g1a5 tyne m1830 (cy5) vs alde m2736 (cy3) cdna klenow cy-dctp labeled 100pmoles each

G1A5 Tyne M1830 (Cy5) vs Alde M2736 (Cy3) cDNA Klenow Cy-dCTP labeled 100pmoles each

Upload: thora

Post on 21-Jan-2016

27 views

Category:

Documents

0 download

Report

Download

Embed Size (px):

DESCRIPTION

G1A5 Tyne M1830 (Cy5) vs Alde M2736 (Cy3) cDNA Klenow Cy-dCTP labeled 100pmoles each. - PowerPoint PPT Presentation

TRANSCRIPT

G1A5Tyne M1830 (Cy5)vsAlde M2736 (Cy3)

cDNAKlenow Cy-dCTPlabeled

100pmoles each

RESEARCH Open Access Comparative proteomics analysis of … · 2017. 8. 29. · cyanine dyes Cy2, Cy3, and Cy5. A protein sample at 100 μg in triplicate was minimally labeled with

Rafael Irizarry, and Yee Hwa Yang Sandrine Dudoit, Robert ...€¦ · 4 x 4 sectors 19 x 21 probes/sector 6,384 probes/array Sector RGB overlay of Cy3 and Cy5 images Probe. Raw data

Direct observation of breathing dynamics at the mismatc h ... · A solid state 532 nm diode laser (Laser Quantum, U.K.) was used to excite Cy3 and the fluorescence from Cy3 and Cy5

Clinical Performance Evaluation Reporteco-informations.net/wp-content/uploads/2020/04/MiCo...nCoVQS-PPM1 nCoVQS-PPM2 ORF3a IPC N IPC Fluorescent dye FAM Cy5 Cy5 HEX Threshold line

GLYCANS ARE THE FACE OF CELLS - glycotechnica.com · analysis could be done on the LED panel. TM GlycoStation™ Reader 2200 GlycoLite™ 2200 Fluorescence wavelength Cy3, Cy5, FITC

ePapyrus PDF Document - Akina, Incakinainc.com/pdf/BioActs_brochure2009.pdf · Binding Protocol cy3- NHS COE FPR-552 ABCDE Dye Solution / Cy3-NHS Method FPR_552 Takara Protem Myosin

SnapShot: Single-Molecule Fluorescence...10 nm Common ˜uorescent agents include organic ˜uorophores (e.g., Cy5), ˜uorescent proteins (e.g., GFP), and semiconductor quantum dots

CY1 CY3 CY2 CY3 2段開閉形ボール弁

New Cy5 photosensitizers for cancer phototherapy: a low

Clustering & microarray technology...200 10000 50.00 5.64 4800 4800 1.00 0.00 9000 300 0.03 -4.91 Genes Cy3 Cy5 Cy5 Cy3 log 2 Cy5 Cy3! " ## $ % && Extracting Data . 17 Why microarray

Temperature-dependent conformations of exciton-coupled Cy3 … · 2018. 2. 16. · Temperature-dependent conformations of exciton-coupled Cy3 dimers in double-stranded DNA Loni Kringle,1

The Bombyx mori Karyotype and the Assignment of Linkage ...2 22.3 1I12H Fluorescein CACAGGGCTTTTTGGTTCTA GCTTTTATGTTATTCACTCG 2 60.3 5J8G Cy3 AAAACGGCTAACTAACGAAG TGAGAAACAGGAGACTACT

Supplemental Figure 1 - Genes & Developmentgenesdev.cshlp.org/.../gad.242206.114.DC1/Supp_Material.docx · Web viewPhotobleaching of non-specifically bound Spo0J-Cy3 proteins on the

3. Resultados 3.1. Identificación de la caja SOS de R ... · fragmento de 1.2 kb que fue clonado en el vector pGEM-T y secuenciado utilizando los oligonucleótidos Direct-Cy5 y Reverse-Cy5

Disegno, sintesi e caratterizzazione di biorecettori ... · effettuata una marcatura dell’oligonucleotide con il marcatore Cy3™ Mono Reactive. ... Ciò riduce la funzione cardiaca

OASIS D: Ending the Battle Over the Functional …(M1830) Bathing: Current ability to wash entire body safely. Excludes grooming (washing face, w ashing hands, and shampooing hair)

research.monash.edu · 1. KF, DMF 2. 25% TFAin DCM 1. Cy5-OSu DIE-A DMSO OH 1. Biotin-OSu DIE-A DMSO OH x NH HN NH2 NH x NH Cy5-LVSR-AOMK (LE40) HN NH2 biotin-LVSR-AOMK (LE42) Figure

Target Discovery program in Systemic sclerosis...ACTA2 (Cy3) EEF1A1 (Cy5) Untransduced D0 D2 Serum deprivation Seed 10% FBS D3 Transduction with adenoviral shRNAS D4 Refresh D7 Fix

RoleofRNF4intheUbiquitinationofRtaofEpstein-BarrVirus · Alexa Fluor 594-conjugated goat anti-rabbit IgG polyclonal antibody (Invitrogen), or Cy5-conjugated goat anti-mouse IgG polyclonal

€¦ · Web viewIn theory, controlled localized drug delivery could enhance therapeutic efficacy. We observed that the Cy5 release rate from the MR 52 -Cy5 hydrogel in the subcutaneous

Chapter 24med.stanford.edu/content/dam/sm/utzlab/documents/...5. Cy3- and Cy5-ampliÞ cation mixtures: 10 U/ L T7 RNA polymerase (Applied Biosystems), 1× transcription buffer (Ambion),

Preprocessing Bioconductor. Overview Data set Salmo, color flip design Name Cy5 Cy3 FileName 2004012211 array1 self1 self2 2004012211.txt 2004012212 array2

ATHENS METRO Construction Methods and associated technical ...library.tee.gr/digital/m1801_1850/m1830/m1830_koukoutas.pdf · ΜΕΤΡΟ της ΑΘΗΝΑΣ -Μέθοδοι κατασκευής

RESEARCH Open Access Histological and ultrastructural · PDF file · 2017-08-23mouse-Cy3 or rabbit-FITC or goat-Cy3; 1:200 (Jack- ... Corneal reflex (eye blink when cornea is lightly

ChromatinDynamicsofGeneActivationandRepressionin ... · the Cy5/Cy3 intensity ratio of each spot in the STAT2 or STAT2 P-STAT2 slides were divided by the Cy5/Cy3 inten-sity ratio

Системы гель документирования Gel Doc™ XR+ и ChemiDoc ... · 2018-07-13 · Cy2 и Cy3 являются торговыми марками компании

Amnis Imaging Flow Cytometry Systems · GFP AF555 PI PerCp5 PE-750 MarBlu AF568 Cy5 YFP DS-Red 7AAD PE-647 SSC Hoechest AF610 APC Syto PE-610 PE-Cy5 APC-Cy5.5 SpecGrn PE-680 Camera

Proteomics Neurodegenerative Disorders · Separation by 2D-electrophoresis Isoelectric focusing (pH) SDS-PAGE (size) Sample A Sample B Labeling with fluorescent dyes (Cy3, Cy5 etc.)

Tissue homogenate with precipitation Tissue homogenate without precipitation Cy5: PP2A 0.1 U Cy5: PP2A 1U Cy3: PP2A 0.1 U Cy3: PP2A 1U Cy5: PP2A 1U Supplementary

Uncertainty in underground workslibrary.tee.gr/digital/m1801_1850/m1830/m1830_mpakogianis.pdf · εξελίσσουν την μέχρι σήμερα γνώση των ... και την

Supporting Information - Royal Society of · PDF fileSupporting Information Contents: Detailed Materials and Methods - Synthesis of photoactivatable Cy3- and Cy5-SBED ... Sulfo-SBED

名古屋大学工学研究科・工学部技術部 · ATP 5—5.} * ATP 5gm ATP ATP 10 sec Time ADP ADP ADP ATP a: Cy3-ATP b : cy5 c : b 1 ffiz, Cy3-ATP Cy3ATP It, cy5 Cya-ATP cy5

SpectraMax i3 Multi-Mode Platform - Molecular Devices · 384–well: 1.3 pM 1536–well: 3.75 pM 1 0200-7004POS Cy3–Cy5 EX 535 nm, EM 595/655 nm 384–well: 2.0 pM 1536–well:

Theranostics€¦ · Web viewFollowing this, the mice were administered with Cy5, DBCO-Cy5, DLQ-Cy5 or DLQ/DZ using intravenous injections, respectively. The Cy5 dose was 300 μg/kg

Magnetically Coupled Rodless Cylindercontent2.smcetech.com/pdf/CY3-C_EU.pdfMagnetically Coupled Rodless Cylinder Upgraded version of space saving magnetically coupled rodless cylinder