gene cloning, molecular modeling, and phylogenetics of ... · sequence obtained was deposited in...

Gene cloning, molecular modeling, andphylogenetics of serine protease P32 and serinecarboxypeptidase SCP1 from nematophagousfungi Pochonia rubescens and Pochoniachlamydosporia

Eduardo Larriba, José Martín-Nieto, and Luis Vicente Lopez-Llorca

Abstract: The fungi Pochonia chlamydosporia and Pochonia rubescens are parasites of nematode eggs and thus are biocon-trol agents of nematodes. Proteolytic enzymes such as the S8 proteases VCP1 and P32, secreted during the pathogenesis ofnematode eggs, are major virulence factors in these fungi. Recently, expression of these enzymes and of SCP1, a new puta-tive S10 carboxypeptidase, was detected during endophytic colonization of barley roots by these fungi. In our study, wecloned the genomic and mRNA sequences encoding P32 from P. rubescens and SCP1 from P. chlamydosporia. P32 showeda high homology with the serine proteases Pr1A from the entomopathogenic fungus Metarhizium anisopliae and VCP1from P. chlamydosporia (86% and 76% identity, respectively). However, the catalytic pocket of P32 showed differences inthe amino acids of the substrate-recognition sites compared with the catalytic pockets of Pr1A and VCP1 proteases. Phylo-genetic analysis of P32 suggests a common ancestor with protease Pr1A. SCP1 displays the characteristic features of amember of the S10 family of serine proteases. Phylogenetic comparisons show that SCP1 and other carboxypeptidases fromfilamentous fungi have an origin different from that of yeast vacuolar serine carboxypeptidases. Understanding proteasegenes from nematophagous fungi is crucial for enhancing the biocontrol potential of these organisms.

Key words: nematophagous fungi, Pochonia spp., serine protease, serine carboxypeptidase, phylogenesis.

Résumé : Les parasites fongiques des œufs de nématodes Pochonia chlamydosporia et Pochonia rubescens sont des agentsde biocontrôle des nématodes. Des enzymes protéolytiques comme les protéases S8 VCP1 et P32, secrétées durant la patho-genèse des œufs de nématodes constituent des facteurs de virulence de ces champignons. Récemment, l’expression de cesenzymes et de SCP1, une nouvelle carboxypeptidase présumée, a été détectée durant la colonisation endophyte des racinesd’orge par ces champignons. Dans cette étude, nous avons cloné des séquences génomiques et d’ARNm codant P32 de P. ru-bescens et SCP1 de P. chlamydosporia. P32 montre un haut degré d’homologie avec les protéases à sérine Pr1A du champi-gnon entomopathogène Metarhizium anisopliae et VCP1 de P. chlamydosporia (86 % et 76 % d’identité, respectivement).Cependant, la poche catalytique de P32 présente des différences en acides aminés aux sites de reconnaissance du substratpar rapport aux protéases Pr1A et VCP1. L’analyse phylogénique de P32 suggère l’existence d’un ancêtre commun à Pr1A.SCP1 montre les propriétés caractéristiques d’un membre de la famille S10 des protéases à sérine. Des comparaisons phylo-géniques montrent que SCP1 et d’autres carboxypeptidases des champignons filamenteux ont une origine différente de celledes carboxypeptidases à sérine vacuolaires des levures. La connaissance des gènes codant les protéases des champignons né-matophages est importante pour accroitre le potentiel de biocontrôle de ces organismes.

Mots‐clés : champignons nématophages, Pochonia spp., protéase à sérine, carboxypeptidase à sérine, phylogenèse.

[Traduit par la Rédaction]

Introduction

Plant-parasitic nematodes are the cause of economicallyimportant agronomic losses throughout the world, estimatedat 100 billion US$ (Casas-Flores and Herrera-Estrella 2007).

Chemical control of these organisms using nematicides isproblematic because of their toxicity, the negative environ-mental impact (e.g., methyl bromide), and the developmentof resistance by nematode populations (Ruzo 2006). Root-

Received 4 January 2012. Revision received 3 April 2012. Accepted 9 April 2012. Published at www.nrcresearchpress.com/cjm on 12 June2012.

E. Larriba and L.V. Lopez-Llorca. Department of Marine Sciences and Applied Biology, University of Alicante, P.O. Box 99, E-03080Alicante, Spain; Multidisciplinary Institute for Environmental Studies “Ramón Margalef”, University of Alicante, P.O. Box 99, E-03080Alicante, Spain.J. Martín-Nieto. Department of Physiology, Genetics and Microbiology, University of Alicante, P.O. Box 99, E-03080 Alicante, Spain;Multidisciplinary Institute for Environmental Studies “Ramón Margalef”, University of Alicante, P.O. Box 99, E-03080 Alicante, Spain.

Corresponding author: Eduardo Larriba (e-mail: [email protected]).

815

Can. J. Microbiol. 58: 815–827 (2012) doi:10.1139/W2012-054 Published by NRC Research Press

knot nematodes (Meloidogyne spp.) and cyst nematodes(Heterodera and Globodera spp.) are mostly responsible forcrop losses in agriculture (Molinari 2011). Nematode eggfungal parasites such as Pochonia spp. infect females of sed-entary nematodes, destroying the eggs they contain (Stirling1991). Consequently, Pochonia spp. have been used as bio-logical control agents of nematodes in different plant crops(Tobin et al. 2008; Ebadi et al. 2009; Carneiro et al. 2011).Pochonia spp. can also act as endophytes in monocot(Lopez-Llorca et al. 2002a) and dicot (Bordallo et al. 2002)plants, eliciting defense responses and promoting plantgrowth (Maciá-Vicente et al. 2009).The nematode eggshell constitutes the main barrier against

nematode egg fungal parasites. The eggshell comprisesseveral layers, including a chitinous layer formed by achitin–protein complex (Bird and McClure 1976) whosecomposition varies according to the nematode species, andshows similarities to the insect cuticle in composition andstructure (Lopez-Llorca and Jansson 2007). Nematode-eggparasitism by Pochonia spp. and other fungal parasites in-volves the differentiation of appressoria, adhesion, and egg-shell penetration (Lopez-Llorca et al. 2002b). The egginfection process by fungal parasites under natural conditionsand in in vitro bioassays involves eggshell degradation(Lopez-Llorca and Duncan 1988; Segers et al. 1996). Ultra-structural evidence supports an involvement of extracellularenzymes from nematode egg fungal parasites in eggshell pen-etration (Lopez-Llorca and Robertson 1993). P32 from Po-chonia rubescens was the first serine protease purified froman egg-parasitic fungus (Lopez-Llorca 1990) and immunolo-calized in appressoria during egg infection (Lopez-Llorca andRobertson 1992). Since then, many proteolytic enzymes fromnematophagous fungi have been found to play an importantrole as virulence factors (Huang et al. 2004; Lopez-Llorca etal. 2008).Pre-penetration events in fungal parasitism of nematode

eggs are similar to those of other fungal parasites of inverte-brates, such as the entomopathogen Metarhizium anisopliae(Hajek and St. Leger 1994; Lopez-Llorca and Jansson 2007).The main protease, Pr1A, from this fungus (St. Leger et al.1992) is serologically related to VCP1 from the nematopha-gous fungus Pochonia chlamydosporia and P32 from P. ru-bescens (Segers et al. 1995). This can be attributed tocommon mechanisms of pathogenicity of these fungi (Huand St. Leger 2004; Li et al. 2010). Because of their impor-tance as virulence factors, genes encoding serine proteasesfrom fungal parasites of invertebrates have been cloned andstudied at the molecular and biochemical levels (reviewed byYang et al. 2007). VCP1 (Morton et al. 2003) and PrC(Liang et al. 2011a) from the egg-parasitic fungi P. chlamy-dosporia and Clonostachys rosea, respectively, are 2 goodexamples of such proteases. Serine carboxypeptidases areproteolytic enzymes that cleave only the C-terminal peptidebond in polypeptides, a reaction in which a serine residue inthe active site of the enzyme is involved. These enzymes,present in fungi, plants, and animals, have diverse biologicalfunctions (Breddam 1986), including pathogenicity (St. Legeret al. 1994). Trichophyton rubrum penetrates keratinized tis-sue using several serine carboxypeptidases (Zaugg et al.2008). In invertebrate pathogenic fungi, the only serine car-boxypeptidase biochemically characterized so far belongs to

the fungal entomopathogen M. anisopliae (St. Leger et al.1994). However, there is little information to date on thesetype of enzymes from nematophagous fungi. In addition tothe role of proteases in nematode egg pathogenesis, we haverecently shown that roots colonized endophytically by Pocho-nia spp. exhibit high proteolytic activity. This was associatedwith the expression of P32 and VCP1 genes, as well as ofSCP1, a serine carboxypeptidase from P. chlamydosporia wehave recently identified (Lopez-Llorca et al. 2010).In this work we cloned the genes encoding the alkaline

serine protease P32 from P. rubescens and the serinecarboxypeptidase SCP1 from P. chlamydosporia. Conclu-sions inferred from their nucleotide and derived amino acidsequences at the molecular, structural, and phylogenetic lev-els are also described in this paper.

Materials and methods

Fungal cultures and nucleic acids isolationPochonia rubescens (CBS 464.88) and P. chlamydosporia

isolate 123 (ATCC No. MYA-4875) grown on corn mealagar at 25 °C in the dark for 1–4 weeks were inoculated inflasks containing 50 mL of potato dextrose broth and incu-bated at 25 °C for 8 days with shaking at 120 r/min. Myceliawere then collected by vacuum filtration, frozen in liquid N2,lyophilized, and stored at –80 °C until used for genomicDNA isolation. For RNA isolation, 8-day-old mycelia grow-ing on potato dextrose broth were transferred to flasks eachcontaining 50 mL of protease-inducing medium, containing0.1% gelatin (Lopez-Llorca 1990), and grown for 2 days.Mycelia were then processed and stored as described above.A cetyltrimethylammonium bromide (CTAB)-based extrac-

tion method adapted from O’Donnell et al. (1998) was usedfor genomic DNA isolation from lyophilized mycelia of P. ru-bescens and P. chlamydosporia, as indicated in Lopez-Llorcaet al. (2010). The PureLink RNA Mini kit (Invitrogen LifeTechnologies, Carlsbad, California, USA) was used for RNAextraction, followed by DNase treatment using the TurboDNA-Free kit (Ambion, Austin, Texas, USA). DNA andRNA were quantified using a Nanodrop ND-100 spectropho-tometer, and RNA integrity was evaluated using an Agilent2100 Bioanalyzer (Agilent Technologies, La Jolla, California,USA). RNA was reverse-transcribed using the Retroscript kit(Ambion) following the manufacturer’s instructions. The T7-dT oligonucleotide from Ambion (5′-GGTAATACGACT-CACTATAGGGAGAAGAGT24-3′) was used as a primer,and the T7 promoter-tagged cDNA generated was used forsubsequent PCR amplifications. Primers for this purposewere designed using Primer3 (Rozen and Skaletsky 2000),evaluated using NetPrimer (http://www.premierbiosoft.com/netprimer/index.html), and synthesized by Invitrogen, andare summarized in Table 1.

Cloning of Pochonia P32- and SCP1-encoding genesA degenerate forward primer, named P32-FW, was de-

signed based on amino acids 5–10 of the N-terminal sequencefrom the purified (secreted) P32 protein, QNGAPW (Lopez-Llorca et al. 2010). PCR was performed using P. rubescensT7-tagged cDNA as template, and primers P32-FW and T7universal. The amplified cDNA fragment was subjected to au-tomated DNA sequencing (Macrogen, Seoul, Korea), and the

816 Can. J. Microbiol. Vol. 58, 2012

Published by NRC Research Press

sequence obtained was deposited in GenBank under acces-sion No. HM635906.For cloning of the 5′ and 3′ regions of the P. rubescens

P32 gene, we designed a set of target-specific primers(TSP), 6 of them forward (TSP-P32-5′and TSP2-P32-5′ ser-ies) and 3 reverse (TSP-P32-3′ series), based on a partial ge-nomic P32 sequence obtained by PCR amplification ofP. rubescens genomic DNA using P32-1F and P32-1R oligo-nucleotides, which annealed near the 5′ and 3′ ends, respec-tively, of the P32 cDNA sequence cloned above. Two roundsof primer walking were performed with the DNA WalkingSpeedUp Premix kit (Seegene, Seoul, Korea) according tothe user’s manual, and genomic DNA from P. rubescens wasused as template. On the basis of the P32 gene sequence ob-tained by primer walking, we designed 2 primers, P32-ATGand P32-polyA, annealing at the initiation codon and polyAsignal, respectively, to clone the complete P32 open readingframe (ORF). Long-distance PCR was performed using T7-tagged cDNA or genomic DNA from P. rubescens as tem-plate, and sequences of the PCR products obtained (1.4 and1.7 kb, respectively) were submitted to GenBank under ac-cession No. JN375322.For cloning of the complete P. chlamydosporia gene en-

coding SCP1 serine carboxypeptidase, TSP oligonucleotideswere designed based on the partial SCP1 gene sequence pre-viously published by our group (Lopez-Llorca et al. 2010).Genomic DNA from P. chlamydosporia was used as a tem-plate for reactions using the primer walking kit above, andPCR fragments spanning the 5′ and 3′ regions were cloned

separately to obtain a total of 3.1 kb of genomic DNA se-quence. For cloning of the SCP1 gene coding region, SCP1-ATG and SCP1-polyA oligonucleotides were designed, andlong-distance PCR was carried out using P. chlamydosporiaT7-tagged cDNA as template. The PCR product obtained(1.9 kb) was cloned and its sequence deposited in GenBankunder accession No. GQ355960.

Assembly and manipulation of nucleic acid sequencesSequences obtained were assembled using the CAP3 program

(Huang and Madan 1999) available at http://pbil.univ-lyon1.fr/cap3.php. Gene prediction was made using FGENESH/HMM based on Neurospora genes (http://linux1.softberry.com/berry.phtml?topic=fgenesh&group=programs&subgroup=gfind). Pairwise alignments were carried out using LALIGN(http://www.ch.embnet.org/software/LALIGN_form.html) andmultiple alignments using ClustalW2 and MUSCLE tools(http://www.ebi.ac.uk/Tools/sequence.html) and improvedmanually. Comparative sequence analyses were performedusing the BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi)and FASTA (http://www.ebi.ac.uk/Tools/sss/fasta) algorithms.The promoter region of the SCP1 gene was predicted usingthe BDGP Neural Network Promoter Prediction interface(http://www.fruitfly.org/seq_tools/promoter.html).

In silico predictions, molecular modeling, and phylogenyAssembled DNA sequences were translated into protein

using the Translate tool (http://web.expasy.org/translate). Pro-tein molecular masses and isoelectric points were calculated

Table 1. Primers used for PCR cloning in this study.

Primer name 5′–3′ sequence Tm (°C) Strain Description or purposeP32-FW CARAAYGGNGCNCCNTGG* 60 P. rubescens N-terminal sequence of purified P32

(aa 5–10)T7 TAATACGACTCACTATAGGG 60 Universal T7 promoter-containing primerP32-1F TGGGGTCTTGGCCGTATCTC 60 P. rubescens Genomic sequence of P32 geneP32-1R TTGGTGGAGGTGTCCTGGAT 60 P. rubescens Genomic sequence of P32 geneTSP-P32-5′-1 AGAGTAGCCACCACCCAGAC 56 P. rubescens Primer walking of P32 gene 5′ regionTSP-P32-5′-2 TTGGCGTCCTGAGCAACATA 60 P. rubescens Primer walking of P32 gene 5′ regionTSP-P32-5′-3 CGCTGATGACGCCTGAGTAAG 61 P. rubescens Primer walking of P32 gene 5′ regionTSP2-P32-5′-1 GAAGGCGTGCTCGTAAATG 56 P. rubescens Primer walking of P32 gene 5′ regionTSP2-P32-5′-2 ACACCATCCTTGAACTTGACGA 59 P. rubescens Primer walking of P32 gene 5′ regionTSP2-P32-5′-3 GGAAATGATGCTCTCAGCCTTG 61 P. rubescens Primer walking of P32 gene 5′ regionTSP-P32-3′-1 CCACATTGCTGGTCTTGCT 57 P. rubescens Primer walking of P32 gene 3′ regionTSP-P32-3′-2 CTGGCACTGTCAACCACCTC 58 P. rubescens Primer walking of P32 gene 3′ regionTSP-P32-3′-3 CAACCACCTCGCCTACAACG 61 P. rubescens Primer walking of P32 gene 3′ regionTSP-SCP1-5′-1 CGTCTTCTTCATCTTGAGCAG 56 P. chlamydosporia Primer walking of SCP1 gene 5′ regionTSP-SCP1-5′-2 GGCTGCTCAACCCAGACAAT 60 P. chlamydosporia Primer walking of SCP1 gene 5′ regionTSP-SCP1-5′-3 GGATTAGGAACGGGCTTGAA 60 P. chlamydosporia Primer walking of SCP1 gene 5′ regionTSP-SCP1-3′-1 TGTTTATCAAGTTGCCACGAC 56 P. chlamydosporia Primer walking of SCP1 gene 3′ regionTSP-SCP1-3′-2 CTCGGTTTCCCTGGCAGTTTC 63 P. chlamydosporia Primer walking of SCP1 gene 3′ regionTSP-SCP1-3′-3 ACCGCCAGGACGTGAAGAAG 62 P. chlamydosporia Primer walking of SCP1 gene 3′ regionP32-ATG ATGCATCTGTCTGCTCTTCT 60 P. rubescens Initiation codon of P32 geneP32-polyA CAACTTGTCCTCTCCGAGT 60 P. rubescens Polyadenylation signal of P32 gene open

reading frameSCP1-ATG ATGCGTTGGGAACTCGTTGC 60 P. chlamydosporia Initiation codon of SCP1 geneSCP1-polyA ATAGTATAAGGAGTCCCGCCG 60 P. chlamydosporia Polyadenylation signal of SCP1 gene

*R: A or G; Y: C or T.

Larriba et al. 817


using the ProtParam tool (http://web.expasy.org/protparam),signal peptides were predicted using SignalP (http://www.cbs.dtu.dk/services/SignalP), and identification of the proteinmotifs was achieved using ScanProsite (http://prosite.expasy.org/scanprosite). N-glycosylation and O-glycosylation (mucin-type) sites were identified using NetNGlyc (http://www.cbs.dtu.dk/services/NetNGlyc/) and NetOGlyc (http://www.cbs.dtu.dk/services/NetOGlyc/), respectively. Molecular modelingof proteins was carried out in the Swiss-Model environment(http://swissmodel.expasy.org), and model manipulationswere made using PDB Viewer (http://spdbv.vital-it.ch/).Phylogenetic analysis of protein sequences was carried outusing the MEGA 5 package (Tamura et al. 2007). The pro-tein sequences used for phylogenetic analysis were alignedusing ClustalW2, and the results obtained were refined us-ing the MUSCLE algorithm included in the MEGA5 pack-age. Phylogenetic reconstructions were inferred using theneighbor-joining method, and evolutionary distances werecomputed using the JTT matrix-based method. Bootstrapanalysis consisted of 1000 replicates.

Results and discussion

Cloning and analysis of the P32 geneA 1157 bp PCR product was amplified from P. rubescens

T7-tagged cDNA using the P32-FW degenerate and T7 uni-versal primers (Table 1), which encompassed a partial ORFof a mature subtilase of the S8 family of serine proteases(Rawlings et al. 2010). With this cDNA sequence we de-signed 2 internal primers, P32-1F and P32-1R, which led usto amplify a 900 bp PCR fragment from P. rubescens ge-nomic DNA. Based on this sequence, we designed a seriesof TSP oligonucleotides that allowed us to amplify by primerwalking a 1875 bp and a 1500 bp fragment from the P32gene 5′ and 3′ regions, respectively. These 2 sequences to-gether with the (overlapping) 900 bp genomic internal seg-ment above were assembled to yield the P32 gene sequenceshown in Fig. 1. This sequence comprised a total of2642 bp, encompassing 862 bp of the 5′ noncoding region,4 exons (of 395, 186, 513, and 487 bp) and 3 introns (of 72,58, and 69 bp), these exhibiting the canonical GT and AGdinucleotides at their 5′ and 3′ ends (Fig. 1). The first exonincluded 113 bp of 5′-UTR and the fourth exon 295 bp of3′-UTR sequence comprising the polyadenylation signal. Inthe 5′ noncoding region we identified several transcriptionfactor binding sites in our cloned DNA segment. Using theNeural Network Promoter Prediction software, the putativecore promoter was detected at –40 to +10 bp from the pre-dicted transcription start point (tsp) and a TATA box elementwas found at –25 to –30 bp from the tsp. Interestingly, weidentified several putative regulatory elements in the P32gene promoter, namely 7 GATA (–79 to –82, –186 to –189,

–261 to –264, –362 to –365, –378 to –381, –511 to –514,and –581 to –584) and 2 CREA (–466 to –471 and –719 to–724) binding sites (Fig. 1), which have also been found atpromoters of protease-encoding genes from other fungal par-asites of invertebrates such as Pr1A (Screen et al. 1997) andVCP1 (Morton et al. 2003) whose transcription has beenshown to be modulated according to the C/N cell status. Thecloned P32 cDNA sequence encompassed 1581 bp showing82.9%, 77.6%, and 73.6% nucleotide identity with cDNAsencoding serine proteases Pr1A from M. anisopliae, VCP1from P. chlamydosporia, and pSP-3 from Paecilomyces lila-cinus, respectively.

Structural features of P32 proteinThe P32 gene ORF encompassed 1173 bp (Fig. 1), coding

for a pro-peptide of 390 amino acids with a molecular massof 40.3 kDa, and contained an N-terminal signal peptide of18 amino acids and a pro-region of 89 amino acids (Figs. 1and 2). The sequence of the signal peptide included acharged residue (His2), a core of 8 hydrophobic residuesforming an a-helix, a helix-breaking residue (Pro11), and 4residues preceding a signal peptidase cleavage site (Ala16-Pro-Ala), a structure typical of signal peptides of serine pro-teases from fungal pathogens of invertebrates (St. Leger et al.1992). The P32 pro-peptide contained a peptidase inhibitor I9sequence common in S8 subtilases (Figs. 1 and 2). The se-creted protein was composed of 283 amino acids, exhibitinga predicted molecular mass of 28.7 kDa and a pI of 8.6. Thispredicted size did not completely agree with the molecularmass of 32 kDa empirically obtained by SDS–PAGE(Lopez-Llorca 1990), possibly reflecting further post-translational modifications present in the mature P32 protein.The P32 sequence lacked N-linked glycosylation sites but ex-hibited 4 potential O-glycosylation sites (Fig. 1). P32 showeda positively charged surface at neutral and alkaline pH val-ues, a feature that should allow it to bind to predominantnegatively charged residues, such as proline, present in thenematode eggshell (Clarke et al. 1967; Morton et al. 2003)and the nematode female (Lopez-Llorca and Fry 1989). Acomparison of the P32 pro-peptide sequence with that ofcharacterized serine proteases from fungal pathogens of in-vertebrates is shown in Fig. 2. The pro-P32 sequence exhib-ited the highest identity with Pr1A from Metarhiziumacridum (86.4%) and M. anisopliae (86.2%), VCP1 from P.chlamydosporia (76.2%), and pSP-3 from Paecilomyces lila-cinus (70.8%). The active site residues, which are conservedin all fungal S8 serine proteases sequenced to date, were rep-resented in P32 by the triad of amino acids Asp148, His179,and Ser334 (Figs. 1 and 2). Pochonia rubescens P32 addition-ally exhibited 5 cysteine residues, 4 of which were putativelyinvolved in the formation of disulphide bonds (Cys143–Cys233

Fig. 1. Nucleotide and deduced amino acid sequences of Pochonia rubescens serine protease P32 gene and protein. An alignment of clonedP32 gene and its predicted protein sequence is shown. Structural sequence details are emphasized as follows. The predicted core promoter isthick-underlined, the TATA element is shown in bold italics, and the putative transcription start point is labeled in bold. Putative CREA (2) andGATA (7) binding sites are highlighted in grey. The open reading frame is shown in capital letters. The start codon, splice donor–acceptorsites, and stop codon are in bold. Discontinuously underlined nucleotides compose the putative polyadenylation signal. Singly and doublyunderlined amino acid regions indicate the P32 signal peptide and the predicted peptidase inhibitor sequence of the I9 superfamily, respec-tively. Thick-underlined codons encode the amino acids constituting the catalytic triad. Cys residues (5) are labeled in bold, and dot-underlinedThr residues (4) represent predicted O-glycosylation sites. The P32 gene sequence was deposited in GenBank under accession No. JN375322.



Larriba et al. 819


and Cys288–Cys360) and leaving the fifth (Cys183) free (Fig. 2and Supplementary Fig. S1a1). These 5 cysteines are con-served in all known serine proteases of nematophagous andentomopathogenic fungi, with the exception of PrC and SprTfrom C. rosea and Hypocrea koningii, respectively, whereCys183 was replaced by Val (Fig. 2).The structure predicted for P32 (Fig. S1a1) showed that the

secreted protein contained six a-helices, two 310 helices, one7-stranded parallel b-sheet, and three 2-stranded antiparallelb-sheets. This predicted P32 structure was consistent withthe crystal structure of proteases pSP-3 and Ver112 fromPaecilomyces lilacinus and Lecanicillium psalliotae (Liang etal. 2011b). Amino acids constituting the catalytic triad werelocated in the b1 (Asp148), a2 (His179), and a5 (Ser336) chains,a structure shared by all subtilisins in their active sites(Wright et al. 1969). Sequence alignments and structure pre-diction analysis allowed us to identify the residues putatively

constituting the S1–S4 substrate-binding pockets in P32 (Fig.S1b1). The S1 pocket comprised residues 267–272 and 331–336; the S4 pocket comprised residues 210–214, 217, 246,and 251; and the S2 and S3 pockets shared residues 241–245 (Figs. 2 and S1c1), according to the numbering of pro-P32 amino acids in Fig. 2. A comparison of residues foundin these regions in P32 with those present in other fungal ser-ine proteases revealed that in the S1 pocket the residueAsp272 was conserved in all proteases, except for PrC, whichexhibited a Ser residue instead (Fig. 2). S1 sites with an Aspresidue display anionic characteristics, which may have func-tional relevance for their binding to basic residues of the sub-strate (Liu et al. 2007). Another relevant change found in theP32 S1 pocket was the presence of Thr279 in comparison toVCP1, pSP-3, and PrC, which harbor a Tyr residue at thispoint (Figs. 2 and S1c1). Mutational studies of protease BPNfrom Bacillus subtilis indicate that changes in this residue

Fig. 2. Alignment of serine protease P32 from Pochonia rubescens with different serine proteases from fungal pathogens of invertebrates. TheP32 amino acid sequence derived from our cloned gene is aligned with sequences of characterized S8 subfamily serine proteases from thenematophagus fungi Pochonia chlamydosporia (VCP1, CAD20578), Clonostachys rosea (PrC, ACS66684), Paecilomyces lilacinus (pSP-3,ABO32256), Hypocrea koningii (SprT, ABN04079), and Lecanicillium psalliotae (Ver112, Q68GV9), and with S8 subfamily serine proteasesfrom the entomopathogenic fungi Metarhizium anisopliae (Pr1A, CAC95042) and Beauveria bassiana (CDEP-1, AAK70804). The solidoverline indicates the signal peptide region, and the dotted overline indicates the peptidase inhibitor region (I9 superfamily). Amino acids ofthe catalytic triad, conserved Cys residues, and putative polymorphic sites known to be involved in host recognition in VCP1 are indicated byasterisks (*), dots (•), and open circles (○), respectively. Residues belonging to the S1 and S4 substrate-binding pockets are enclosed bybroken and dotted frames, respectively. Residues involved in the S2 and S3 sites are marked with a tilde (~) symbol. Ca2+-binding aminoacids are indicated with inverted triangles (▿). Black boxes label conserved amino acids, and grey boxes amino acids showing ≥ 90% simi-larity.

1Supplementary data are available with the article through the journal Web site at http://nrcresearchpress.com/doi/suppl/10.1139/w2012-054.



Fig. 3. Phylogenetic analysis of P32 and characterized and predicted S8 serine proteases. Neighbor-joining tree of 48 S8 serine proteaseamino acid sequences. Bootstrap support and GenBank accession numbers are provided in the figure. The scale segment shows the evolu-tionary distance (number of amino acid substitutions per site). The clade of fungal parasites of nematode eggs and insect parasites and theclade of nematode-trapping fungi are indicated.

Larriba et al. 821


can modulate the substrate specificity of the S1 pocket (Estellet al. 1986; Wells et al. 1987). In the S4 pocket, P32 con-tained a Gly residue at position 246, like the other fungalproteases with the only exception of VCP1, which displays aPro residue (Fig. S1c1) and, hence, bears a more hydrophobicS4 pocket (Liang et al. 2011b). The presence in P32 of anAsn at position 177, as a difference from VCP1 and Pr1A(Fig. S1c1), which harbor a His residue (Figs. 2 and S1c1),indicated a preference for negatively charged residues in thesubstrate at low pH. Finally, a series of polymorphic posi-tions, which have been proposed in VCP1 from P. chlamydo-sporia to be involved in nematode host recognition (Mortonet al. 2003), corresponded to P32 residues Gln172, Ser209,Gln277, and Leu383.

Phylogenetic analysis of P32 and other serine proteasesfrom fungal invertebrate pathogensThe results from phylogenetic analyses based on character-

ized and predicted amino acid sequences of S8 serine pro-teases from filamentous fungi, yeast, bacteria, andvertebrates are shown in Fig. 3. The neighbor-joining tree ob-tained suggests the existence of paralogous relationshipsamong different serine proteases from fungal pathogens of in-vertebrates, forming an independent clade with respect to thedifferent S8 subtilisins analyzed. Regarding nematode-trappingfungi proteases, they likely showed a common origin withvacuolar proteases such as Alp1 protease from Aspergillusspp. and protease Prb1p from the yeast Saccharomyces cer-evisiae (Fig. 3).Proteases from nematode-trapping fungi formed an independ-

ent group, which suggested that proteases from egg-parasiticand entomopathogenic fungi may exhibit a common ancestorand evolved separately from those of nematode-trapping fungi.The differences in their mode of pathogenicity toward theirhosts in egg-parasitic and nematode-trapping fungi are notonly due to morphological features (e.g., appressoria vs.traps) but are also manifest at the molecular level in com-mon virulence factors, such as extracellular enzymes. P32was more related to Pr1A than to VCP1 sequences from 2varieties of P. chlamydosporia (namely var. chlamydosporiaisolate V10 and var. catenulata), thus forming P32 andPr1A a separate subclade (Fig. 3). This result suggested asimilarity between the virulence factors of the insect-pathogen fungus M. anisopliae and of the nematophagousfungus P. rubescens. Also noticeable were the differencesfound between the 2 varieties of P. chlamydosporia, whichexhibited a certain degree of divergence. pSP-3 and SprTformed a cluster different from that including CDEP-1 andVer112. The sequence of CDEP-1 from the insect pathogen

Beauveria bassiana forming a cluster with Ver112 proteasefrom L. psalliotae was expected, since the latter can be iso-lated from insects being infected by this fungus (Asensio etal. 2007).

Cloning and analysis of the SCP1 geneBased on the partial sequence of the SCP1 gene previously

published by us (Lopez-Llorca et al. 2010), we designed aseries of 6 TSP primers (Table 1) that allowed us to clone a2.2 kb fragment of P. chlamydosporia genomic DNA corre-sponding to the gene’s 5′ region, as well as a second (over-lapping) fragment of 1.4 kb corresponding to its 3′ region.The 3 assembled sequences yielded a 3147 bp stretch ofSCP1 genomic DNA (Fig. 4). On the basis of this sequence,we designed the primer named SCP1-ATG, containing the in-itiation codon, which was used together with the T7 universalprimer for PCR amplification of a 1.9 kb fragment fromP. chlamydosporia T7-tagged cDNA. The cloned SCP1 genesequence (Fig. 4) encompassed 799 bp of the 5′ noncodingregion, 4 exons (of 258, 176, 275, and 1429 bp) and 3 in-trons (of 67, 83, and 60 bp). The first exon included 62 bpof 5′-UTR, and the fourth exon 375 bp of 3′-UTR sequencecomprising 2 polyadenylation signals. The putative core pro-moter was predicted at –40 to +10 bp from the predicted tsp,containing a TATA box element at –27 to –31 bp from thispoint. Similar to the P32 gene, we found 7 GATA (–167 to–170, –193 to –196, –211 to –214, –274 to –277, –378 to–381, –450 to –453, and –573 to –576) and 2 CREA (–63to –68 and –118 to –123) binding sites in the SCP1 genepromoter (Fig. 4).

Structural features of SCP1 proteinThe SCP1 mRNA contained an ORF of 1701 bp encoding

an S10 protease (Rawlings et al. 2010) of 566 amino acids.This protein exhibited a signal peptide of 18 amino acids, in-dicating that SCP1 was synthesized as a precursor polypep-tide. The pro-SCP1 protein had a predicted molecular massof 62.5 kDa, and in its secreted form of 60.5 kDa, both poly-peptides exhibiting a pI of 7.1. The pro-SCP1 sequence ex-hibited the highest homology with serine carboxypeptidases(predicted from sequenced genomes) of M. anisopliae(88.1%), M. acridum (86.5%), and Neurospora crassa(60.1%) (cpdS). The active center included Ser214, Asp432,and His501 (Fig. 4). Eight cysteine residues (127, 220, 286,322, 341, 351, 345, and 559) were found. Notably, residuesCys220 and Cys559 were located near the active site and theC-terminus of the protein, respectively. Finally, 4 potentialN-glycosylation sites were found as well in the SCP1 proteinsequence (Fig. 4).

Fig. 4. Nucleotide and deduced amino acid sequences of Pochonia chlamydosporia serine carboxypeptidase SCP1 gene and protein. Thefigure shows an alignment of cloned SCP1 gene sequence and its predicted protein product. Structural sequence details are emphasized asfollows. The predicted core promoter is thick-underlined, the TATA element is shown in bold italics, and the putative transcription start point(tsp) is labeled in bold. Putative CREA (2) and GATA (7) binding sites are highlighted in grey. The open reading frame is shown in capitalletters. The start codon, splice donor–acceptor sites, and stop codon are shown in bold. The 2 predicted polyadenylation signals are discon-tinuously underlined. The underlined amino acid region indicates the SCP1 signal peptide. Thick-underlined codons encode the amino acidsconstituting the catalytic triad. Putative substrate-binding amino acid regions are wavy underlined. Cys residues (8) are labeled in bold, anddot-underlined asn residues (4) represent predicted N-glycosylation sites. The SCP1 gene sequence was deposited in GenBank under acces-sion No. GQ355960.



Larriba et al. 823


Fig. 5. Phylogenetic analysis of SCP1 and characterized and predicted S10 serine carboxypeptidases. Neighbor-joining tree of 44 S10 pro-teases amino acid sequences. Bootstrap support and GenBank accession numbers are provided in the figure. The scale segment shows theevolutionary distance (number of amino acid substitutions per site).



Phylogenetic relationships of SCP1 with other S10carboxypeptidasesPhylogenetic analyses based on the peptide sequences of

S10 carboxypeptidases from several filamentous fungi, yeast,bacteria, algae, plants, and vertebrates are shown in Fig. 5.These proteases were grouped into 2 clades, of which cladeI included both characterized and genome-wide-predicted car-boxypeptidases from several fungi. In this group, SCP1 fromP. chlamydosporia and genome-wide predicted carboxypepti-dases from M. anisopliae and M. acridum were clustered to-gether, suggesting a common origin for these proteases.Furthermore, SCP1 had phylogenetic relationships with otherfungal S10 carboxypeptidases, such as carboxypeptidases Ffrom Aspergillus niger and N. crassa. These serine carboxy-peptidases exhibited a signal peptide in their sequences,suggesting that they are secreted enzymes, but their functionremains unclear. Clade II included serine carboxypeptidaseswith vacuolar function, among which are the S10 carboxy-peptidases of filamentous fungi, yeasts, vertebrates, plants,and algae. The vacuolar proteases of fungi are grouped in asingle subclade, including Prc1 from S. cerevisiae (Jung etal. 1999), TruSCPC from T. rubrum (Zaugg et al. 2008),and different orthologous protein sequences of CpyA-typevacuolar serine carboxypeptidases, all of which are involvedin C-terminal processing of peptides and proteins (Jung et al.1999). Interestingly, this clade also containsglycosylphosphatidyl-inositol-anchored membrane-associatedcarboxypeptidases, represented by TruSCPA and TruSCPBfrom T. rubrum, which are involved in pathogenesis (Zaugget al. 2008). Finally, clade II, also included the carboxypep-tidases of animals and plants. As seen in Fig. 5, animal andfungal serine carboxypeptidases displayed a phylogenetic re-lationship, unlike serine carboxypeptidases from plants andalgae, which formed a separate cluster.

ConclusionsIn this article we report the cloning of the gene encoding

the first protease purified from a nematophagous fungus,P32. This is also the first report of the complete sequence ofa serine carboxypeptidase, SCP1, from a fungal parasite ofnematode eggs. P32 from P. rubescens showed a strongerphylogenetic similarity with protease Pr1A from the entomo-pathogenic fungus M. anisopliae than with protease VCP1from the closely related nematophagous species P. chlamydo-sporia. The P32 gene showed the same regulatory elementsin its promoter region as the VCP1-encoding (Morton et al.2003) and Pr1A-encoding (St. Leger et al. 1992) genes. Cys-teine residues detected in P32 are very likely involved in itsproteolytic activity, since several thiol-reducing agents havebeen shown to enhance the activity of the purified enzymein vitro (Lopez-Llorca 1990). Further studies should evaluatethe magnitude of reducing conditions in the rhizosphere, es-pecially in areas such as nematode feeding sites and in eggmasses where the biocontrol action of nematophagous fungiis crucial. Biocontrol strategies of plant-parasitic nematodesshould be designed to enhance the activity of pathogenicityfactors, such as proteases (e.g., P32) of nematophagousfungi.SCP1 is the first serine carboxypeptidase whose encoding

gene has been cloned from a nematophagous fungus, P. chla-

mydosporia. Although SCP1 function is unknown, expres-sion of its mRNA has been detected during endophyticcolonization of barley roots by this fungal species (Lopez-Llorca et al. 2010), suggesting a role for SCP1 in this pro-cess. Interestingly, the SCP1 promoter elements found in thiswork suggest that its expression is regulated by the sametranscription factors proposed to act on the VCP1 promoter(Morton et al. 2003), and hence on the P32 gene as well.Studies based on massive transcriptome analysis (e.g., RNA-Seq) of Pochonia spp. are needed to determine the involve-ment of P32, VCP1, SCP1, and perhaps other proteolytic en-zymes in the different life styles of these fungi (i.e.,saprotroph, endophytic, and nematode-egg parasitic). Func-tional studies of proteases from fungal invertebrate pathogensshould benefit as well from the recent availability of se-quenced genomes and transcriptomic data obtained duringhost infection from the entomopathogenic fungi M. aniso-pliae and M. acridum (Gao et al. 2011). In this context, the ge-nome sequence and proteomic data obtained under conditionssimulating nematode infection from the nematode-trappingfungus Arthrobotrys oligospora have been recently pub-lished (Yang et al. 2011). In a complementary or parallelfashion, cloning and sequencing of protease-coding genesfrom nematophagous fungi would be crucial for understand-ing the evolution of these pathogenicity factors (Li et al.2010) as well as for enhancing their efficiency in biologicalcontrol (Morton et al. 2004; Macia-Vicente et al. 2011).

AcknowledgmentsThis research was funded by the Spanish Ministry of Sci-

ence and Innovation grants AGL2008-00716/AGR andAGL2011-29297.

ReferencesAsensio, L., López-Jiménez, J.A., and López-Llorca, L.V. 2007.

Mycobiota of the date palm phylloplane: description andinteractions. Rev. Iberoam. Micol. 24(4): 299–304. doi:10.1016/S1130-1406(07)70060-8. PMID:18095764. [In Spanish.]

Bird, A.F., and McClure, M.A. 1976. The tylenchid (Nematoda) eggshell: structure, composition and permeability. Parasitology, 72(1):19–28. doi:10.1017/S0031182000043158.

Bordallo, J.J., Lopez-Llorca, L.V., Jansson, H.B., Salinas, J., Pers-mark, L., and Asensio, L. 2002. Colonization of plant roots by egg-parasitic and nematode-trapping fungi. New Phytol. 154(2): 491–499. doi:10.1046/j.1469-8137.2002.00399.x.

Breddam, K. 1986. Serine carboxypeptidases. A review. CarlsbergRes. Commun. 51(2): 83–128. doi:10.1007/BF02907561.

Carneiro, R.M.D.G., Hidalgo-Díaz, L., Martins, I., Ayres de SouzaSilva, K.F., Guimarães de Sousa, M., and Tigano, M.S. 2011. Effectof nematophagous fungi on reproduction of Meloidogyne entero-lobii on guava (Psidium guajava) plants. Nematology, 13(6): 721–728. doi:10.1163/138855410X545777.

Casas-Flores, S., and Herrera-Estrella, A. 2007. Antagonism of plantparasitic nematodes by fungi. In The mycota IV: environmentaland microbial relationships. 2nd ed. Edited byC.P. Kubicek and I.S.Druzhinina. Springer, Berlin, Germany. pp. 147–157.

Clarke, A.J., Cox, P.M., and Shepherd, A.M. 1967. The chemicalcomposition of the egg shells of the potato cyst-nematode,Heterodera rostochiensis Woll. Biochem. J. 104(3): 1056–1060.PMID:6069200.

Ebadi, M., Fatemy, S., and Riahi, H. 2009. Evaluation of Pochoniachlamydosporia var. chlamydosporia as a control agent of

Larriba et al. 825


Meloidogyne javanica on pistachio. Biocontrol Sci. Technol. 19(7):689–700. doi:10.1080/09583150903051844.

Estell, D.A., Graycar, T.P., Miller, J.V., Powers, D.B., Wells, J.A.,Burnier, J.P., and Ng, P.G. 1986. Probing steric and hydrophobiceffects on enzyme-substrate interactions by protein engineering.Science, 233(4764): 659–663. doi:10.1126/science.233.4764.659.PMID:17835820.

Gao, Q., Jin, K., Ying, S.H., Zhang, Y., Xiao, G., Shang, Y., et al.2011. Genome sequencing and comparative transcriptomics of themodel entomopathogenic fungi Metarhizium anisopliae andM. acridum. PLoS Genet. 7(1): e1001264. doi:10.1371/journal.pgen.1001264. PMID:21253567.

Hajek, A.E., and St. Leger, R.J. 1994. Interactions between fungalpathogens and insect hosts. Annu. Rev. Entomol. 39(1): 293–322.doi:10.1146/annurev.en.39.010194.001453.

Hu, G., and St. Leger, R.J. 2004. A phylogenomic approach toreconstructing the diversification of serine proteases in fungi. J.Evol. Biol. 17(6): 1204–1214. doi:10.1111/j.1420-9101.2004.00786.x. PMID:15525405.

Huang, X., and Madan, A. 1999. CAP3: a DNA sequence assemblyprogram. Genome Res. 9(9): 868–877. doi:10.1101/gr.9.9.868.PMID:10508846.

Huang, X., Zhao, N., and Zhang, K. 2004. Extracellular enzymesserving as virulence factors in nematophagous fungi involved ininfection of the host. Res. Microbiol. 155(10): 811–816. doi:10.1016/j.resmic.2004.07.003. PMID:15567274.

Jung, G., Ueno, H., and Hayashi, R. 1999. Carboxypeptidase Y:structural basis for protein sorting and catalytic triad. J. Biochem.126(1): 1–6. PMID:10393313.

Li, J., Yu, L., Yang, J., Dong, L., Tian, B., Yu, Z., et al. 2010. Newinsights into the evolution of subtilisin-like serine protease genesin Pezizomycotina. BMC Evol. Biol. 10(1): 68. doi:10.1186/1471-2148-10-68. PMID:20211028.

Liang, L., Yang, J., Li, J., Mo, Y., Li, L., Zhao, X., and Zhang, K.-Q.2011a. Cloning and homology modeling of a serine protease gene(PrC) from the nematophagous fungus Clonostachys rosea. Ann.Microbiol. 61(3): 511–516. doi:10.1007/s13213-010-0166-5.

Liang, L., Liu, S., Yang, J., Meng, Z., Lei, L., and Zhang, K. 2011b.Comparison of homology models and crystal structures of cuticle-degrading proteases from nematophagous fungi: structural basis ofnematicidal activity. FASEB J. 25(6): 1894–1902. doi:10.1096/fj.10-175653. PMID:21350115.

Liu, S.-Q., Meng, Z.-H., Yang, J.-K., Fu, Y.-X., and Zhang, K.-Q.2007. Characterizing structural features of cuticle-degradingproteases from fungi by molecular modeling. BMC Struct. Biol.7(1): 33. doi:10.1186/1472-6807-7-33. PMID:17511867.

Lopez-Llorca, L.V. 1990. Purification and properties of extracellularproteases produced by the nematophagous fungus Verticilliumsuchlasporium. Can. J. Microbiol. 36(8): 530–537. doi:10.1139/m90-093.

Lopez-Llorca, L.V., and Duncan, G.H. 1988. A study of fungalendoparasitism of cereal cyst nematode (Heterodera avenae) byscanning electron microscopy. Can. J. Microbiol. 34(5): 613–619.doi:10.1139/m88-101.

Lopez-Llorca, L.V., and Fry, S.C. 1989. Dityrosine, trityrosine andtetratyrosine, potential cross-links in structural proteins of plant-parasitic nematodes. Nematologica, 35(2): 165–179. doi:10.1163/002825989X00304.

Lopez-Llorca, L.V., and Jansson, H.-B. 2007. Fungal parasites ofinvertebrates: multimodal biocontrol agents? In Exploitation offungi. Edited by G.D. Robson, P. van West, and G. Gadd.Cambridge University Press, Cambridge, UK. pp. 310–335.

Lopez-Llorca, L.V., and Robertson, W.M. 1992. Immunocytochem-ical localization of a 32-kDa protease from the nematophagous

fungus Verticillium suchlasporium in infected nematode eggs.Exp. Mycol. 16(4): 261–267. doi:10.1016/0147-5975(92)90002-9.

Lopez-Llorca, L.V., and Robertson, W.M. 1993. Ultrastructure ofinfection of cyst nematode eggs by the nematophagous fungusVerticillium suchlasporium. Nematologica. 39(1–4): 65–74.doi:10.1163/187529293X00042.

Lopez-Llorca, L.V., Bordallo, J.J., Salinas, J., Monfort, E., and López-Serna, M.L. 2002a. Use of light and scanning electron microscopyto examine colonisation of barley rhizosphere by the nematopha-gous fungus Verticillium chlamydosporium.Micron, 33(1): 61–67.doi:10.1016/S0968-4328(00)00070-6. PMID:11473815.

Lopez-Llorca, L.V., Olivares-Bernabeu, C.M., Salinas, J., Jansson,H.-B., and Kolattukudy, P.E. 2002b. Pre-penetration events infungal parasitism of nematode eggs. Mycol. Res. 106(4): 499–506.doi:10.1017/S0953756202005798.

Lopez-Llorca, L.V., Maciá-Vicente, J.G., and Jansson, H.-B. 2008.Mode of action and interactions of nematophagous fungi. InIntegrated management and biocontrol of vegetable and graincrops nematodes. Edited by A. Ciancio and K.G. Mukerji.Springer, Dordrecht, Netherlands. pp. 51–76.

Lopez-Llorca, L.V., Gómez-Vidal, S., Monfort, E., Larriba, E.,Casado-Vela, J., Elortza, F., et al. 2010. Expression of serineproteases in egg-parasitic nematophagous fungi during barley rootcolonization. Fungal Genet. Biol. 47(4): 342–351. doi:10.1016/j.fgb.2010.01.004. PMID:20097301.

Maciá-Vicente, J.G., Rosso, L.C., Ciancio, A., Jansson, H.-B., andLopez-Llorca, L.V. 2009. Colonisation of barley roots byendophytic Fusarium equiseti and Pochonia chlamydosporia:effects on plant growth and disease. Ann. Appl. Biol. 155(3):391–401. doi:10.1111/j.1744-7348.2009.00352.x.

Macia-Vicente, J.G., Palma-Guerrero, J., Gomez-Vidal, S., andLopez-Llorca, L.V. 2011. New insights on the mode of action offungal pathogens of invertebrates for improving their biocontrolperformance. In Biological control of plant-parasitic nematodes:building coherence between microbial ecology and molecularmechanisms, progress in biological control. Edited by K. Daviesand Y. Spiegel. Springer, Netherlands. pp. 203–225.

Molinari, S. 2011. Natural genetic and induced plant resistance, as acontrol strategy to plant-parasitic nematodes alternative topesticides. Plant Cell Rep. 30(3): 311–323. doi:10.1007/s00299-010-0972-z. PMID:21184231.

Morton, C.O., Hirsch, P.R., Peberdy, J.F., and Kerry, B.R. 2003.Cloning of and genetic variation in protease VCP1 from thenematophagous fungus Pochonia chlamydosporia. Mycol. Res.107(1): 38–46. doi:10.1017/S0953756202007050. PMID:12735242.

Morton, C.O., Hirsch, P.R., and Kerry, B.R. 2004. Infection of plant-parasitic nematodes by nematophagous fungi — a review of theapplication of molecular biology to understand infection processesand to improve biological control. Nematology, 6(2): 161–170.doi:10.1163/1568541041218004.

O’Donnell, K., Cigelnik, E., and Nirenberg, H.I. 1998. Molecularsystematics and phylogeography of the Gibberella fujikuroispecies complex. Mycologia, 90(3): 465–493. [Available fromhttp://www.jstor.org/stable/3761407].

Rawlings, N.D., Barrett, A.J., and Bateman, A. 2010. MEROPS: thepeptidase database. Nucleic Acids Res. 38(Suppl. 1): D227–D233.doi:10.1093/nar/gkp971.

Rozen, S., and Skaletsky, H.J. 2000. Primer3 on the WWW forgeneral users and for biologist programmers. In Bioinformaticsmethods and protocols: methods in molecular biology. Edited byS. Krawetz and S. Misener. Humana Press, Totowa, N.J., USA. pp.365–386.

Ruzo, L.O. 2006. Physical, chemical and environmental properties of



selected chemical alternatives for the pre-plant use of methylbromide as soil fumigant. Pest Manag. Sci. 62(2): 99–113. doi:10.1002/ps.1135. PMID:16308867.

Screen, S., Bailey, A., Charnley, K., Cooper, R., and Clarkson, J.1997. Carbon regulation of the cuticle-degrading enzyme PR1from Metarhizium anisopliae may involve a trans-acting DNA-binding protein CRR1, a functional equivalent of the Aspergillusnidulans CREA protein. Curr. Genet. 31(6): 511–518. doi:10.1007/s002940050238. PMID:9211795.

Segers, R., Butt, T.M., Keen, J.N., Kerry, B.R., and Peberdy, J.F.1995. The subtilisins of the invertebrate mycopathogens Verticil-lium chlamydosporium and Metarhizium anisopliae are serologi-cally and functionally related. FEMS Microbiol. Lett. 126(3): 227–231. doi:10.1111/j.1574-6968.1995.tb07423.x. PMID:7729666.

Segers, R., Butt, T.M., Kerry, B.R., Beckett, A., and Peberdy, J.F.1996. The role of the proteinase VCP1 produced by thenematophagous Verticillium chlamydosporium in the infectionprocess of nematode eggs. Mycol. Res. 100(4): 421–428. doi:10.1016/S0953-7562(96)80138-9.

St. Leger, R.J., Frank, D.C., Roberts, D.W., and Staples, R.C. 1992.Molecular cloning and regulatory analysis of thecuticle-degrading-protease structural gene from the entomopatho-genic fungus Metarhizium anisopliae. Eur. J. Biochem. 204(3):991–1001. doi:10.1111/j.1432-1033.1992.tb16721.x. PMID:1551399.

St. Leger, R.J., Bidochka, M.J., and Roberts, D.W. 1994. Character-ization of a novel carboxypeptidase produced by the entomopatho-genic fungus Metarhizium anisopliae. Arch. Biochem. Biophys.314(2): 392–398. doi:10.1006/abbi.1994.1458. PMID:7979380.

Stirling, G.R. 1991. Biological control of plant parasitic nematodes.CAB International, Wallingford, UK.

Tamura, K., Dudley, J., Nei, M., and Kumar, S. 2007. MEGA4:molecular evolutionary genetics analysis (MEGA) softwareversion 4.0. Mol. Biol. Evol. 24(8): 1596–1599. doi:10.1093/molbev/msm092. PMID:17488738.

Tobin, J.D., Haydock, P.P.J., Hare, M.C., Woods, S.R., and Crump,D.H. 2008. Effect of the fungus Pochonia chlamydosporia andfosthiazate on the multiplication rate of potato cyst nematodes(Globodera pallida and G. rostochiensis) in potato crops grownunder UK field conditions. Biol. Control, 46(2): 194–201. doi:10.1016/j.biocontrol.2008.03.014.

Wells, J.A., Powers, D.B., Bott, R.R., Graycar, T.P., and Estell, D.A.1987. Designing substrate specificity by protein engineering ofelectrostatic interactions. Proc. Natl. Acad. Sci. U.S.A. 84(5):1219–1223. doi:10.1073/pnas.84.5.1219. PMID:3547407.

Wright, C.S., Alden, R.A., and Kraut, J. 1969. Structure of subtilisinBPN′ at 2.5 Å resolution. Nature, 221(5177): 235–242. doi:10.1038/221235a0. PMID:5763076.

Yang, J., Tian, B., Liang, L., and Zhang, K.-Q. 2007. Extracellularenzymes and the pathogenesis of nematophagous fungi. Appl.Microbiol. Biotechnol. 75(1): 21–31. doi:10.1007/s00253-007-0881-4. PMID:17318531.

Yang, J., Wang, L., Ji, X., Feng, Y., Li, X., Zou, C., et al. 2011.Genomic and proteomic analyses of the fungus Arthrobotrysoligospora provide insights into nematode-trap formation. PLoSPathog. 7(9): e1002179. doi:10.1371/journal.ppat.1002179.PMID:21909256.

Zaugg, C., Jousson, O., Léchenne, B., Staib, P., and Monod, M. 2008.Trichophyton rubrum secreted and membrane-associated carboxy-peptidases. Int. J. Med. Microbiol. 298(7–8): 669–682. doi:10.1016/j.ijmm.2007.11.005. PMID:18222721.

Larriba et al. 827


–

N

C

α1

α6

α4

α3

α5

α2

β13 β12

β1

β5 β7

β6

β9

β8

β1

β2

β3 β10

D148

H179

S334

C360 C288

C233 C143

C183 β4

S1

S4 S2 S3

Q172

S4

V217 D148

S209

N177

H179 S334

S1

L383

Q277

T279 S2-S3

V217

Supplementary Fig. S1. Molecular modeling of P. rubescens serine protease P32 structure. a) Ribbon diagram of P32 protein. The α-helices are colored green, β-strands are colored red, loops are colored blue, catalytic triad amino acids are colored yellow and cys residues are colored magenta. b) Molecular surface of P32 protein. Positive and negative surface potentials are displayed in blue and red, respectively. The figure also shows the approximate locations of substrate-binding sites (S1-S4). c) Residues of P32 involved in catalytic function. Amino acids forming the P32 catalytic triad are colored yellow, P32 unique residues putatively involved in catalytic activity are colored green, VCP1 homologous residues are colored red, Pr1A homologous residues are colored blue and VCP1 polymorphisms detected in P32 are colored light blue. P32 substrate-binding pockets are colored black (S1), grey (S4) and magenta (S2-S3).

a) b)

c)

gene cloning, molecular modeling, and phylogenetics of ... · sequence obtained was deposited in...

Documents