Expression and Genetic Analysis of prtb, a Gene ThatEncodes a Highly Conserved Proline-Rich ProteinExpressed in the BrainWEI YANG AND SUZANNE L. MANSOUR*Department of Human Genetics, University of Utah, Salt Lake City, Utah

ABSTRACT A mouse gene, designated prtb(proline codon-rich transcript, brain expressed)was identified and characterized from a genetrap embryonic stem cell line. It encodes a proline-rich protein of 168 amino acids that shares 99%amino acid sequence identity with its humanhomologue and is located on the distal region ofmouse chromosome 15. To determine the expres-sion pattern and function of prtb, mice that carrythe prtbgt allele were generated. During embryo-genesis, prtb gene expression as revealed by b-ga-lactosidase (b-gal) marker gene activity washighly regulated. Between embryonic day (E) 11.5and E12.5, b-gal activity was restricted to thedeveloping heart. From E13.5 on, expression inthe heart was extinguished. However, very strongb-gal activity could be detected in the brains ofadult mice, suggesting a role for this gene in brainfunction. Mice homozygous for the mutation wereviable, fertile,anddidnotdisplayanyobviousabnor-malities. This could be due to functional redun-dancy as Northern blot hybridization analysisclearly demonstrated that prtbgt is likely to be a nullallele. Dev Dyn 1999;215:108–116. r 1999 Wiley-Liss, Inc.

Key words: gene trap; mouse development; innerear; heart; Purkinje cell

INTRODUCTION

The generation and analysis of large numbers ofmutants in Drosophila and C. elegans has greatlyimproved our understanding of the molecular mecha-nisms underlying the development of these organisms.However, in higher organisms, it remains difficult touse genetic screening to identify genes controllingdevelopment. Forward genetics, which is used to iden-tify genes responsible for a particular phenotype, ishampered by the size and complexity of the mammaliangenome, thus is often time and labor consuming (Vitat-erna et al., 1994; King et al., 1997). An alternativeapproach to gene identification employs reverse genet-ics, in which a particular gene of interest is mutated bygene targeting and the resulting phenotype is analyzed(Shastry, 1998). However, this method requires priorknowledge about the structure of the gene, and is not anefficient way to carry out large-scale screening andcharacterization of genes involved in development.

With the rapid progress in the genome sequencingprojects, additional methods will be required to analyzeefficiently the function of the genes governing embryo-logical development (Brown and Nolan, 1998). The genetrap approach, with its power to rapidly identify andmutate genes simultaneously, can circumvent some ofthe difficulties inherent in other methods (Evans et al.,1997; Hicks et al., 1997). Using this method, a gene trapvector that comprises a promoterless lacZ reporter genepreceded by a splice acceptor sequence and whichincludes a selectable marker gene is introduced into themouse embryonic stem (ES) cell genome by electropora-tion or retroviral infection. Integration of the vectorinto the intron of a transcriptionally active gene gener-ates a fusion transcript that contains lacZ sequencespreceded by endogenous (trapped) gene sequences.Significantly, since the endogenous gene is molecularlytagged, it can be cloned easily using the 58-RACEmethod (Frohman et al., 1988; Townley et al., 1997;Zambrowicz et al., 1998). Expression of the lacZ re-porter gene also facilitates detection of the expressionpattern of the trapped gene. Most importantly, thepresence of the gene trap vector within an activetranscription unit is usually mutagenic. ES cells harbor-ing such a mutation can then be used to generatetransgenic mice and the mutant phenotype can bereadily studied (Gossler et al., 1989; Friedrich andSoriano, 1991; Skarnes et al., 1992; von Melchner et al.,1992; Wurst et al., 1995; Stoykova et al., 1998; Zambrow-icz et al., 1998).

Since the initial gene trap screens, several groupshave explored the possibility of enriching for specifictypes of trapping events in ES cells. One approach isdesigned to trap genes that encode proteins with spe-cific subcellular locations (Skarnes et al., 1995; Tate etal., 1998). Another approach has been to pre-screengene trap cell lines for lacZ expression that is regulatedby differentiation and/or by the application of exog-enous factors (Forrester et al., 1996; Baker et al., 1997;Bonaldo et al., 1998; Gajovic et al., 1998). We alsodescribed an induction gene trap screen aimed at

Grant sponsor: NIH/NIDCD; Grant number: 5 R01 DC02043.*Correspondence to: Suzanne L. Mansour, Department of Human

Genetics, 15 N. 2030 E RM 2100, Salt Lake City, UT 84112. E-mail:suzi.mansour@genetics.utah.edu

Received 16 December 1998; Accepted 9 March 1999

DEVELOPMENTAL DYNAMICS 215:108–116 (1999)

r 1999 WILEY-LISS, INC.

enriching for trapped genes that are expressed in thedeveloping mouse inner ear (Yang et al., 1997). In thisreport, we show that one of the genes identified in thatscreen is a novel mouse gene, which we named prtb(proline codon-rich transcript, brain expressed). Analy-sis of lacZ expression in mice that carry the gene trapallele showed that prtb is expressed in the developingheart of embryonic day (E) 11.5 and E12.5 mouseembryos and also at many sites in the adult brain.However, despite the fact that the prtbgt allele appearsto be a null, phenotypic analysis of homozygous mu-tants suggests that the gene does not have a uniquefunction. Identification and genetic analysis of relatedgenes may be required to reveal the function of prtb.

RESULTSScreening and b-Galactosidase Expression inCultured Cells

An ES cell line originally designated 6–12 was iso-lated as one of 245 neomycin resistant clones from theelectroporation of R1 ES cells with gene trap vector(pGTV1). Expression of b-galactosidase (b-gal) in undif-ferentiated 6–12 ES cells in culture was inducible bythyroid hormone (T3 - 3,38, 5-triiodo-L-thyronine) or 7Snerve growth factor, or following spontaneous differen-tiation. No b-gal activity was detected in 6–12 ES cellscultured in the presence of leukemia inhibitory factor orretinoic acid (Yang et al., 1997).

58-RACE and Isolation of prtb cDNA

Southern blot hybridization analysis using a lacZ-containing probe revealed that one copy of pGTV1 waspresent in the 6–12 genome (data not shown). 58-RACEwas employed to isolate lacZ complementary DNAs(cDNAs) carrying endogenous 58 sequences (Frohmanet al., 1988). Sequence analysis of the initial 58-RACEclones indicated that the Adenovirus splice acceptorthat precedes the lacZ gene in pGTV1 was used cor-rectly. To obtain full-length cDNA copies of the trappedgene, a primer was designed from the 92 basepairs (bp)of novel sequence located at the 58 end of the longest58-RACE clone, and 38-RACE was performed usingoligo-dT-primed first-strand cDNAs prepared from E12.5mouse embryos as template. The polymerase chainreaction (PCR) products were purified, cloned, andsequenced (Fig. 1A). No evidence for alternative splic-ing of the trapped gene was found. The longest cDNA,designated prtb, was found to contain 1844 bp with asingle large open reading frame (ORF) that encodes aproline-rich protein of 168 amino acids (GenBank acces-sion number AF085348). The ATG at position 80 is in agood context to be the initiation codon (Kozak, 1989).Furthermore, three stop codons precede the putativetranslation initiation codon, two of which are in thesame frame as the ORF, further substantiating theassignment of the prtb initiation codon. Inspection ofthe prtb cDNA also revealed a putative polyadenylationsignal at position 1823. Finally, Northern blot hybridiza-tion analysis using prtb cDNA as a probe revealed a

single messenger RNA (mRNA) species of approxi-mately 2 kilobases (kb, see below), suggesting that thecloned prtb cDNA is nearly full-length. The gene trapinsertion disrupts the prtb ORF after the fourth codonand the lacZ gene is out-of-frame with respect to theprtb initiation codon. Therefore, it is likely that transla-tion of the reporter gene is initiated from the Kozakconsensus site included on the gene trap vector (Yang etal., 1997).

Database searches revealed that prtb has a humanhomologue (designated KIAA0058, GenBank accessionnumber D31767). The human prtb cDNA was isolatedrandomly from a library prepared from the humanimmature myeloblast cell line KG-1 (Nomura et al.,1994). Interestingly, the mouse prtb protein differs fromits human homologue at only one residue (Fig. 1B). Inthe mouse protein there is a substitution of an alanineresidue for a threonine residue at position 103. At thenucleotide level, 92% sequence identity was observed inthe coding portions of the cDNAs. Protein motif searchesfailed to reveal any conserved functional domains inprtb. The PSORT II program (http://psort.nibb.ac.jp:8800/form2.html) predicted that prtb is likely to belocalized in the cytoplasm.

Chromosomal Localization of prtb

A genomic DNA fragment located 38 of the pGTV1insertion in 6–12 ES cells was obtained by PCR amplifi-cation, using a gene trap vector primer and a down-stream prtb exon primer. This approximately 1 kbfragment was used as a probe to hybridize to M.musculus (C57Bl/6JEi) and M. spretus (SPRET/Ei)genomic DNAs digested with different restriction en-zymes. A Taq I restriction fragment length polymor-phism (RFLP) was identified (see Experimental Proce-dures). The same probe was hybridized with Taq Idigested DNA samples from The Jackson LaboratoriesBSS Backcross Panel (Rowe et al., 1994). The resultingstrain distribution pattern of the RFLP was the sameas that of several markers in the distal region ofchromosome 15, including Scn8a, Tuba1, and Ddn (Fig.1C). This region is syntenic with human chromosome12q13 and the result is consistent with somatic cellhybrid mapping of human prtb to chromosomes 2 or 12(Nomura et al., 1994).

Embryonic Expression of prtb

X-gal staining of chimeric embryos prepared using6–12 ES cells suggested that the prtb gene is expressedin the developing heart and inner ear (Yang et al.,1997). To assess prtb expression throughout develop-ment, and to determine its function, a mouse strainthat carries the prtb gene trap insertion was generatedusing standard procedures. To examine the prtb expres-sion pattern, males heterozygous for prtbgt were matedto CD-1 females; embryos were collected at variousstages and assayed for b-gal activity using X-gal stain-ing. From E8.5 to E10.5, no b-gal activity could bedetected (Fig. 2A). From E11.5 through E12.5, moder-

109EXPRESSION AND GENETIC ANALYSIS OF prtb

ately strong b-gal activity was restricted to the develop-ing heart (Figs. 2B,C). By E13.5 no obvious sites of prtbexpression were apparent in whole or sagitally hemi-sected embryos (Fig. 2D and data not shown). Dissec-tion of the E13.5 inner ear revealed moderate levels ofb-gal activity in the developing cochlear duct (data notshown) as expected from previous studies of chimericembryos (Yang et al., 1997). At E15.5, hemisectedembryos displayed broad, but extremely weak b-galactivity in most tissues except the brain. Expression ofb-gal in the gut appeared to be slightly higher than inother tissues (data not shown).

prtb Expression in Adults

Strong X-gal staining was observed in the brains ofheterozygous or homozygous prtbgt mice (Fig. 3). Someof the strongest b-gal expression was found in thecerebral cortical plate (Figs. 3A, B, and C), the piriformcomplex (Fig. 3A), the pyramidal layer of the hippocam-pus (Figs. 3C, D), the granule cells in the islands ofCalleja (Figs. 3E and F), and the cerebellar Purkinjecells (Figs. 3G and H). See Table 1 for a detailedanalysis. No differences in the b-gal expression patterncould be found between heterozygous and homozygousmutant individuals. Furthermore, no b-gal expressionwas detected in adult tissues other than the brain.Finally, expression of b-gal was not detected in P0brains (data not shown), suggesting that the complexpattern of prtb expression in the adult brain is estab-lished during postnatal development.

To determine whether b-gal activity truly reflectedthe expression of the endogenous prtb gene, RNA in situhybridization was performed on adult brains roughlycut into eight coronal or six sagittal pieces. The resultswere compared with the X-gal staining pattern (Fig. 4).Strong expression of prtb was detected in the cerebral

Fig. 1. The prtb gene trapped in 6–12 ES cells encodes a smallproline-rich protein that is 99% identical to its human homologue andwhich maps to the distal region of mouse chromosome 15. A. Nucleotidesequence and features of the mouse 1844 bp prtb cDNA, and amino acidsequence of the encoded protein. The boxed sequence indicates prtbsequences found at the 58 end of lacZ cDNA prepared from 6–12 cells.The Kozak translation initiation consensus is double underlined. Se-quences associated with mRNA instability are in bold, and the putativepolyadenylation signal is single underlined. B. Alignment of human andmouse prtb amino acid sequences. The sequences differ at position 103,which is highlighted with a black box. All proline residues are shown inbold type. C. Top: Map figure from the Jackson BSS backcross showingthe distal end of Chromosome 15. The map is depicted with thecentromere toward the top. A 3 centiMorgan (cM) scale bar is shown to theright of the map. Loci mapping to the same position are listed inalphabetical order. Missing typings were inferred from surrounding datawhere assignment was unambiguous. Raw data from The JacksonLaboratory were obtained from the World Wide Web address http://www.jax.org/resources/documents/cmdata. Bottom: Haplotype figure fromthe Jackson BSS backcross showing the distal end of Chromosome 15with loci linked to prtb. Loci are listed in order with the most proximal at thetop. The black boxes represent the C57BL6/JEi allele and the white boxesthe SPRET/Ei allele. The number of animals with each haplotype is givenat the bottom of each column of boxes. The percent recombination (R)between adjacent loci is given to the right of the figure, with the standarderror (SE) for each R.

110 YANG AND MANSOUR

cortical plate, in the pyramidal cell layer of the hippo-campus, the piriform complex (Fig. 4A), and in thePurkinje cell layer of the cerebellum (Fig. 4B). Thispattern of prtb mRNA expression coincided with b-galexpression (Fig. 3), indicating that the lacZ expressiondata faithfully reflect the localization of prtb mRNA.

Mice Homozygous for the prtb Gene TrapInsertion are Viable and Fertile

Heterozygous prtbgt mice did not exhibit any abnor-malities as compared to wild type mice. To determinewhether the prtb gene has an essential function, hetero-zygous prtbgt animals were intercrossed. The offspringwere genotyped by Southern blot hybridization analy-sis of tail DNA using a probe located 38 of the pGTV1insertion site. Of 37 offspring, 8 were wild type, 21 wereheterozygous, and 8 were homozygous mutants, consis-tent with a normal Mendelian distribution. Homozy-gous mutants of either mixed background, pure 129background, or backcrossed four generations to C57Bl/6appeared outwardly normal. They gained weight andreached sexual maturity similarly to heterozygous andwild type littermates. Homozygotes of both sexes hadnormal fertility. To assess cerebellar and inner earfunction, we examined gait, the ability to maintainbalance on a pencil, swimming ability and auditorybrainstem response thresholds. In all of these tests,homozygotes performed similarly to their heterozygousand wild type littermates (data not shown).

prtbgt is Likely to be a Null Mutation

One possible explanation for the failure to detect anyabnormal phenotypes of prtbgt homozygotes is that theinsertion did not create a null mutation. The gene trapvector is located in a prtb intron. Normal prtb tran-scripts could be produced if pGTV1 sequences werespliced out of a primary transcript that extended to thenormal 38 end of the prtb transcription unit. To addressthis issue, total RNAs prepared from the brains of prtbgt

mice of all three genotypes were subjected to Northernblot hybridization analysis using prtb cDNA as probe(Fig. 5). A single transcript of approximately 2 kb couldbe detected in the wild type and heterozygous samples.This transcript could not be detected in homozygousmutant brain RNA, even after long exposures. A subse-quent hybridization of the same blot using a b-actinprobe revealed that intact RNA was present at similarlevels in all three samples. Thus, the prtbgt allele islikely to be a null.

DISCUSSION

We identified a novel mouse gene prtb, which encodesa protein that shares 99% sequence identity with itshuman homologue, suggesting an important function.The total length of the prtb cDNA, not including thepolyA tail, is 1844 bp. This is consistent with theapproximately 2 kb mRNA detected by Northern blot

hybridization. prtb mRNApotentially encodes a proline-rich protein of 168 amino acids. The proposed ATGinitiation codon found at position 80 of the cDNA ispreceded by a Kozak consensus sequence 58 GCCACC38 (Kozak, 1989). Furthermore, this proposed initiatorATG is preceded by both in-frame and out-of-frame stopcodons. A typical polyadenylation signal (AATAAA) canbe found near the end of the 38UTR at positions1823–1828. The prtb gene contains relatively long 38non-coding sequences (from nucleotide position 647 to1884), suggesting the possibility of post-transcriptionalregulation. Within the 38 UTR, there are three ‘‘ATTTA’’motifs, which have been found in some short-livedtranscripts (Vakalopoulou et al., 1991).

An interesting feature of the prtb protein is that itsmost frequent amino acid is proline (18%). Proline-richproteins have been found in many organisms and someof them are transcription factors that are involved inneuronal differentiation. For example, the mouse ho-meobox protein Hoxb4 has a cluster of proline residues(Graham et al., 1988) and the Drosophila homeoboxprotein CUT also contains proline-rich regions at itscarboxy terminus (Blochlinger et al., 1990). However,prtb has no other features in common with transcrip-tion factors. In fact, motif searches failed to reveal anyconserved functional domains in PRTB and revealedonly that there is a high probability of cytoplasmiclocalization. The proline residues in prtb are arrangedsuch that there are many potential sites for SH3-domain binding (Pawson, 1995; Pawson and Scott,1997). In addition to the high proline content, it is alsoapparent that prtb has a large number of serine,threonine and tyrosine residues, some of which could besubstrates for phosphorylation and/or the binding ofproteins that contain SH2, PTB, or WW domains(Pawson, 1995; Pawson and Scott, 1997). Taken to-gether, these features suggest that prtb could partici-pate in an intracellular signaling complex. However, inthe absence of any phenotypic clues as to its function,prtb may have to be placed into the category of otherproline-rich proteins with unknown functions, such ascordon-bleu (Gasca et al., 1995) and NDPP-1 (Sazuka etal., 1992). Interestingly, both of these genes are alsoexpressed in the central nervous system.

During embryogenesis, the prtb gene displayed aregulated pattern of expression. Analysis of reportergene activity revealed that it was not activated any-where in the embryo until E11.5, at which time expres-sion could be detected in the heart. This expression sitepersisted only until E12.5, after which it could nolonger be detected. Expression in the cochlear ductinitiated at E13.5, and widespread low level expressioncommenced at E15.5. In adult brains, but not at P0,prtb was strongly expressed in cerebral cortex, hippo-campus, thalamus, and cerebellar cortex, suggesting arole in brain function.

Despite its strong expression in various regions of thebrain and its high homology with its human counter-

111EXPRESSION AND GENETIC ANALYSIS OF prtb

part, mice homozygous for prtbgt are viable, fertile, andphenotypically normal. Tests of inner ear and cerebel-lar function failed to detect any differences betweenhomozygous mutants and their wild-type littermates.This result has several possible explanations. First,incomplete disruption of the endogenous gene, dueeither to splicing around the gene trap vector, or tointegration near the 38 end of a gene can cause ahypomorphic rather than a null allele. Examples ofthese phenomena have been reported for the cordon-bleu (Gasca et al., 1995) and Bodenin (Faisst andGruss, 1998) gene trap mutations. However, gene trapvector integration in the present case was found tooccur near the 58 end of the endogenous prtb gene andNorthern blot hybridization analysis clearly suggestedthat prtbgt is a null allele. Alternatively, the existence of

a gene family could lead to functional redundancy, suchthat inactivation of one family member has little effect.This outcome is not uncommon in gene targeting experi-ments aimed at individual members of complex genefamilies (St-Jacques and McMahon, 1996; Capecchi,1997; Keverne, 1997). Although no genes related bysequence to prtb have yet been identified in the data-bases, low stringency Southern blot hybridization usingprtb probes suggests the possibility that there could betwo relatives in the genome (data not shown). Isolationand mutational analysis of these genes would be re-quired to initiate studies of possible functional redun-dancy. Finally, it is also possible that subtle functionalabnormalities exist in homozygous prtb mutant miceand that more sophisticated tests are needed to revealthese defects.

Fig. 2. b-gal activity as revealed by X-galstaining of whole heterozygous prtbgt em-bryos is detected in the heart from E11.5 toE12.5. A. E105. B. E11.5. C. E12.5. D.E13.5. Open arrows point to unstained hearts,closed arrows indicate stained hearts. Objec-tive magnifications: A, 1.63; B, 1.23; C,1.03; D, 1.03.

112 YANG AND MANSOUR

Fig. 3. b-gal activity as revealed byX-gal staining of adult prtbgt brains. A.Coronal brain slice with arrows indicatingb-gal expression in the cortical plate (Cp)and piriform complex (Pi). Objective mag-nification 0.83. B. Section (10µm) of slicein panel A showing b-gal-expressing cellsin cortical plate. Objective magnification403. C. Coronal brain slice with arrowsindicating b-gal expression in cortical plate(Cp), hippocampus (Hi), amygdala (Am),hypothalamus (Hy), and thalamus (Th).Objective magnification 0.83. D. Section(10 µm) of slice in panel C showing b-gal-expressing cells in the pyramidal cell layerof the hippocampus. Objective magnifica-tion 403. E. Ventral surface of brain witharrows indicating b-gal expression in theIslands of Calleja (IsC). Objective magnifi-cation 0.63. F. Sagittal section (10 µm) ofbrain showing b-gal-expressing cells ingranule cells of an Island of Calleja. Objec-tive magnification 403. G. Dorsal surfaceof brain with bracket indicating the cerebel-lar cortex (CbC). Objective magnification0.63. H. Sagittal section (10µm) of brainshowing prtb expression in Purkinje cellsof the cerebellum. A few cells in the mo-lecular layer also express prtb. Objectivemagnification 403.

Figure 4. (Legend on following page.)

EXPERIMENTAL PROCEDURESES Cell Induction, Staining, and Generation ofTransgenic Mice

pGTV-1 construction, ES cell culture, in vitro induc-tion and b-gal assays have been described previously(Yang et al., 1997). The cell line containing the insertionin prtb was originally designated 6–12. The generationof prtbgt germline chimeric mice was achieved by micro-injection of 6–12 ES cells into C57Bl/6 blastocystsfollowed by uterine transfer. Chimeric males weremated to C57Bl/6 females to establish the prtbgt strain(Hogan et al., 1994). To obtain staged embryos, adultswere mated and the day on which a vaginal plug wasobserved was considered E0.5.

Genotyping of Mice

PCR-based analysis of genomic DNA isolated fromtail or embryonic yolk sacs was performed to identifylacZ carriers. Ten µl reactions containing 50 mM TrispH 8.3, 0.25 mg/ml crystalline BSA, 2 mM MgCl2, 0.2mM dNTPs, 0.5µM each primer, 50 ng template, and0.4 units Taq DNA polymerase were prepared andincubated at 94°C for 15 sec, and then subjected to 35cycles of 94°C for 0 sec, 58°C for 0 sec, and 72°C for 30sec in an Idaho Technologies Air Thermo-Cyler. The

forward primer was 58 GGGTTGTTACTCGCTCACA 38.The reverse primer was 58 AAAGCGAGTGGCAA-CATGG 38. A reaction product of 333 bp indicated thepresence of lacZ DNA. Heterozygous carriers wereintercrossed and tail or yolk sac DNA isolated from theoffspring was genotyped using Southern blot hybridiza-tion (Mansour et al., 1993). A genomic probe locatedimmediately 38 of the gene trap integration site wasobtained by PCR amplification of 6–12 ES cell DNAusing vector primer 58 AACGTTGTTGCCATTGCTA-CAG 38 and downstream prtb exon primer: 58 TAGGCT-GTGTTGGATATTGAC 38. This 1 kb probe was hybrid-ized to genomic DNA digested with Eco RI. The probedetected a fragment of about 15 kb in wild type DNA,and one of 12 kb in prtbgt DNA.

58-RACE and Cloning of the prtb cDNA

One µg of total RNA isolated from 6–12 ES cells by aguanidine monothiocyanate extraction protocol (Chirg-win et al., 1979) was used to perform 58-RACE. A kit(from Gibco-BRL) was used according to the manufac-turer8s instructions, except for the following modifica-tions: Gene-specific primer 1 (GSP1: 58AAAGCGAGTG-

Fig. 5. prtb mRNA cannot be detected in the brains of mice homozy-gous for prtbgt. RNA was isolated from the brains of mice of the indicatedgenotypes or from 6–12 ES cells, and analyzed by Northern blothybridization using a prtb probe. The positions of migration of theribosomal RNAs are indicated. The lower panel shows the results of asubsequent hybridization with a b-actin probe.

TABLE 1. Summary of b-Galactosidase Activity inBrains of Adult Mice Homozygous for prtbgt

ForebrainCerebral cortex 111a

External plexiform layer, olfactory bulb 1Lateral septal nu, dorsal, intermediate, and ven-

tral 11Medial septal nu 1Islands of Calleja 111

AmygdalaLateral amygdaloid nu, dorsolat and ventrolat 1Basomed. amygdal, anterior and ventral 1

Hippocampal formationPyramidal cell layer, hippocampus 11Stratum radiatum, hippocampus 1

ThalamusLaterodorsal thalamus, dorsomed and ventrolat 11

HypothalamusVentromed hypoth, dorsomed and ventrolat 1Ventromed hypothal nu, central 1

MidbrainSuperior colliculus 1Inferior colliculus 1

Pons 1Cerebellum

Purkinje cell layer 11

aThe right column indicates the subjective X-gal stainingintensity.

Fig. 4. (Previous page.) RNA in situ hybridization to wild-type mousebrain slices demonstrates a correspondence between prtb mRNA expres-sion and b-gal activity in prtbgt brains. A. Coronal slice showing prtbexpression in the cortical plate (Cp), pyramidal cell layer of the hippocam-pus (Hi), and piriform complex (Pi). Sagittal section through the cerebel-lum (CbC) showing prtb expression in the Purkinje cell layer. Objectivemagnification in both panels is 1.23.

114 YANG AND MANSOUR

GCAACATGG 38) was pre-incubated with RNA for 20min at 60°C before the addition of RT buffer (Chen,1996). Reverse transcription was carried out at 50°C for60 min.

RACE-PCR was performed in 20 µl volumes contain-ing 1x PCR buffer (Promega), 200 µM dNTP, 300µM ofeach primer, and 0.5 U of Taq DNA polymerase (Pro-mega) in a PT-100 thermal cycler (MJ Research). After2 min at 94°C, 35 cycles of denaturation at 94°C for 10sec, annealing at 60°C for 10 sec, and elongation at72°C for 2 min were performed. The PCR products wereseparated on an agarose gel, the major band wasextracted using QiaexII beads (Qiagen) and cloned intoa pBluescript T-vector. Sequencing of individual cloneswas carried out on an ABI377 sequenator using T3 andT7 primers. The largest clone had 92 bp 58 of the spliceacceptor.

Full-length prtb cDNA was obtained by PCR amplifi-cation of first-strand cDNA pools made from E12.5CD-1 mouse embryo mRNA (CapFinder PCR cDNAlibrary construction kit, Clontech). The primers usedwere: 58 GGACTCAGAGCCACCATGAAC 38, obtainedfrom the 58-RACE clone, and CDS/38 PCR primer: oligo(dT)30 N-1 N (N5A, G, C, or T; N-15 A, G, or C.Clontech). The PCR products were separated on anagarose gel, excised, purified, cloned and sequenced asdescribed above.

Mapping of prtb

Nylon filters carrying Taq I-digested samples of DNAfrom The Jackson Laboratory BSS Backcross panel(Rowe et al., 1994) were hybridized with the prtb intronprobe described above. This probe detects an RFLP of2.7 kb in C57Bl/6J DNA and one of 2.4 kb in M. spretusDNA. The strain distribution data were analyzed usingMapMaker software.

Whole-Mount b-Galactosidase Activity Assays

Whole embryos (E8.5-E13.5) were fixed and stainedwith X-gal as described previously (Yang et al., 1997).To detect potential internal sites of b-gal expression atE13.5 and E15.5, the embryos were hemisected in thesagittal plane during the fixation period and werestained as usual. Adult mice were perfused with 2%HCHO in PEM solution (0.1M PIPES, 2 mM MgCl2,1.25 mM EGTA). Brains were dissected out and fixed in4% HCHO/PBS solution for 30 min at 4°C, cut into fourcoronal pieces using a razor blade, and refixed for 30min at 4°C. The X-gal staining procedure was the sameas that for embryos (Yang et al., 1997), except thatdetergents (0.02% NP-40 and 0.01% sodium deoxycho-late) were present in every solution, and the times ofwashing and incubation were increased to 20 min.X-gal stained areas were identified by comparison withthe Nissl stained sections illustrated in Franklin andPaxinos (1996). In all cases, wild type littermate samplesserved as controls to distinguish endogenous enzymeactivity from that encoded by lacZ.

In Situ Hybridization to Brain Slices

A 599 bp BalI-BamHI fragment containing the 38untranslated region of prtb cDNA was cloned intopBluescript KS1 and SK1 vectors (Stratagene). Senseand antisense digoxigenin-labeled RNA probes weresynthesized using T7 RNA polymerase from the respec-tive vectors. Adult mouse brains were fixed in 4%formaldehyde buffer for 30 min, cut into 2 mm-thickpieces coronally or sagittally and refixed overnight at4°C. Hybridization, washing, and detection conditionswere as described (Wilkinson, 1992).

Northern Blotting

25µg of total RNA isolated from adult mice of differ-ent genotypes were separated in a formaldehyde aga-rose gel. The gel was treated with mild alkali hydrolysisin 50 mM NaOH, 100 mM NaCl for 40 min to improvetransfer of high molecular weight RNAs, and neutral-ized in 100 mM Tris, pH 7.4 for 30 min. The RNA wasthen transferred to a GeneScreen nylon membrane(NEN Research Products). The blot was hybridizedwith a 1205 bp Hind III fragment from prtb cDNA orwith a b-actin probe at 42°C in formamide hybridiza-tion buffer (50% formamide, 2X pipes, 1% SDS). Twostringent washes were performed at 60°C in 0.2X SSC,0.1% SDS.

ACKNOWLEDGMENTS

We gratefully acknowledge Dr. Mario Capecchi andhis animal facility staff for producing prtbgt germlinechimeras. Dr. Teresa Musci contributed to the originalisolation and characterization of the 6–12 ES cells.Craig Dietrich, Sheri Williams, Dr. Chaoying Li, andXioafen Wang have all contributed their technicalexpertise to the maintenance and characterization ofthe prtbgt mice. We thank Lucy Rowe and Mary Barterof The Jackson Laboratory for managing the submis-sion of the mapping data and preparation of the mapfigure. We are grateful to Dr. Richard Mullen forsharing his expertise in mouse neuroanatomy. DNAsequencing was performed by the Huntsman CancerInstitute DNA Sequencing Resource.

REFERENCESBaker RK, Haendel MA, Swanson BJ, Shambaugh JC, Micales BK,

Lyons GE. 1997. In vitro preselection of gene-trapped embryonicstem cell clones for characterizing novel developmentally regulatedgenes in the mouse. Dev Biol 185:201–214.

Blochlinger K, Bodmer R, Jan LY, Jan YN. 1990. Patterns of expres-sion of cut, a protein required for external sensory organ develop-ment in wild-type and cut mutant Drosophila embryos. Genes Dev4:1322–1331.

Bonaldo P, Chowdhury K, Stoykova A, Torres M, Gruss P. 1998.Efficient gene trap screening for novel developmental genes usingIRESbetageo vector and in vitro preselection. Exp Cell Res 244:125–136.

Brown SDM, Nolan PM. 1998. Mouse mutagenesis-systematic studiesof mammalian gene function. Hum Mol Genet 7:1627–1633.

Capecchi MR. 1997. Hox genes and mammalian development. ColdSpring Harb Symp Quant Biol 62:273–281.

Chen Z. Simple modifications to increase specificity of the 58 RACEprocedure. 1996. Trends Genet 12:87–88.

115EXPRESSION AND GENETIC ANALYSIS OF prtb

Chirgwin JM, Przybyla AE, MacDonald RJ, Rutter WJ. 1979. Isolationof biologically active ribonucleic acid from sources enriched inribonuclease. Biochemistry 18:5294–5299.

Evans MJ, Carlton MB, Russ AP. 1997. Gene trapping and functionalgenomics. Trends Genet 13:370–374.

Faisst AM, Gruss P. 1998. Bodenin: a novel murine gene expressed inrestricted areas of the brain. Dev Dyn 212:293–303.

Forrester LM, Nagy A, Sam M, Watt A, Stevenson L, Bernstein A,Joyner AL, Wurst W. 1996. An induction gene trap screen inembryonic stem cells: Identification of genes that respond to retinoicacid in vitro. Proc Natl Acad Sci USA 93:1677–1682.

Franklin KBJ, Paxinos G. 1996. The Mouse Brain in StereotaxicCoordinates. San Diego: Academic Press, Inc.

Friedrich G, Soriano P. 1991. Promoter traps in embryonic stem cells:a genetic screen to identify and mutate developmental genes inmice. Genes Dev 5:1513–1523.

Frohman MA, Dush MK, Martin GR. 1988. Rapid production offull-length cDNAs from rare transcripts: amplification using asingle gene-specific oligonucleotide primer. Proc Natl Acad Sci USA85:8998–9002.

Gajovic S, Chowdhury K, Gruss P. 1998. Genes expressed after retinoicacid-mediated differentiation of embryoid bodies are likely to beexpressed during embryo development. Exp Cell Res 242:138–143.

Gasca S, Hill DP, Klingensmith J, Rossant J. 1995. Characterization ofa gene trap insertion into a novel gene, cordon-bleu, expressed inaxial structures of the gastrulating mouse embryo. Dev Genet17:141–154.

Gossler A, Joyner AL, Rossant J, Skarnes WC. 1989. Mouse embryonicstem cells and reporter constructs to detect developmentally regu-lated genes. Science 244:463–465.

Graham A, Papalopulu N, Lorimer J, McVey JH, Tuddenham EG,Krumlauf R. 1988. Characterization of a murine homeo box gene,Hox-2.6, related to the Drosophila Deformed gene. Genes Dev2:1424–1438.

Hicks GG, Shi EG, Li XM, Li CH, Pawlak M, Ruley HE. 1997.Functional genomics in mice by tagged sequence mutagenesis. NatGenet 16:338–344.

Hogan BLM, Beddington R, Constantini F, Lacy E. Manipulating theMouse Embryo: A Laboratory Manual. 1994. Cold Spring Harbor,NY: Cold Spring Harbor Laboratory Press. 497 p.

Keverne EB. 1997. An evaluation of what the mouse knockoutexperiments are telling us about mammalian behaviour. Bioessays19:1091–1098.

King DP, Zhao Y, Sangoram AM, Wilsbacher LD, Tanaka M, AntochMP, Steeves TD, Vitaterna MH, Kornhauser JM, Lowrey PL, TurekFW, Takahashi JS. 1997. Positional cloning of the mouse circadianclock gene. Cell 89:641–653.

Kozak M. 1989. The scanning model for translation: an update. J CellBiol 108:229–241.

Mansour SL, Goddard JM, Capecchi MR. 1993. Mice homozygous for atargeted disruption of the proto-oncogene int-2 have developmentaldefects in the tail and inner ear. Development 117:13–28.

Nomura N, Nagase T, Miyajima N, Sazuka T, Tanaka A, Sato S, SekiN, Kawarabayasi Y, Kshikawa K, Tabata S. 1994. Prediction of thecoding sequences of unidentified human genes. II. The codingsequences of 40 new genes (KIAA0041-KIAA0080) deduced byanalysis of cDNA clones from human cell line KG-1. DNA Res1:223–229.

Pawson T. 1995. Protein modules and signalling networks. Nature373:573–580.

Pawson T, Scott JD. 1997. Signaling through scaffold, anchoring, andadaptor proteins. Science 278:2075–2080.

Rowe LB, Nadeau JH, Turner R, Frankel WN, Letts VA, Eppig JT, KoMS, Thurston SJ, Birkenmeier EH. 1994. Maps from two interspe-cific backcross DNA panels available as a community geneticmapping resource [published erratum appears in Mamm Genome1994 Jul;5(7):463]. Mamm Genome 5:253–274.

Sazuka T, Tomooka Y, Kathju S, Ikawa Y, Noda M, Kumar S. 1992.Identification of a developmentally regulated gene in the mousecentral nervous system which encodes a novel proline rich protein.Biochim Biophys Acta 1132:240–248.

Shastry BS. 1998. Gene disruption in mice: models of development anddisease. Mol Cell Biochem 181:163–179.

Skarnes WC, Auerbach BA, Joyner AL. 1992. A gene trap approach inmouse embryonic stem cells: the lacZ reporter is activated bysplicing, reflects endogenous gene expression, and is mutagenic inmice. Genes Dev 6:903–918.

Skarnes WC, Moss JE, Hurtley SM, Beddington RSP. 1995. Capturinggenes encoding membrane and secreted proteins important formouse development. Proc Natl Acad Sci USA 92:6592–6596.

St-Jacques B, McMahon AP. 1996. Early mouse development: lessonsfrom gene targeting. Curr Opin Genet Dev 6:439–444.

Stoykova A, Chowdhury K, Bonaldo P, Torres M, Gruss P. 1998. Genetrap expression and mutational analysis for genes involved in thedevelopment of the mammalian nervous system. Dev Dyn 212:198–213.

Tate P, Lee M, Tweedie S, Skarnes WC, Bickmore WA. 1998. Capturingnovel mouse genes encoding chromosomal and other nuclear pro-teins. J Cell Sci 111:2575–2585.

Townley DJ, Avery BJ, Rosen B, Skarnes WC. 1997. Rapid sequenceanalysis of gene trap integrations to generate a resource of inser-tional mutations in mice. Genome Res 7:293–298.

Vakalopoulou E, Schaack J, Shenk T. 1991. A 32-kilodalton proteinbinds to AU-rich domains in the 38 untranslated regions of rapidlydegraded mRNAs. Mol Cell Biol 11:3355–3364.

Vitaterna MH, King DP, Chang AM, Kornhauser JM, Lowrey PL,McDonald JD, Dove WF, Pinto LH, Turek FW, Takahashi JS. 1994.Mutagenesis and mapping of a mouse gene, Clock, essential forcircadian behavior. Science 264:719–725.

von Melchner H, DeGregori JV, Rayburn H, Reddy S, Friedel C, RuleyHE. 1992. Selective disruption of genes expressed in totipotentembryonal stem cells. Genes Dev 6:919–927.

Wilkinson DG. Whole-mount in situ hybridization of vertebrate em-bryos. In: Wilkinson DG, ed. In situ hybridization: a PracticalApproach. Oxford: Oxford University Press, 1992:75–84.

Wurst W, Rossant J, Prideaux V, Kownacka M, Joyner A, Hill DP,Guillemot F, Gasca S, Cado D, Auerbach A, Ang S-L. 1995. Alarge-scale gene-trap screen for insertional mutations in developmen-tally regulated genes in mice. Genetics 139:889–899.

Yang W, Musci TS, Mansour SL. 1997. Trapping genes expressed in thedeveloping mouse inner ear. Hear Res 114:53–61.

Zambrowicz BP, Friedrich GA, Buxton EC, Lilleberg SL, Person C,Sands AT. 1998. Disruption and sequence identification of 2,000genes in mouse embryonic stem cells. Nature 392:608–611.

116 YANG AND MANSOUR