fluorescently labeled lac repressor tetramer for single

Fluorescently Labeled Lac repressor Tetramer for Single-Molecule Analysis of Transcription Regulation Mechanisms

Master’s Thesis

Presented to

The Faculty of the Graduate School of Arts and Sciences Brandeis University

Department of Biochemistry Jeff Gelles, Advisor

In Partial Fulfillment

of the Requirements for the Degree

Master of Science in

Biochemistry

by Nate Shammay

May 2014

Copyright by

Nathanel Abraham Shammay

© 2014

iii

ACKNOWLEDGEMENTS

I would like to thank Dan Oprian for helping me sort out my schedule for Brandeis and giving me the resources to find the right lab experience for me.

Thank you Jeff Gelles for entrusting me to research and learn just like the graduate students in

your lab. Most of what I know about Biochemistry I attribute to my experience working for you.

I would like to thank Aaron Hoskins, Maggie Williams, Marcus Long, and Larry Friedman for their undying support and investment in my learning about the scientific method and research

techniques.

Big thanks to the Gelles lab for their overall enthusiasm and care for the development of my project and their advice on troubleshooting the RNA Polymerase experiments. Special thanks to

Larry Tetone and Tim Harden for their advice on the positive control and RNA polymerase preparation, respectively.

I would like to acknowledge the financial support for this work received by NSF BIO grant #1062136 as part of the Brandeis University Cell and Molecular Visualization REU and by

NIGMS grant #R01GM81648.

Finally, I would like to thank everyone who listened to me rant about my project and helped me more clearly explain my thesis work. Specific thanks to Samuel Bhutto, Shane Scott, Kaitlin

Hulce, Thaya Paramanathan, and Rick Roy.

iv

ABSTRACT

Fluorescently Labeled Lac repressor Tetramer for Single-Molecule Analysis of Transcription Regulation Mechanisms

A thesis presented to the Department of Biochemistry

Graduate School of Arts and Sciences

Brandeis University Waltham, Massachusetts

By Nathanel Shammay

Lac repressor is a transcription factor that represses expression of genes in the lac operon. The

mechanism by which Lac repressor regulates transcription initiation remains unclear, but it is

understood that in the presence of Lac repressor, open complex formation is inhibited. In this

thesis, we fluorescently label a single-cysteine mutant of the Lac repressor that specifically binds

to O1 operator and responds to inducer IPTG in bulk and single molecule in vitro experiments.

The labeling efficiency is 26% of monomers, corresponding to 70% of all tetramers in solution

having at least one cysteine labeled. The labeled construct, dubbed TAMRA-Lac, was found to

be 41% active using an Electrophoretic Mobility Shift Assay. On the single molecule level, the

labeled construct binds 57% of operator DNA versus 0.86% of nonoperator DNA and 3.8% of

operator DNA after IPTG induction. I used this active and labeled construct in an attempt to

probe the mechanism by which Lac repressor regulates transcription initiation on the single

molecule level.

v

Table of Contents

Chapter 1- No Lack of History: E. coli Lac repressor 1

Background and Discovering Lac repressor 1

Lac repressor and Operator Features 2

Lac repressor DNA Binding Activity 4

Transcription Initiation vs. Gene Regulation 5

Lac repressor-DNA Loops 7

Lac repressor Fluorescence and Mutant Studies 8

References 9

Chapter 2- Preparing A Specifically Labeled Active Lac repressor 11

Introduction 11

Results 12

Purifying the Lac repressor Constructs 12

Specifically Labeling OneCys-Lac 14

Dye-Labeled Lac repressor Binds Operator in Bulk 18

TAMRA-Lac Specifically Binds Operator on the Single Molecule Level 20

Discussion 22

Methods 22

DNA Constructs 23

Purifying the Lac repressor Constructs 24

Specifically Labeling OneCys-Lac 25

Dye-Labeled Lac repressor Binds Operator in Bulk 26

TAMRA-Lac Specifically Binds Operator on the Single Molecule Level 27

vi

References 27

Chapter 3- Applications of Fluorescently Labeled Lac repressor Tetramer 29

Dynamics of Opening/Closing Lac repressor-DNA Loops 29

Mechanism of Lac repressor Transcription Regulation 31

References 32

vii

List of Tables

2.1: Distribution of OneCys-Lac Species After Labeling. 17

2.2: PCR DNA Constructs. 19

2.3: DNA Sequence of Primers Used. 24

2.4: Recipes for all Buffer Solutions Used. 25

viii

List of Illustrations/Figures

1.1: Ribbon Representation of a 4.80Å Crystal Structure of Tetrameric Lac repressor 2

Bound to Two DNA Operators.

1.2: Natural Lac repressor Operator Sequences. 3

1.3: Cartoon representation of Lac repressor Binding Mechanism and Fate of Gene Expression. 4

1.4: Possible Mechanisms for Lac repressor Repression for One Operator. 6

1.5: Cartoon Representation of Tight and Relaxed Lac repressor Induced DNA Loops. 7

2.1: A Ribbon Model of the OneCys-Lac Homotetramer Structure Homotetramer Excluding 11

DNA Binding Domain.

2.2: A280 Trace of Lac repressor Construct Purification from Talon Column. 13

2.3: Purification of Lac repressor Species. 13

2.4: OneCys-Lac Labeling Experiment With Negative Control. 15

2.5: A280 Readout from G-50 Sephadex Size Exclusion Column Purifying TAMRA-Lac 16

from Unreacted Dye.

2.6: Fluorescence Scans of an 8% Native-PAGE Gel Shift Assay for TAMRA-Lac 18

and Quantification of Fluorescence.

2.7: Single Molecule Experiments to Verify TAMRA-Lac Activity With 21

Cartoon Representation.

2.8: DNA Sequence of Region in NS03/AS01 Strains Used for Thesis. 23

3.1: Cartoon Representation of Tight and Relaxed TAMRA-Lac Induced DNA Loops and 30

Fictitious Expected Single Molecule Results.

1

Chapter 1: No lack of history: E. coli Lac repressor

Background and Discovering Lac repressor

E. coli has a metabolic bias for glucose over other sugars like lactose (Loomis &

Magasanik, 1967). E. coli cells incubated in lactose and glucose start metabolizing glucose first

and then lactose. It was determined that lactose has a different metabolic pathway because of the

diauxic growth pattern for E. coli in solutions containing both lactose and glucose, and a protein

called !-galactosidase was responsible for part of the pathway for digesting lactose. !-

galactosidase is expressed by the lacZ gene in the lac operon. It was known that a regulator for

lacZ existed, as evidenced by the diauxic growth, but not much more was known about the

operon. Jacob and Monod (1961) discovered that growing E. coli cells in the presence of an

‘inducer’— in this case an analogue to allolactose—increased the cellular production of !-

galactosidase up to 10,000 fold. After studying a variety of inducers, it was determined that the

transcription factor responded most sensitively to Isopropyl-!-Thiogalactoside (IPTG). It was

hypothesized that: (1) a protein transcription factor binds to a portion of DNA called the

operator; (2) then in the presence of inducer it is released from the operator; and (3) transcription

of the gene is induced. Ultimately, the transcription factor Lac repressor was isolated (Gilbert &

Muller-Hill, 1966), paving the way for structural studies and studies about Lac repressor DNA

binding activity and the mechanism of E. coli gene repression.

2

Lac repressor and Operator Features

Fully functional Wild-Type Lac repressor (WT-Lac) is a tetramer arranged as a dimer of

dimers (Friedman, Fischmann, & Steitz, 1995). The four major domains of Lac repressor are the

C-terminal tetramerization domain, the core regulatory region, the allosteric control linker, and

the N-terminal DNA binding region (figure 1.1, Lewis et al., 1996). The C-terminal domain is

the tetramerization domain, allowing the four subunits to come together via a four "-helix

bundle. Leucine zipper motifs make the bundle stable (Alberti, Oehler, von Wilcken-Bergmann,

& Muller-Hill, 1993). The C-terminal domain is tethered to the core regulatory region by a

flexible linker. The core regulatory region is where inducers and anti-inducers bind to Lac

repressor, inducing dissociation from or stronger association to the operator respectively. The

allosteric control linker tethers the core domain to the DNA binding domain and is important for

communication of allosteric binding of inducer. Finally, the N-terminal domain, which is rich in

positively charged amino acids, binds operator DNA (figure 1.1). In Lac repressor mutants that

form only a dimer, a single homodimer is sufficient to bind the operator DNA (Chen &

Matthews, 1992).

Tetramerization Domain (C-terminus)

Core Domain (Inducer Binding)

DNA Binding Domain (N-terminus)

Figure 1.1: Ribbon Representation of a 4.80Å Crystal Structure of Tetrameric Lac repressor Bound to Two DNA Operators. This crystal structure shows the four monomers (colors red, blue, green, and purple) bound to two DNA operators. The allosteric linker (not labeled) tethers the Core Domain to the DNA Binding Domain. Image obtained using the PDB 1LBG (Lewis et al., 1996) structure and Chimera.

3

Wild type E. coli DNA has three operators, dubbed O1, O2, and O3. The structural dimer

of dimers allows for Lac repressor to bind DNA at more than one operator. Each operator DNA

sequence is 21 base pairs long (Figure 1.2). Lac repressor binds most stably to O1 (Bell & Lewis,

2001). It is believed that all three operators are necessary for maximum gene repression and that

O2 and O3 act as auxiliary operators to increase occupancy of Lac repressor at O1 (Oehler,

Amouyal, Kolkhof, von Wilcken-Bergmann, & Muller-Hill, 1994) through DNA looping

(Chakerian & Matthews, 1992).

The nucleotide sequence of the operator has been studied extensively for maximizing the

Lac repressor’s binding strength. Studies involving mutating the operator (Adler et al., 1972) and

making operator analogues (Sadler, Sasmor, & Betz, 1983) demonstrate that the Lac repressor

DNA binding domain binds at the major groove and that DNA with palindromic symmetry

allows for binding an order of magnitude higher than that for the Lac repressor-O1 affinity.

O1 5’-AATTGTGAGCGGATAACAATT-3’ 3’-TTAACAC.TC.GCCTA.TTGTTAA-5’ O2 5’-AAATGTGAGCGAGTAACAACC-3’

3’-T.T.TACACT.CGC.TCAT.T.GTTGG-5’ O3 5’-GGCAGTGAGCGCAACGCAATT-3’

3’-C.CGTC.ACT.CGCGT.TGCGTTAA-5’

Figure 1.2: Natural Lac repressor Operator Sequences. The three operators are 21bp long. O1 is nearly palindromic and Lac repressor binds O1 most stably. The base pairs that are palindromic are colored red.

4

Lac repressor DNA Binding Activity

Binding of Lac repressor to operator DNA and dissociation from operator DNA is well

understood (Lewis, 2005) (figure 1.3). Lac repressor binds to its Operator (O1), repressing the

lac operon genes. The Lac-O1 interaction is very stable with a Kd around 20pM (Chen, Alberti,

& Matthews, 1994). Induction of Lac repressor with IPTG favors dissociation of Lac repressor

from O1. IPTG binds to Lac repressor with a Kd around 1.5µM at pH 7.5 (Chen et al., 1994).

Binding of IPTG to Lac repressor decreases operator affinity 1000-fold (Barkley, Riggs, Jobe, &

Bourgeois, 1975). The binding of Lac repressor to Operator is very strong and is likely driven by

entropic factors such as release of structured water molecules (Riggs, Bourgeois, & Cohn, 1970).

!"#$%&'%&(()%$

*+,$-)./0&%"(&$

!"#$%&'()!*+,-(

./01(+'2"3%'456(

Transcription of lac genes Transcription of lac genes

!"#$% &'% !"#$%&'&($!!"#"

!"#$% &'% !"#$%&'&($!!"#" !"#$% &'% !"#$%&'&($!!"#"

Figure 1.3: Cartoon Representation of Lac repressor Binding Mechanism and Fate of Gene Expression. Lac repressor binds O1 very stably, but can be induced to dissociate in the presence of allolactose or IPTG. In the simplest mechanism, presence of Lac repressor prevents gene expression.

5

Transcription Initiation vs. Gene Regulation

For the PlacUV5 mutant bacterial promoter, transcription initiation can occur

independently of catabolite activator protein (CAP) and follows a simple three step mechanism

that is irreversible at 37˚C (Buc & McClure, 1985). It was found in this paper that below 37˚C,

the most stable RNA polymerase-PlacUV5 promoter interaction is the RNA polymerase closed

complex. At 37˚C a rapid isomerization, which includes melting of the DNA, leads to open

complex formation. Addition of NTPs to the open complex commits the Polymerase to

transcription initiation (Sanchez, Osborne, Friedman, Kondev, & Gelles, 2011) and prevents Lac

repressor from repressing the gene.

The precise mechanism for Lac repressor gene repression is unknown. While it is known

that the presence of Lac repressor prevents transcription, it was unclear where along the path to

initiation Lac repressor inhibited transcription (figure 1.4). One hypothesis is that Lac repressor

bound to operator sterically prohibits RNA Polymerase binding to its promoter and vice-versa.

Determining whether RNA Polymerase and Lac repressor can simultaneously bind to their DNA

sites can provide a clue as to whether the regulation mechanism involves prevention of promoter

escape or inhibition of binding as hypothesized. Footprint studies looking to answer the question

have given evidence for (Majors, 1975; Nick & Gilbert, 1985) and against (Straney & Crothers,

1987; Lee & Goldfarb, 1991) the hypothesis. It was, however, shown on the single molecule

level that the presence of Lac repressor prevents the formation of Open Complexes and that

Open Complexes are committed to initiation in the presence of Lac repressor and NTPs (Sanchez

et al., 2011).

6

!"#$%

##&%

!"#$% &'% !"#$%&'&($'()$*+%'),-(*.% !"#$% &'% !"#$%&'&($'()$*+%

'),-(*.%

!"#$% &'% !"#$%&'&($/-*0%'),-(*.% !"#$% &'% !"#$%&'&($/-*0%

'),-(*.%

!

!"#$%

##&%

!"#$%&'%&(()%$

*+,$-)./0&%"(&$

!"#$%&'()!*+,-(

./01(+'2"3%'456(

!

!"#$% &'% !"#$%&'&($!!"#" !"#$% &'% !"#$%&'&($!!"#"

!"#$% &'% !"#$%&'&($!!"#" !"#$% &'% !"#$%&'&($!!"#" 1()0234)0%'),-(*.%

1()0234)0%'),-(*.%

Figure 1.4: Possible Mechanisms for Lac repressor Repression for One Operator. The prevailing question is whether Lac repressor prevents promoter escape (Blue question mark) or it regulates another step or other steps in the process of transcription initiation (Red and Black question marks). Sanchez et al. (2011) showed that presence of Lac repressor prevents Open Complex formation and Open Complex formation undergoes transcription in the presence of Lac repressor (Black question marks). In the steric occlusion model, either Lac repressor or RNA polymerase binds first and the fate of transcription is known.

7

Lac repressor-DNA Loops

In DNA containing two operators, tetrameric Lac repressor can induce a DNA loop by

binding both operators. Loops can be in phase, meaning that the DNA is oriented in the same

direction entering and exiting the loop, or out of phase, meaning that the DNA is rotated 180˚ on

its axis as a result of looping. In phase loops are more stable and result in better repression in

vivo (Becker, Peters, Lionberger, & Maher, 2013). For tight loops, DNA experiences a bending

strain. Hinge opening of the Lac repressor tetramer has been implicated in stabilizing the tight

loop. The hypothesis is that the Lac repressor tetramer undergoes a large conformational change

(figure 1.5). Previous single molecule tethered particle motion studies showed the kinetics of

various looped states and their stabilities (Wong, Guthold, Erie, & Gelles, 2008). The hypothesis

has not yet been directly verified.

!

Tight Loop Relaxed Loop

Figure 1.5: Cartoon Representation of Tight and Relaxed Lac repressor Induced DNA Loops. Lac repressor tetramers (monomers shown here as red, blue, green, and purple ovals) can bind two operators, inducing a DNA loop. Tight loop formation is high energy. It is hypothesized that this tight loop relaxes into a looser loop, implicating the flexible tetramerization domain linker. Images from Wong, et al. (2008)

8

Lac repressor Fluorescence and Mutant Studies

For fluorescence experiments, the typically prepared Lac repressor construct is the C-

terminal GFP-Lac repressor fusion protein. This preparation has the benefit of allowing scientists

to express the fluorescent protein and watch dynamics in vivo. The side effect of having the

fusion protein is loss of tetramerization, having only dimers form (Elf, Li, & Xie, 2007). Dimeric

Lac repressors have slower association rates, but relatively unchanged dissociation rates (Chen &

Matthews, 1992), further indicating that to bind DNA properly, a Lac repressor dimer is

sufficient. GFP-Lac repressor fusions are not viable for looping experiments, which require the

fully functional tetramer.

Other Lac repressor mutant studies include mutating specific residues to learn more about

the location of residues and learn more about their access to the protein surface (Brown &

Matthews, 1979). In this paper, WT-Lac, which has three cysteines (Beyreuther, Adler, Geisler,

& Klemm, 1973), was treated with maleimide spin labels and observed for reactivity of the

surface cysteines. It was determined that two of the cysteines readily react, and one does not

react so strongly. Furthermore, these endogenous cysteines are not essential to Lac repressor

function as indicated by a relatively small decrease in activity. Knowing this, a Cysteine lacking

mutant (NoCys-Lac) and from that single cysteine mutants (OneCys-Lac) were studied

(Rutkauskas, Zhan, Matthews, Pavone, & Vanzi, 2009). The NoCys-Lac was made by

incorporating C107A, C140A, and C281A mutations to the WT-Lac sequence. NoCys-Lac was

used as a background vector for the creation of an E36C construct and a Q231C construct for

cross-linking the N-terminus DNA biding domains and core domains near the C-terminus

respectively. These single cysteine mutants were used to study looping mechanics when parts of

9

the tetramer is locked in position and found that when the DNA binding domains are cross-

linked, loops do not form. Both constructs still bind DNA and respond to inducer however.

In this thesis I explore a specific fluorophore-maleimide labeling of the Q231C single

cysteine Lac repressor mutant from the Ruthauskas (2009) paper and characterize how active the

labeled construct is at the single molecule level in order to probe further into the kinetics and

mechanism of Lac repressor transcription regulation in vitro.

References

Adler, K., Beyreuther, K., Fanning, E., Geisler, N., Gronenborn, B., Klemm, A., … Schmitz, A. (1972). How lac Repressor Binds to DNA. Nature, 237(5354), 322–327. doi:10.1038/237322a0

Alberti, S., Oehler, S., von Wilcken-Bergmann, B., & Muller-Hill, B. (1993). Genetic analysis of the leucine heptad repeats of Lac repressor: evidence for a 4-helical bundle. The EMBO Journal, 12(8), 3227–3236.

Barkley, M. D., Riggs, A. D., Jobe, A., & Bourgeois, S. (1975). Interaction of effecting ligands with lac repressor and repressor-operator complex. Biochemistry, 14(8), 1700–1712. doi:10.1021/bi00679a024

Becker, N. A., Peters, J. P., Lionberger, T. A., & Maher, L. J. (2013). Mechanism of promoter repression by Lac repressor–DNA loops. Nucleic Acids Research, 41(1), 156–166. doi:10.1093/nar/gks1011

Bell, C. E., & Lewis, M. (2001). Crystallographic analysis of Lac repressor bound to natural operator O1. Journal of Molecular Biology, 312(5), 921–926. doi:10.1006/jmbi.2001.5024

Beyreuther, K., Adler, K., Geisler, N., & Klemm, A. (1973). The Amino-Acid Sequence of lac Repressor. Proceedings of the National Academy of Sciences, 70(12), 3576–3580.

Brown, R. D., & Matthews, K. S. (1979). Chemical modification of lactose repressor protein using N-substituted maleimides. Journal of Biological Chemistry, 254(12), 5128–5134.

Buc, H., & McClure, W. R. (1985). Kinetics of open complex formation between Escherichia coli RNA polymerase and the lac UV5 promoter. Evidence for a sequential mechanism involving three steps. Biochemistry, 24(11), 2712–2723.

Chakerian, A. E., & Matthews, K. S. (1992). Effect of lac repressor oligomerization on regulatory outcome. Molecular Microbiology, 6(8), 963–968. doi:10.1111/j.1365-2958.1992.tb02162.x

Chen, J., Alberti, S., & Matthews, K. S. (1994). Wild-type operator binding and altered cooperativity for inducer binding of lac repressor dimer mutant R3. Journal of Biological Chemistry, 269(17), 12482–12487.

Chen, J., & Matthews, K. S. (1992). Deletion of lactose repressor carboxyl-terminal domain affects tetramer formation. Journal of Biological Chemistry, 267(20), 13843–13850.

10

Elf, J., Li, G.-W., & Xie, X. S. (2007). Probing Transcription Factor Dynamics at the Single-Molecule Level in a Living Cell. Science, 316(5828), 1191–1194. doi:10.1126/science.1141967

Friedman, A. M., Fischmann, T. O., & Steitz, T. A. (1995). Crystal structure of lac repressor core tetramer and its implications for DNA looping. Science, 268(5218), 1721–1727. doi:10.1126/science.7792597

Gilbert, W., & Muller-Hill, B. (1966). ISOLATION OF THE LAC REPRESSOR. Proceedings of the National Academy of Sciences of the United States of America, 56(6), 1891–1898.

Jacob, F., & Monod, J. (1961). Genetic regulatory mechanisms in the synthesis of proteins. Journal of Molecular Biology, 3, 318–356.

Lee, J., & Goldfarb, A. (1991). lac repressor acts by modifying the initial transcribing complex so that it cannot leave the promoter. Cell, 66(4), 793–798.

Lewis, M. (2005). The lac repressor. Comptes Rendus Biologies, 328(6), 521–548. doi:10.1016/j.crvi.2005.04.004

Lewis, M., Chang, G., Horton, N. C., Kercher, M. A., Pace, H. C., Schumacher, M. A., … Lu, P. (1996). Crystal Structure of the Lactose Operon Repressor and Its Complexes with DNA and Inducer. Science, 271(5253), 1247–1254. doi:10.1126/science.271.5253.1247

Loomis, W. F., & Magasanik, B. (1967). Glucose-Lactose Diauxie in Escherichia coli. Journal of Bacteriology, 93(4), 1397–1401.

Majors, J. (1975). Initiation of in vitro mRNA synthesis from the wild-type lac promoter. Proceedings of the National Academy of Sciences of the United States of America, 72(11), 4394–4398.

Nick, H., & Gilbert, W. (1985). Detection in vivo of protein-DNA interactions within the lac operon of Escherichia coli. Nature, 313(6005), 795–798.

Oehler, S., Amouyal, M., Kolkhof, P., von Wilcken-Bergmann, B., & Muller-Hill, B. (1994). Quality and position of the three lac operators of E. coli define efficiency of repression. The EMBO Journal, 13(14), 3348–3355.

Riggs, A. D., Bourgeois, S., & Cohn, M. (1970). The lac repressor-operator interaction. 3. Kinetic studies. Journal of Molecular Biology, 53(3), 401–417.

Rutkauskas, D., Zhan, H., Matthews, K. S., Pavone, F. S., & Vanzi, F. (2009). Tetramer opening in LacI-mediated DNA looping. Proceedings of the National Academy of Sciences, 106(39), 16627–16632. doi:10.1073/pnas.0904617106

Sadler, J. R., Sasmor, H., & Betz, J. L. (1983). A perfectly symmetric lac operator binds the lac repressor very tightly. Proceedings of the National Academy of Sciences, 80(22), 6785–6789.

Sanchez, A., Osborne, M. L., Friedman, L. J., Kondev, J., & Gelles, J. (2011). Mechanism of transcriptional repression at a bacterial promoter by analysis of single molecules. The EMBO Journal, 30(19), 3940–3946. doi:10.1038/emboj.2011.273

Straney, S. B., & Crothers, D. M. (1987). Lac repressor is a transient gene-activating protein. Cell, 51(5), 699–707.

Wong, O. K., Guthold, M., Erie, D. A., & Gelles, J. (2008). Interconvertible Lac Repressor–DNA Loops Revealed by Single-Molecule Experiments. PLoS Biol, 6(9), e232. doi:10.1371/journal.pbio.0060232

11

Chapter 2: Specifically Fluorescently Labeled Lac repressor

Introduction

As discussed in the last chapter, a single cysteine Lac repressor construct (OneCys-Lac)

and a Cysteine lacking construct (NoCys-Lac) have been created for the purpose of studying

crosslinking of the core domains near the C-terminus (Rutkauskas, Zhan, Matthews, Pavone, &

Vanzi, 2009). Since the OneCys-Lac has four cysteines in the tetramer (figure 2.1) and that the

two on the inside can be derivatized with maleimide compounds, I expect that labeling the

construct with a fluorescent maleimide dye will allow for specific labeling and visualization of

the OneCys-Lac. Dr. Matthews gave plasmids containing the genes for expressing the Q231C

OneCys-Lac and NoCys-Lac mutants in BLIM cells to me as a gift.

Figure 2.1: A Ribbon Model of the OneCys-Lac Homotetramer Structure Excluding DNA Binding Domain. Each monomer in the model (red, blue, purple, and green) has a single reactive cysteine. Two cysteines can be seen in the center of the protein and two can be seen on the outside (orange circles). This single-cysteine mutant can be selectively labeled at the cysteine residues with maleimide dyes. This model is missing the DNA binding domain. Lac model from PDB 1LBI (Lewis M., et al, 1996). Image created using PyMol.

12

In this chapter I will discuss how WT-Lac, OneCys-Lac, and NoCys-Lac were purified,

then demonstrate that active TAMRA-Lac can be specifically labeled and used for single

molecule experiments probing Lac repressor function in vitro.

Results

Purifying the Lac repressor Constructs

I began by transforming our plasmids into XL10-Gold plasmid amplification strains and

into BLIM cells containing no endogenous Lac repressor gene. The constructs are not his-tagged,

but WT-Lac can be purified on immobilized nickel affinity columns because of fortuitously

placed histidine residues (Velkov, Jones, & Lim, 2008). Talon column purification allowed for

quick purification of each construct (figure 2.2). A 12% SDS-PAGE gel (figure 2.3) confirmed

that the Lac repressor constructs were purified with !90% purity and that the construct

monomers are the expected molecular weight (~38kDa). 1 mL quantities of NoCys-Lac were

obtained in on the order of 1µM and OneCys-Lac on the order of 5-10µM per purification.

The purifications were very successful because high concentrations of the Lac repressor

constructs were obtained in high purity. As shown in figure 2.2, one peak is observed followed

by a plateau. I believe the raised plateau is caused by the imidazole in solution required to

remove Lac repressor from the column absorbing at 280nm. Purification was successful in

allowing us to obtain very pure products as indicated in figure 2.3. This allowed us to have more

accurate concentration measurements and reduced fear of unwanted reactions during labeling.

13

!"#$%&"

'&'(

")*"

!"#

!"#$%&"

'&'()*

"

!"#$%&"

'&'()*

"

$"#

%"#

!

1 2 3 4

!"#$%&

'(#$%&

()#$%&

"(#$%& Figure 2.3: Purification of Lac repressor Species. This is a coomassie stained 12% SDS-PAGE gel demonstrating that the purifications of the Lac repressor variants were successful (monomer weight= 38kDa). Each species was purified to >90% purity. Lane 1: molecular weight marker. Lane 2: NoCys-Lac. Lane 3: OneCys-Lac. Lane 4: WT-Lac.

Figure 2.2: A280

Trace of Lac repressor Construct Purification from Talon Column. (A) Purification of WT-Lac. (B) Purification of NoCys-Lac. (C) Purification of OneCys-Lac.

14

Specifically Labeling OneCys-Lac

Labeling reactions were performed side-by-side for the NoCys-Lac and OneCys-Lac to

determine the optimal labeling ratio of dye to monomer. The dye used was Tetramethyl

Rhodamine 5’-Maleimide (TAMRA 5’-Maleimide) which absorbs at 555nm and self quenches

when in close proximity to itself. When the labeling reaction was performed (figure 2.4), only

the OneCys-Lac was labeled appreciably until the dye concentration was 10 times that of the Lac

monomer concentration in solution.

With increasing dye concentration, more efficient labeling was not observed. Nonspecific

reactions became much more commonplace with increasing dye for the NoCys construct. While

it may seem that the NoCys construct is more labeled at the 20:1 [Dye]:[Monomer] ratio, there is

a lot of background in the respective lanes that may not have been subtracted correctly in the

analysis. It is also possible that specific labeling occludes nonspecific labeling by virtue of the

specific reaction occurring at much faster rates. It is clear that the protein impurities are labeled

more heavily in the solution with NoCys-Lac than those with OneCys-Lac. This evidence

provides confidence that future fluorescence measurements are of the labeled OneCys-Lac

(heretofore TAMRA-Lac) as opposed to an impurity.

It also does not seem that the labeling efficiency improves significantly after the 5:1

[Dye]:[Monomer] ratio, which is strange because the four cysteine residues are assumed to react

independently. It should also be noted that while the monomer subunits are identical, their

assembly into dimers and further into tetramers is not perfectly symmetric and each cysteine has

a unique local environment. It is also possible that the labeling is better than I observed, but

many of the TAMRA molecules may be located in the two inner positions of the tetramer,

causing them to self-quench by proximity. In order to perform any fluorescence experiments, it is

15

important that TAMRA-Lac is specifically labeled at the cysteine residues. The labeling data

suggests that labeling is specific when there is not too much free dye in solution.

In order to use pure TAMRA-Lac for single molecule experiments, the free dye

was separated from TAMRA-Lac using a G-50 size exclusion column. In the separation

experiment (figure 2.5), one clear peak is discernable for both the protein and free dye

respectively. This is the expected result; G-50 Sephadex does not have pores large enough for

TAMRA-Lac to fit into, therefore TAMRA-Lac is the first to exit the column.

0.0E+00 5.0E+05 1.0E+06 1.5E+06 2.0E+06 2.5E+06 3.0E+06 3.5E+06

!" #" $!" $#" %!"

Fluo

resc

ence

Uni

ts

[Dye]:[Monomer]

!"#$%&'()*+),'$-./0!"1)2/3)4*-./0!"1)

TAMRA-Lac

NoCys-Lac

OneCys-Lac Labeling NoCys-Lac Labeling

[Dye]:[Lac monomer] 1 2 5 10 20 1 2 5 10 20

!&'()'"*+,-./01/21/"

'3"

43"

Figure 2.4: OneCys-Lac Labeling Experiment With Negative Control. (A) A 12% SDS-PAGE gel scanned for TAMRA fluorescence of the different labeling experiments for both OneCys-Lac and NoCys-Lac after washing in water. The negative control checks for nonspecific labeling of the NoCys-Lac. (B) A graph showing the fluorescence quantification of the gel in (A).

16

Subsequent purifications of the OneCys-Lac involved immediate labeling reactions off

the Talon column and further sephadex purification. This prevented freeze-thawing the Lac

constructs more than once. Separation seemed to be effective by size exclusion (figure 2.5). The

labeling efficiency was measured to be 26%, which corresponds to 70% of tetramers having at

least one dye on a cysteine (Table 2.1). This result corresponds well to the poorly increasing

labeling efficiency with increasing dye concentration as observed in figure 2.4, suggesting an

upper limit to the labeling efficiency with this preparation.

Since the individual cysteines are assumed to react independently, it is possible to lay out

expected labeling distributions for TAMRA-Lac (Table 2.1). At 100% labeling, every TAMRA-

Lac tetramer would have four dyes. It should be noted that even with 50% labeling efficiency,

there would be less than 10% of dye-less Lac repressor molecules in solution.

!"#$%&"

'&'!"()"

Figure 2.5: A280 Readout from G-50 Sephadex Size Exclusion Column Purifying TAMRA-Lac from Unreacted Dye. TAMRA-Lac came out of the size exclusion column first because of its much larger size (~150kDa) compared to the Dye (~0.5kDa).

17

Number of Dye Labels Associated Binomial Probability

!"#$%&'

$!"#$%('

$)!"#$%)'

$(!"#$%'

$&'

40

!

"#

$

%&

42

!

"#

$

%&

43

!

"#

$

%&

Obtained Distribution

Expected Distribution for 50% labeling

Expected Distribution for 75% labeling

44

!

"#

$

%&

40

!

"#

$

%& *+(**"'

*+&)"&'

*+)))*'

*+*,)*'

*+**&-'

*+*-),'

*+),**'

*+(.,*'

*+),**'

*+*-),'

*+**(/'

*+*&-/'

*+)"*/'

*+&)"/'

*+("-&'

Table 2.1: Distribution of OneCys-Lac species After Labeling. For the tetramer, assuming each cysteine is independent and labeling once does not affect the ability of other residues to be labeled, we can calculate and expect that the labeling of each subunit to follow a binomial distribution. At 50% labeling, there would be nearly no dark Lac repressor molecules.

18

Dye-Labeled Lac repressor Binds Operator in Bulk

With TAMRA-Lac in hand, I proceeded to test the activity of the newly made construct

(figure 2.6). To measure activity significantly above the Kd, a stoichiometric binding assay is

sufficient to determine activity. The stoichiometry was assumed to be one Lac repressor per two

operators. This reflects the fact that the Lac repressor molecules are tetramers behaving as

dimers of dimers when binding DNA (DNA constructs described in table 2.2). TAMRA-Lac was

found to be 41.3% active (figure 2.6). The implication in this experiment is that TAMRA-Lac is

not dysfunctional as a result of labeling with a small dye. This is the expected result, since the

study crosslinking the inside cysteines also observed significant DNA binding activity

(Rutkauskas et al., 2009). The loss of activity or observed lower activity may be due to some

aggregation lowering the fraction of active TAMRA-Lac in solution.

!"#$%&'%&(()%$*+,-$ .$ $$.$ $/$ $$0$ $1$ $$2$ $$3$ $4.$ /.$ /.$5678$*9,-$ .$ $$.$ $.$ $$.$ $.$ $$.$ $$.$ $$.$ $.$ 4.$

DNA Fluorescence

Lac repressor Fluorescence

!"#$% &'% !"#$%&'&($!!"#"

!"#$% &'% !"#$%&'&($!!"#"

!"#$% &'% !"#$%&'&($!!"#"

A)

B)

!"

#!"

$!"

%!"

&!"

'!!"

!" #" $" %" &" '!" '#" '$" '%" '&" #!"

!"#$%%"&'

("

)*(+,(-./0"*%1$/2%$3"45+6"

78/59:0/9;5";<"*(+,(-./0"(09=>1?"

Figure 2.6: Fluorescence Scans of an 8% Native-PAGE Gel Shift Assay for TAMRA-Lac and Quantification of Fluorescence. The DNA concentration is 10nM in every lane. (A) 58O50 DNA (table 2.2) and TAMRA-Lac were scanned for fluorescence. Top panel: Scan of gel using 488nm excitation laser, exciting the dye on the DNA (blue star). Bottom panel: Scan of gel with 532nm excitation laser, exciting the dye on the Lac repressor (green star). (B) A graph showing a quantitation of the free DNA from the top gel and a best-fit line to the data not counting the data point at 20nM. The best-fit line was restricted to reach the y-intercept at 100%. For the IPTG lane, there is 40% free DNA. Best-fit line: y = -8.26x + 100 R! = 0.98836

19

The one odd result is the IPTG lane, It doesn’t seem like induction worked completely. I

think that since the Lac repressor molecules were mixed with operator first and then diluted into

a solution with DNA molecules, the equilibrium was shifted towards binding more DNA

molecules. Mixing TAMRA-Lac with DNA first and then adding in IPTG and mixing may

prevent this observation. It is also possible that since the concentrations used (nM) were well

above the Kd (pM) and IPTG lower Lac repressor affinity to DNA 1000-fold (Barkley, Riggs,

Jobe, & Bourgeois, 1975), the new Kd would be in the nM range, still low enough for about 50%

binding of DNA ligand. With 41% active protein at 20nM: 8.2nM of TAMRA-Lac could bind

most of the DNA molecules, even at the lower affinity. This phenomenon may explain what was

observed (40% of DNA molecules were free in this lane).

DNA Construct DNA Length (bp)

Primer 1 Primer 2 Direction of Promoter

58O50 108 p322 (Alexa 488) p323 N/A

353PO165 518 p247 (Bio) p248 (Cy5) Towards Tether

Blue_165OP353 518 p247 (Alexa 488) p248 (Bio) Towards Dye

Red_165OP353 518 p247 (Cy5) p248 (Bio) Towards Dye

Blue_165O322 487 p247 (Alexa 488) p248 (Bio) N/A

Red_165O322 487 p247 (Cy5) p248 (Bio) N/A

59O165 224 p247 (Bio) p388 (Alexa 488) N/A

Table 2.2: PCR DNA Constructs. The chemical modifications to the primers are indicated in parentheses. Sequences are given in Table 2.2. The names are oriented from right to left in order from the dye to the tether for those constructs containing a Biotinated primer.

20

TAMRA-Lac Specifically Binds Operator on the Single Molecule Level

To test whether TAMRA-Lac binds Operator DNA specifically, a series of experiments

were performed sequentially (figure 2.7 A-E). (A) TAMRA-Lac was added to a slide to check

for nonspecific accumulation on the surface; no significant accumulation was found. (B) DNA

was tethered to the surface in the absence of TAMRA-Lac. (C) TAMRA-Lac was added in four

times molar excess to DNA and checked for binding activity; after 30 minutes 57% of all DNA

molecules could be found with a TAMRA-Lac molecule bound to it. (D) A solution containing

saturating amounts of IPTG was then flowed in to check for inducer response; TAMRA-Lac near

the surface dropped to 4% occupancy on the DNA. (E) The test was repeated on a DNA not

containing any operator sequence; <1% of the DNA molecules co-localized with a TAMRA-Lac

molecule.

Excitingly, these are the expected results for TAMRA-Lac on the single molecule level.

TAMRA-Lac binds the operator DNA specifically and responds to IPTG induction. The results

correspond directly to the bulk assay experiment, but are more sensitive. It is important to note

that when a solution is added to the slide, any free-floating molecules are removed from solution.

For instance, when IPTG is added, any TAMRA-Lac that binds IPTG has two chemical

motivations for dissociation: (1) IPTG induction that reduces affinity to DNA and (2) removal of

free TAMRA-Lac that entropically promotes dissociation and dilution. These qualities and the

near Kd concentrations used explain why the single molecule induction result is more

pronounced than the bulk gel-shift. It was also expected that TAMRA-Lac would not bind to

DNA lacking an operator. Any binding leftover in both the induction and the operator-less

control may have been false positives from dirt that absorbs in many wavelengths leftover even

after photobleaching the slide carefully before performing the experiment.

21

200pM TAMRA-Lac only 50pM 353PO165 DNA only

50pM 353PO165 DNA and 200pM TAMRA-Lac 50pM 353PO165 DNA and 200pM TAMRA-Lac with 10mM IPTG inducer

Cover Slip Cover Slip

!"#$%&'%

!"#$%&'&($


Cover Slip

!"#$%&'%

!"#$%&'&($

A) B)

C) D)

DNA Fluorescence


DNA Fluorescence Cover Slip

!"#$%&'%

!"#$%&'&($


DNA Fluorescence

!!"#"!!"#"

!!"#"

Cover Slip

E) Lac repressor Fluorescence

DNA Fluorescence

50pM 595P7 (Friedman et al., 2013) and 200pM TAMRA-Lac

Figure 2.7: Single Molecule Experiments to Verify TAMRA-Lac Activity With Cartoon Representation. These images represent a series of single molecule experiments designed to verify the activity of TAMRA-Lac for probing transcription regulation mechanisms. Each picture fluorescence image of molecules near the slide surface of the color indicated by the caption above or below it. Molecules with dyes on them (blue, red, and green stars) correspond to the molecules being observed to the right. White dots are individual molecules. (A) shows that Lac repressor will not stay near surface without DNA molecules to bind. (B) shows that the fluorescent DNA is easily detectable. In (C), (D), and (E), TAMRA-Lac is mixed with a DNA molecule (indicated) and a blowup of the top image containing an overlay of DNA locations allows for quick analysis of DNA binding activity (filled in yellow box means a bound DNA molecule).

22

Discussion

I have demonstrated that OneCys-Lac and NoCys-Lac can be isolated in high purity

and concentrations. I then showed that the OneCys-Lac is specifically labeled at the reactive

cysteine residues on its surface. Finally, I characterized the labeling efficiency and specific

activity of this fluorescently labeled construct. It has been demonstrated here that the OneCys-

Lac can be specifically labeled and functions as expected both in bulk assays and on the Single

molecule level. This work represents the first report of a fluorescently labeled Lac repressor

tetramer.

Having acquired the specifically labeled and active TAMRA-Lac molecule, I will now

discuss two applications of the repressor in chapter 3, one of which was attempted but the

experiments did not succeed. The other provided the stimulus for selecting OneCys-Lac for the

fluorescence experiments, but labeling levels could not be brought high enough to study.

Consequently, this application is reserved as a future direction for this research.

Methods

All reagents used in buffers were purchased from Sigma-Aldrich and Fisher Scientific. TAMRA-

5’ maleimide dye was purchased from Molecular Probes. DNA constructs and primers used are

detailed in tables 2.2 and 2.3 respectively. All gels were scanned with a Typhoon 9410

Multimode Imager for dye fluorescence. Buffers used are detailed in table 2.4. The molecular

weight marker in figure 2.6 and all gel-casting supplies were obtained from Bio-Rad.

22

23

DNA Constructs

DNA constructs were made using PCR from the strain NS03, containing a derivative of

pBN1824 given to us as a gift by Bryce Nickels (Figure 2.11). AS01, a BN1824 derivative was

given to me as a gift by Alvaro Sanchez. For gel shift analysis, primers p122 and p123-A488

were used. For single molecule experiments, primers p246-biotin and p248-A488 and p248-cy5

were used. Promoterless DNA constructs were made using PCR from the Plasmid AS01, which

has a deletion of the -6 to -36 region of the pLACUV5 promoter in the pBN1824 plasmid.

All of the primers used and the PCR constructs made from them are explicitly listed in

Tables 2.1 and 2.2. The PCR products were made using HercII DNA Polymerase and the

following steps: 2 minutes of 96˚C, 18x[30 seconds of 96˚C, 55 seconds of 50˚C, 1 minute of

72˚C], and 10 minutes of 72˚C. PCR reactions were cleaned using the QIAquick PCR

purification kit. Some constructs underwent further gel extraction purification using the

QIAquick Gel Extraction kit.

NS03/AS01: 5’-GCGCCGATGGTAGTGTGGGGTCTCCCCATGCGAGAGTAGGGAACTGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGGGAGCGGATTTGAACGTTGCGAAGCAACGGCCCGGAGGGTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGCATCAAATTAAGCAGAAGGCCATCCTGACGGATGGCCTTTTTGCGTTTCTACAAACTCTTTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCAAGAATTCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTTGCGCAAGCTTGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCTTTGCCTGGTTTCCGGCACCAGAAGCGGTGCCGGAAGCTGGCTGGAGTGCGATCTTCCTGAGGCCGATACTGTCGTCGTCCCCTCAAACTGGCAGATGCACGGTTACGATGCGCCCATCTACACCAACGTGACCTATCCCATTACGGTCAATCCGCCGTTTGTTCCCACGGAGAATCCGACGGGTTGTTACTCGCTCACATTT -3’

Figure 2.8: DNA Sequence of Region in NS03/AS01 Strains Used for Thesis. This sequence above is a region of interest derived from BN1824. This plasmid has a nucleotide change from an A to G located at +311 compared to BN1824. The red text is O1 located at +1 (bolded) and the blue text is O2 located at +363 relative to transcription. The purple text represents the PlacUV5 promoter elements that are not present in ASO1.

24

Purifying the Lac repressor Constructs

I began by transforming the Lac repressor mutant plasmids into XL10-Gold plasmid

amplification strains and into BLIM cells using a Calcium Chloride treatment as described

(Sambrook & Russell, 2006). As part of purification, I followed the procedures for removal of

periplasmic protein impurities as described (Magnusdottir, Johansson, Dahlgren, Nordlund, &

Berglund, 2009). I expressed and purified all three Lac repressor constructs as described (Velkov

et al., 2008) and stored them at -80˚C in 20% Glycerol for future use. Purified protein samples

were run on a 12% SDS-PAGE gel for 1.5 hours at 200V. Protein concentrations were

approximated using the A280 correction to concentration of Lac monomer using the reported

molar absorptivity of 2.25x104 M-1cm-1 (Kumar, Galaev, & Mattiasson, 1999). Quantifying the

% purity of the purified constructs was accomplished using 1D Gel analysis in the software

ImageQuant TL.

!"#$%"&'($%&

)%*+%,-%& ./0#1%2&34%$#-(0&562#7-(/6,8&

9:;<& =>?@@A3ABAB33@@3AAA333@!AB3BBB33A3AA3B3A@AA@3?C>& D=E#6DF&D=@0%G(;HH'DF&D=3I=D&

9:;H& =>?B@3ABBB33AAA3BAAAA@A3ABAABAAAB?C>& D=E#6DF&D=3I=D&

9C::& =>?3@@B3AAB3B3@@B3ABAAA3?C>& D=@0%G(;HH'D&

9C:C& =>?A3@3A3@AA@BB3@3333@BB3AAA@3@3AAA@?C>& 'D@&

9CHH& =>?3B3@@AA@@ABAB@BAA@B!3A3@3A3@AA@BB3@3333@BB3?C>& D=@0%G(;HH'D&

Table 2.3: DNA Sequence of Primers Used. Some of the primers have regions that do not overlap the original sequence. These regions are 5’ of the bold commas. The chemical modifications are the same as those referred to in Table 2.1.

25

Specifically Labeling OneCys-Lac

Thawed samples of OneCys-Lac and NoCys-Lac were diluted to 240nM [monomer] and

incubated with TAMRA concentrations that were multiples of the Lac monomer concentration

from 1x to 20x (figure 2.5). These were incubated for 2 hours at 4˚C before quenching with 100x

Buffer pH Salt Components Notes

BB 7.6 0.3mM TCEP, 0.05% Glucose, 200mM Tris-HCl, 200mM KCl, 10mM Mg(OAc)2, 0.5mg/mL Lysozyme, 7mg/mL PMSF (in EtOH)*

Add TCEP, Lysozyme, and PMSF fresh for each use. *PMSF add 1mL per 100mL buffer.

SB 8.0 50mM NaH2PO4, 300mM NaCl, 10mM Tris-Base, 0.3mM TCEP

Add TCEP fresh for each use.

EB 7.0 50mM NaH2PO4, 300mM NaCl, 10mM Tris-Base, 150mM Imidazole, 0.3mM TCEP


MLB 7.15 100mM NaH2PO4, 150mM NaCl, 5mM EDTA, 0.1mM TCEP


20% Sucrose Buffer

7.9 50mM HEPES, 20% Sucrose, 1mM EDTA

5xPBB*Cl 8.0 250mM Tris-Base, 500mM KCl, 40mM Mg(Cl)2 Transcription Buffer

5xPBB*OAc 8.0 250mM Tris-Base, 500mM KOAc, 40mM Mg(OAc)2 Transcription Buffer

1xPBBS 8.0 600!L 5xPBB*, 3!L 100mg/mL BSA, 2mM DTT, mQ H2O

Dilute to final volume= 3mL in H2O. Add DTT and BSA fresh for each use.

Table 2.4: Recipes for all Buffer Solutions Used. This table is a list of buffer names and their components used for the various portions of the methods. All buffers were filtered using a 0.2µm vacuum filter and stored at 4˚C for four months before being made again.

26

TBE over the dye concentration and run on a 12% SDS-PAGE gel at 200V for 1.5 hours.

Quantification of band thickness was accomplished using 1D Gel analysis in the software

ImageQuant TL.

After the initial test, labeling was performed immediately after Talon column purification

using a 6x [Dye]:[Monomer] ratio and then quenching after 2 hours. The labeled TAMRA-Lac

was purified from free dye using a G-50 sephadex column in MLB buffer. A microplate analysis

using a 532nm excitation scan allowed for quick identification of the most concentrated

fractions. Typical Lac repressor yields from the sephadex column were about 400µL at 10% the

original unlabeled concentration. These fractions were flash frozen in liquid nitrogen after being

diluted to 20% Glycerol using 100% Glycerol for molecular biology and stored at -80˚C and can

be used for months without loosing activity.

Labeling efficiency was determined using the reported absorptivity of TAMRA-5’-

maleimide at 555nm, measuring its A280/A555=0.019, and measuring the absorbance at 280nm

and 555nm for TAMRA-Lac to find [Dye] and [Lac], subtraction the correction for Dye

absorbance at 280nm to find [Lac].

!"#$%&'(!!""#$#%&$' ! !"#!"#!!"#"!$% ! !""# (1)

Dye-Labeled Lac repressor Binds Operator in Bulk

Thawed samples of TAMRA-Lac were spun on a tabletop centrifuge at 14,000rpm for 20

minutes then carefully pipetted to separate it from any aggregate pellet before use. 8% Native

Gel-Electrophoresis was performed to test the activity of both TAMRA-Lac and NoCys-Lac.

The gels were made in 0.5x TBE buffer. In each experiment, Lac repressor and 58O50 were

incubated at 37˚C for 30 minutes before adding loading buffer and loading into the gel. The gels

were pre-run at 10V/cm for an hour and run at 10V/cm for 3.5 hours then scanned for DNA

27

fluorophore fluorescence (488nm) and where applicable TAMRA-Lac fluorescence (532nm).

Measuring the %DNA bound was accomplished using 1D Gel analysis in the software

ImageQuant TL.

TAMRA-Lac Specifically Binds Operator on the Single Molecule Level

Slides were prepared as described (Friedman, Chung, & Gelles, 2006), except for before

adding lanes, placed slides in a container flushed with Nitrogen gas and stored at -80˚C for up to

4 months. When needed, a slide was thawed and lanes were added as described.

The process of testing the labeled TAMRA-Lac specific activity on the single molecule

level involved showing (figure 2.9.A) that TAMRA-Lac [tetramer]=200pM concentration did not

nonspecifically bind to the surface, (figure 2.9.B) that 353PO165 [DNA]=50pM does tether to

the Biotinated surface when streptavidin is added, (figure 2.9.C) that TAMRA-Lac (200pM) co-

localizes with operator DNA, (figure 2.9.D) that TAMRA-Lac dissociates from its operator when

inducer IPTG is introduced in saturating conditions, and finally (figure 2.9.E) that Lac repressor

does not make stable complexes with DNA lacking an operator (the construct used is named

595P7). 595P7 was obtained as a gift from Larry Friedman (Friedman, Mumm, & Gelles, 2013).

The laser powers used in these experiments were 250µW for 532nm, and 400µW for 488nm, and

100µW for 633nm.

References

Barkley, M. D., Riggs, A. D., Jobe, A., & Bourgeois, S. (1975). Interaction of effecting ligands with lac repressor and repressor-operator complex. Biochemistry, 14(8), 1700–1712. doi:10.1021/bi00679a024

Friedman, L. J., Chung, J., & Gelles, J. (2006). Viewing Dynamic Assembly of Molecular Complexes by Multi-Wavelength Single-Molecule Fluorescence. Biophysical Journal, 91(3), 1023–1031. doi:10.1529/biophysj.106.084004

28

Friedman, L. J., Mumm, J. P., & Gelles, J. (2013). RNA polymerase approaches its promoter without long-range sliding along DNA. Proceedings of the National Academy of Sciences, 201300221. doi:10.1073/pnas.1300221110

Kumar, A., Galaev, I. Y., & Mattiasson, B. (1999). Purification of Lac repressor protein using polymer displacement and immobilization of the protein. Bioseparation, 8(6), 307–316. doi:10.1023/A:1008101711218

Magnusdottir, A., Johansson, I., Dahlgren, L.-G., Nordlund, P., & Berglund, H. (2009). Enabling IMAC purification of low abundance recombinant proteins from E. coli lysates. Nature Methods, 6(7), 477–478. doi:10.1038/nmeth0709-477


Sambrook, J., & Russell, D. W. (2006). Preparation and Transformation of Competent E. coli Using Calcium Chloride. Cold Spring Harbor Protocols, 2006(1), pdb.prot3932. doi:10.1101/pdb.prot3932

Velkov, T., Jones, A., & Lim, M. L. R. (2008). Ni2+-Based Immobilized Metal Ion Affinity Chromatography of Lactose Operon Repressor Protein from Escherichia Coli. Preparative Biochemistry and Biotechnology, 38(4), 422–441. doi:10.1080/10826060802325725


29

Chapter 3: Applications of Fluorescently Labeled Lac repressor Tetramer

Dynamics of Opening/Closing Lac repressor-DNA Loops

It was observed that for DNA containing two O1 operators 158 base pairs from each

other, the rate of loop opening is 0.022(3)s-1 and the rate of loop closing is 0.0030(5)s-1 (Wong,

Guthold, Erie, & Gelles, 2008). Since TAMRA dyes self-quench when in close proximity to

identical dyes, TAMRA-Lac tetramers that have dyes on the inside can be used to observe

whether a large conformational change is a necessary part of loop opening (figure 3.1A). Kinetic

rate constants can be measured from plotting fluorescence intensity vs. time and time between

events of tight and loose loops (figures 3.1B and C). Comparing the kinetic rates of the increase

and decrease of TAMRA-Lac fluorescence to the kinetic rates of the loop opening and closing,

respectively, would verify whether Lac repressor undergoes a large conformational change

(figure 3.2B). As part of the analysis, checking if loop dynamics are coupled with fluorescence

changes in TAMRA-Lac would provide a preliminary answer to the experimental question. The

hypothesis will be verified by direct observation if the kinetic rates are similar and if increases in

TAMRA-Lac fluorescence by conformational change occur simultaneously with loop opening.

Using the data presented in table 2.1 and assuming each cysteine has an equal chance of

reacting with the maleimide dye, the fraction of molecules having two dyes in the center (f)

would be:

!!!! !! !! ! ! ! !

!!! !! !! ! ! !

! !! ! ! (2)

Therefore, for the obtained monomer labeling efficiency of 26%, f=0.0676.

30

Alternately, with labeling efficiencies of 50% and 75%, f=0.25 and 0.5625 respectively. Even

doubling the labeling efficiency would have allowed for the hypothesis to be tested. I believe that

more efficient labeling can be obtained, since the original paper discussing this mutant was able

to cross-link the inner cysteines (Rutkauskas et al., 2009). However, since the labeling efficiency

reproducibly could not be brought high enough to be able to perform the experiment, this

experimental question was not pursued further and became reserved as a future application.

Tight Loop Relaxed Loop A)

B)

Time

Rel

ativ

e Fl

uore

scen

ce U

nits

!"

#"

$"

%" C)

Time

Frac

tion

of E

vent

s

!"

Figure 3.1: Cartoon Representation of Tight and Relaxed TAMRA-Lac Induced DNA Loops and Fictitious Expected Single Molecule Results. (A) When TAMRA-Lac is bound in the “tight loop” state, the two TAMRA dyes on the inside are quenched (empty green stars) due to their proximity. When the loop loosens, the hypothesis says that TAMRA-Lac undergo a large conformational change and separate the inner dyes, allowing them to fluoresce (filled in green stars). Images adapted from Wong, et al. (2008). (B) Theoretical fluorescence reading from a tethered particle motion experiment using TAMRA-Lac. If all four dyes fluoresce in the loose loop state, the reading will be 4 relative fluorescence units. Otherwise, the reading will be 2 relative fluorescence units. (C) The length of events can be recorded in a time between events plot and a single falling exponential fit will give the observed kinetic rate constant.

31

Mechanism of Lac repressor Transcription Regulation

Using Lac repressor for single molecule in vitro studies of transcription regulation has

given some insights into the mechanism of repression (Sanchez et al., 2011). Since Sanchez

(2011) did not have fluorescent Lac repressor, it was impossible to observe how exactly

transcription regulation occurs. This paper reported two major results: (1) the presence of Lac

repressor prevents stable open complex formation and (2) that open complexes presented with

Lac repressor and NTPs are committed to initiation on the PlacUV5 mutant promoter.

To more specifically probe the mechanism of transcription initiation, a few experiments

can be performed. Observing TAMRA-Lac in solution with RNA polymerase in conditions that

lead to closed complex formation would demonstrate whether both RNA polymerase and Lac

repressor can bind to their DNA sites simultaneously (red question marks in figure 1.4). Heating

the same system to 37˚C would demonstrate whether Lac repressor prevents DNA melting or if

Lac repressor can bind to open complexes transiently (black question marks in figure 1.4). At

this point, adding NTPs would allow me to see if the presence of Lac repressor prevents

promoter escape for any tertiary complexes, or dissociates suddenly (blue question mark in

figure 1.4).

Direct observation of the mechanism of Lac repressor regulation of initiation starts with

detection of closed and open complexes. It was reported that, at room temperature, closed

complex formation is very stable, lasting on the order of tens of minutes (Buc & McClure, 1985).

Buc and McClure also found that at 37˚C open complex formation was irreversible.

Unfortunately, using the same buffer conditions as Sanchez et al. (2011) and also switching the

buffer anion from chloride to acetate did not allow me to detect closed complex or open complex

formation. A positive control on the preparation of polymerase using the T7A1 bacteriophage

32

promoter demonstrated that the polymerase was active and could form initiation complexes on

the microscope. The next step is to try the original buffer conditions Buc and McClure used

(1985) and see if that allows for similar detection of closed complexes as reported.

Since I couldn’t detect closed complex formation or open complex formation, I could not

study the Lac repressor transcription initiation regulation mechanism. Future experiments with

detectable closed and open complexes (as determined by careful comparison to binding on

promoterless DNA) will permit similar experiments with the addition of TAMRA-Lac to observe

the mechanism of repression directly.

References

Buc, H., & McClure, W. R. (1985). Kinetics of open complex formation between Escherichia coli RNA polymerase and the lac UV5 promoter. Evidence for a sequential mechanism involving three steps. Biochemistry, 24(11), 2712–2723.


Sanchez, A., Osborne, M. L., Friedman, L. J., Kondev, J., & Gelles, J. (2011). Mechanism of transcriptional repression at a bacterial promoter by analysis of single molecules. The EMBO Journal, 30(19), 3940–3946. doi:10.1038/emboj.2011.273


fluorescently labeled lac repressor tetramer for single

Documents