for review only - prince of songkla universityrdo.psu.ac.th/sjstweb/ar-press/58-apr/13.pdf · 72...
TRANSCRIPT
![Page 1: For Review Only - Prince of Songkla Universityrdo.psu.ac.th/sjstweb/Ar-Press/58-Apr/13.pdf · 72 Bacteriocin activity was checked by agar well diffusion (AWD) assay (Schillinger 73](https://reader033.vdocuments.net/reader033/viewer/2022042201/5ea161f7c2698b059763aca5/html5/thumbnails/1.jpg)
For Review O
nly
1
Title: Physical and biochemical characterization of enterocin CE5-1 produced by 1
Enterococcus faecium CE5-1 isolated from Thai indigenous chicken intestinal tract and 2
their enterocin CE5-1 gene profiles 3
Authors: Kraiyot Saelim1, Sireewan Kaewsuwan
2, Akio Tani
3 and Suppasil 4
Maneerat1*
5
Affiliation: 1
Department of Industrial Biotechnology, Faculty of Agro-Industry, Prince 6
of Songkla University, Hat Yai, Songkhla 90112, Thailand; 2
Department of 7
Pharmacognosy and Pharmaceutical Botany, Faculty of Pharmaceutical Sciences, Prince of 8
Songkla University, Hat Yai, Songkhla 90112, Thailand, 3Institute of Plant Science and 9
Resources, Okayama University, Chuo, Kurashiki 710-0046, Japan. 10
*Corresponding author: Suppasil Maneerat 11
E-mail: [email protected] 12
Tel. +66 74286379, Fax +66 74558866 13
14
15
16
17
18
19
20
21
22
Page 2 of 29
For Proof Read only
Songklanakarin Journal of Science and Technology SJST-2014-0216.R1 Maneerat
123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960
![Page 2: For Review Only - Prince of Songkla Universityrdo.psu.ac.th/sjstweb/Ar-Press/58-Apr/13.pdf · 72 Bacteriocin activity was checked by agar well diffusion (AWD) assay (Schillinger 73](https://reader033.vdocuments.net/reader033/viewer/2022042201/5ea161f7c2698b059763aca5/html5/thumbnails/2.jpg)
For Review O
nly
2
Abstract 23
Enterocin CE5-1 produced by Enterococcus faecium CE5-1 isolated from the 24
chicken gastrointestinal tract was active in the wide range of pH 2-10 and temperature 30-25
100 °C and sensitive to proteolytic enzymes and α-amylase. It remained active after storage 26
at -20 °C for 2 months. Moreover, enterocin CE5-1 showed antibacterial activity against 27
lactobacilli, bacilli, listeria, staphylococci and enterococci, especially antibiotic-resistant 28
enterococci. In vitro study of enterocin CE5-1 decreased the population of Ent. faecalis 29
VanB from 6.03 to 4.03 log CFU/ml. The lethal mode of action of enterocin CE5-1 30
appeared to be pore and filament formation in the cell wall. PCR sequencing analysis 31
revealed the presence of two open reading frames (ORFs), containing enterocin CE5-1 32
(entCE5-1) and enterocin immunity (entI) gene. Therefore, enterocin CE5-1 from Ent. 33
faecium CE5-1 could possibly be used as an antimicrobial agent to control foodborne 34
pathogen, spoilage bacteria and antibiotic-resistant enterococci in foods, feeds and the 35
environments. 36
Keywords: enterocin; Enterococcus faecium; chicken; antibiotic-resistant enterococci 37
38
Page 3 of 29
For Proof Read only
Songklanakarin Journal of Science and Technology SJST-2014-0216.R1 Maneerat
123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960
![Page 3: For Review Only - Prince of Songkla Universityrdo.psu.ac.th/sjstweb/Ar-Press/58-Apr/13.pdf · 72 Bacteriocin activity was checked by agar well diffusion (AWD) assay (Schillinger 73](https://reader033.vdocuments.net/reader033/viewer/2022042201/5ea161f7c2698b059763aca5/html5/thumbnails/3.jpg)
For Review O
nly
3
Introduction 39
Vancomycin-resistant enterococci (VRE) are enterococci that are resistant to 40
vancomycin. Enterococci are widespread in nature such as soil, water, food and 41
gastrointestinal tract (GIT) in human and animal, and they have been considered as an 42
opportunistic pathogens in hospitals. They cause serious diseases such as nervous system, 43
blood stream, neonatal, nosocomial and other infections (Sood et al., 2008). In addition, 44
some of them can transmit the antibiotic-resistant gene to other bacteria and may involve in 45
the spread of these genes into environment and food chain (Abriouel et al., 2005; Klare et 46
al., 2003). 47
In our previous work, we found that Ent. faecium CE5-1 isolated from GIT of Thai 48
indigenous chicken was suitable potential probiotic strains (Saelim et al., 2012). This strain 49
was able to inhibit all lactic acid bacteria (LAB) strains and some Gram-positive bacteria 50
such as Enterococcus, Pediococcus, Lactobacillus and Listeria monocytogenes, especially 51
VRE. In addition, Ent. faecium CE5-1 was able to reduce the growth of Ent. faecalis VanB 52
in vitro which inhibitory effects of Ent. faecium CE5-1 were due to the combination of 53
organic acid, hydrogen peroxide and bacteriocin productions. Bacteriocins are ribosomally 54
synthesized, extracellularly released bioactive peptide or peptide complexes which have 55
bactericidal or bacteriostatic effects on closely related species (Garneau et al., 2002). Many 56
research have explored the use of bacteriocins for control of pathogenic and spoilage 57
bacteria in food. However, there is also interest in the use of them for its application to 58
control the dissemination of VRE. 59
Page 4 of 29
For Proof Read only
Songklanakarin Journal of Science and Technology SJST-2014-0216.R1 Maneerat
123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960
![Page 4: For Review Only - Prince of Songkla Universityrdo.psu.ac.th/sjstweb/Ar-Press/58-Apr/13.pdf · 72 Bacteriocin activity was checked by agar well diffusion (AWD) assay (Schillinger 73](https://reader033.vdocuments.net/reader033/viewer/2022042201/5ea161f7c2698b059763aca5/html5/thumbnails/4.jpg)
For Review O
nly
4
In this study, we describe the characterization of enterocin CE5-1 produced by the 60
probiotic Ent. faecium CE5-1. In addition, the efficacy in vitro of enterocin CE5-1 against 61
VRE was also studied. 62
2. Materials and Methods 63
2.1 Bacterial strains and culture conditions 64
Ent. faecium CE5-1 was isolated from gastrointestinal tract (GIT) of Thai 65
indigenous chicken. The indicator strains used for inhibition study are listed in Table 1. All 66
the LAB strains were grown in deMan, Rogosa and Shape broth (MRS broth, Hi Media 67
Laboratory Pvt. Ltd., Mumbai, India, pH 6.5 ± 0.2) at 37 °C. Other strains were grown in 68
Brain Heart Infusion broth (BHI broth, Hi Media Laboratory Pvt. Ltd., Mumbai, India) at 69
37 °C. 70
2.2 Determination of bacteriocin activity 71
Bacteriocin activity was checked by agar well diffusion (AWD) assay (Schillinger 72
and Lucke, 1989) using Lactobacillus sakei subsp. sakei JCM1157 as an indicator strain 73
and expressed in arbitrary units (AU/ml). An arbitrary unit was defined as the reciprocal of 74
highest two-fold dilution showing clear zones of growth inhibition and is expressed in 75
arbitrary units per ml. 76
2.3 Preparation of crude enterocin CE5-1 77
Ent. faecium CE5-1 was grown in 1 L of MRS broth at 37 °C for 15 h. Cells were 78
removed by centrifugation at 12,000×g for 10 min at 4 °C and supernatant was collected. 79
Ammonium sulfate was added to the supernatant to reach 60% saturation. Then, the 80
mixture was stirred overnight at 4 °C. The precipitant was collected by centrifugation at 81
Page 5 of 29
For Proof Read only
Songklanakarin Journal of Science and Technology SJST-2014-0216.R1 Maneerat
123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960
![Page 5: For Review Only - Prince of Songkla Universityrdo.psu.ac.th/sjstweb/Ar-Press/58-Apr/13.pdf · 72 Bacteriocin activity was checked by agar well diffusion (AWD) assay (Schillinger 73](https://reader033.vdocuments.net/reader033/viewer/2022042201/5ea161f7c2698b059763aca5/html5/thumbnails/5.jpg)
For Review O
nly
5
12,000×g for 20 min at 4 °C. The pellet was dissolved in 50 mM sodium phosphate buffer 82
(PB) pH 5.8 and dialyzed using dialysis tubes with molecular cut-off 1 kDa (Spectra/Por®
, 83
Spectrum Medical Industries, Inc., Texas, USA) against the same buffer at 4 °C overnight 84
and lyophilized. 85
2.4 Characterization of enterocin CE5-1 from Ent. faecium CE5-1 86
2.4.1 Spectrum of bacteriocin activity 87
The crude enterocin CE5-1 powder (1 mg/ml) was used for determination of activity 88
spectrum of bacteriocin using the method of AWD assay with various indicator strains as 89
shown in Table 1. 90
2.4.2 Effect of enzyme on bacteriocin activity 91
The crude enterocin CE5-1 powder (1 mg/ml) was dissolved with 50 mM PB, pH 92
7.5 in the presence of 1 mg/ml of each enzyme including proteinase K, pronase E, trypsin, 93
α-chymotrypsin, α-amylases and lipase. The samples were incubated in a water bath at 37 94
°C for 3 h. After incubation, the enzyme was inactivated by heating at 100 °C for 5 min. 95
2.4.3 Effect of pH on bacteriocin stability 96
The crude enterocin CE5-1 powder (1 mg/ml) was dissolved in buffer at different 97
pH as follows: 50 mM glycine-HCl buffer (pH 2.2 to 3.6); 50 mM citric acid-sodium citrate 98
buffer (pH 3.0 to 6.2); 50 mM M sodium phosphate buffer (pH 5.7 to 8.0); 50 mM tris-HCl 99
buffer (pH 7.0 to 9.0); and 50 mM glycine-NaOH buffer (pH 8.6 to 10.6) and incubated at 100
37 °C for 24 h. 101
Page 6 of 29
For Proof Read only
Songklanakarin Journal of Science and Technology SJST-2014-0216.R1 Maneerat
123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960
![Page 6: For Review Only - Prince of Songkla Universityrdo.psu.ac.th/sjstweb/Ar-Press/58-Apr/13.pdf · 72 Bacteriocin activity was checked by agar well diffusion (AWD) assay (Schillinger 73](https://reader033.vdocuments.net/reader033/viewer/2022042201/5ea161f7c2698b059763aca5/html5/thumbnails/6.jpg)
For Review O
nly
6
2.4.4 Effect of temperature on bacteriocin stability 102
The crude enterocin CE5-1 powder (1 mg/ml) was dissolved in different buffers 103
including glycine-HCl buffer pH 3.0, phosphate buffer pH 6.5 and glycine-NaOH buffer 104
pH 8.6. The sample was heated under different temperature at 30 to 100 °C for 2 h and 105
sterilizing temperature at 110 °C for 20 min and 121 °C for 15 min using an autoclave 106
(Tommy Seiko Corp., Tokyo, Japan). 107
For effect of storage temperature and time on bacteriocin activity, entericin CE5-1 108
was dissolved in different buffers including glycine-HCl buffer pH 3.0, phosphate buffer 109
pH 6.5 and glycine-NaOH buffer pH 8.6. Then, the samples were stored at 4 °C, -20 °C and 110
room temperature (29 ± 2 °C) for a period of three months. 111
2.5 In vitro antibacterial effect of enterocin CE5-1 on the survival of Ent. faecalis 112
VanB 113
Ent. faecalis VanB was incubated in 50 ml of MRS broth at 37 °C. After 6 h of 114
incubation in the early logarithmic phase, enterocin CE5-1 was added to the culture broth 115
of Ent. faecalis VanB at a final concentration of 2,560 AU/ml. The viability of Ent. faecalis 116
VanB was determined by using the drop plate method (Hoben and Somasegaran, 1982) in 117
triplicate onto MRS agar and incubated at 37 °C for 48 h. Ent. faecalis VanB cultivated in 118
50 ml of MRS broth without added enterocin CE5-1 was used as control. 119
Morphological changes of Ent. faecalis VanB after treatment with enterocin CE5-1 120
were observed with scanning electron microscopy (SEM; FEI Quanta 400, Oxford. 121
Instruments, Oxford). The cells were centrifuged at 12,000×g at 4 °C for 10 min and 122
resuspended in 0.2 M phosphate buffer pH 7.0. The samples were fixed in 2.5% 123
Page 7 of 29
For Proof Read only
Songklanakarin Journal of Science and Technology SJST-2014-0216.R1 Maneerat
123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960
![Page 7: For Review Only - Prince of Songkla Universityrdo.psu.ac.th/sjstweb/Ar-Press/58-Apr/13.pdf · 72 Bacteriocin activity was checked by agar well diffusion (AWD) assay (Schillinger 73](https://reader033.vdocuments.net/reader033/viewer/2022042201/5ea161f7c2698b059763aca5/html5/thumbnails/7.jpg)
For Review O
nly
7
gluteraldehyde, dehydrated with a graded ethanol series (10, 30, 50, 70, 90 and 100%), 124
critical-point dried with CO2 and mounted on SEM stubs. Then, the samples were observed 125
with SEM. 126
2.7 PCR and DNA sequencing 127
The genomic DNA of Ent. faecium CE5-1 was extracted using the Genomic DNA 128
Mini Kit (Geneaid, Tao-Yuan, Taiwan). The entCE5-1 genes were amplified from specific 129
primers: EntF 5′- AGGGGTGATTAGATTATGAAAC-3′ and EntR 5′- 130
TTAAAATTGAGATTTATCTCCATAATC-3′. The PCR reactions composed of the 131
following steps: initial denaturation at 94 °C for 5 min and then performed in 30 cycles of 132
denaturation at 94 °C for 1 min, annealing at 58 °C for 1 min and extension at 72 °C for 3 133
min, followed by final extension at 72 °C for another 10 min, then immediately cooled at 4 134
°C. PCR products were determined by agarose gel electrophoresis and purified using a 135
HiYield TM Gel/PCR extraction kit (Real Biotech Corporation, Taipei, Taiwan). The 136
purified DNA fragments were sequenced and compared to nucleotide sequence database of 137
GenBank via BLAST search (http://www.ncbi.nlm.nih.gov). 138
3. Results and Discussion 139
3.1 Inhibitory spectrum of enterocin CE5-1 140
The crude entercin CE5-1 showed antibacterial activity against Gram-positive 141
bacteria (Enterococcus, Lactobacillus, and Pediococcus strains) and foodborne pathogenic 142
and spoilage bacteria (Bacillus cereus, L. monocytogenes and Staphylococcus aureus), but 143
not against Gram-negative bacteria (Table 1). Usually, bacteriocins from Enterococcus are 144
active against Gram-positive foodborne pathogenic and food spoilage bacteria, whereas 145
Page 8 of 29
For Proof Read only
Songklanakarin Journal of Science and Technology SJST-2014-0216.R1 Maneerat
123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960
![Page 8: For Review Only - Prince of Songkla Universityrdo.psu.ac.th/sjstweb/Ar-Press/58-Apr/13.pdf · 72 Bacteriocin activity was checked by agar well diffusion (AWD) assay (Schillinger 73](https://reader033.vdocuments.net/reader033/viewer/2022042201/5ea161f7c2698b059763aca5/html5/thumbnails/8.jpg)
For Review O
nly
8
they are inactive against Gram-negative bacteria. Similar results were reported for enterocin 146
from Ent. faecium MTCC513 (Badarinath and Halami, 2011). The resistance of Gram-147
negative bacteria to bacteriocins could be due to the relative impermeability of their outer 148
membranes (Jack et al., 1995). This result indicates that entercin CE5-1 from Ent. faecium 149
CE5-1 can be used as biopresevatives and to extend shelf life of foods. 150
Moreover, bacteriocin-producing Ent. faecium CE5-1 was not inhibited by its own 151
bacteriocin due to the production of immunity protein to protect itself. From genetic 152
characterization of enterocin A from Ent. faecium CE5-1, the enterocin A immunity gene in 153
genomic DNA of Ent. faecium CE5-1 was observed (Figure 1). 154
Currently, many recent researches have demonstrated bacteriocins for application in 155
food, there have been a few studies on their application in therapeutics. Unakal (2013) 156
reported that bacteriocin produced from Ent. faecium was active against multiple resistant 157
bacteria isolated from different clinical specimens i.e. Pseudomonas aeruginosa, E. coli, S. 158
aureus. Interestingly, our results showed that enterocin CE5-1 exhibited inhibitory activity 159
against antibiotic-resistant enterococci, especially Ent. faecalis VanB. Ent. faecalis VanB, 160
known as VRE, is more resistant to streptomycin, tetracycline and vancomycin (Saelim 161
et al., 2012). Most often, VRE have been isolated from patients and food animals in many 162
countries and acknowledged as the leading cause of hospital-acquired infections (Noviais et 163
al., 2005). Based on this spectrum of inhibitory activity, enterocin CE5-1 from Ent. faecium 164
CE5-1 may be used as a therapeutic agent to control antibiotic-resistant enterococci. 165
3.2 Effect of enzyme 166
Bacteriocin activity of the crude enterocin CE5-1 was inactivated by proteolytic 167
enzyme and α-amylase (Table 2). After addition of proteolytic enzyme or α-amylase, the 168
Page 9 of 29
For Proof Read only
Songklanakarin Journal of Science and Technology SJST-2014-0216.R1 Maneerat
123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960
![Page 9: For Review Only - Prince of Songkla Universityrdo.psu.ac.th/sjstweb/Ar-Press/58-Apr/13.pdf · 72 Bacteriocin activity was checked by agar well diffusion (AWD) assay (Schillinger 73](https://reader033.vdocuments.net/reader033/viewer/2022042201/5ea161f7c2698b059763aca5/html5/thumbnails/9.jpg)
For Review O
nly
9
bacteriocin activity was lost. Similar results were also reported for enterocin ON-157 169
produced by Ent. faecium NIAI157 (Ohmomo et al., 2000). Lee and Kim (2010) also 170
reported that inactivation of bacteriocin activity from Ent. faecium DB1 was observed after 171
treatment with proteolytic enzymes and α-amylase. This suggested that carbohydrate and 172
protein moieties were required for the bacteriocin activity of enterocin CE5-1. Due to the 173
sensitivity of our bacteriocin to digestive enzymes, it suggests that enterocin CE5-1 from 174
Ent. faecium CE5-1 could be safely used. 175
3.3 Effect of pH 176
Bacteriocin activity of the crude enterocin CE5-1 at different pH levels is shown in 177
Table 2. The bacteriocin activity of enterocin CE5-1 was active in a wide pH range (2.2 - 178
10.6). These results are supported by Franz et al. (1996), who showed that enterocin 900 179
retained activity at pH ranging from 2.0 - 10.0. The maximum bacteriocin activity of 180
enterocin CE5-1 was observed at acidic (glycine-HCl buffer pH 3.0 - 3.6), neutral (sodium 181
phosphate buffer pH 5.7 - 6.5) and alkaline (glycine-NaOH buffer pH 8.6 - 9.6) pH 182
conditions after 1 h of incubation at 37 °C. Moreover, the decrease in bacteriocin activity 183
after 24 h of incubation was observed in acidic condition, while inactivation occurred in PB 184
pH 6.5 - 8.0, tris-HCl buffer pH 7.0 and glycine-NaOH buffer pH 10.6. These results 185
indicated that enterocin CE5-1 retained its bacteriocin activity in acidic condition rather 186
than neutral and alkaline conditions and can be applied in several products. 187
3.4 Effect of temperature 188
In this context, we were interested in investigating the effects of temperature on 189
bacteriocin stability in different pH. Figure 2 showed that the crude enterocin CE5-1 was 190
stable to heating at 30 - 90 °C for 30 min, except that at pH 8.6, in which reduced activity 191
Page 10 of 29
For Proof Read only
Songklanakarin Journal of Science and Technology SJST-2014-0216.R1 Maneerat
123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960
![Page 10: For Review Only - Prince of Songkla Universityrdo.psu.ac.th/sjstweb/Ar-Press/58-Apr/13.pdf · 72 Bacteriocin activity was checked by agar well diffusion (AWD) assay (Schillinger 73](https://reader033.vdocuments.net/reader033/viewer/2022042201/5ea161f7c2698b059763aca5/html5/thumbnails/10.jpg)
For Review O
nly
10
occurred at temperatures higher than 60 °C. The thermal stability of enterocin CE5-1 was 192
similar to another enterocin produced from Ent. faecium (Gupta et al., 2010). Heating 193
above 80 °C for 2 h caused the loss or decrease of bacteriocin activity, depending on the pH 194
of the enterocin preparation. Moreover, the enterocin CE5-1 retained bacteriocin activity 195
under sterilization condition at 110 °C for 20 min and 121 °C for 15 min, whereas at pH 6.5 196
and 8.6, it was partially or completely inactivated under sterilization condition. Similarly, 197
enterocin 900 activity from Ent. faecium BFE 900 was heat stable, retaining activity after 198
heating at 121 °C for 15 min (Franz et al., 1996). Heat stability of bacteriocin may be due 199
to the formation of small globular structures and the occurrence of strongly hydrophobic 200
regions, stable cross-linkages and high glycine content (de Vuyst and Vadamme, 1994). 201
The heat stability of enterocin CE5-1 indicates that it could be used as preservatives in 202
foods and feeds because many processing procedures involve a heating step. 203
Stability of enterocin CE5-1 during storage was also investigated. It was found that 204
the enterocin CE5-1 was stable at low temperature. Enterocin CE5-1 could be stored in pH 205
3.0 at -20 °C for at least 2 months, at 4 °C for at least 1 week and at room temperature for 206
at 3 days (Figure 3). Similar results were found in another study conducted by Casaus et al. 207
(1997). The antimicrobial activity of enterocin P was not lost in long-term storage at 4 and -208
20 °C. 209
3.5 In vitro antibacterial effect of enterocin CE5-1 on the survival of Ent. faecalis 210
VanB 211
Effect of enterocin CE5-1 on the survival of Ent. faecalis VanB is shown in Figure 212
4. Ent. faecalis VanB dramatically declined from 6.03 to 4.03 log CFU/ml and remained 213
stable until 18 h of cultivation after enterocin CE5-1 was added. However, the regrowth of 214
Page 11 of 29
For Proof Read only
Songklanakarin Journal of Science and Technology SJST-2014-0216.R1 Maneerat
123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960
![Page 11: For Review Only - Prince of Songkla Universityrdo.psu.ac.th/sjstweb/Ar-Press/58-Apr/13.pdf · 72 Bacteriocin activity was checked by agar well diffusion (AWD) assay (Schillinger 73](https://reader033.vdocuments.net/reader033/viewer/2022042201/5ea161f7c2698b059763aca5/html5/thumbnails/11.jpg)
For Review O
nly
11
Ent. faecalis VanB was observed after 18 h of enterocin CE5-1 treatment, resulting from 215
the bacteriocin concentration used or the development of resistant cells. Similar results 216
were in agreement with previous study obtained by Enan (2006), who found that L. 217
monocytogenes regrowth was observed only in samples treated with a single bacteriocin 218
(nisin or plantaricin UG1) and proved to be resistant variants at a resistance frequency in 219
the range of 10-5
to 10-6
. The resistance to nisin or curvaticin 13 may be due to change in 220
cytoplasmic membrane fatty acid and phospholipid compositions in the cell wall 221
(Bouttefroy and Millière, 2000). 222
However, the decrease of cell counts after treatment with enterocin CE5-1 caused 223
by cell death, confirming any morphological change of cell wall of Ent. faecalis VanB by 224
SEM analysis. Apparently, the cell wall of Ent. faecalis VanB treated with enterocin CE5-1 225
was damaged due to formation of pores and filaments (Figure 5). Generally, class II 226
bacteriocins have an amphiphilic/hydrophilic helical structure, which allows them to insert 227
into the membrane of the target cell, leading to depolarization and death (Cotter et al., 228
2005). According to these results, enterocin CE5-1 showed bactericidal mode of action 229
against Ent. faecalis VanB. 230
3.6 Analysis of enterocin CE5-1 encoding gene 231
Nucleotide sequence of PCR product (about 540 bp) showed 100% homology with 232
enterocin A gene of Ent. faecium (GenBank code AF240561). According to the nucleotide 233
sequence analysis, two ORFs were predicted to encode proteins (Figure 1). The ORF1, 234
designated entCE5-1, encoded the 65 amino acids residues (pre-peptide), including 18 235
amino acids of leader peptide in the putative N-terminus and 47 amino acids of the mature 236
entCE-1. The first 18 amino acids were identified as leader peptide or signal peptide 237
Page 12 of 29
For Proof Read only
Songklanakarin Journal of Science and Technology SJST-2014-0216.R1 Maneerat
123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960
![Page 12: For Review Only - Prince of Songkla Universityrdo.psu.ac.th/sjstweb/Ar-Press/58-Apr/13.pdf · 72 Bacteriocin activity was checked by agar well diffusion (AWD) assay (Schillinger 73](https://reader033.vdocuments.net/reader033/viewer/2022042201/5ea161f7c2698b059763aca5/html5/thumbnails/12.jpg)
For Review O
nly
12
containing Gly-Gly motif at position -1 and -2 and glutamic acid motif (Glu) at position -8. 238
Most of bacteriocins are synthesized in inactive form called pre-bacteriocin or pre-peptides, 239
which carry a leader peptide at N-terminus. There are many types of bacteriocin leader, 240
such as double-glycine-type (G-G) leader peptide, leader peptide and signal peptide (Franz 241
et al., 2007). However, some bacteriocins are synthesized without a leader peptide, such as 242
enterocin L50A, enterocin Q (Cintas et al., 2000), and aureocin A53 (Netz et al., 2002). 243
The leader peptide is cleaved during secretion of enterocin on the cytoplasmic membrane. 244
In addition, the putative mature entCE5-1 was composed of 47 amino acid residues. The 245
prediction of the three-dimensional structure of the putative mature entCE5-1 showed 246
98.8% confidences with the pediocin-like antimicrobial peptide sakacin P (PDB code 247
1OG7) using Phyre2 software. Enterocin CE5-1 was grouped as a Class IIa bacteriocins 248
because it contains YGNGVXC motif near N-terminus. 249
The relationships between structure and function were investigated by diversity of 250
Class IIa enterocins, activity spectrum, amino acid sequences and predicted secondary 251
structure. After alignment of amino acid sequences of Class IIa bacteriocins, the results 252
showed that Class IIa bacteriocins contained many conserved regions (Figure 6). The first 253
region at amino acids 8 to 14 is a region of YGNGVXC motif at N-terminus, which is 254
normally found in Class IIa bacteriocins. However, Class IIa bacteriocins have a strong 255
effect against L. monocytogenes. The YGNGVXC motif does not play a role in inhibition 256
of L. monocytogenes. For example, enterocin EJ97 did not show the YGNGVXC motif, but 257
it can restrain the growth of L. monocytogenes (Gálvez et al., 1998). Though, the 258
replacements made in the YGNGVXC motif showed the decrease of antibacterial activity 259
against target organisms (Franz et al., 2007). The antimicrobial activity was reduced after 260
Page 13 of 29
For Proof Read only
Songklanakarin Journal of Science and Technology SJST-2014-0216.R1 Maneerat
123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960
![Page 13: For Review Only - Prince of Songkla Universityrdo.psu.ac.th/sjstweb/Ar-Press/58-Apr/13.pdf · 72 Bacteriocin activity was checked by agar well diffusion (AWD) assay (Schillinger 73](https://reader033.vdocuments.net/reader033/viewer/2022042201/5ea161f7c2698b059763aca5/html5/thumbnails/13.jpg)
For Review O
nly
13
replacement of tyrosine (Y) residue in the YGNGV motif of carnobacteriocin B2 to 261
phenylalanine (F) residue (Quadri et al., 1997). 262
The second region at Cys-14 and Cys-19 residues forms the disulfide bridge, which 263
plays an important role in spectrum of activity. Two disulfide bonds have broader spectra 264
of activity than those with a single bond (Ennahar et al., 2000; Simon et al., 2002). 265
Moreover, addition of reducing agents, such as β-mercaptoethanol or dithiothreitol reduced 266
the inhibitory activity of enterocin KP (Isleroglu et al., 2012) and enterocin A (Badarinath 267
and Halami, 2011). 268
The third regions at Val-21, Trp-23, Ala-26 and Ile-30 are the hydrophobic amino 269
acid residues. However, still little is known about the function of these regions. The three-270
dimensional structure shows that Val-21 and Trp-23 is a hinge region of Class IIa 271
enterocins. Moreover, Ala-26 and Ile-30 locate in the transmembrane helices that binds to 272
the target membrane. 273
Finally, the GXXXG motif at C terminus is found in the transmembrane helices. 274
This motif can interact with the membranes of the bacterial cells. The GXXXG-containing 275
sequence variants cause the antimicrobial activity of bacteriocin. The replacement of 276
glycine that are part of the G13XXXG17-motif in plantaricin J (plnJ) and plantaricin K 277
(plnK) with large residue was detrimental to the antimicrobial activity. However, similar 278
replacements of the other residues (Gly-20 in plnJ and Gly-7, Gly-25 and Gly-26 in plnK) 279
had little effect on the antimicrobial activity of the bacteriocin (Rogne et al., 2009). 280
The ORF2, termed entI, was located downstream of entCE5-1. The entI is 312 bp in 281
length that encoded 103 amino acid sequences and the reported sequence makes it very 282
similar to the enterocin A immunity protein. Genetic analyses showed that prediction of 283
Page 14 of 29
For Proof Read only
Songklanakarin Journal of Science and Technology SJST-2014-0216.R1 Maneerat
123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960
![Page 14: For Review Only - Prince of Songkla Universityrdo.psu.ac.th/sjstweb/Ar-Press/58-Apr/13.pdf · 72 Bacteriocin activity was checked by agar well diffusion (AWD) assay (Schillinger 73](https://reader033.vdocuments.net/reader033/viewer/2022042201/5ea161f7c2698b059763aca5/html5/thumbnails/14.jpg)
For Review O
nly
14
three-dimensional structure of the putative enterocin CE5-1 exhibited 100% confidence 284
with the enterocin A immunity protein (PDB code 2BL8) using Phyre2 software. Immunity 285
protein of Class IIa bacteriocins are located intracellularly, with a small proportion being 286
associated with cell membrane (Soliman et al., 2007). It was produced to protect 287
bacteriocin-producing cells against the antimicrobial activity of their own bacteriocin 288
(Johnsen et al., 2005). However, unknown mechanisms of the immunity protein interact 289
with the bacteriocin. In hypothesis, possibility is that the immunity proteins recognize with 290
a bacteriocin receptor and directly or indirectly inhibit its action by altering the receptor 291
conformation or by hiding its bacteriocin-binding site (Drider et al., 2006). 292
4. Conclusion 293
Enterocin CE5-1 produced from Ent. faecium CE5-1 displays a narrow inhibitory 294
spectrum, tolerance to a wide range of pH and temperature and sensitivity to proteolytic 295
enzymes and α-amylase. In addition, it can inhibit the growth of VRE in vitro. Therefore, 296
enterocin CE5-1 may be potentially suitable for use as an antibacterial agent to control 297
foodborne pathogen, spoilage bacteria in food and feed processes and to decrease the 298
dissemination of VRE in the environments. However, purification of enterocin CE5-1 299
should be studied to prove its structure, safety profile and mode of action. In addition, the 300
ability of the enterocin CE5-1 or enterocin CE5-1-producing cells to control foodborne 301
pathogen, spoilage bacteria or VRE in situ has to be investigated. 302
Acknowledgment 303
This work was supported by the Office of the Higher Education Commission (grant 304
fund "Strategic Scholarships for Frontier Research Network for the Thai Doctoral Ph.D. 305
Page 15 of 29
For Proof Read only
Songklanakarin Journal of Science and Technology SJST-2014-0216.R1 Maneerat
123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960
![Page 15: For Review Only - Prince of Songkla Universityrdo.psu.ac.th/sjstweb/Ar-Press/58-Apr/13.pdf · 72 Bacteriocin activity was checked by agar well diffusion (AWD) assay (Schillinger 73](https://reader033.vdocuments.net/reader033/viewer/2022042201/5ea161f7c2698b059763aca5/html5/thumbnails/15.jpg)
For Review O
nly
15
Program, Thailand") and Prince of Songkla University (Contract No. AGR550004S), 306
Thailand. 307
References 308
Abriouel, H., Lucas, R., Ben Omar, N., Valdivia, E., Maqueda, M., Martínez-Cañamero, M. 309
and Gálvez, A. 2005. Enterocin AS-48RJ: a variant of enterocin AS-48 310
chromosomally encoded by Enterococcus faecium RJ16 isolated from food. 311
Systematic and Applied Microbiology. 28, 383–397. 312
Badarinath, V. and Halami, P.M. 2011. Molecular characterization of class IIa, heat-stable 313
enterocin produced by Enterococcus faecium MTCC 5153. Indian Journal of 314
Biotechnology. 10, 307–315. 315
Bouttefroy, A. and Millière, J.B. 2000. Nisin-curvaticin 13 combinations for avoiding the 316
regrowth of bacteriocin resistant cells of Listeria monocytogenes ATCC 15313. 317
International Journal of Food Microbiology. 62, 65–75. 318
Casaus, P., Nilsen, T., Cintas, L.M., Nes, I.F., Hernández, P.E. and Holo, H. 1997. 319
Enterocin B, a new bacteriocin from Enterococcus faecium T136 which can act 320
synergistically with enterocin A. Microbiology. 143, 2287–2294. 321
Cintas, L.M., Casaus, P., Herranz, C., Håvarstein, L.S., Holo, H., Hernández, P.E. and Nes, 322
I.F. 2000. Biochemical and genetic evidence that Enterococcus faecium L50 323
produces enterocins L50A and L50B, thesec-dependent enterocin P, and a novel 324
bacteriocin secreted without an N-terminal extension termed enterocin Q. Journal of 325
Bacteriology. 182, 6806–6814. 326
Cotter, P.D., Hill, C. and Ross, R.P. 2005. Food microbiology: bacteriocins: developing 327
innate immunity for food. Nature Reviews Microbiology. 3, 777–788. 328
Page 16 of 29
For Proof Read only
Songklanakarin Journal of Science and Technology SJST-2014-0216.R1 Maneerat
123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960
![Page 16: For Review Only - Prince of Songkla Universityrdo.psu.ac.th/sjstweb/Ar-Press/58-Apr/13.pdf · 72 Bacteriocin activity was checked by agar well diffusion (AWD) assay (Schillinger 73](https://reader033.vdocuments.net/reader033/viewer/2022042201/5ea161f7c2698b059763aca5/html5/thumbnails/16.jpg)
For Review O
nly
16
De Vuyst, L. and Vadamme, E.J. 1994. Bacteriocins of Lactic Acid Bacteria; 329
Microbiology, Genetics and Applications, 1st ed. Blackie Academic & Profesional, 330
London. 331
Drider, D., Fimland, G., Héchard, Y., McMullen, L.M.and Prévost, H. 2006. The 332
continuing story of class IIa bacteriocins. Microbiology and Molecular Biology 333
Reviews. 70, 564–582. 334
Enan, G.E. 2006. Control of the regrowing bacteriocin resistant variants of Listeria 335
monocytogenes LMG 10470 in vitro and in food by nisin-plantaricin UG1 mixture. 336
Biotechnology. 5, 143–147. 337
Ennahar, S., Sashihara, T., Sonomoto, K. and Ishizaki, A. 2000. Class IIa bacteriocins: 338
biosynthesis, structure and activity. FEMS Microbiology Reviews. 24, 85–106. 339
Franz, C.M.A.P., van Belkum, M.J., Holzapfel, W.H., Abriouel, H. and Gálvez, A. 2007. 340
Diversity of enterococcal bacteriocins and their grouping in a new classification 341
scheme. FEMS Microbiology Reviews. 31, 293–310. 342
Franz, C.M., Schillinger, U. and Holzapfel, W.H. 1996. Production and characterization of 343
enterocin 900, a bacteriocin produced by Enterococcus faecium BFE 900 from 344
black olives. International Journal of Food Microbiology. 29, 255–270. 345
Gálvez, A., Valdivia, E., Abriouel, H., Camafeita, E., Mendez, E., Martínez-Bueno, M. and 346
Maqueda, M. 1998. Isolation and characterization of enterocin EJ97, a bacteriocin 347
produced by Enterococcus faecalis EJ97. Archives of Microbiology. 171, 59–65. 348
Garneau, S., Martin, N.I. and Vederas, J.C. 2002. Two-peptide bacteriocins produced by 349
lactic acid bacteria. Biochimie. 84, 577–592. 350
Page 17 of 29
For Proof Read only
Songklanakarin Journal of Science and Technology SJST-2014-0216.R1 Maneerat
123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960
![Page 17: For Review Only - Prince of Songkla Universityrdo.psu.ac.th/sjstweb/Ar-Press/58-Apr/13.pdf · 72 Bacteriocin activity was checked by agar well diffusion (AWD) assay (Schillinger 73](https://reader033.vdocuments.net/reader033/viewer/2022042201/5ea161f7c2698b059763aca5/html5/thumbnails/17.jpg)
For Review O
nly
17
Gupta, H., Malik, R.K., Bhardwaj, A., Kaur, G., De, S. and Kaushik, J.K. 2010. 351
Purification and characterization of enterocin FH 99 produced by a faecal isolate 352
Enterococcus faecium FH 99. Indian Journal of Microbiology. 50, 145–155. 353
Hoben, H.J. and Somasegaran, P. 1982. Comparison of the pour, spread, and drop plate 354
methods for enumeration of Rhizobium spp. in inoculants made from presterilized 355
peat. Applied and Environmental Microbiology. 44, 1246–1247. 356
Isleroglu, H., Yildirim, Z., Tokatli, M., Oncul, N. and Yildirim, M. 2012. Partial 357
characterisation of enterocin KP produced by Enterococcus faecalis KP, a cheese 358
isolate. International Journal of Dairy Technology. 65, 90–97. 359
Jack, R.W., Tagg, J.R. and Ray, B. 1995. Bacteriocins of gram-positive bacteria. 360
Microbiological Reviews. 59, 171–200. 361
Johnsen, L., Dalhus, B., Leiros, I. and Nissen-Meyer, J. 2005. 1.6-Angstroms crystal 362
structure of EntA-im. A bacterial immunity protein conferring immunity to the 363
antimicrobial activity of the pediocin-like bacteriocin enterocin A. Journal of 364
Biological Chemistry. 280, 19045–19050. 365
Klare, I., Konstabel, C., Badstübner, D., Werner, G. and Witte, W. 2003. Occurrence and 366
spread of antibiotic resistances in Enterococcus faecium. International Journal of 367
Food Microbiology. 88, 269–290. 368
Lee, H.-J. and Kim, W.J. 2010. Isolation and characterization of anti-listerial and amylase 369
sensitive enterocin producing Enterococcus faecium DB1 from Gajami-sikhae, a 370
fermented flat fish in Korea. Food Science Biotechnology. 19, 373–381. 371
Netz, D.J.A., Pohl, R., Beck-Sickinger, A.G., Selmer, T., Pierik, A.J., Bastos, M. do C. de 372
F. and Sahl, H.-G. 2002. Biochemical characterisation and genetic analysis of 373
Page 18 of 29
For Proof Read only
Songklanakarin Journal of Science and Technology SJST-2014-0216.R1 Maneerat
123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960
![Page 18: For Review Only - Prince of Songkla Universityrdo.psu.ac.th/sjstweb/Ar-Press/58-Apr/13.pdf · 72 Bacteriocin activity was checked by agar well diffusion (AWD) assay (Schillinger 73](https://reader033.vdocuments.net/reader033/viewer/2022042201/5ea161f7c2698b059763aca5/html5/thumbnails/18.jpg)
For Review O
nly
18
aureocin A53, a new, atypical bacteriocin from Staphylococcus aureus. Journal of 374
Molecular Biology. 319, 745–756. 375
Novais, C., Coque, T.M., Ferreira, H., Sousa, J.C. and Peixe, L. Environmental 376
contamination with vancomycin-resistant enterococci from hospital sewage in 377
Portugal. Applied and Environmental Microbiology. 71, 3364–3368. 378
Ohmomo, S., Murata, S., Katayama, N., Nitisinprasart, S., Kobayashi, M., Nakajima, T., 379
Yajima, M. and Nakanishi, K. 2000. Purification and some characteristics of 380
enterocin ON-157, a bacteriocin produced by Enterococcus faecium NIAI 157. 381
Journal of Applied Microbiology. 88, 81–89. 382
Quadri, L.E.N., Yan, L.Z., Stiles, M.E. and Vederas, J.C. 1997. Effect of amino acid 383
substitutions on the activity of carnobacteriocin B2 overproduction of the 384
antimicrobial peptide, its engineered variants, and its precursor in Escherichia coli. 385
Journal of Biological Chemistry. 272, 3384–3388. 386
Rogne, P., Haugen, C., Fimland, G., Nissen-Meyer, J. and Kristiansen, P.E. 2009. Three-387
dimensional structure of the two-peptide bacteriocin plantaricin JK. Peptides. 30, 388
1613–1621. 389
Saelim, K., Sohsomboon, N., Kaewsuwan, S.and Maneerat, S. 2012. Probiotic properties of 390
Enterococcus faecium CE5-1 producing a bacteriocin-like substance and its 391
antagonistic effect against antibiotic-resistant enterococci in vitro. Czech Journal of 392
Animal Science. 57, 529–539. 393
Schillinger, U. and Lucke, F.K. 1989. Antibacterial activity of Lactobacillus sake isolated 394
from meat. Applied and Environmental Microbiology. 55, 1901–1906. 395
Page 19 of 29
For Proof Read only
Songklanakarin Journal of Science and Technology SJST-2014-0216.R1 Maneerat
123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960
![Page 19: For Review Only - Prince of Songkla Universityrdo.psu.ac.th/sjstweb/Ar-Press/58-Apr/13.pdf · 72 Bacteriocin activity was checked by agar well diffusion (AWD) assay (Schillinger 73](https://reader033.vdocuments.net/reader033/viewer/2022042201/5ea161f7c2698b059763aca5/html5/thumbnails/19.jpg)
For Review O
nly
19
Simon, L., Fremaux, C., Cenatiempo, Y. and Berjeaud, J.M. 2002. Sakacin G, a new type 396
of antilisterial bacteriocin. Applied and Environmental Microbiology. 68, 6416–397
6420. 398
Soliman, W., Bhattacharjee, S. and Kaur, K. 2007. Molecular dynamics simulation study of 399
interaction between a class IIa bacteriocin and its immunity protein. Biochimica et 400
Biophysica Acta. 1774, 1002–1013. 401
Sood, S., Malhotra, M., Das, B.K. and Kapil, A. 2008. Enterococcal infections & 402
antimicrobial resistance. Indian Journal of Medical Research.128, 111–121. 403
Unakal, C.G. 2013. Effect of bacteriocin produced from Enterococcus faecium against drug 404
resistant bacterial isolates. International Journal of Biomedical and Advance 405
Reserch. 3, 881-886. 406
Page 20 of 29
For Proof Read only
Songklanakarin Journal of Science and Technology SJST-2014-0216.R1 Maneerat
123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960
![Page 20: For Review Only - Prince of Songkla Universityrdo.psu.ac.th/sjstweb/Ar-Press/58-Apr/13.pdf · 72 Bacteriocin activity was checked by agar well diffusion (AWD) assay (Schillinger 73](https://reader033.vdocuments.net/reader033/viewer/2022042201/5ea161f7c2698b059763aca5/html5/thumbnails/20.jpg)
For Review O
nly
Figure captions
Figure 1. Nucleotide sequence of enterocin A structural (ORF1) and immunity (ORF2)
genes. The arrows are indicated as the start codons. The asterisks are indicated at the
end of protein synthesis. Leader peptides are indicated by bold type. Transmembrane
helices are enclosed in boxes.
Figure 2. Effect of temperature on bacteriocin activity.
Figure 3. Effect of storage temperature and time on bacteriocin activity in different pH.
Figure 4. Growth of the Enterococcus faecalis VanB in MRS broth with enterocin
CE5-1 (VanB+) and without enterocin CE5-1 (VanB). The arrow indicates the point at
which the enterocin CE5-1 was added.
Figure 5. Scanning electron microscopy (SEM) of Enterococcus faecalis VanB cells.
(A) untreated and (B) treated with enterocin CE5-1. An arrow indicates pore formation.
Figure 6. Alignment of the putative amino acid of Class IIa bacteriocin. (ent:
enterocin; mut: mutacin; mes: mesenteriocin; lac: lactococcin; cur: curracin; leu:
leucocin; wei: weissellin; sak: sakacin; ped: pediocin).
Page 21 of 29
For Proof Read only
Songklanakarin Journal of Science and Technology SJST-2014-0216.R1 Maneerat
123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960
![Page 21: For Review Only - Prince of Songkla Universityrdo.psu.ac.th/sjstweb/Ar-Press/58-Apr/13.pdf · 72 Bacteriocin activity was checked by agar well diffusion (AWD) assay (Schillinger 73](https://reader033.vdocuments.net/reader033/viewer/2022042201/5ea161f7c2698b059763aca5/html5/thumbnails/21.jpg)
For Review O
nly
M K H L K I L S I K E T Q L I
1 AGGGGTGATTAGATTATGAAACATTTAAAAATTTTGTCTATTAAAGAGACACAACTTATC
Y G G T T H S G K Y Y G N G V Y C T K N
61 TATGGGGGTACCACTCATAGTGGAAAATATTATGGAAATGGAGTGTATTGCACTAAAAAT
K C T V D W A K A T T C I A G M S I G G
121 AAATGTACGGTCGATTGGGCCAAGGCAACTACTTGTATTGCAGGAATGTCTATAGGTGGT
F L G G A I P G K C * M K K N A K Q I V
181 TTTTTAGGTGGAGCAATTCCAGGGAAGTGCTAAAATGAAAAAAAATGCTAAGCAAATTGT
H E L Y N D I S I S K D P K Y S D I L E
241 TCATGAATTATATAATGATATATCTATAAGTAAAGATCCTAAATATTCTGATATTCTTGA
V L Q K V Y L K L E K Q K Y E L D P S P
301 GGTTTTACAAAAGGTATATTTAAAATTAGAAAAACAAAAATATGAATTAGATCCCAGTCC
L I N R L V N Y L Y F T A Y T N K I R F
361 TTTAATAAATAGATTGGTGAATTATCTATATTTTACTGCTTATACTAATAAAATAAGATT
T E Y Q E E L I R N L S E I G R T A G I
421 CACTGAATATCAAGAGGAATTAATAAGAAATTTGAGTGAAATTGGAAGAACTGCTGGAAT
N G L Y R A D Y G D K S Q F *
481 AAATGGTTTATATCGAGCAGATTATGGAGATAAATCTCAATTTTAATGATACTTATAATA
ORF1
ORF2
Fig. 1
Page 22 of 29
For Proof Read only
Songklanakarin Journal of Science and Technology SJST-2014-0216.R1 Maneerat
123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960
![Page 22: For Review Only - Prince of Songkla Universityrdo.psu.ac.th/sjstweb/Ar-Press/58-Apr/13.pdf · 72 Bacteriocin activity was checked by agar well diffusion (AWD) assay (Schillinger 73](https://reader033.vdocuments.net/reader033/viewer/2022042201/5ea161f7c2698b059763aca5/html5/thumbnails/22.jpg)
For Review O
nly
Fig. 2
Page 23 of 29
For Proof Read only
Songklanakarin Journal of Science and Technology SJST-2014-0216.R1 Maneerat
123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960
![Page 23: For Review Only - Prince of Songkla Universityrdo.psu.ac.th/sjstweb/Ar-Press/58-Apr/13.pdf · 72 Bacteriocin activity was checked by agar well diffusion (AWD) assay (Schillinger 73](https://reader033.vdocuments.net/reader033/viewer/2022042201/5ea161f7c2698b059763aca5/html5/thumbnails/23.jpg)
For Review O
nly
Fig. 3
Page 24 of 29
For Proof Read only
Songklanakarin Journal of Science and Technology SJST-2014-0216.R1 Maneerat
123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960
![Page 24: For Review Only - Prince of Songkla Universityrdo.psu.ac.th/sjstweb/Ar-Press/58-Apr/13.pdf · 72 Bacteriocin activity was checked by agar well diffusion (AWD) assay (Schillinger 73](https://reader033.vdocuments.net/reader033/viewer/2022042201/5ea161f7c2698b059763aca5/html5/thumbnails/24.jpg)
For Review O
nly
Fig. 4
Page 25 of 29
For Proof Read only
Songklanakarin Journal of Science and Technology SJST-2014-0216.R1 Maneerat
123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960
![Page 25: For Review Only - Prince of Songkla Universityrdo.psu.ac.th/sjstweb/Ar-Press/58-Apr/13.pdf · 72 Bacteriocin activity was checked by agar well diffusion (AWD) assay (Schillinger 73](https://reader033.vdocuments.net/reader033/viewer/2022042201/5ea161f7c2698b059763aca5/html5/thumbnails/25.jpg)
For Review O
nly
Fig. 5
Page 26 of 29
For Proof Read only
Songklanakarin Journal of Science and Technology SJST-2014-0216.R1 Maneerat
123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960
![Page 26: For Review Only - Prince of Songkla Universityrdo.psu.ac.th/sjstweb/Ar-Press/58-Apr/13.pdf · 72 Bacteriocin activity was checked by agar well diffusion (AWD) assay (Schillinger 73](https://reader033.vdocuments.net/reader033/viewer/2022042201/5ea161f7c2698b059763aca5/html5/thumbnails/26.jpg)
For Review O
nly
10 20 30 40 50
....|....|....|....|....|....|....|....|....|....|...
ent CE5-1 TTHSGKYYGNGVYCTKNKCTVDWAKATTCIAGMSI------GGFLGGAIPGKC-
ent A TTHSGKYYGNGVYCTKNKCTVDWAKATTCIAGMSI------GGFLGGAIPGKC-
ent P ---ATRSYGNGVYCNNQKCWVNWNEAKQQIAG-----IVIGGWASGLASMGR-
ent SE-K4 ----ATYYGNGVYCNKQKCWVDWSRARSEIIDRGV-KAYVNGFTKVLGGIGGR
ent CRL35 -----KYYGNGVSCNKKGCSVDWGKAIGIIGNNSA-ANLATGGAAGWKS----
mut F-59.1 -----KYYGNGVTCGKHSXSVDWXKXT--------------------------
mes Y105 -----KYYGNGVHCTKSGCSVNWGEAASAGIHR-----LANGGN-GF------
lac MMFII -----TSYGNGVHCNKSKCWIDVSELETYKAG-----TVSN--PKDILW----
cur A ----ARSYGNGVYCNNKKCWVNRGEATQSIIG-----GMISGWASGLAGM---
leu C -----KNYGNGVHCTKKGCSVDWGYAWTNIANNSV-MNGLTGGNAGWHN----
wei A -----KNYGNGVYCNKHKCSVDWATFSANIANNSVAMAGLTGGNAGNK-----
sak P -----KYYGNGVHCGKHSCTVDWGTAIGCIGNNAA-ANWATGGNAGWNKC---
ped PA-1 -----KYYGNGVTCGKHSCSVDWGKATTCIINNGA-MAXATGGHQGNHKX---
Consensus YGNGVXC C V W A I GXXXG
Fig. 6
Page 27 of 29
For Proof Read only
Songklanakarin Journal of Science and Technology SJST-2014-0216.R1 Maneerat
123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960
![Page 27: For Review Only - Prince of Songkla Universityrdo.psu.ac.th/sjstweb/Ar-Press/58-Apr/13.pdf · 72 Bacteriocin activity was checked by agar well diffusion (AWD) assay (Schillinger 73](https://reader033.vdocuments.net/reader033/viewer/2022042201/5ea161f7c2698b059763aca5/html5/thumbnails/27.jpg)
For Review O
nly
Table 1 Antagonistic spectrum of a crude enterocin CE5-1 of Ent. faecium CE5-1.
Indicator stains Sourcea
Radius of inhibition zone
(mm)
supernatantc 1 mg/mld
Bacillus cereus DMST5040 DMST 0 5.7
Enterococcus durans 3L20 Our strain collection 1.5 4.6
Enterococcus faecalis 2L24 Our strain collection 1.0 2.2
Enterococcus faecalis VanBb CU 2.0 4.9
Enterococcus faecium 139b CU 0 0
Enterococcus faecium 174b CU 1.5 3.8
Enterococcus faecium 348b CU 1.5 3.7
Enterococcus faecium 4S13 Our strain collection 1.5 3.8
Enterococcus faecium 8S16 Our strain collection 2.0 4.7
Enterococcus faecium CE5-1 Our strain collection 0 0
Enterococcus faecium L7-45 Our strain collection 2.2 4.6
Enterococcus gallinarum VanCb CU 2.0 4.0
Escherichia coli DMST4212 DMST 0 0
Lactobacillus plantarum D6SM3 Our strain collection 0 6.0
Lactobacillus sakei subsp sakei JCM1157 JCM 6.0 6.0
Listeria monocytogenes DMST17303 DMST 5.0 5.0
Pediococcus pentosaceus 3CE27 Our strain collection 3.0 2.7
Pediococcus pentosaceus DMST18752 ATCC 0 1.0
Salmonella Typhimurium DMST16809 DMST 0 0
Salmonella Enteritidis DMST15676 DMST 0 0
Staphylococcus aureus DMST8840 DMST 0 5.6
Vibrio parahaemolyticus DMST5665 DMST 0 0
a Abbreviations: ATCC: American Type Culture Collection; DMST: Department of
Medical Sciences; CU: The WHO Global Salm-Surv Regional Centre of Excellence:
South-East Asia and Western Pacific, Faculty of Veterinary Science, Chulalongkorn
University, Thailand; JCM: Japan Collection of Microorganisms.
b Antibiotic-resistant enterococci.
c Reference from Saelim et al. (2012).
d The crude enterocin CE5-1 after 60% ammonium sulfate precipitation.
Page 28 of 29
For Proof Read only
Songklanakarin Journal of Science and Technology SJST-2014-0216.R1 Maneerat
123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960
![Page 28: For Review Only - Prince of Songkla Universityrdo.psu.ac.th/sjstweb/Ar-Press/58-Apr/13.pdf · 72 Bacteriocin activity was checked by agar well diffusion (AWD) assay (Schillinger 73](https://reader033.vdocuments.net/reader033/viewer/2022042201/5ea161f7c2698b059763aca5/html5/thumbnails/28.jpg)
For Review O
nly
Table 2 Effect of enzyme and pH on bacteriocin activity.
Treatments Residual bacteriocin activity (AU/ml)
Effect of enzyme
Control 80
Trypsin 0
α-chymotrypsin 0
Proteinase K 0
Pronase E 0
α-amylases 0
Lipase 80
Effect of pH pH Incubation time (hours)
1 24
Glycine-HCl buffer 2.2 160 160
3.0 320 160
3.6 320 40
Citric buffer 3.0 160 160
4.2 160 80
6.2 160 40
Sodium phosphate buffer 5.7 320 80
6.5 320 0
8.0 80 0
Tris-HCl buffer 7.0 160 0
8.0 80 20
9.0 80 80
Glycine-NaOH buffer 8.6 320 80
9.6 320 80
10.6 160 0
Page 29 of 29
For Proof Read only
Songklanakarin Journal of Science and Technology SJST-2014-0216.R1 Maneerat
123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960