations detected in serum samples ofpatients with colorectal carcinomascompared with healthy blood donors; (B) sICAM-J in serum samples ofpatients with active and inactive Crohn's disease.

assayed with two different monoclonal anti-bodies directed against ICAM-1 (mAb 7F7 andmAb 84H10). Figure 3 shows the immunostain-ing of HT-29 cells, after incubation with IFN-y,with mAb 7F7. IFN-y and TNF-a inducedenhanced ICAM-1 cell surface expression inHT-29 cells, while IFN-y and IL-1l enhancedICAM-1 expression on CaCo-2 cells.

DETECTION OF SICAM- 1 SHEDDED BY COLONICCARCINOMA CELLSTo investigate whether colonic carcinomacells also shed the recently described solublesICAM-1, culture supernatants were collectedfrom confluently growing colonic tumour celllines after five days of culture and assessed induplicate in an ICAM-1 specific 'sandwich'ELISA. The comparative amounts of sICAM-1determined from undiluted cell culture super-natants were 8 5 ng/ml for HT-29 cells and 13-5for CaCo-2 cells. The medium control was

constantly negative for sICAM-1. ThereforesICAM-l is shed from both, HT-29 and Ca-Co-2cells. After cytokine treatment of HT-29 andCaCo-2 cells, the values of sICAM-l in some ofthe cell culture supernatants were raised forTNF-a twofold, for IFN-y fourfold in HT-29cells, for IFN-y and IL-113 about twofold inCaCo-2 cells.

SICAM-I IN SERUM SAMPLES FROM PATIENTS WITHCOLONIC CARCINOMA AND INFLAMMATORY BOWELDISEASETo see whether patients with colonic carcinomaand inflammatory bowel disease show raisedserum concentrations of sICAM- 1, we comparedthe content of sICAM-l in their serum sampleswith the sICAM-l concentrations in samples of19 healthy blood donors. Figure 4A shows that

sICAM- was present in the normal serum

samples at an average of 334 ng/ml, whereas thesamples of colonic carcinoma patients containedsICAM-1 at an average of 684 ng/ml. In a Mann-Whitney-White analysis, these differences were

shown to be highly statistically significant with0 00l<p<0 0001 at confidence intervals of95%.Some of the patients' samples showed extremelyhigh sICAM-1 concentrations with up to 1-700ng/ml while only few did not differ from thecontrol group. We also saw a significantlyincreased concentration 001<p<0 001 ofsICAM-l in the serum samples of 15 patientswith active Crohn's disease (average 804 ng/ml)compared with 10 patients with inactive disease(average 546 ng/nl) (see Fig 4B). Five patientswith active ulcerative colitis also showedincreased serum concentrations of sICAM (640ng/ml).

DiscussionThe data presented show that colonic carcinomacells express ICAM-1 molecules on theircell surface in contrast with normal colonicepithelium. In a previous report on a de novo

expression of ICAM-1 by mucosal mononuclearphagocytes in inflammatory bowel disease,4 thepercentage of mononuclear phagocytes was

increased from 7% in controls to 70% in ulcera-tive colitis and to 45% in Crohn's disease. Thesefindings were confirmed in this study. Accordingto the analysis of Maliza4 and our data, however,the source of soluble ICAM- 1 seems to bedifferent, in inflammatory bowel disease, themononuclear phagocytes and in colonic cancer,the tumour cells. The de novo expression ofICAM-1 in phagocytes of the colonic mucosa andthe raised soluble ICAM-1 in active Crohn'sdisease and ulcerative colitis shown here are

consistent with a condition of immunological

1600

1500

1400

1300

1200'

E 1100'c 1000'r- 900'

< 800''j 700

600500400300200100ni

Normal serum

1596

0

0 0 0

0 , *0 0 0

0 0 00

0. 9 0 0 0

00

0 00

.

0 0 00

4, 0 * 0, 0a

0 00

on August 19, 2021 by guest. P

rotected by copyright.http://gut.bm

j.com/

Gut: first published as 10.1136/gut.34.11.1593 on 1 N

ovember 1993. D

ownloaded from

Expression ofintercellular adhesion molecule I (ICAM-1, CD54) in colonic epithelial cells 1597

activation induced by the local release of pro-inflammatory cytokines. Therefore, it may be ofvalue to include the value of soluble ICAM-1 inthe index of inflammatory activity in the clinicalassessment and progression of inflammatorybowel disease.28 A study is underway thatincludes a large number of patients and theirspecific clinical and laboratory findings.

For the same reason we feel that it is importantto determine ICAM-1 expression in tissues andserum samples of patients with colonic cancer,because ICAM- 1 expression on melanoma wasshown to be an important pathophysiologicalparameter. Patients whose primary tumoursexpress abundant ICAM-1 have an increased riskof metastasis.'0 16 It is therefore tempting tospeculate whether the expression of ICAM-1 oncolonic and pancreatic carcinoma cells'3 maycontribute, in an as yet unknown way, to theaggressive potential ofcolonic cancer cells. In thetwo colonic tumour cell lines cytokine treatmentresulted in an induction or enhancement ofICAM-1 expression on the cell surface, but alsoincreased the shedding of sICAM-1. In agree-ment with the findings in melanoma, the shed-ding of sICAM-l could be a mechanism forcolonic tumour cells to evade from lymphocytemediated cytolysis.29 Therefore the relationbetween the ICAM-1 expression and the clinicalcourse seems to be of diagnostic interest forcolonic carcinoma. In conclusion it is justified toexamine ICAM-1 expression as a potential prog-nostic risk factor for colonic carcinoma.

This study was supported by SFB 302 C 40 and the Naturwissen-schaftlich-Medizinisches Forschungszentrum Mainz. WD is arecipient of professorship of the Stifterverband fur die DeutscheWissenschaft. The authors are most grateful to DrM P Dierich forsupplying the antibody mAb7F7 and Dr B Seed for generouslycontributing his cDNA clone for ICAM-1.

1 Springer TA, Dustin ML, Kishimoto TK, Marlin SD. Thelymphocyte function-associated LFA-1, CD2, and LFA-3molecules: cell adhesion receptors of the immune system.Annu Rev Immunol 1987; 5: 223-52.

2 Diamond MS, Staunton DE, Marlin SD, Springer TA.Binding of the Integrin Mac-I (CD11b/CD18) to the thirdimmunoglobulin-like domain of ICAM-1 (CD54) and itsregulation by glycosylation. Cell 1991; 65: 961-71.

3 Rothlein R, Czaikowski M, O'Neill MM, Marlin SD, MainolfiE, Merluzzi VJ. Induction of intercellular adhesionmolecule-I on primary and continuous cell lines by pro-inflammatory cytokines. J Immunol 1988; 141: 1665-9.

4 Malizia G, Calabrese A, Cottone M, Raimondo M,Treidosiewicz LK, Smart CJ, et al. Expressions of leukocyteadhesion molecules by mucosal mononuclear phagocytes ininflammatory bowel disease. Gastroenterology 1991; 100:150-9.

5 Adams DH, Shaw J, Hubscher SG, Rothlein R, NeubergerJM. Intercellular adhesion molecule-I on liver allograftsduring rejection. Lancet 1989; ii: 1122-4.

6 Maio M, Pinto A, Carbone A, Zagonel V, Gloghini A, MarottaG, et al. Differential expression of CD54/intercellularadhesion molecule-I in myeloid leukemias and in lympho-proliferative disorders. Blood 1990; 76: 783-90.

7 Guarini L, Temponi M, Bruce JN, Bollon AP, Duigou GJ,Moulton TA, et al. Expression and modulation by cytokines

of the intercellular adhesion molecule- I (ICAM- 1) in humancentral nervous system tumor cell cultures. Int J Cancer1990; 46: 1041-7.

8 Taylor RS, Griffiths CE, Brown MD, Swanson NA,Nickoloff, BJ. Constitutive absence and interferon-y-induced expression of adhesion molecules in basal cellcarcinoma. iAm Acad Dermatol 1990; 22: 721-6.

9 Barker JN, Allen MH, MacDonald DM. Distribution ofintercellular adhesion molecule-I (ICAM-1) and lympho-cytefunction-associated antigen (LFA-1) in epidermaltumors. Clin Exp Dermatol 1990; 15: 331-4.

10 Johnson JP, Stade BG, Holzmann B, Schwaeble W,Riethmuller, G. De novo expression of intercellularadhesion molecule-I in melanoma correlates with increasedrisk of metastasis. Proc Nati Acad Sci 1989; 86: 641-4.

11 Tomita Y, Nishiyama T, Watanabe H, Fujiwara M, Sato S.Expression of intercellular adhesion molecule-I (ICAM-1)on renal cell cancer: possible significance in host immuneresponses. Intl Cancer 1990; 46: 1001-6.

12 Koyoma S, Ebihara T, Fukao K. Expression of intercellularadhesion molecule 1 (ICAM-1) during the development ofinvasion and/or metastasis of gastric carcinoma. J CancerResClin Oncol 1992; 118: 609-14.

13 Schwaeble W, Kerlin M, Meyer zum Buschenfelde K-H,Dippold W. De novo expression of intercellular-adhesionmolecule 1 (ICAM- 1, CD54) in pancreas cancer. IntJ Cancer1993; 53: 328-33.

14 Vogetseder W, Feichtinger H, Schulz TF, Schwaeble W,Tabaczewski P, Mitterer M, et al. Expression of 7F7-antigen, a human adhesion molecule identical tointercellular adhesion molecule-I (ICAM-1) in humancarcinomas and their stromal fibroblasts. IntJ Cancer 1989;43: 768-73,

15 Rothlein R, Mainolfi EA, Czaikowski M, Marlin SD. A formof circulating ICAM-1 in human serum. J Immunol 1991;147: 3788-93.

16 Altomonte M, Carbone A, Bertola G, Golombatti A, FerroneS, Maio. Functional role of cell adhesion molecules in thecell-mediated cytotoxicity of human melanoma cells[Abstract]. ProcAm Assoc Cancer Res 1992; 33: 297.

17 Wawrky SO, Novotny JR, Wicks IP, Wilkinson D, Maher D,Salvaris E, et al. The role of LFA-l/ICAM-l interaction inhuman leukocyte homing and adhesion. Immunol Rev 1989;108:135-61.

18 Most J, Schwaeble W, Drach J, Sommerauer A, Dierich MP.Regulation of the expression of intercellular adhesionmolecule-I (ICAM-1) on human monocytes and monocytictumor cell lines. J Immunol 1992; 148: 1635-42.

19 Dippold W, Lloyd KO, Li LTC, Ikeda H, Oettgen HF, OldLJ. Cell surface antigens of human malignant melanoma:definition of six antigenic systems with monoclonal anti-bodies. Proc Natl Acad Sci USA 1980; 77: 6114-8.

20 Dippold W, Klingel R, Kerlin M, Schwaeble W, Meyer zumBuschenfelde K-H. Stimulation of pancreas and gastriccarcinoma cell growth by interleukin 3 and granulocyte-macrophage colony-stimulating factor. Gastroenterology1991; 100: 1338-44.

21 Dippold W, Dienes HP, Knuth A, Meyer zum BuschenfeldeK-H. Immunohistochemical localization ofganglioside GD3in human malignant melanoma, epithelial tumors andnormal tissues. CancerRes 1985; 45: 3699-705.

22 Chirgwin JM, Przybyla AE, MacDonald RJ, Rutter WJ.Isolation of biologically active ribonucleic acid from sourcesenriched in ribonuclease. Biochemistry 1979; 18: 5294-9.

23 Maniatis T, Frisch EF, Sambrook J. Molecular cloning.A laboratory manual. New York: Cold Spring HarborLaboratory, Cold Spring Harbor Press, 1989.

24 Simmons D, Makoba MW, Seed B. ICAM-1, an adhesionligand of LFA-1, is homologous to the neural adhesionmolecule NCAM. Nature 1988; 331: 624-7.

25 Feinberg AP, Vogelstein B. A technique for radiolabelingDNA restriction endonuclease fragments to high specificactivity. Anal Biochem 1983; 132: 6-13.

26 Barbu, Dautry F. Northern blot normalization with a 28SrRNA oligonucleotide probe. Nucleic Acid Res 1989; 17:7115.

27 Best WR, Becktel JM, Singleton JW, Kern F. Development ofa Crohn's disease activity index. Gastroenterology 1976; 70:439-44.

28 Seth R, Raymond FD, Makgoba MW. Circulating ICAM-1isoforms: diagnostic prospects for inflammatory andimmune disorders. Lancet 1991; 338: 83-4.

29 Vanky F, Wang P, Patarroyo M, Klein E. Expression of theadhesion molecule ICAM-1 and major histocompatibilitycomplex class I antigens on tumor cells is required for theirinteraction with autologous lymphocytes in vitro. CancerImmunol Immunother 1990; 31: 19-27.

on August 19, 2021 by guest. P

rotected by copyright.http://gut.bm

j.com/

Gut: first published as 10.1136/gut.34.11.1593 on 1 N

ovember 1993. D

ownloaded from