gene therapy & molecular biology volume 10 issue b

GENE THERAPY &

MOLECULAR BIOLOGY

FROM BASIC MECHANISMS TO

CLINICAL APPLICATIONS

Volume 10

Number 2

December 2006

Published by Gene Therapy Press

GENE THERAPY & MOLECULAR BIOLOGY FREE ACCESS www.gtmb.org

!!!!!!!!!!!!!!!!!!!!!!!!

Editor Teni Boulikas Ph. D.,

CEO Regulon Inc.

715 North Shoreline Blvd.

Mountain View, California, 94043

USA

Tel: 650-968-1129

Fax: 650-567-9082

E-mail: [email protected]

Teni Boulikas Ph. D.,

CEO, Regulon AE.

Gregoriou Afxentiou 7

Alimos, Athens, 17455

Greece

Tel: +30-210-9853849

Fax: +30-210-9858453


!!!!!!!!!!!!!!!!!!!!!!!!

Assistant to the Editor Maria Vougiouka B.Sc.,


Alimos, Athens, 17455

Greece

Tel: +30-210-9858454

Fax: +30-210-9858453


!!!!!!!!!!!!!!!!!!!!!!!! Associate Editors Aguilar-Cordova, Estuardo, Ph.D., AdvantaGene, Inc., USA

Berezney, Ronald, Ph.D., State University of New York at Buffalo, USA

Crooke, Stanley, M.D., Ph.D., ISIS Pharmaceuticals, Inc, USA

Crouzet, Joël, Ph.D. Neurotech S.A, France

Gronemeyer, Hinrich, Ph.D. I.N.S.E.R.M., IGBMC, France

Rossi, John, Ph.D., Beckman Research Institute of the City of Hope, USA

Shen, James, Ph.D., Institute of Molecular Biology, Academia Sinica, Taipei, Taiwan, Republic of China & University of

California at Davis, USA.

Webb, David, Ph.D., Celgene Corporation, USA

Wolff, Jon, Ph.D., University of Wisconsin, USA

!!!!!!!!!!!!!!!!!!!!!!!!

Editorial Board Akporiaye, Emmanuel, Ph.D., Arizona Cancer

Center, USA

Anson, Donald S., Ph.D., Women's and Children's

Hospital, Australia

Ariga, Hiroyoshi, Ph.D., Hokkaido University,

Japan

Baldwin, H. Scott, M.D Vanderbilt University

Medical Center, USA

Barranger, John, MD, Ph.D., University of

Pittsburgh, USA

Black, Keith L. M.D., Maxine Dunitz Neurosurgical

Institute, Cedars-Sinai Medical Center, USA

Bode, Jürgen, Gesellschaft für Biotechnologische

Forschung m.b.H., Germany

Bohn, Martha C., Ph.D., The Feinberg School of

Medicine, Northwestern University, USA

Bresnick, Emery, Ph.D., University of Wisconsin

Medical School, USA

Caiafa, Paola, Ph.D., Università di Roma “La

Sapienza”, Italy

Chao, Lee, Ph.D., Medical University of South

Carolina, USA

Cheng, Seng H. Ph.D., Genzyme Corporation, USA

Clements, Barklie, Ph.D., University of Glasgow,

USA

Cole, David J. M.D., Medical University of South

Carolina, USA

Chishti, Athar H., Ph.D., University of Illinois

College of Medicine, USA

Davie, James R, Ph.D., Manitoba Institute of Cell

Biology;USA

DePamphilis, Melvin L, Ph.D., National Institute of

Child Health and Human, National Institutes of Health,

USA

Donoghue, Daniel J., Ph.D., Center for Molecular

Genetics, University of California, San Diego, USA

Eckstein, Jens W., Ph.D., Akikoa Pharmaceuticals

Inc, USA

Fisher, Paul A. Ph.D., State University of New York,

USA

Galanis, Evanthia, M.D., Mayo Clinic, USA

Gardner, Thomas A, M.D., Indiana University

Cancer Center, USA

Georgiev, Georgii, Ph.D., Russian Academy of

Sciences, USA

Getzenberg, Robert, Ph.D., Institute Shadyside

Medical Center, USA

Ghosh, Sankar Ph.D., Yale University School of

Medicine, USA

Gojobori, Takashi, Ph.D., Center for Information

Biology, National Institute of Genetics, Japan

Harris David T., Ph.D., Cord Blood Bank, University

of Arizona, USA

Heldin, Paraskevi Ph.D., Uppsala Universitet,

Sweden

Hesdorffer, Charles S., M.D., Columbia University,

USA

Hoekstra, Merl F, Ph.D., Epoch Biosciences, Inc.,

USA

Hung, Mien-Chie, Ph.D., The University of Texas,

USA

Johnston, Brian, Ph.D., Somagenics, Inc, USA

Jolly, Douglas J, Ph.D., Advantagene, Inc.,USA

Joshi, Sadhna, Ph.D., D.Sc., University of Toronto

Canada

Kaltschmidt, Christian, Ph.D., Universität

Witten/Herdecke, Germany

Kiyama, Ryoiti, Ph.D., National Institute of

Bioscience and Human-Technology, Japan

Krawetz, Stephen A., Ph.D., Wayne State

University School of Medicine, USA

Kruse, Carol A., Ph.D., La Jolla Institute for

Molecular Medicine, USA

Kuo, Tien, Ph.D., The University of Texas M. D.

Anderson Cancer USA

Kurachi Kotoku, Ph.D., University of Michigan

Medical School, USA

Kuroki, Masahide, M.D., Ph.D., Fukuoka

University School of Medicine, Japan

Lai, Mei T. Ph.D., Lilly Research Laboratories USA

Latchman, David S., PhD, Dsc, MRCPath

University of London, UK

Lavin, Martin F, Ph.D., The Queensland Cancer

Fund Research Unit, The Queensland Institute of

Medical Research, Australia

Lebkowski, Jane S., Ph.D., GERON Corporation,

USA

Li, Jian Jian, Ph.D., City of Hope National Medical

Center, USA

Li, Liangping Ph.D., Max-Delbrück-Center for

Molecular Medicine, Germany

Lu, Yi, Ph.D., University of Tennessee Health Science

Center, USA

Lundstrom Kenneth, Ph.D. , Bioxtal/Regulon, Inc.

Switzerland

Malone, Robert W., M.D., Aeras Global TB Vaccine

Foundation, USA

Mazarakis, Nicholas D. Ph.D., Imperial College

London, UK

Mirkin, Sergei, M. Ph.D., Tufts University, USA

Moroianu, Junona, Ph.D., Boston College, USA

Müller, Rolf, Ph.D., Institut für Molekularbiologie

und Tumorforschung, Phillips-Universität Marburg,

USA

Noteborn, Mathieu, Ph.D., Leiden University, The

Netherlands

Papamatheakis, Joseph (Sifis), Ph.D., Institute of

Molecular Biology and Biotechnology

Foundation for Research and Technology Hellas, USA

Platsoucas, Chris, D., Ph.D., Temple University

School of Medicine, USA

Rockson, Stanley G., M.D., Stanford University


Poeschla, Eric, M.D., Mayo Clinic, USA

Pomerantz, Roger, J., M.D., Tibotec, Inc., USA

Raizada, Mohan K., Ph.D., University of Florida,

USA

Razin, Sergey, Ph.D., Institute of Gene Biology

Russian Academy of Sciences, USA

Robbins, Paul, D, Ph.D., University of Pittsburgh,

USA

Rosenblatt, Joseph, D., M.D, University of Miami


Rosner, Marsha, R., Ph.D., Ben May Institute for

Cancer Research, University of Chicago, USA

Royer, Hans-Dieter, M.D., (CAESAR), Germany

Rubin, Joseph, M.D., Mayo Medical School

Mayo Clinic, USA

Saenko Evgueni L., Ph.D., University of Maryland

School of Medicine Center for Vascular and

Inflammatory Diseases, USA

Salmons, Brian, Ph.D., (FSG-Biotechnologie GmbH),

Austria

Santoro, M. Gabriella, Ph.D., University of Rome

Tor Vergata, USA

Sharrocks, Andrew, D., Ph.D., University of

Manchester, USA

Shi, Yang, Ph.D., Harvard Medical School, USA

Smythe Roy W., M.D., Texas A&M University

Health Sciences Center, USA

Srivastava, Arun Ph.D., University of Florida

College of Medicine, USA

Steiner, Mitchell, M.D., University of Tennessee,

USA

Tainsky, Michael A., Ph.D., Karmanos Cancer

Institute, Wayne State University, USA

Sung, Young-Chul, Ph.D., Pohang University of

Science & Technology, Korea

Taira, Kazunari, Ph.D., The University of Tokyo,

Japan

Terzic, Andre, M.D., Ph.D., Mayo Clinic College of

Medicine, USA

Thierry, Alain, Ph.D., National Cancer Institute,

National Institutes of Health, France

Trifonov, Edward, N. Ph.D., University of Haifa,

Israel

Van de Ven, Wim, Ph.D., University of Leuven,

Belgium

Van Dyke, Michael, W., Ph.D., The University of

Texas M. D. Anderson Cancer Center, USA

White, Robert, J., University of Glasgow, UK

White-Scharf, Mary, Ph.D., Biotransplant, Inc., USA

Wiginton, Dan, A., Ph.D., Children's Hospital

Research Foundation, CHRF , USA

Yung, Alfred, M.D., University of Texas, USA

Zannis-Hadjopoulos, Maria Ph.D., McGill Cancer

Centre, Canada

Zorbas, Haralabos, Ph.D., BioM AG Team, Germany

!!!!!!!!!!!!!!!!!!!!!!!!

Associate Board Members

Aoki, Kazunori, M.D., Ph.D., National Cancer Center

Research Institute, Japan

Cao, Xinmin, Ph.D., Institute of Molecular and Cell

Biology, Singapore

Falasca, Marco, M.D., University College London,

UK

Gao, Shou-Jiang, Ph.D., The University of Texas

Health Science Center at San Antonio, USA

Gibson, Spencer Bruce, Ph.D., University of Manitoba,

USA

Gra•a, Xavier, Ph.D., Temple University School of

Medicine, USA

Gu, Baohua, Ph.D., The Jefferson Center, USA

Hiroki, Maruyama, M.D., Ph.D., Niigata University

Graduate School of Medical and Dental Sciences, Japan

MacDougald, Ormond A, Ph.D., University of

Michigan Medical School, USA

Rigoutsos, Isidore, Ph.D., Thomas J. Watson Research

Center, USA

For submission of manuscripts and inquiries:

Editorial Office

Teni Boulikas, Ph.D./ Maria Vougiouka, B.Sc.


Alimos, Athens 17455

Greece

Tel: +30-210-985-8454

Fax: +30-210-985-8453

and electronically to

[email protected]

Instructions to authors:

Gene Therapy and Molecular Biology (GTMB) FREE ACCESS www.gtmb.org

Scope

Gene Therapy and Molecular Biology, bridging various fields is one of the most rapid with free access

at gtmb.org.

The scope of Gene Therapy and Molecular Biology is to promote interaction between researchers in

the fields of Gene Therapy and Molecular Biology providing rapid publication of review articles and

research papers. Articles (both invited and submitted) review or report novel findings of importance to

a general audience in gene therapy, molecular medicine, gene discovery, and molecular biology with

emphasis to molecular mechanisms. The journal will accept papers on all aspects of gene therapy,

including gene delivery systems, gene therapy of cancer and other diseases (e.g. CFTR, hemophilia,

AIDS, restenosis) at the clinical, preclinical or cell culture stage, gene discovery, cancer

immunotherapy, DNA vaccines, use of DNA regulatory elements in gene transfer, cell therapy and

transplantation, arraying technologies & DNA chips, peptide libraries and drug discovery related to

gene therapy, cell targeting, gene targeting, therapy with oligonucleotides (antisense, ribozymes,

triplex). The authors are encouraged to elaborate on the molecular mechanisms that govern a gene

therapy approach. Gene Therapy and Molecular Biology will also publish articles on, transcription

factors, DNA replication, recombination, repair, chromatin, nuclear matrix, DNA regulatory regions,

locus control regions, protein phosphorylation, signal transduction, development, and on molecular

mechanism of human disease. To make the publication attractive authors are encouraged to

include color figures.

Type of articles

Both review articles and original research articles will be considered. In addition, short 1-2 page news

& views will also be considered for publication. Original research articles should contain a generous

introduction in addition to experimental data. The articles contain information important to a general

audience as the volume is also addressed to researches outside the field. There is no limit on the length

of the articles provided that the subject is interesting to a general audience and covers exhaustively a

field. The typical length of each manuscript is a approximately 4-20 printed page including Figures

and Tables. This is 12-60 manuscript pages.

Charges, Complimentary reprints & Subscriptions

There are no charges for color figures or page numbers. Corresponding authors get a one-year free

subscription (hard copy) plus 25 reprints free of charge. The free subscription can be renewed for

additional years by having one paper per year accepted for publication.

The free electronic access to articles published in " Gene Therapy and Molecular Biology " to a big

general audience, the attractive journal title, the speed of the reviewing process, the no-charges for

page numbers or color figure reproduction, the 25 complimentary reprints, the rapid electronic

publication, the embracing of many fields in gene therapy (from molecular mechanisms to clinical

trials), the high quality in depth reviews and first rate research articles and most important, the

eminent members of the Editorial Board being assembled are prognostic factors of a big success for

GTMB.

Sections of the manuscript

Each manuscript should have a Title, Authors, Affiliation, Corresponding Author (with Tel, Fax, and

E-mail), Summary, key words , running title and Introduction; review articles are subdivided into

headings I, II, III, etc. (starting with I. Introduction) subdivided into A, B, C, and further subdivided

using 1, 2, 3, etc. You can further subdivide into 1, 2, 3, etc. Research articles are divided into

Summary; I. Introduction; II. Materials and Methods III. Results; IV. Discussion; Acknowledgments;

and References. Please include in your text citations the name of authors and year in parenthesis; for

three or more authors use: (name of first author et al, with year); for two authors please use both

names. Please delete hidden text for references. In the reference list, please, type references with year

and Journal in boldface and provide full title of the article such as:

Buschle M, Schmidt W, Berger M, Schaffner G, Kurzbauer R, Killisch I, Tiedemann J-K, Trska B,

Kirlappos H, Mechtler K, Schilcher F, Gabler C, and Birnstiel ML (1998) Chemically defined, cell-

free cancer vaccines: use of tumor antigen-derived peptides or polyepitope proteins for vaccination.

Gene Ther Mol Biol 1, 309-321.

To avoid delays it is essential to submit an electronic and a hard copy version of your manuscript via

e-mail and mail in a floppy, CD-ROM or ZIP, containing the manuscript that will be used to typeset

the paper. Please include in the digital media: Tables, if any, (preferably as a Microsoft Word text) and

Figure legends. Please use Microsoft Word, font “Times” (Mac users) or “Times New Roman” (PC

users) and insert Greek or other characters using the “Insert/Symbol” function in the Microsoft Word

rather than simple conversion to font “Symbol”. Please boldface Figure 1, 2, 3 etc. as well as Table 1,

2, etc. throughout the text. Please provide the highest quality of prints of your Figures; whenever

possible, please provide in addition an electronic version of your figures.

Article contributors are kindly requested to provide a color (or black/white) photo of themselves

(preferably 4x5 cm or any size) or a group photo of the authors, as we shall include these in the

publication

Submission and reviewing

Peer reviewing is by members of the Editorial Board and external referees. Please suggest 2-3

reviewers providing their electronic addresses, mailing addresses and telephone/fax numbers. Authors

are sent page proofs.

Gene Therapy and Molecular Biology is published in on high quality paper, hardbound, and with

excellent reproduction of color figures.

Reviewing is completed within 5-15 days from receiving the manuscript.

Articles accepted without revisions (i.e., review articles) will be published online (www.gtmb.org) in

approximately 1 month following submission.

Please submit an electronic version of full text and figures preferably in jpeg format. The electronic

version of the figures will be used for the rapid reviewing process. High quality prints or photograph

of the figures and the original with one copy should be sent via express mail to the Editorial Office.

Citation in MedLine

Articles accepted for publication by GTMB or Cancer Therapy can be included in MedLine (PubMed)

as full articles upon the request of authors provided that the authors have completed their published

work under a government grant by NIH (or EU/Japan government grant). If this is you case, please

consult the NIH Manuscript Submission System http://www.nihms.nih.gov/.

Editorial Office

Teni Boulikas, Ph.D./ Maria Vougiouka, B.Sc.


Alimos, Athens 17455

Greece

Tel: +30-210-985-8454

Fax: +30-210-985-8453

and electronically to

[email protected]

The free electronic access to articles published in "GTMB" to a big general audience, the attractive

journal title, the speed of the reviewing process, the no-charges for page numbers or color figure

reproduction, the 25 complimentary reprints, the rapid electronic publication, the embracing of many

fields in cancer, the anticipated high quality in depth reviews and first rate research articles and most

important, the eminent members of the Editorial Board being assembled are prognostic factors of a big

success for the newly established journal.

Gene Therapy and Molecular Biology (GTMB) is

covered in the following Thomson Scientific

services:

" Science Citation Index Expanded (also known as

SciSearch#)

" Biotechnology Citation Index#

" Journals Citation Reports/Science Edition

Table of contents

Gene Therapy and Molecular Biology

Vol 10 Number 2, December 2006

Pages Type of

Article Article title Authors (corresponding author is in

boldface)

165-172 Research

Article FLT3-ITD: technical approach and

characterization of cases with double

duplications

Emanuela Frascella, Claudia

Zampieron, Martina Piccoli,

Francesca Intini, Giuseppe Basso

173-178 Research

Article The Human VG5Q Gene Transcript is

Over !Expressed in Colorectal and

Bladder Carcinomas Research Article

Mutaz Akkawi, Ibrahim Abbasi,

Abraham Hochberg, Ofer N. Gofrit,

Hassan !Dweik, Imad J. Matouk

179-184 Review

Article Title-loss of "catenin is an independent

prognostic factor in ovarian

carcinomas: !A multivariate analysis

Cristina Faleiro-Rodrigues, Isabel

Macedo-Pinto, Deolinda Pereira

185-192 Research

Article New generations of retroviral vector

for safe, efficient and targeted gene

therapy

Walter H. Günzburg, Juraj Hlavaty,

Stanislav Indik, Walter Tabotta,

Ingrid Walter, Christine Hohenadl,

Eva Maria Brandtner, Francoise

Rouault, Matthias Renner and Brian

Salmons

193-198 Research

Article The association of endothelial

constitutive Nitric Oxide Synthase

polymorphisms with family history of

coronary heart disease in men

Nasser M. Al-Daghri

199-206 Research

Article Apoptotic signaling induced by

Tiazofurin-an in vitro study

Sujata Pathak, Himani Sharma,

Chandresh Sharma, Hiremagalur N.

Jayaram, Neeta Singh

207-222 Research

Article Effects of spatial configuration on

tumor cells transgene expression

Cecilia C. Casais, Armando L.

Karara, Gerardo C. Glikin, and

Liliana M. E. Finocchiaro

223-232 Research

Article Use of lectin as an anchoring agent for

adenovirus- microbead conjugates:

Application to the transduction of the

inflamed colon in mice

Alan Jerusalmi, Samuel J. Farlow and

Takeshi Sano

233-244 Research

Article Replicating minicircles: Generation of

nonviral episomes for the efficient

modification of dividing cells

Kristina Nehlsen, Sandra Broll and

Juergen Bode

245-250 Research

Article Cloning, Expression and Purification

of a novel antiangiogenic factor-

Tumstatin

Chongbi Li, Liming Yang, Hongli Jia

251-254 Research

Article Plasmodium and host carbonic

anhydrase: !molecular function and

biological process

Viroj Wiwanitkit

255-262 Research

Article Isolation of genes controlling apoptosis

through their effects on cell survival

Gwyn T. Williams, Jane P. Hughes

Victoria Stoneman, Claire L.

Anderson, Nicola J. McCarthy, Mirna

Mourtada-Maarabouni, Mark Pickard,

Vanessa L. Hedge, Ian Trayner,

Farzin Farzaneh

263-268 Research

Article The prevalence of antibiotic resistance

in anaerobic bacteria isolated from

patients with skin infections

Gita Eslami, Fatemeh Fallah,

Hossein Goudarzi and Masoumeh

Navidinia

269-276 Research

Article Transfection of the anti-apoptotic gene

bcl-2 inhibits oxidative stress-induced

cell injuries through delaying of NF-

#B activation

Shinobu Yanada, Masashi Misumi,

Yasukazu Saitoh, Yasufumi Kaneda,

Nobuhiko Miwa

Gene Therapy and Molecular Biology Vol 10, page 165

165

Gene Ther Mol Biol Vol 10, 165-172, 2006

FLT3-ITD: technical approach and characterization

of cases with double duplications Research Article

Emanuela Frascella*, Claudia Zampieron, Martina Piccoli, Francesca Intini,

Giuseppe Basso Laboratory of Pediatric Hematology-Oncology Unit, Department of Pediatrics, University of Padova, Italy __________________________________________________________________________________

*Correspondence: Emanuela Frascella, MD, PhD, Paediatric Haematology-Oncology Unit, Department of Paediatrics, University of

Padova, via Giustiniani 3, 35128 Padova, Italy; Tel: +39-0498211455; Fax: +39-0498211462; e-mail: [email protected]

Key words: FLT3-ITD, AML, acrylamide, purification, mutant level

Abbreviations: acute myeloid leukaemia, (AML); Internal Tandem Duplication, (ITD); tyrosine-kinase-receptor, (RTK)

Received: 11 January 2006; Revised: 04 April 2006

Accepted: 18 May 2006; electronically published: May 2006

Summary

FLT3-Internal Tandem Duplication (ITD) of the juxtamembrane domain is one of the most common genetic

alterations in acute myeloid leukemia (AML) and in some FAB subgroups seems to represent an unfavorable

prognostic factor. Thus, its correct identification is critical. We analyzed 261 AML cases to individuate FLT3-ITD

by RT-PCR and we compare different techniques (agarose and polyacrilamide gel electrophoresis, sequence and

Genescan of PCR products) to define FLT3-ITD presence, length and number. All 53 positive cases were identified

by electrophoresis on agarose gel. The sequence of the FLT3-ITD amplicons eluted from polyacrilamide gel was

successfully performed while failing from agarose gel. We compared different methods of purifying PCR products

from polyacrilamide gel to identify the fastest and most effective one. Genescan analysis was used to confirm the

presence and the length of the ITD and to study the rate between ITD/WT transcripts. In our experience

electrophoresis on 2% agarose gel is adequate for identifying FLT3-ITD, while purification from polyacrilamide gel

is suggested for sequencing. In our series we found 20% of positive cases, 7.5% of these lacked FLT3 wild-type

transcript and 13.2% showed two different FLT3-ITDs. In addition we identify 2 cases carrying 2 FLT3-ITD with

the same length but different nucleotide sequence.

I. Introduction FLT3 is a member of the class III tyrosine-kinase-

receptor-family (RTK) involved in differentiation,

proliferation and apoptosis of hematopoietic cells. It is

mainly expressed by early myeloid and lymphoid

progenitor cells and is one of the most frequently mutated

genes in Acute Myeloid Leukemia (AML). It has been

detected in all AML FAB subtypes, with the highest

reported frequency among M3 subtype (Rosnet et al, 1996;

Abu-Duhier et al, 2001; Stirewalt and Radich, 2003). The

most common type of mutation is an internal tandem

duplication (ITD) of the juxtamembrane domain which is

found in about 25% of AML (Stirewalt and Radich, 2003).

FLT3-ITD results from a head-to-tail duplication of 3-400

base pair in exons 14 or 15 which encode the

juxtamembrane domain of FLT3; they are variable in

length from patient to patient, but are always in frame

(Schaniptger et al, 2002). These repeat sequences cause a

ligand-independent activation of the receptor and

activation of a downstream signaling pathway. Some cases

with both FLT3 alleles mutated and some lacking the

residual wild-type allele have been described (Withman et

al, 2001; Thiede et al, 2002). Patients with AML harboring

FLT3-ITD mutations have a significantly greater relapse

and many studies suggested that the presence of FLT3-

ITD is associated with poor clinical outcome in both

pediatric and adult AML patients (Kottaridis et al, 2001;

Schaniptger et al, 2002; Thiede et al, 2002). Recently there

has been great interest in developing FLT3-inhibitors for

therapeutic use and several molecules are currently under

investigation (Stirewalt and Radich, 2003). Considering

prognostic and therapeutic relevance of this mutation, the

standardization of methods to study FLT3-ITD seems

useful. In our study, we compare the efficiency of different

techniques to define FLT3-ITD presence, length and

number and analyzed by sequencing all ITD found. In

Frascella et al: FLT3-ITD: technical approach

166

addition we identified a group of cases carrying more than

one FLT3-ITD in which we analyzed the sequence of

ITDs and the mutant level.

II. Materials and methods A. Patients We analyzed, retrospectively, bone marrow (BM)

diagnostic samples, obtained after informed consent, in a series

of 261 Italian children with AML, treated at AIEOP centers

between 1988 and 1998 and whose RNA were available.

B. RNA extraction and RT-PCR method BM samples were centralized at diagnosis in the reference

laboratory at the University of Padua. Nucleated cells were

isolated by the Ficoll-Hypaque technique and frozen in liquid

nitrogen. Total RNA was isolated using the RNAzol-B reagent

(Tel-Test, Inc., Friendswood, TX, USA), dissolved in DEPc

water and quantified with GeneQuant spectrophotometry

(Pharmacia, Amersham Biosciences, Freiburg, Germany). 2 µg

of total RNA were reverse transcribed using Superscript! II

(Life Technologies, Invitrogen, Milan, Italy) and random

hexamers.

A PCR with ABL specific primers was performed, in each

sample, to assess the presence of intact RNA and amplifiable

cDNA and to exclude the presence of genomic DNA. Forward

and reverse ABL primers (CCT TCT CGC TGG ACC CAG

TGA and TGT GAT TAT AGC CTA AGA CCC GGA G), were

located in two distinct exons. The length of PCR products

derived from mRNA and DNA were 127 bp and 691 bp,

respectively. Forward and reverse primers used to amplify FLT3

transcript were GCAATTTAGGTATGAAAGCCAGC and

CACCTGATCCTAGTACCTTCCCA. Also these primers were

located between different exons: the length of the wild-type

amplicon derived from mRNA was 155 bp whilst the amplicon

derived from genomic DNA was 222 bp. In each assay a sample

without nucleic acid were included to verify the absence of cross

contamination. PCR amplification was performed using

Amplitaq polymerase (Applied Biosystem, Monza, Italy)

according to the BIOMED-1 protocol. PCR reaction products

were electrophoresed through 2% agarose gel and 12,5%

polyacrilamide gel, and then stained with ethidium bromide

(Nakao et al, 1996; Kiyoi et al, 1997; van Dongen et al, 1999).

C. Purification of PCR products PCR products were processed with NucleoSpin ® Extract 2

in 1 (M-Medical, Milan, Italy), Microcon YM Centrifugal Filter

Device (Millipore, Billerica, MA, USA) and CENTRI-SEP

COLUMNS (Princeton Separation, Adelphia, NJ, USA)

following manufacturer’s instructions.

D. Purification of PCR products from

agarose gel FLT3-ITD and FLT3-WT bands were cut and eluted from

agarose gel with NucleoSpin ® Extract 2 in 1 and QIAquick PCR

Purification KIT (Qiagen, Milano, Italy) following

manufacturer’s instructions.

E. Purification of PCR products from

polyacrilamide gel Bands were excised and eluted using two different

methods. Classical method (Sambrook et al, 1989) with minor

modification was used in our laboratory. Briefly, gel pieces were

crushed and incubate, over night at 55°C, into microcentrifuge

tube with 380 µl of elution buffer (10 mM Tris HCl pH 7.4, 0.1%

SDS, 1 mM EDTA pH 8). Elution buffer were recovered, added

of NaAcetate 0.3 M pH 5.4 (100 µl) and cold absolute Ethanol (1

ml), hold at –20°C for 30 min and centrifuged at 15000 x g for

20 min at 4°C. The supernatant was decanted and the pellet was

washed in Ethanol 70% and dried. DNA recovery from

polyacrilamide gel with Ultrafree"-MC and Amicon#

Microcoon# Centrifugal Filter Devices (Millipore, Billerica,

MA, USA) was performed following manufacturer’s instructions.

Samples were dissolved in sterile water and 5 µl of eluted

samples were re-amplified by PCR reactions in a 100 µl mixture

using the same PCR primers and electrophoresed by 2% agarose

gel. To evaluate the critical step of each method we mixed the

two elution protocols in six different combinations (see results).

F. Genescan analysis and sequencing All positive samples and 20 negative samples were

analysed on ABI Prism 310 Genetic Analyzer after a PCR

reaction with FAM5’ labelled antisense-primer. PCR products

were mixed with Genescan-500 Tamra Size Standards (Applied

Biosystem, Monza, Italy) and analysed by capillar

electrophoresis using POP 4 (Applied Biosystem, Monza, Italy)

by Genescan analysis software. The Genescan analysis software

(Applied Biosystem, Monza, Italy) was used to quantify the areas

under the curves that resulted from this analysis for FLT-ITD and

FLT3 wild type transcripts. The level of FLT3-ITD was

expressed as a percentage of total FLT3 (wild-type plus

mutated). Positive sample were sequenced using BigDye™

Terminator mix and automated sequencer ABI Prism 310

Genetic Analyzer (Applied Biosystem, Monza, Italy), according

to manufacturer’s instructions. Results of sequencing were

analyzed by Chromas software and sequences were aligned with

reference sequence (Z26652) by DotLET (http://www.isrec.isb-

sib.ch/java/dotlet/Dotlet.html) and BLAST

(http://www.ncbi.nih.gov/BLAST/).

III. Results and discussion We found 53 out of 261 (20%) positive cases and 61

FLT3-ITD. All ITDs were identified using electrophoresis

on 2% agarose gel in which they appeared as one or more

amplicons longer than the expected product (Figure 1 A).

Due to scarce availability of material 2 cases were only

analysed by electrophoresis on agarose gel. All the other

PCR products were electrophoresed on 12.5%

polyacrilamide gel to evaluate agarose gel sensitivity and

specificity in showing shortest insertions: the presence of

ITD was always confirmed and we did not identify any

additional positive case. It is noteworthy that, on

polyacrilamide gel, all positive cases showed a specific

migration pattern, including two or more products with

seemingly high molecular weight in addition to WT and

ITD. These bands were cut and the PCR product was

eluted: its re-amplification produced both WT and ITD

transcripts (Figure 1, B1 and B2) showing that these

bands contain heterodimers.

The sequence of PCR products extracted from

agarose gel was successfully performed for the WT

transcript, but failed for the ITD amplicons in which the

re-amplification show both WT and ITD products

(Figure1 A1). Instead the sequence of the products eluted

from polyacrilamide gel was successfully carried out for

both WT and ITD transcript (Figure1 B3).

In view of the fact that sequence and Genescan analysis is

required to better characterize FLT3-ITD, we compared

the efficiency of different techniques to purify PCR


167

products directly, from agarose and polyacrilamide gel,

using different methods, buffers and columns. After

purification, each sample was quantified by

spectrophotometer to evaluate DNA recovery, re-

amplificated with same primers, and sequenced with

different template concentrations. Results are illustrated in

Table 1.DNA recovery percentage and sequence quality

was equivalent in almost all methods used to purify

amplicons directly or from agarose gel. On the contrary,

we observed different results in processing samples from

polyacrilamide gel. Re-amplification failed using products

eluted by ethanol precipitation without further purification.

The two buffers used allowed a comparable DNA recovery, nevertheless the buffer with Tris-HCl required a

longer incubation time than buffer with Na4+-acetate, and

further salt addition for nucleic acid recovery. Ethanol

precipitation needed a longer assay-time than purification

by column.

We evaluated also the sequencing result after

purification of PCR products. Preliminary experiments,

using progressive amounts of template ranged from 10 to

80 ng, showed that better results were obtained with 25 ng

of PCR product using the reverse primer (data not shown).

Sequencing was successfully performed after purification

of PCR products and agarose gel, while, in several cases

after elution from polyacrilamide gel an additional re-

amplification is required.

In our series FLT3-ITD was found in 53 out of 261

patients. Duplications ranging from 18 to 132 bp and

involved the region between 1702 to 1857 nucleotides of

the FLT3 reference sequence Z26652. We did not find any

association between the region involved in the tandem

repeat and the different FAB subtype. All ITDs were in-

frame, according with other studies (Schaniptger et al,

2002; Thiede et al, 2002). In two cases ITD’s sequence

contained a portion of the intron sequence and in 12

included an insertion range between 5 and 38 nt. In 4

patients, the analysis by agarose gel showed the lack of

WT transcripts, however in 3 out of 4 electrophoresis by

polyacrilamide gel showed a very weak band of WT FLT3

transcript. In these 3 cases Genescan analysis identified a

little peak corresponding to the WT amplicon.

Seven cases show more than one ITD (Table 2). Five

were identified by agarose gel and 2 (M167 and M380)

only by polyacrilamide gel. For 6 out of 7 cases there were

available material for sequencing and Genescan analysis.

FLT3-ITDs ranged from 21 to 99 bp, only one had an

insertion of 6 bp. In 2 cases (M167 and M218) the ITDs

involved different regions. In 2 cases (M375 and M380)

there was a partial overlap and in the last 2 ones (M397

and M447) the shorter ITD involved a region completely

included in the longer (Figure 2). Cases M167 and M380

had two ITDs with the same length but different

sequences. These cases were identified by polyacrilamide

gel and confirmed by sequencing, whilst when analyzed

by Genescan showed a unique peak (Figure 3, panel D).

In this group the total level of mutants detected ranged

from 12.5% to 90.2%. In 3 cases the values were

compatible with a heterozygous mutation in all or the

majority of cells; in case M397 results suggested the lack

of wild-type transcript, while in the other two cases data

suggested the presence of mutation in a cell sub-clone.

Figure 1. Electrophoresis on agarose and polyacrilamide gels. Patients are identified by number. First line molecular weight markers.

Panel A: agarose gel. Panel A1: re-amplification after elution of ITD amplicon generates both ITD and wild-type products. Panel B:

polyacrilamide gel. Panel B1 and B2: electrophoresis on agarose (B1) and polyacrilamide (B2) after elution and re-amplification of the

amplicon with seemingly high molecular weight. The re-amplification generates both ITD and wild-type products. Panel B3: re-

amplification after elution of ITD amplicons generates only ITD product.


168

Table 1. Evaluation of different methods of PCR product purification. Assay-time, DNA recovery and quality of re-

amplification and sequence were evaluated for each method. PCR elution from polyacrilamide gel was performed using

two different buffers: *Buffer 10 mM TRIS HCl pH 7.4, 0.1% SDS, 1 mM EDTA pH 8; ^Buffer 0.5 M NH4+ Acetate, 2

mM EDTA pH 8, 0.1% SDS.

# Purification Method Assay

Time

% DNA

recovery Re-amplification

Source of

amplicon 1 No purification 0 100 +

2 Nucleospin Extract (M-Medical Cat. N. 740-590-250) 60 min 9 +

3 Microcon YM Centrifugal Filter Device (Millipore Cat N.

42413) 20 min 8 +

PC

R p

rod

uct

4 Centri-Sep Columns (Priceton Separations Cat. N. CS-901) 150 min 9 +

5 Nucleospin Extract (M-Medical Cat. N. 740-590-250) 90 min 11 +/-

Ag

aro

se

gel

6 QIAquick PCR purification Kit (Qiagen Cat. N. 28180) 120 min 8 +

7 Elution buffer with Tris-HCl*, Ultrafree–MC 0.45 µm

(Millipore Cat N. UFC3 0HV 0S) for polyacrilamide residues

750 min

2 +

8 Elution buffer with Tris-HCl*, ethanol precipitation. 890 min 8 -

9 Elution buffer with Tris-HCl *, ethanol precipitation,

purification with Microcon YM 910 min 2 +

10 Elution buffer with ammonium acetate^, ethanol precipitation 270 min 4 -

11 Elution buffer with ammonium acetate^, ethanol

precipitation, purification with Microcon YM 290 min 2 +

Po

lia

cr

yla

mm

id

e g

el

12

Elution buffer with ammonium acetate^, Ultrafree–MC 0.45

µm for polyacrilamide residues, purification with Microcon

YM

155 min 4 +

Table 2. Cases with double FLT3-ITD

N.

Pts.

FLT3-ITD

sequence

FLT3-ITD

length

(insertion)

Genescan

analysis

ITD/WT+ITD

M167 1705-1725 21

1777-1797 21

Unique peak

12.5%

M218 1714-1779 66 12%

1789-1812 24 52%

M300 not done not done

not done not done

M375 1798-1839 42

(6 nt) 27%

1786-1806 21 18.5%

M380 1768-1788 21

1777-1797 21

Unique peak

41%

M397 1738-1836 99 86.5%

1774-1794 21 3.7%

M447 1756-1833 78 13 %

1798-1827 30 13.5%

We analyzed also the level of each mutant in the 4 cases in

which the internal tandem duplications were different in

length. In two cases (M218 and M397) the strong

difference of the mutant level suggested the presence of

two different mutant clones. In the others we did not able

to exclude a unique sub-clone in which the WT FLT3

transcript was lacked. In conclusions, in our experience

electrophoresis on agarose 2% gel showed excellent

sensitivity and specificity in the identification of the

FLT3-ITD and shorter ITD were never found, even after

capillary electrophoresis analysis. The use of

polyacrilamide gel is suggested to isolate the ITD

amplicons for sequencing, due to their strong propensity in

forming heterodimers with the WT amplicon. Purification

of PCR products is useful to sequence amplicons. Methods

tested to purify PCR products directly or from agarose gel

were equivalent. Thus, the method chosen could be based

on cost and time-assay. On the contrary, purification from

polyacrilamide can be very laborious and poorly effective:

in our experience elution by Ultrafree-MC column with

NH4+-acetate buffer, followed by a further purification by


169

Figure 2. Representation of the internal tandem duplication found ordered by sample. Colors identified different patients. Group 1 red

and green. Group 2 orange and blue. Group 3 pink and yellow.

Figure 3. Upper: Sequence and

scheme of 4 exemplificative

samples. White-boxes: exons;

black-boxes: tandem duplication;

square-box: intron fragment. ITDs

are highlighted in bolded character

and are underlined together with

the previous exonic similar

sequence. Lower: Genescan

electropherograms of the same

samples. Red line molecular

weight markers, blue line PCR

products. White arrows indicate

wild-type amplicon peak, black

arrows point to ITD peaks. Panel

A: normal peripheral blood. Panel

B: sample #400 with a 18 bp ITD.

Panel C: sample #447 with two

ITDs of 30 and 81 bp, respectively.

Panel D: sample #380. This

sample had two ITD with the same

length (21 bp) but Genescan

analysis was not able to

discriminate them. Panel E:

sample #089 with a very small

peak corresponding to the ITD.


170

Microcon-YM column, represents the most effective and

fast method (Table 1 number 12).

The Genescan analysis allowed for the identification

of normal and mutated transcripts even if present in very

low amounts. In addition it allowed the study of mutant

level.

In our series 20% of AML carried an FLT3-ITD and

according with previous report all the internal tandem

duplication found were in-frame. The high frequency of

FLT3-ITD could be due to the retrospective nature of the

study (Frascella et al. 2004) and the high number of acute

promyelocytic leukaemia (52/261). In contrast with data

regarding adult population (Withman et al, 2001), in our

paediatric series the absence of the WT transcript seems to

be very rare. In 3 out of 4 cases a low quantity of WT

FLT3 transcript was found but we suppose that this small

amount could originate from residual bone marrow normal

cells.

Finally we individuate a subset of patients carrying

more than one FLT3-ITD. Among these cases we identify

2 cases carrying two internal tandem duplications with the

same length but different nucleotide sequence. These cases

were discovered by polyacrilamide gel because the ITDs

appeared as a unique band on agarose gel and as a unique

peak with the Genescan analysis. It is to note that, in this

group, only in one case the lack of WT FLT3 might

suggest lost of heterozygosity or biallelic mutation. In

these patients the structure of the couple of ITDs found

could be classify in 3 group based on the region involved

in the duplication: group 1- different ITDs (M167, M218);

group 2 - partially overlapped ITDs (M375, M380); group

3 - completely overlapped ITDs, in which all the

nucleotide involved in the shorter one are included also in

the longer (M397, M447) (Figure 2). Until now no

definitive hypothesis regarding FLT3-ITD origin exists.

Some authors suggested that binding sites for

Topoisomerase II, identified in the region interested by

duplication, could cause breaks to double strand of the

DNA (Libura et al, 2003). These breaks are normally

repaired by either non-homologous or homologous repair

systems. In some AML a decreased efficiency of the not-

homologous repair system has been reported (Gaymes et

al, 2002; Zhong et al, 1999), and it could contribute to the

creation of the FLT3-ITD in consequence of the loop

formation, (Kiyoi et al, 1998). In our series we could

hypothesize different mutation in group 1 patients cases

while an evolution of the first mutation could be suggested

in group 2 and 3 cases.

Acknowledgments We thank Dr C. Case for manuscript preparation.

This research was supported by Fondazione Città della

Speranza and AIL.

References Abu-Duhier FM, Goodeve AC, Wilson GA, Care RS, Peake IR,

Reilly JT (2001) Genomic structure of human FLT3:

implication for mutational analysis. Br J Haematol 113,

1076-1077.

Frascella E, Rondelli R, Pigazzi M, Zampieron C, Fagioli F,

Favre C, Lippi AA, Locatelli F, Luciani M, Menna G,

Micalizzi C, Rizzari C, Testi AM, Pession A, Basso G (2004)

Clinical features of childhood acute myeloid leukaemia with

specific geneRearrangements. Leukemia 18, 1427-1450.

Gaymes TJ, Mufti GJ, Rassool FV (2002) Myeloid leukemias

have increased activity of the nonhomologous end joining

pathway and concomitant DNA misrepair that is dependent

on the Ku70/86 heterodimer. Cancer Res. 62: 2791-2797.

Kiyoi H, Naoe T, Yokota S, Nakao M, Minami S, Kuriyama K,

Takeshita A, Saito K, Hasegawa S, Shimodaira S, Tamura J,

Shimazaki C, Matsue K, Kobayashi H, Arima N, Suzuki R,

Morishita H, Saito H, Ueda R, Ohno R (1997) Internal

tandem duplication of the FLT3 associated with leukocytosis

in acute promyelocytic leukemia. Leukemia Study Group of

the Ministry of Health and welfare (Kohseisho). Leukemia

11, 1447-1452.

Kiyoi H, Towatari M, Yokota S, Hamaguchi M, Ohno R, Saito

H, Naoe T (1998) Internal tandem duplication of the FLT3

gene is a novel modality of elongation mutation which

causes constitutive activation of the product. Leukemia 12,

1333-1337.

Kottaridis PD, Gale RE, Frew ME, Harrison G, Langabeer SE,

Belton AA, Walker H, Wheatley K, et al (2001) The

presence of an internal tandem duplication in patients with

acute myeloid leukemia (AML) adds important prognostic

information to cytogenetic risk group and response to the

first cycle of chemotherapy: analysis of 854 patients from the

United Kingdom Medical Research Council AML 10 and 12

trials. Blood 98, 1752-1759.

Libura M, Asnafi V, Tu A, Delabesse E, Tigaud I, Cymbalista F,

Bennaceur-Griscelli A, Villarese P, Solbu G, Hagemeijer A,

Beldjord K, Hermine O, Macintyre E (2003) FLT3 and MLL

intragenic abnormalities in AML reflect a common category

of genotoxic stress. Blood 102, 2198-2204.

Nakao M, Yokota S, Iwai T, Kaneko H, Horiike S, Kashima K,

Sonoda Y, Fujimoto T, Misawa S (1996) Internal tandem

duplication of the flt3 gene found in acute myeloid leukemia.

Leukemia 10, 1911-1918.

Rosnet O, Buhring HJ, Marchetto S, Rappold I, Lavagna C,

Sainty D, Arnoulet C, Chabannon C, Kanz L, Hannum C,

Birnbaum D (1996) Human FLT3/FLK2 receptor tyrosine

kinase is expressed at the surface of normal and malignant

hematopoietic cells. Leukemia 10, 238-248.

Sambrook J, Fritsh EF, and Maniatis T (1989) Molecular

Cloning, a laboratory manual. Cold Spring Harbor

Laboratory Press, New York, USA.

Schnittger S, Schoch C, Dugas M, Kern W, Staib P, Wuchter C,

Loffler H, Sauerland CM, Serve H, Buchner T, Haferlach T,

Hiddemann W (2002) Analysis of FLT3 length mutations in

1003 patients with acute myeloid leukemia: correlation to

cytogenetics, FAB subtype, and prognosis in AMLCG study

and usefulness as a marker for the detection of minimal

residual disease. Blood 100, 59-66.

Stirewalt D and Radich JP (2003) The role of FLT3 in

haematopoietic malignancies. Nat Rev Cancer 3, 650-665.

Thiede C, Steudel C, Mohr B, Schaich M, Schakel U,

Platzbecker U, Wermke M, Bornhauser M, Ritter M,

Neubauer A, Ehninger G, Illmer T (2002) Analysis of FLT3-

activating mutations in 979 patients with acute myelogenous

leukemia: association with FAB subtype and identification of

subgroups poor prognosis. Blood 99, 4326-4335.

van Dongen JJ, Macintyre EA, Gabert JA, Delabesse E, Rossi V,

Saglio G, Gottardi E, Rambaldi A, Dotti G, Griesinger F,

Parreira A, Gameiro P, Diaz MG, Malec M, Langerak AW,

San Miguel JF, Biondi A (1999) Standardized RT-PCR


171

analysis of fusion gene transcripts from chromosome

aberrations in acute leukemia for detection of minimal

residual disease. Report of the BIOMED-1 Concerted

Action: investigation of minimal residual disease in acute

leukemia Leukemia 13, 1901-1928

Whitman SP, Archer KJ, Feng L, Baldus C, Becknell B, Carlson

BD, Carroll AJ, Mrozek K, Vardiman JW, George SL, Kolitz

JE, Larson RA, Bloomfield CD, Caligiuri MA (2001)

Absence of the wild type allele predicts poor prognosis in

adult de novo acute myeloid leukemia with normal

cytogenetics and internal tandem duplication of FLT3: a

cancer and leukemia group B study. Cancer Res 61, 7233-

7239.

Zhong S, Hu P, Ye TZ, Stan R, Ellis NA, Pandolfi PP (1999) A

role for PML and the nuclear body in genomic stability.

Oncogene 18, 7941-7947.

From the top to the bottom and from the left to right: Emanuela Frascella, Claudia Zampieron, Martina Piccoli, Francesca

Intini, Giuseppe Basso


172


173


The Human VG5Q Gene Transcript is Over

Expressed in Colorectal and Bladder Carcinomas Research Article

Mutaz Akkawi1, Ibrahim Abbasi1, Abraham Hochberg2, Ofer N. Gofrit2, Hassan

Dweik1, Imad J. Matouk1,2,* 1Faculty of Science and Technology, Al-Quds University, Abu-Dis, Jerusalem 2The Department of Biological Chemistry, Alexander Silberman Institute of life Science, The Hebrew University of

Jerusalem

__________________________________________________________________________________

*Correspondence: Imad J. Matouk, Department of Biology, Faculty of Science and Technology, Alquds University, Abu-Dis-

Jerusalem and Silberman Institute of Life Science, Hebrew University, Jerusalem-Israel; Fax: 972-2-561-0250; e-mail:

[email protected] Key words: Colorectal and bladder carcinomas; VG5Q; Tumor marker; Cancer grade; Primary and secondary growth

Abbreviations: human umbilical vein endothelial cells, (HUVECS); klippel-trenaunay syndrome;, (KTS); reverse transcriptase

polymerase chain reaction, (RT-PCR); TNF-related weak inducer of apoptosis, (TWEAK); tumor necrosis factor (ligand) superfamily,

member 12, (TNFSF12); vascular endothelial growth factor, (VGEF); vasculogenesis gene on 5q, (VG5Q)

Received: 15 June 2006; Accepted: 20 June 2006; electronically published: July 2006

Summary We studied the pattern of the human VG5Q (AGGF1) mRNA expression in both normal and noeplastic colorectal

and bladder tissues. VG5Q mRNA was detected by RT-PCR technique. VG5Q is weekly expressed in the majority

of normal cases (n=12). Seven of eight colorectal carcinomas (87.5%) overexpressed VG5Q mRNA when compared

to their corresponding normal colorectal tissues of the same patient. The level of VG5Q expression in primary

tumor is also upregulated in (75%) of the cases when compared to their corresponding liver metastasis. No

consistent relationship in the expression level of VG5Q could be deduced when comparing normal colorectal

samples to their liver metastasis colorectal tumors. Comparing 4 normal bladder and 16 bladder carcinomas

samples reveal that VG5Q expression is also upregulated in bladder carcinomas. The level of VG5Q expression is

more frequently upregulated in low grade when compared to high grade bladder carcinomas. These are the first

results indicating the association of the newly discovered VG5Q gene transcript with human colorectal and bladder

carcinomas. Further studies are needed to evaluate the usage of VG5Q as a complementary histopathologic and a

candidate tumor marker among other modalities in both and other types of cancers.

I. Introduction In the past decade, the field of angiogenesis has

greatly widened with the discovery of new factors having

either angiogenic or anti-angiogenic activities.

Angiogenesis plays a central role in ovulation,

implantation of the fertilized ovum, fetal growth and

gestation, wound healing and repair following surgery and

trauma (Carmeliet, 2005). In many serious disease states,

the body loses control over angiogenesis. Excessive

angiogenesis occurs in cancer, age-related macular

degeneration, rheumatoid arthritis and many other

pathological conditions (Carmeliet and Jian, 2000).

VG5Q is a newly discovered angiogenic factor (Tian

et al, 2004). Its physiological properties resemble those of

the VEGF, but mediate distinct downstream events,

probably by interacting with the C-terminal domain of

TWEAK (also known as TNFSF12) (Tian et al, 2004).

VG5Q colocolizes with TWEAK around the nuclei in

HUVECS cultured on plastic dishes. When endothelial

tube formation is induced in matrigel, VG5Q and TWEAK

moved to the cell surface, and VG5Q detected also outside

of cells. Purified wild type VG5Q protein promoted strong

angiogenesis in a chick chorioallantoic membrane assay,

demonstrating that VG5Q is a potent angiogenic factor. It

can bind to endothelial cells and promotes cell

proliferation, suggesting that the protein may act in an

autocrine fashion. VG5Q shows strong expression in

blood vessels and is secreted when vessel formation is

initiated. Furthermore, VG5Q was detected in human

umbilical vein endothelial cells (HUVECs), human heart

fibroblast (HHF) and ovarian cancer cells (OV-3), but low

Akkawi et al: Positive association between AGGF1 overexpression with colorectal and bladder carcinomas

174

expression was detected in kidney cancer cells (RP-45),

HeLa cells and bladder cancer cells. VG5Q was

ubiquitously expressed in human tissues examined,

including heart, brain, placenta, lung, liver, skeletal

muscle, kidney, and pancreas. The VG5Q gene was

identified at the 5q13.3 breakpoint of a translocation

t(5;11)(q13.3;p15.1) (Tian et al, 2004).

Defects in VG5Q associated with its overexpression,

and through mutation render its protein hyperactive are a

cause of klippel-trenaunay syndrome (KTS). KTS is a

congenital disease characterized by malformations of

capillary, venous and lymphatic vessels. Susceptibility to

vascular defects typical of KTS is increased either by

higher expression of the gene due to chromosomal

translocation, or by a mutant protein which is assumed to

be hyperactive (Tian et al, 2004).

The association and probably contribution of VG5Q

gene product in cancer progression and metastasis is not

studied yet, nor do its upstream and its downstream

effectors identified. It is the aim of our study to investigate

whether VG5Q is differentially expressed in normal and

neoplastic states of colorectal and bladder carcinomas. We

report here for the first time that the expression level of

VG5Q is elevated in primary colorectal carcinomas when

either compared to normal tissue or secondary growth

tumor that metastasizes to the liver. Moreover, VG5Q is

overexpressed in bladder carcinomas when compared to

normal bladder tissues. The level of VG5Q overexpression

is more frequent in low grade tumor of the bladder when

compared to high grade.

Moreover we found that the expression level of

VG5Q mRNA is not induced when bladder carcinoma

(T24P) and hepatocellular carcinoma (Hep3B) cell lines

are exposed to hypoxic stress conditions under different

culture confluences.

II. Materials and methods A. Cell culture All the human carcinoma cell lines used in this study were

obtained from the American type culture collection (Manassas,

VA) and were maintained in DMEM-F12 (1:1) medium

containing 10% fetal calf serum (inactivated 55 oC for 30 min),

25 mM HEPES (pH 7.4), penicillin (180 units/ml), streptomycin

(100 !g/ml) and amphotericin B (0.2 !g /ml). Approximately

4x104 cells/cm2 were plated in polystyrene culture dishes

(NUNC). Every 4 days, the cells were trypsinized with 0.05%

trypsin-EDTA solution (Biet Haemek) for 10 min and re-plated

again at the same initial densities.

B. Reverse Transcriptase Polymerase Chain

Reaction (RT-PCR) Total RNA was extracted from cultured cell lines, and

patient specimens using the TRI REAGENT (Sigma) according

to the manufacturer’s instructions and treated with DNase I to

exclude genomic DNA contamination. The synthesis of cDNA

was performed using the p(dT)15 primer (Roche, Germany), to

initiate reverse transcription of 2!g total RNA with 400 units of

Reverse Transcriptase (Gibco BRL), according to manufacturer's

instructions. The PCR reaction was carried out with peQLab

Taq-polymerase for 29 cycles (94 °C for 1 min, 52 °C for 45s,

and 72 °C for 45s) preceded by 94 °C for 5 min, and a final

extension of 5 min at 72°C. The primers used in the PCR

reaction were (5'-ACGTACTTGAGCATGGAGATG-3') and (5'-

GTCCCCAAGCCTGCATGTGTT-3'), as described by Tian et

al. (2004). The PCR products were electrophorized on 2%

agarose containing ethedium bromide dye.

C. Hypoxic condition Hep3B cells (Hepatocellular carcinoma) and T24P cells

(Bladder carcinoma) were seeded in 5 ml medium flasks at

different conflencies 24 hours pre-treatment. Cells were either

placed into Aneoropack rectangular jar (Mitsubishi chemical

company Japan) to create a hypoxic conditions within an hour

(1% O2, 20% CO2), or left into normal oxygen concentration.

Incubation lasted for 24 hours before RNA extraction.

D. Specimens Normal, primary tumor samples from the ceacum and the

sigmoid colon and colon, and their corresponding liver

metastasis were obtained fresh from surgery from eight patients,

and immediately transferred snap frozen in liquid nitrogen, and

stored at -80 °C for later RNA extraction. Histological grading

was performed on the biopsies by two pathologists who were

unaware of our experimental design. Low grade bladder

carcinomas used in this study are of grade 1, while those of high

grade are of grade 3, according to modern grading classification

of bladder cancer (Epstein et al, 1998). All are classified as

transitional cell carcinomas of the bladder.

III. Results and discussion The mechanisms by which the growing tumor tissue

recruits new blood vessels has been the subject of intense

investigations over the last few years as the acquisition of

a functional blood supply seems to be rate-limiting for the

ability of a tumor to grow beyond a certain size and to

metastasize to other sites. High proliferating tumors

frequently outstrip their vascular supply leading to a tumor

microenvironment characterized by low oxygen tension,

low glucose levels, and an acidic pH (Folkman, 1992; Ellis

and Fidler, 1996; Hanahan and Folkman, 1996). Hypoxia

is a common feature of solid tumor growth. Reduced pO2

levels have been found in the majority of human tumors

analyzed compared with normal tissue of the

corresponding organ (Brown and Giaccia, 1998; Vaupel et

al, 1989). A wide range of genes known to be involved in

adaptive mechanisms to hypoxia, such as those coding for

angiogenic growth factors, enzymes of glucose

metabolism, and pH regulation, have classically been

associated with tumors. (Semenza, 1998).

Based on this reasoning we studied if VG5Q is a

responsive gene to hypoxic stress. Hepatocelluar (Hep3B)

and bladder carcinoma (T24P) cell lines were exposed to

hypoxic stress under different culture confluences. As

shown in (Figure 1) hypoxic stress does not affect the

expression level of VG5Q mRNA in both cell lines tested

even at different confluences. The integrity of the RNA

samples was verified by performing a PCR for GADPH

housekeeping gene which showed no differences between

samples (data not shown). These negative results could

indicate that VG5Q promoter does not contain consensus

sequence to specific transcription factors involved in

hypoxic stress response. However, possibilities of other

types of regulation are still possible namely protein

stability, activity and secretion.


175

Figure 1. The effect of hypoxia on the expression level of VG5Q mRNA in Hep3B and T24P cell lines seeded at different

confluences: Hep3B and T24P cells were cultured in normal medium conditions for 24 hours at different confluences before hypoxic

manipulation. Shown are RT- PCR products for VG5Qin Hep3B cells (1-4), and T24P cells (5-8). C= PCR blank. 1, 2, 5, 6 (Hep3B and

T24P cultured at low confluences and grow in normal (1, 6) and hypoxic (2, 7) conditions respectively. 3, 4 7, 8 (Hep3B and T24P

cultured at high confluences and grow in normal (4, 7) and hypoxic (5, 8) conditions respectively. Hypoxic manipulation lasted for 24

hours.

Colorectal cancer is one of the most common types

of cancer in both men and women. About 6 per cent of the

populations in Western countries develop bowel cancer at

some time during their lives, making this the second

commonest cause of cancer-related death. Approximately

50% of patients diagnosed with colorectal cancer die

within 5 years from diagnosis. Prevention and early

detection of colorectal cancer will improve the patients’

chance of survival dramatically. Altogether, new models

based on a deeper molecular understanding of the disease

are required to improve screening, diagnosis, treatment,

and, ultimately, survival (Bertario et al, 1999).

The clinical value of angiogenesis-related factors as

a tumor marker is well established (Sund et al, 2005;

Zlobec et al, 2005). In our present study, we explored the

status of VG5Q expression in normal versus neoplastic

tissues. So we next checked if VG5Q is differentially

expressed in normal versus cancer tissues taken from the

same patient in colorectal cancer. VG5Q expression levels

were assessed by semi-quantitative reverse transcriptase

polymerase chain reaction. Samples of colorectal cancers

(primary growth) and cancer that metastasize to the liver

(secondary growth), and their normal counterpart tissue

taken adjacent to cancer primary site from the same patient

were analyzed for VG5Q expression. Results show that

VG5Q mRNA is upregulated in primary colorectal cancer

relative to the normal in seven out of eight samples

(87.5%) (Figure 2a, b). The status of VG5Q expression in

primary tumors does not correlate with its expression in

liver metastasic tumors. The level of VG5Q expression in

primary tumor is also upregulated in (75%) of the cases

when compared to their corresponding liver metastasis.

(Figure 2a, b).

No consistent relationship in the expression level of

VG5Q could be deduced when comparing normal

colorectal samples to their liver metastasis colorectal

tumors. (Figure 2a, b).

A number of disparities between the characteristics of

primary tumor tissue and that of metastatic disease have

been described suggesting that metastatic tumors are

biologically distinct from the primary tumors from which

they arose (Agui et al, 2002). Although angiogenesis is

needed to sustain growth of primary and metastatic

lesions, comparison of microvessel density between

primary colorectal cancers and their liver metastases

revealed that angiogenesis scores were significantly lower

in metastatic lesions compared with their primary tumors

(Mooteri et al, 1996). Moreover, the level of VEGF

expression may be site specific in patients with metastatic

disease, with decreased expression noted in liver

metastases relative to primary tumors and abdominal

metastases (Berney et al, 1998; Cascinu et al, 2000).

Similar results were obtained for VEGFR2, where

decreased VEGFR-2 expression was documented in

hepatic metastasis compared to primary colon tumors.

This could explain why, in our case, the level of VG5Q

expression in primary colorectal carcinomas is elevated

when compared to their corresponding liver metastases. It

was reported that the primary tumor produces a potent

antiangiogenic factor, which prevented vascularization and

thereby outgrowth of metastasis (O’Reilly et al, 1994;

Sckell et al, 1998). The suppression of secondary tumor

growth by its primary tumor via inhibition of angiogenesis

is a widely accepted phenomenom not only in animal

models, but also in human cancer patients (Peeters et al,

2004). Thus in our case we speculate that endogenous

inhibitor could be secreted from primary colorectal tumor

to suppress the expression of VG5Q angiogenic factor and

others in its liver metastatic tumor.

We also checked if VG5Q mRNA expression is

elevated in bladder carcinomas and associated with tumor

grade. Bladder cancer is the fourth most common

malignancy in men, and the eighth most common cause of

death from cancer. More than 90% of bladder tumors are

urothelial carcinomas. At the time of initial diagnosis,

approximately 80% of urothelial carcinomas are confined

to the epithelium (pTa, CIS) or lamina propria (pT1),

whereas the remaining 20% invade the muscularis propria

(pT2, pT3, pT4). Our finding that VG5Q expression is

more abundant in low grade bladder carcinoma. pTa

tumors are the commonest type of primary bladder tumor.

These tumors rarely progress but recur in more than 50%

of cases. Because most of these tumors show VG5Q

overexpression, the detection of such changes may provide

an accurate additional means of follow-up and

identification of tumor recurrences. This could be

especially useful for low-grade lesions, which are difficult

to detect by urine cytology and which harbor VG5Q


176

overexpression in all of cases tested as shown in (Figure

3).

Figure 2. VG5Q transcript is differentially expressed in primary colorectal carcinomas when compared to their normal and

corresponding liver metastasis. Normal, primary tumor and their corresponding liver metastasis biopsies from the ceacum and the

sigmoid colon (A) and colon (B), were obtained fresh from surgery, and immediately transferred snap frozen in liquid nitrogen, and

stored at -80 °C for later RNA extraction. RNA extraction and subsequent RT-PCR analysis for VG5Q was performed as described in

‘materials and methods’. Shown is the PCR product of VG5Q in 6 patients of sigmoid colon (A P1-P4), and caecum (A P5-P6). 1-

Primary cancer, 2-corresponding liver metastasis, 3-Normal. (B)-The expression level of VG5Q in two other patients (Patient 1, 2) of

colon carcinomas 1- Normal, 2- Primary cancer, 3- corresponding liver metastasis. M= 100 Bp molecular weight marker. The PCR

products were electrophorized on 2% agarose containing ethedium bromide dye.

Figure 3. VG5Q transcript is elevated

in bladder carcinomas when

compared to normal bladder with a

more pronounced expression in low

grade carcinomas. Total RNA from

normal, low grade bladder carcinomas

(grade 1), high grade bladder

carcinomas (grade 3) biopsies were

obtained and handled as described and

subjected to RT-PCR analysis for

VG5Q. Shown is the PCR product for

VG5Q in 4 normal specimens (A, 1-4),

7 low grade carcinomas (A, 5-11), and

9 high grade carcinomas (B). C is a

PCR blank and M=100Bp molecular

weight marker.


177

To the best of our knowledge, this is the first report

that studied pattern of VG5Q expression in normal,

primary cancer, and secondary cancer growth, in

colorectal cancers, and studied its expression in normal

bladder and bladder cancers at different grades. Future

studies are required to further elucidate the biological

function of VG5Q, especially its role in the tumorigenic

process, and to evaluate its diagnostic and prognostic

value in larger number of specimens and different tumor

types.

Acknowledgments We are very grateful to Dr. Offer Gofrit (Hadassah

medical hospital) for providing us with the patient samples

used to perform this study.

This work was supported by funds of DFG (Deutsche

Forschungs gemeinschaft) SA 7772/6-1 and is gratefully

acknowledged.

References Agui T, McConkey DJ, Tanigawa N (2002) Comparative study

of various biological parameters, including expression of

survivin, between primary and metastatic human colonic

adenocarcinomas. Anticancer Res 22, 1769-76.

Berney CR, Yang JL, Fisher RJ (1998) Vascular endothelial

growth factor expression is reduced in liver metastasis from

colorectal cancer and correlates with urokinase-type

plasminogen activator. Anticancer Res 18, 973-77.

Bertario L, Russo A, Sala P, Eboli M, Radice P, Presciuttini S,

Andreola S, Rodriguez-Bigas MA, Pizzetti P, Spinelli P

(1999) Survival of patients with hereditary colorectal cancer:

Comparison of hnpcc and colorectal cancer in fap patients

with sporadic colorectal cancer. Int J Cancer 80, 183-87.

Brown JM, Giaccia AJ (1998) The unique physiology of solid

tumors: opportunities (and problems) for cancer therapy.

Cancer Res 58, 1408-16.

Carmeliet P (2005) Angiogenesis in life, disease and medicine.

Nature 438, 932-36.

Carmeliet P, Jian PK (2000) Angiogenesis in cancer and other

diseases. Nature 407, 249-57.

Cascinu S, Graziano F, Catalano V, Staccioli MP, Barni S,

Giordani P, Rossi MC, Baldelli AM, Muretto P, Valenti A,

Catalano G (2000) Differences of vascular endothelial

growth factor (VEGF) expression between liver and

abdominal metastases from colon cancer. Implications for the

treatment with VEGF inhibitors. Clin Exp Metastasis 18,

651-55.

Ellis LM, Fidler IJ (1996) Angiogenesis and metastasis. Eur J

Cancer 32A, 2451-60.

Epstein JI, Amin MB' Reuter VR (1998) The world health

organization/International society of urological pathology

consensus classification of urothelial (transitional cell)

neoplasms of the urinary bladder. Bladder consensus

conference committee. Am J Surg Pathol 22, 1435-48.

Folkman J (1992) The role of angiogenesis in tumor growth.

Semin Cancer Biol 3, 65-71.

Hanahan D, Folkman J (1996) Pattern and emerging mechanisms

of the angiogenic switch during tumorigenesis. Cell 86, 353-

64.

Mooteri S, Rubin D, Leurgans S, Jakate S, Drab E, Saclarides T

(1996) Tumor angiogenesis in primary and metastatic

colorectal cancers. Dis Colon Rectum 10, 1073-1080.

O'Reilly MS, Holmgren L, Shing Y, Chen C, Rosenthal RA,

Moses M, Lane WS, Cao Y, Sage EH, Folkman J (1994)

Engiostatin: a novel angiogenesis inhibitor that mediates the

suppression of metastasis by a Lewis lung carcinoma. Cell

79, 315-28.

Peeters CF, Westphal JR, de Waal RM, Ruiter DJ, Wobbes T,

Ruers TJ (2004) Vascular density in colorectal liver

metastasis increases after removal of the primary tumor in

human cancer patients. Int J Cancer 112, 554-59.

Sckell A, Safabakhsh N, Dellian M, Jian RK (1998) Primary

tumor size- dependent inhibition of angiogenesis at a

secondary site: an intravital microscopic study in mice.

Cancer Res 58, 5866-9.

Semenza GL (1998) Hypoxia inducible factor: master regulator

of O2 homeostasis. Curr Opin Genet Dev 8, 588-94.

Sund M, Zeisberg M, Kalluri R (2005) Endogenous stimulators

and inhibitors of angiogenesis in gastrointestinal cancers:

basic science to clinical application. Gastroenterology 129,

20761-91.

Tian XL, Kadaba R, You SA, Liu M, Timur AA, Yang L, Chen

Q, Szafranski P, Rao S, Wu L, Housman DE, DiCorleto PE,

Driscoll DJ, Borrow J, Wang Q (2004) Identification of an

angiogenic factor that when mutated causes susceptibility to

Klippel-Trenaunay syndrome. Nature 427:640-45.

Vaupel P, Kallinowski F, Okunieff P (1989) Blood flow, oxygen

and nutrient supply, and metabolic microenvironment of

human tumors: a review. Cancer Res 49, 6449-65.

Zlobec I, Steele R, Compton CC (2005) VEGF as a predictive

marker of rectal tumor response to preoperative radiotherapy.

Cancer 104, 2517-21.


178


179


Title-loss of !catenin is an independent prognostic

factor in ovarian carcinomas: A multivariate

analysis Research Article

Cristina Faleiro-Rodrigues1,*, Isabel Macedo-Pinto1, Deolinda Pereira2 1Department of Anatomy and Pathology 2Department of Medical Oncology, Portuguese Institute of Oncology of Francisco Gentil, Centro Regional do Norte, Porto,

Portugal

__________________________________________________________________________________ *Correspondence: Faleiro-Rodrigues C., Instituto Português de Oncologia Francisco Gentil, Centro Regional do Norte, Departamento

de Anatomia Patológica, Rua Dr. António Bernardino de Almeida4200-072 Porto, Portugal; Telephone: +351-22-5084000 Ext 1002;

Fax +351-22-5084001; e-mail: [email protected] Key words: ovarian cancer, cell adhesion, epithelial cadherin, !-catenin, immunohistochemistry

Abbreviations: avidin-biotin peroxidase, (ABC); E-cadherin catenin unit, (ECCU); Epithelial cadherin, (E-cadherin); International

Federation of Gynaecology and Obstetrics system, (FIGO); Overall survival, (OS); World Health Organization, (WHO)

Received: 10 March 2006; Revised: 26 April 2006

Accepted: 16 May 2006; electronically published: July 2006

Summary In ovarian carcinomas, numerous studies have shown consistent prognostic significance of FIGO stage and residual

tumour as independent prognostic factors. However, these prognostic factors alone cannot accurately predict

disease outcome since a considerable degree of heterogeneity remains within the various subgroups limiting the

predictive value of these factors. Therefore, the identification of new molecular markers that may possibly

distinguish patients at a higher risk is of great importance. In two previous studies, the individual loss of E-cadherin

and the individual loss of !-catenin were important prognostic factors of poorer overall survival in patients with

ovarian carcinomas. Purpose of the present study was to re-analyse the immunohistochemical expression of E-

cadherin and !-catenin in 104 patients with ovarian carcinomas, and evaluate whether these two proteins continue

to be important independent prognostic factors when assessed together in a multivariate Cox´s proportional hazard

regression analysis. Results In the multivariate analysis, the most important independent prognostic factors of

poorer overall survival were loss of !-catenin expression ([HR], 5.79, 95% CI, 2.38 to 14.10; P=0.0001), FIGO stage

IV ([HR], 7.19, 95% CI, 1.02 to 50.8; P=0.04) and residual tumour ([HR], 6.78, 95% CI, 1.41 to 32.56; P=0.034).

Conclusion The loss of !-catenin expression is a stronger prognostic factor than E-cadherin. The findings in the

present study and previously reported data suggest that !-catenin is a significant prognostic indicator in patients

with epithelial ovarian cancer, however, these results should be supported by more and larger studies.

I. Introduction In ovarian carcinomas, numerous studies have shown

consistent prognostic significance of FIGO tumour stage

and size of residual tumour as independent prognostic

factors (Rubin et al, 2003). However, these prognostic

factors alone cannot accurately predict disease outcome

since a considerable degree of heterogeneity remains

within the various subgroups limiting the predictive value

of these factors. Therefore, the identification of new

molecular markers that may possibly distinguish patients

at a higher risk is of great importance. Epithelial cadherin

(E-cadherin) is a calcium-dependent cell adhesion

molecule which plays a key role in cell-cell epithelial

adhesion and epithelial tissue integrity. The intracellular

domain of E-cadherin is found in a complex linked with

the catenins ("-and !-). The association of catenins to

cadherins is a key step in the function of intact adhesion

complexes. The catenins link the cadherin molecules to the

cytoskeleton and mediate signal transduction mechanisms

that regulate cell adhesion, growth and differentiation

(Frixen et al, 1991; Tsukita et al, 1992; Kemler, 1993;

Hinck et al, 1994). Detachment of tumour cells from the

primary lesion is considered a main step in the process of

invasion and metastases. Increasing evidence points to a

role for E-cadherin and the catenins in cancer progression

since the loss or reduced expression of E-cadherin and !-

Faleiro-Rodrigues et al: Loss of ! catenin expression in primary ovarian carcinomas

180

catenin correlates with invasive behaviour, increased

lymph node metastasis and poor outcome in patients with

malignant melanoma and gastric carcinomas (Jawhari et

al, 1997; Ramesh et al, 1999; Kageshita et al, 2001;

Tanaka et al, 2002). In two previous individual studies, a

significant correlation between poor overall survival and

the loss of E-cadherin and the loss of !-catenin was

observed in patients with ovarian carcinomas. The loss of

E-cadherin and !-catenin immunoexpression was also

shown to be independent predictors of poorer survival in a

multivariate analysis (Faleiro-Rodrigues et al 2004a, b).

This study represents a re-analyse of previously published

data with the purpose of determining whether these two

proteins continue to be important independent prognostic

factors when assessed together in a multivariate Cox‚s

proportional hazard regression analysis.

II. Material and Methods Routinely formalin-fixed and paraffin-embedded tissue

samples from 104 cases of primary ovarian carcinomas were

retrieved from the Department of Pathology at the Portuguese

Institute of Oncology of Francisco Gentil, Porto, from January

1995 to December 1999. The mean age at the time of diagnosis

was 56 years (range, 21 to 89 years). None of these patients had

undergone neoadjuvant chemotherapy prior to surgery. All tissue

specimens were reviewed and re-evaluated by an experienced

gynaecological pathologist. Histological classification was

performed according to the World Health Organization (WHO)

standards. The grading and staging of the tumours were assigned

according to the International Federation of Gynaecology and

Obstetrics system (FIGO). The mean overall survival duration of

the patients was 35 months. At the end of the follow-up period,

65 (62%) patients were without evidence of disease, 35 (34%)

patients had died of disease, and 4 (4%) patients were lost for

follow up.

A. Tissue sections All the tissue sections (stained by haematoxylin and eosin)

from each case were observed. Areas of necrosis or deterioration

of tissue morphology were avoided. The pathologist selected the

best tumour section representing well preserved tissue

architecture and cell morphology with approximately 2.0 x 1.0

cm.

B. Immunohistochemical staining Archival tissue was fixed in 10% formalin and 3 µm

sections were used for both histological and

immunohistochemical studies. Immunohistochemistry was

performed in all cases using the avidin-biotin peroxidase (ABC)

complex with an additional step for microwave antigen retrieval

as described (Faleiro-Rodrigues et al, 2004b). The following

monoclonal antibodies were used: E-cadherin (C20820), and !-

catenin (C19220) (Transduction Laboratories, Lexington, UK).

To ensure accurate and reproducible staining, normal skin

epithelium was used as a positive control.

Staining of E-cadherin and !-catenin was localized on the

cell membrane of epithelial cells, particularly at areas of cell-to-

cell contact. Normal skin epithelium without the primary

antibody was used as a negative control.

C. Evaluation of E-cadherin and !-catenin

immunostaining Membranous immunoreactivity of the catenins was

assessed by light microscopy by two independent observers,

without previous knowledge of the patients clinicopathological

details. E-cadherin and !-catenin immunoexpression in the

tumours was scored semi-quantitatively on a scale of 0 to 3

(0=complete absence of expression, 1=10%, 2 >10 and = 50%, 3

>50%). For all the association analyses, the subdivision into

negative (0 scale) and positive expression (1-3 scale) was used.

D. Statistical analysis The statistical software used was the Statistical Package for

the Social Sciences (SPSS version 8.0, SPSS, Chicago). Clinical

data was obtained from the Cancer Registry Records of the

patients and evaluated by a Medical Oncologist. Overall survival

(OS) was defined as the time from diagnosis to death or last

clinical control date, and used as a measure of prognosis.

Univariate survival curves were estimated using the Kaplan-

Meier method and compared using the Log-rank or the Breslow

test. Multivariate analysis was performed using the Cox´s

proportional hazards regression model with overall survival as

the outcome measure. Forward stepwise procedure was used to

select the independent variables in the multivariate analysis.

Forward selection, allows variables to be considered one at a

time for entry into the model. After a variable is added to the

model, all variables already in the model are examined for

removal. The algorithm stops when no more variables meet entry

or removal criteria. A value of P<0.05 was regarded as

significant.

III. Results The present series consisted of 104 carcinomas that

were classified into the following histological types, 56

serous carcinomas, 22 mucinous carcinomas, 16 clear cell

carcinomas, 8 endometrioid and 2 transitional cell

carcinomas. These carcinomas were graded into 26 well-

differentiated, 27 moderately differentiated and 51 poorly

differentiated tumours. In this series, 31 cases were

diagnosed with FIGO stage I tumours, 7 in FIGO stage II,

47 in FIGO stage III and 19 in FIGO stage IV. The

clinicopathological parameters studied were FIGO staging,

histological type, tumour differentiation, peritoneal

metastasis, and residual tumour after surgery, the

appearance of the ovarian capsule, peritoneal cytology and

lymphatic/vascular invasion (previously described in

Faleiro-Rodrigues et al 2004a).

A. Immunoreactivity of E-cadherin and

!-catenin in carcinoma tissue Negative E-cadherin expression was observed in 7

(7%) malignant tumours, and positive in 97 (93%).

Negative !-catenin expression was observed in 15 (14%)

malignant tumours, and positive in 89 (86%).

B. Relationship between E-cadherin and

!-catenin expression in carcinoma tissue In the 15 carcinomas demonstrating negative

expression for !-catenin, 3 carcinomas showed negative

expression for E-cadherin, and 12 carcinomas showed

positive expression for E-cadherin (Table 1).

C. Relationship between the expression of

E-cadherin and !-catenin and patient overall

survival


181

In the univariate survival analysis, patients whose

carcinoma tissue demonstrated negative E-cadherin

expression had a statistically significant decreased 5-year

overall survival rate compared with patients showing

positive expression (29% versus 66%, P=0.006), (Faleiro-

Rodrigues et al, 2004a). Patients whose carcinoma tissue

demonstrated negative !-catenin expression had a

statistically significant decreased 5-year overall survival

rate compared with patients showing positive expression

(44% versus 66%, P=0.022), (Faleiro-Rodrigues et al,

2004b).

The parameters that had a significant impact on

overall survival as E-cadherin (P=0.006), !-catenin

(P=0.022), FIGO stage (P!0.0001), peritoneal metastasis

(P!0.0001), and post-operative residual tumour

(P!0.0001), peritoneal cytology (P!0.0001) and

lymphatic/vascular invasion (P=0.008), were then

reviewed by a multivariate analysis (Cox´s proportional

hazards regression model, Table 2). Negative expression

of !-catenin (P=0.0001); (Figure 1), FIGO stage IV

(P=0.04) and residual postoperative tumour (P=0.01) were

shown to associate significantly with poor patient

prognosis.

IV. Discussion The cause of epithelial ovarian carcinoma is

unknown and diagnosis is retarded by the lack of

symptoms in early stage disease. Consequently, the poor

overall survival and morbidity associated with epithelial

ovarian cancer deaths results from the detection of the

disease in advanced tumour stages with widespread

metastatic disease at the time of diagnosis (Ozols et al,

2000). To date, the molecular mechanisms that allow

ovarian cancer cells to detach from the primary tumour

and consequently interact with the mesothelium are not

fully characterized.

Cell adhesion molecules may play an important role

in epithelial ovarian carcinogenesis, since cell-to-cell

adhesion plays a critical role in a wide variety of

biological processes including embryogenesis,

maintenance of cell polarity, cell growth, and cell

differentiation (Skubitz, 2002). The loss of cell adhesion

molecules may lead to changes in cellular adhesion and to

increased motility, processes that contribute to the

invasive and/or metastatic potential of cells (Vleiminckx et

al, 1991; Birchmeier and Behrens, 1993; Mareel et al,

1994; Van Aken et al, 2001).

E-cadherin has been identified as an important

transmembrane molecule involved in the adhesion of

epithelial cells at adherens junctions. Adherens junctions

are organized around transmembrane proteins of the

cadherin family. While the extracellular domain of the E-

cadherin molecule interacts with that of an opposing E-

cadherin on a neighbouring cell, the intracellular

cytoplasmic domain of E-cadherin associates with ß-

catenin, which in turn complexes with "-catenin mediating

the connection of E-cadherin to the cytoskeleton (Tsukita

et al, 1992). The complex of E-cadherin and the

Table 1. Relationship between E-cadherin and !-catenin expression in ovarian carcinomas

Immunoexpression Nº !-catenin

Negative Positive

E-cadherin

Negative 7 3 4

Positive 97 12 85

Total 104 15 89

Table 2. Multivariate analysis for overall survival

Covariate Hazard ratio (95% CI) P value

I 1

II 5.58 (0.47-65.6) 0.1700

III 2.99 (0.47-19.1) 0.2400

IV 7.19 (1.02-50.8) 0.0400

Residual tumour

(-) 1

(+) 6.78 (1.41-32.56) 0.0100

!-catenin

(+) 1

(-) 5.79 (2.38-14.1) 0.0001


182

Figure 1. Immunoreactivity of !-catenin (A) Negative expression, (B) Mucinous carcinoma showing positive ß-catenin expression.

catenins is a functional unit, which is termed here as the E-

cadherin-catenin unit (ECCU). Binding to catenins is

important for E-cadherin function, rendering the catenins

regulatory molecules of E-cadherin. Thus, alterations in E-

cadherin or the catenins may lead to loss of cell-cell

adhesion, resulting in tumour aggressiveness and

invasiveness in neoplastic disease (Ozawa et al, 1990;

Frixen et al, 1991; Mareel et al, 1994).

In two previous individual studies, the significance

of E-cadherin and the catenins ", !- and #-, as predictors

of poorer survival in patients with ovarian carcinomas was

assessed. The first study showed that negative E-cadherin

immunoexpression significantly predicted a poorer overall

survival, and was an independent prognostic factor in the

multivariate analyses (Faleiro-Rodrigues et al 2004a). In

the second study, although negative immunoexpression of

"-catenin and #-catenin was observed, only negative !-

catenin expression was associated with patient poorer

overall survival in the univariate analyses. In the

multivariate analysis, !-catenin immunoexpression and

residual tumour were shown to be independent prognostic

factors for survival (Faleiro-Rodrigues et al 2004b).

In the present study, when E-cadherin and !-catenin

were assessed together in a Cox´s multivariate regression

analysis to determine whether the immunoexpression of

these two proteins continued to be independent prognostic

factors, only !-catenin continued to be an independent

prognostic factor of poor survival. The loss of !-catenin

expression, FIGO stage IV and residual tumour, when

considered with parameters that had a significant impact

on overall survival as peritoneal metastasis, peritoneal

cytology, lymphatic/vascular invasion and E-cadherin

expression, were shown to be the strongest independent

predictors of poor survival. The results of this study

suggest that when !-catenin and E-cadherin are assessed in

a multivariate analysis, the loss of !-catenin proves to be a

more important prognostic marker than the loss of E-

cadherin in patients with ovarian carcinomas.

A study by the group of Akimoto et al, showed that

the expression of E-cadherin in murine adenocarcinomas

correlated well with the expression of !-catenin. They also

showed that reduced expression of !-catenin in these

tumours correlated with enhanced metastasis formation

(Akimoto et al, 1999). Whether !-catenin alone could have

affected the propensity of these tumour cells to metastasise

is unclear. However, some recent studies show an

independent role of the catenins in tumour invasion and

metastases (Kawanishi et al, 1995; Vermeulen et al, 1995).

Studies on the molecular organization of the ECCU

using recombinant proteins have demonstrated !-catenin

to play a central role in the formation of the E-cadherin

complex (Oyama et al, 1994; Kawanishi et al, 1995;

Vermeulen et al, 1995; Harington and Syrigos, 2000). In

general, adhesion between normal epithelial cells is strong

and stable. For tumour cells to dissociate, invade and

metastasize, cell-to-cell associations must be disrupted. In

our series of ovarian carcinomas, despite the small number

of tumours showing loss of expression for !-catenin the

observation that a) 15 carcinomas demonstrated negative

expression for !-catenin, of which 3 were negative and 12

were positive for E-cadherin, respectively, and b) !-

catenin expression was shown to be an independent

prognostic factor in a previous (Faleiro-Rodrigues et al

2004b) and in the present study, reinforces the viewpoint

that !-catenin is a crucial and indispensable component in

the formation of the ECCU, and that loss of !-catenin

alone may be sufficient to disassemble the adherent

junction, leading to loss of intercellular adhesion. Thus,

loss of !-catenin expression may be an important step in

the development of a malignant tumour, by this approach,

enable the dissociation of cells from the primary tumour,

and thus possibly contribute to tumour cell invasion and

tumour peritoneal implantation in ovarian cancer patients.

Although the prognostic value of !-catenin needs to

be supported by more studies and a larger number of

patients, this retrospective study, suggests that the

immunohistochemical assessment of !-catenin into

negative versus positive expression on primary ovarian

carcinomas may prove to be a useful marker for selecting


183

a small group of patients with a high risk of suffering an

unfavourable clinical outcome. Whether this information

can be used to stratify patients for therapeutic strategies

also needs to be explored in future clinical studies.

In several carcinomas, loss of !-catenin expression

by immunohistochemistry has been associated with

malignant transformation as increased invasiveness,

disease progression, and poor prognosis (Takayama et al,

1996; Jawhari et al, 1997; Muzio et al, 1999; Ramesh et al,

1999; Garcia del Muro et al, 2000; Kageshita et al, 2001;

Tanaka et al, 2002). However, the molecular mechanisms

that bring about the loss of !-catenin in these tumours

have not been characterized and yet to be investigated.

The causal mechanism for the loss of !-catenin protein

expression in our series of ovarian carcinomas is not clear.

Several mechanisms may impair !-catenin from being

expressed, such as hypermethylation of the !-catenin gene

(CTNNB1) promoter, CTNNB1 mutations and deletions

(Ebert et al, 2003; Ueda et al, 2001). It is now of interest

to evaluate further the molecular mechanisms that underlie

the observed loss of !-catenin observed in the present

study. Future investigations on the regulation of the

expression of !-catenin may elucidate possible

mechanisms resulting in the loss of this protein.

Nevertheless, irrespective of the mechanism that impairs

the expression of !-catenin, based on the above results, it

seems that tumour cells may become increasingly invasive

and show an aggressive cellular phenotype upon the loss

of !-catenin, which may be an important step in the

progression of ovarian carcinomas.

In conclusion, these findings suggest that !-catenin

immunoexpression may assist in the identification of a

group of patients who run a higher risk of an unfavourable

disease outcome, and may be a useful prognostic marker

for the clinical assessment of epithelial ovarian cancer

complementary to other established prognostic factors as

FIGO tumour stage and residual tumour. It should be

noted that these results need be supported by more studies

and a larger number of patients.

Acknowledgements This project was supported by a Ph.D. grant PRAXIS

XXI/BD/9615/96 from the Foundation of Science and

Technology (FCT).

References Akimoto T, Kawabe S, Grothey A, Milas L (1999) Low E-

cadherin and !-catenin expression correlates with increased

spontaneous and artificial lung metastases of murine

carcinomas. Clin Exp Metastasis 17, 171-176.

Birchmeier W, Behrens J (1993) Cadherin expression in

carcinomas: role in the formation of cell junctions and the

prevention of invasiveness. Biochim Biophys Acta 1198,

11-26.

Ebert MP, Yu J, Hoffmann J, Rocco A, Rocken C, Kahmann S,

Muller O, Korc M, Sung JJ, Malfertheiner P (2003) Loss of

!-catenin expression in metastatic gastric cancer. J Clin

Oncol 21, 1708-1714.

Faleiro-Rodrigues C, Macedo-Pinto I, Pereira D, Lopes CS

(2004a) Prognostic value of E-cadherin immunoexpression

in patients with primary ovarian carcinomas. Ann Oncol 15,

1532-1542.

Faleiro-Rodrigues C, Macedo-Pinto I, Pereira D, Lopes CS

(2004b) Loss of !-catenin, is associated with poor survival in

ovarian carcinomas. Int J Gynecol Pathol 23, 337-346.

Frixen UH, Behrens J, Sachs M, Eberle G, Voss B, Warda A,

Lochner D, Birchmeier W (1991) Ecadherin mediated cell-

cell adhesion prevents invasiveness of human carcinoma

cells. J Cell Biol 113, 173-185.

Garcia del Muro X, Torregrosa A, Munoz J, Castellsague X,

Condom E, Vigues F, Arance A, Fabra A, Germa JR (2000)

Prognostic value of expression of E-cadherin and !-catenin

in bladder cancer. Eur J Cancer 36, 357-362.

Harington KJ, Syrigos KN (2000) The role of E-cadherin-catenin

complex: more than an intercellular glue? Ann Surg Oncol

7, 783-788.

Hinck L, Näthke IS, Papkoff J, Nelson WJ (1994) Dynamics of

cadherin/catenin complex formation: novel protein

interactions and pathways of complex assembly. J Cell Biol

125, 13271340.

Jawhari A, Jordan S, Poole S, Browne P, Pignatelli M, Farthing

MJ (1997) Abnormal immunoreactivity of the E-cadherin-

catenin complex in gastric carcinoma: relationship with

patient survival. Gastroenterology 112, 46-54.

Kageshita T, Hamby CV, Ishihara T, Matsumoto K, Saida T,

Ono T (2001) Loss of !-catenin expression associated with

disease progression in malignant melanoma. Br J Dermatol

145, 210216.

Kawanishi J, Kato J, Sasaki K, FujiisS, Watanabe N, Niitsu Y

(1995) Loss of E-cadherin dependent cell-cell adhesion due

to mutation of the !-catenin gene in a human cancer cell line

HSC-39. Molecular Cell Biol 15, 1175-1181.

Kemler R (1993) From cadherins to catenins: cytoplasmatic

protein interactions and regulation of cell adhesion. Trends

Genetics 9, 317-321.

Lo Muzio LL, Staibano S, Pannone G, Grieco M, Mignogna MD,

Cerrato A, Testa NF, De Rosa G (1999) ! and #-catenin

expression in oral squamous cell carcinoma. Anticancer Res

19, 3817-3826.

Mareel M, Bracke M, Van Roy F (1994) Invasion promoter

versus invasion suppressor molecules: the paradigm of E-

cadherin. Mol Biol Rep 19, 45-67.

Oyama T, Kanai Y, Ochiai A, Akimoto S, Oda T, Yanigihara K,

Nagafuchi A, Tsukita S, Shibamoto S, Ito F et al (1994) A

truncated !-catenin disrupts the interaction between E-

Cadherin and "-catenin: A cause of loss of intercellular

adhesiveness in human cancer cell lines. Cancer Res 54,

6282-6287.

Ozawa M, Ringwald M, Kemler R (1990) Uvomorulin-catenin

complex formation is regulated by aspecific domain in the

cytoplasmic region of the cell adhesion molecule. Proc Natl

Acad Sci USA 87, 4246-4250.

Ozols RF, Rubin SC, Thomas GM, Robboy SJ (2000) Epithelial

ovarian cancer. In Hoskins W J, Perez CA, Young RC (eds.):

Principles and Practice of Gynecologic Oncology, 3rd

edition. Philadelphia: PA: Lippincott Williams & Wilkins;

981-1058.

Ramesh S, Nash J, McCulloch PG (1999) Reduction in

membranous expression of !-catenin and increased

cytoplasmic E-cadherin expression predict poor survival in

gastric cancer. Br J Cancer 81, 1392-1397.

Rubin SC, Sabbatini P, Randall ME (2002) Ovarian Cancer. In:

Pazdur R, Coia LR, Hoskins W J,Wagman LD (eds): Cancer

Management: A Multidisciplinary Approach, 3rd edition.

287-307.

Skubitz APN (2002) Adhesion molecules. Cancer Treat Res

107, 305-329.


184

Takayama T, Shiozaki H, Shibamoto S, Oka H, Kimura Y,

Tamura S, Inoue M, Monden T, Ito F, Monden M (1996) !-

catenin expression in human cancers. Am J Pathol 148, 39-

46.

Tanaka M, Kitajima Y, Edakuni G, Sato S, Miyazaki K (2002)

Abnormal expression of E-cadherin and !-catenin may be a

molecular marker of submucosal invasion and lymph node

metastasis in early gastric cancer. Br J Surgery 89, 236-244.

Tsukita S, Tsukita S, Nagafuchi A, Yonemura S (1992)

Molecular linkage between cadherins and actin filaments in

cell-cell adherens junctions. Curr Opin Cell Biol 4, 834-

839.

Ueda M, Gemmill RM, West J, Winn R, Sugita M, Tanaka N,

Ueki M, Drabkin HA (2001) Mutations of the !- and #-

catenin genes are uncommon in human lung, breast, kidney,

cervical and ovarian carcinomas. Br J Cancer 85, 64-68.

Van Aken E, De Wever O, Correia da Rocha AS, Mareel M

(2001) Defective E-cadherin/catenincomplexes in human

cancer. Virchows Archn 439, 725-751.

Vermeulen SJ, Bruyneel EA, Bracke ME, De Bruyne GK,

Vennekens KM, Vleminckx KL, Berx GJ, van Roy FM,

Mareel MM (1995) Transition from the noninvasive to the

invasive phenotype and loss of !-catenin in human colon

cancer cells. Cancer Res 55, 4722-4728.

Vleiminckx K, Vakaet l Jr, Mareel M, Fiers W, Van Roy F

(1991) Genetic manipulation of E-Cadherin expression by

epithelial tumor cells reveals an invasion suppressor role.

Cell 66, 107-119.

Cristina Faleiro-Rodrigues


185


New generations of retroviral vector for safe,

efficient and targeted gene therapy Review Article

Walter H. Günzburg1,2,*, Juraj Hlavaty1, Stanislav Indik1,2, Walter Tabotta1,3,

Ingrid Walter4, Christine Hohenadl3, Eva Maria Brandtner3, Francoise Rouault3,

Matthias Renner3 and Brian Salmons3 1Research Institute for Virology and Biomedicine, University of Veterinary Medicine, Vienna, Austria 2Christian Doppler Laboratory for Gene Therapeutic Vector Development, Vienna, Austria 3Austrianova Biotechnology GmbH, Vienna, Austria 4Institute of Histology, Department of Pathobiology, University of Veterinary Medicine, Vienna, Austria

__________________________________________________________________________________

*Correspondence: Walter H. Günzburg, Research Institute for Virology and Biomedicine, University of Veterinary Medicine, Veterinaerplatz 1, A-1210 Vienna, Austria. Phone +43-1-25077-2301; Fax +43-1-25077-2390; email: [email protected] Key words: retroviral vector, murine leukaemia virus, mouse mammary tumour virus, improvements, promoter conversion vector, reconstituting vector Abbreviations: cytomegalovirus, (CMV); enhanced green fluorescent protein, (eGFP); mouse mammary tumour virus, (MMTV); murine leukaemia virus, (MLV); promoter conversion, (ProCon); Rev responsive element, (RRE); woodchuck posttranscriptional regulatory element, (WPRE)

Received: 1 March 2006; Accepted: 29 May 2006; electronically published: July 2006

Summary

Retroviral vectors were the first virus vectors to be used in gene therapy trials and have proved to be successful for

the treatment of X-linked severe combined immunodeficiency. However, there are safety concerns associated with

the use of retroviral vectors or indeed delivery systems based upon viruses in general. Over the last few years, we

have been developing retroviral vectors with the aim of (i) removing the retroviral promoter in transduced cells (ii)

obtaining limited expression of therapeutic genes in therapeutically relevant cells by the inclusion of targeting

promoters in place of the retroviral promoter (iii) being able to stably produce retroviral vectors carrying toxic

genes from cells. Two of these vector systems, promoter conversion vectors and reconstituting vectors, have been

described in proof of principle studies, but suffered from reduced titres that precluded their effective use in the

clinic. A number of vector optimisation modifications have been made to these vectors, resulting in the successful

improvement of both titre and expression levels such that these vectors are now suitable for use in clinical trials.

The use of such optimised vectors for in vitro and in vivo applications using a number of different genes of interest

will be described. Future successful gene therapy of solid tumours may require the use of replicating vectors. The

application of many of the principles learned from the vector optimisation modifications described above to

replicating MLV and MMTV based vectors will be described along with data demonstrating efficient tissue specific

expression targeting.

I. Introduction Retroviral vectors have delivered some of the first

promising successes in gene therapy, such as the successful gene therapeutic treatment of severe combined immunodeficiency (Cavazzana-Calvo et al, 2000) and yet this success has been bittersweet since it was accompanied by the confirmation that retroviruses also have the potential to play a role in the series of events that culminate in tumorigenesis in humans (Hacein-Bey-Abina et al, 2003a).

The ability to redesign such vectors so that they specifically target therapeutically relevant cells has long been an aim of gene therapists since it was realised early on that this would increase both the efficacy as well as the safety of gene transfer (Salmons and Günzburg, 1993; Weber et al, 2001). Virus vectors can either be modified so that they are preferentially able to infect particular cell types (infection targeting) or so that the gene of interest is expressed only in therapeutically relevant cells (expression targeting). While infection targeting has been shown to be achievable by many groups using a number of different

Günzburg et al: New generations of retroviral vector for safe, efficient and targeted gene therapy

186

strategies, it is invariably associated with drastic reductions in infection and thus gene transfer efficiency (Karavanas et al, 1998). Another means to achieve the targeted production of a therapeutic product is to express it from a tissue specific promoter and there have been many strategies employed to create such expression targeted retroviruses. Over the last decade, we have been developing retroviral vectors that allow expression targeting, but that also replace the virus promoter with the targeting promoter in the infected cell. This is an important feature since (i) the virus promoter often over-rides or inactivates the tissue specific promoter in other types of expression targeted vectors and (ii) it contributes to safety since the virus promoter has the potential to play a role in tumorigenesis (Hacein-Bey-Abina et al, 2003b) and its removal reduces the chances for recombination occurring that might generate a replication competent vector.

II. Promoter conversion vectors based

on murine leukaemia virus Promoter conversion (ProCon) vectors utilise the

characteristics of the natural and reproducible genetic reshuffling that retroviruses must go through during the process of reverse transcription. Retroviruses are RNA

viruses that have to replicate via a DNA. The virus encoded reverse transcriptase that creates the double stranded DNA form of the genome from the single stranded virus genomic RNA. The promoter conversion ProCon vectors that we have been developing utilise the reverse transcriptase mediated genetic reorganisation to replace the virus promoter, which is active in the vector producing (i.e. packaging) cells, with a heterologous promoter in the vector transduced cell. If this heterologous promoter is preferentially expressed in a given cell type, it is expected that expression of the therapeutic gene carried by the vector will be limited to the very same cells (Figure

1). Proof of concept for ProCon vectors has been obtained using murine leukaemia virus (MLV) vectors carrying a variety of nonhomologous promoters, i.e. constitutively active promoters like the cytomegalovirus (CMV) promoter or tissue specific/restrictive promoters like that of mouse mammary tumour virus (Saller et al, 1998) or whey acidic protein (Özturk-Winder et al, 2002; Lipnik et al, 2005). Inducible promoters are also useful in this context since they allow cells transduced with genes encoding proteins that are not compatible with cell growth to be obtained in the absence of the inducer (Mrochen et al, 1997). The ProCon strategy can be applied in principle to all retroviral and lentiviral vectors.

Figure 1. The promoter conversion (ProCon) principle. The U3 region carried in the 3’ LTR of the retroviral vector is removed (except for the inverted repeated required for integration) and replaced with a promoter of choice (shaded box). The vector is then introduced into retroviral vector packaging cells and produces a packageable transcript. Target cells are then transduced with the vector, resulting in reverse transcription of the packaged RNA into a double-stranded proviral DNA. During reverse transcription, the promoter of choice, originally located at the 3’ end of the retroviral genomic transcript is duplicated and one copy placed at the 5’end of the virus. The provirus is then integrated into the host cell genome by the virus enzyme integrase.


187

Although such MCV based ProCon vectors function as expected, the titres of vector obtained are reduced ~100 fold as compared to nonmodified, first generation type MLV vectors. While these titres are still useful in cell culture experiments, they preclude use in the clinic. A second drawback to the use of retroviral vectors based upon MLV, regardless of whether they are of the first generation or ProCon type, is that the level of expression in the infected cell is not always optimal. This depends on the activity of the promoter that drives expression in the particular cell type of therapeutic relevance and can affect both first generation and ProCon vectors. Promoters that are preferentially active only in certain cell types (i.e.tissue specific promoters) are often relatively weak in their ability to drive gene expression. Here we highlight some of the modifications that can be made to vectors to improve both the titres and the efficacy of gene expression in transduced cells. Moreover, a combination of these modifications in a single vector results in high titre vectors that efficiently express the delivered transgene to high levels.

A. Modifications to improve virus titre 1. Inclusion of a strong enhancer in the

plasmid carrying the vector One possible reason for suboptimal titres of vector

produced from packaging cells is that the amount of genomic RNA is limiting. To address this issue, we have introduced a CMV enhancer into the backbone of the vector in both orientations and nearer either to the 5’ or to the 3’ long terminal repeat (LTR) (Figure 2). The insertion of the CMV enhancer reproducibly enhanced vector expression in both human and murine packaging cells two fold and increased the titre of vector produced from these cells by two fold also as measured by the number of genome containing virions in the supernatant of producer cells (determined by real-time RT-PCR) or as by G418 resistant colony formation. This enhancement is obtained regardless of the site and orientation of insertion of the enhancer (Hlavaty et al, 2004a).

2. Inclusion of an extended attachment site

and the AT stretch At the time of construction of the first ProCon

vector, it was generally accepted that the terminal 13bp of the double stranded DNA is necessary and sufficient as a recognition sequence to which the virus encoded integrase binds in order to effect the integration of double stranded MLV DNA into the host cell genome. Recently, it has been shown that a longer sequence is involved and so an additional 23bp has been included in the vector (Figure

2). An AT rich sequence has also been identified that is located just upstream of the polypurine tract that affects the efficiency of reverse transcription (Figure 2). Incorporation of both sequences resulted in a 2-fold increase in titre but no significant improvement in the efficiency of reverse transcription (Hlavaty et al, 2004a).

3. Inclusion of a triple polyadenylation signal In addition to the AAUAAA sequence located 16 to

25bp upstream of the polyadenylation site and a GU rich site 20-30bp downstream of this site, some retroviruses carry an additional polyadenylation signal in the U3 region. As a result of the vector design, any regulatory signals carried in the U3 region are no longer present in the ProCon vector. To ensure that efficient polyadenylation was occurring, three copies of the SV40 early polyadenylation signal were inserted into the 5’ end of the U5 region carried by the 3’LTR, resulting in a 2 fold increase in viral titre (Hlavaty et al, 2004a).

4. Removal of procaryotic sequences from the

vector The original ProCon vectors carry a bacterial origin

of replication to facilitate the recloning of proviruses from infected cells. This was deemed important for proof of principle and further characterisation of ProCon vectors. However it could be shown that removal of these sequences results in a 2 fold improvement in vector virus titres. A further improvement in vector titre was obtained by replacing the gene that confers G418 resistance to infected cells with the puromycin resistance gene (Hlavaty et al, 2004b). This confirms the data obtained by others (Bowtell et al, 1988; Artelt et al, 1991; Byun et al, 1996).

Figure 2. Summary of modifications improving titre and expression. Schematically shown are the modifications undertaken to improve ProCon vectors: (1) replacement of the U3 region in the 5’ LTR with a strong, constitutively active cytomegalovirus (CMV) promoter (2) extension of the inverted repeat (att) recognition site for integrase (3) insertion of three copies of a heterologous polyadenylation site in the U5 region of the 3’LTR (4) insertion of the woodchuck post-transcriptrional regulatory element (WPRE) (5) deletion of the SV40-neomycin resistance cassette (6) deletion of the prokaryotic origin of replication (ori).


188

B. Modifications to improve gene

expression The removal of prokaryotic sequences and the

replacement of the neomycin resistance gene with the puromycin resistance gene not only improved the titres of ProCon vectors but also improved expression of genes carried by these vectors by about two fold (Hlavaty et al, 2004b).

Some retroviruses carry sequences that facilitate the transport of transcripts from the nucleus of infected cells to the cytoplasmic compartment. The classic example of this is the Rev/RRE system of human immunodeficiency virus (HIV). Rev is a virus encoded regulatory factor that binds the Rev Regulatory Element (RRE) present on viral nonspliced, genomic as well as single spliced env coding transcripts and couples them to cell encoded RNA transport proteins such as Crm-1 for efficient export out of the nucleus of infected cells. The woodchuck hepadnavirus also carries a posttranscriptional regulatory element, the WPRE, in its genome (Donello et al, 1998). The WPRE has already been used to improve the transport and thus expression of gene delivered by virus vectors (Zuffrey et al, 1999). In comparison to other candidate RNA transport elements, inclusion of the WPRE element in ProCon vectors resulted in an up to 4 fold increase in expression (Figure 2 and Table 1). Indeed it could be shown that improvement in expression levels can be obtained regardless of the site of introduction of the WPRE in the vector genome (Hlavaty et al, 2005). Nevertheless, it should be noted that we have recently shown the ability of the WPRE to improve gene expression can be both promoter and cell type specific (Klein et al, 2006).

Recently, a high incidence of liver tumours after in

utero application of a third-generation equine infectious anaemia virus vectors carrying the WPRE has been observed (Coutelle et al, 2005) and it remains to be seen if this finding is generally applicable to all vector types and configurations as well as for nonfatal gene transfer.

III. Reconstituting vectors based on

MLV It is difficult to establish stable, quality controllable,

retroviral vector producing cells delivering genes that encode a toxic protein, or proteins that are not compatible with cell growth such as cell cycle inhibitors or pro-apoptotic proteins since these gene products preclude

longterm growth of the vector producing cells. A popular strategy to overcome this difficulty is to create drug inducible vector systems. These are however always to some extent leaky and it is difficult to remove the inducer (often an antibiotic or hormone) from the final vector preparation which may cause problems or raise safety issues.

The reconstituting vector has been created to overcome this problem. Similar to the ProCon system, the principle behind the ReCon system is based on the necessity for the genomic retroviral RNA to undergo reverse transcription in the target infected cell, thereby producing a provirus which then gives rise to therapeutic gene expression (Figure 3). The retroviral vector that is introduced into the producing cell line has two features: (i) it carries the therapeutic gene coding sequences, lacking a promoter, in the opposite orientation to the vector transcription in place of the U3 region at the end of the transcriptional unit, which thus cannot be expressed and (ii) it carries a promoter of choice inserted into the U5 region at the 5’ end, also in the opposite orientation to the vector transcription, which thus cannot drive expression in vector producing cells (Figure 3). The vector genomic RNA, expressed from the classic retroviral promoter, is packaged into virions and infection of target cells with the vector virus can proceed as usual. After infection, the virus genomic RNA is reverse transcribed and generates a double stranded proviral DNA in which the coding sequence of the therapeutic gene is now placed in close proximity to the heterologous promoter thereby creating a functional transcriptional unit. Moreover, there are two copies of the promoter-gene expression cassette, one at each end of the provirus, in the virus infected cell (Figure

3). Proof of principle for the ReCon vector has been obtained using the enhanced green fluorescent protein (eGFP) gene and a number of promoters (Tabotta et al, 2001). Genes encoding toxins such as the diphtheria A toxin are now being tested in the ReCon system.

IV. Mouse Mammary Tumour Virus

as a retroviral vector As mentioned above, the mouse mammary tumour

virus (MMTV) promoter shows specificity in that it is preferentially active in mammary epithelial and tumour cells as well as B-lymphocytes (Günzburg and Salmons, 1992; Zhu and Dudley, 2001). Further MMTV promoter activity is inducible by glucocorticoid hormones

Table 1. Some post-transcriptional regulatory elements that function poorly in ProCon vectors1

Element Source Reference

constitutive transport element (CTE) simian retrovirus type D (SRV-1) Zhao et al, 2000

Retroviral transport element (RTE) endogenous retrovirus VL30 Nappi et 2001; Smulevitch et al, 2005

5’ untranslated transcript region (5’UTR) heat shock protein 70 gene Huez et al, 1998; Vivinus et al, 2005

1Hlavaty et al, 2005


189

Figure 3. The reconstituting (ReCon) vector principle. The U3 region carried in the 3’LTR of the retroviral vector is removed (except for the inverted repeated required for integration) and replaced with a promoterless gene of choice inserted in the opposite transcriptional orientation to that of the vector (shaded box). In addition, a promoter of choice is inserted into the U5 region of the 5’LTR (without deleting U5 sequences), again in the opposite transcriptional orientation to the vector. Thus the promoter and gene of interest are physically separated and are not active in vector producing cells. The vector is then introduced into retroviral vector packaging cells and produces a packageable transcript. Target cells are then transduced with the vector, resulting in reverse transcription of the packaged RNA into a double-stranded proviral DNA. During reverse transcription, the promoter of choice, originally located at the 5’ end of the retroviral genomic transcript is duplicated and one copy placed at the 3’ end of the provirus and the gene of interest is also duplicated and one copy placed at the 5’ end of the provirus. Thus two reconstitute expression cassettes are generated at either end of the provirus, which is then integrated into the host cell genome by the virus enzyme integrase.

(Günzburg and Salmons, 1992; Aurrekoetxea-Hernandez and Buetti, 2004), shows mammary specificity in transgenic mice (Figure 4) and, when it is inserted into a ProCon vector it retains both cell type specificity, at least in transgenice mice, as well as hormone inducibility (Mrochen et al, 1997; Saller et al, 1998). MMTV is thought to be poorly infective in cell culture, though in

vivo it may show infection specificity for murine mammary epithelial cells and other glandular cells as well as for B and T lymphocytes. MMTV would thus make an ideal mammary/B-lymphocyte specific infection and expression targeted vector system. However, the virus is poorly infectious even for mouse mammary gland cells in cell culture and it is reported to be poorly infectious for human cells. This latter observation seemed to be supported by the recent identification of the MMTV receptor as the murine transferrin receptor, since the human form of this receptor appears to be either non-functional (Ross et al, 2002) or only weakly functional (Zhang et al, 2003). Nevertheless, the murine transferrin

receptor is known to be expressed on many cell types in

vivo and so this alone cannot explain apparent infection spectrum of MMTV in vivo. One caveat to the studies involved in the identification of the MMTV receptor is that they were conducted using pseudotyped vectors consisting of an MLV genome carrying the ß-galactosidase gene in an MLV core with the envelope of MMTV. These pseudotyped vectors were generated by transient transfection. It is conceivable that such vectors do not accurately mimic the infection with a wild type MMTV. In addition, only one strain of MMTV envelope was tested in these pseudotyped vectors whereas there are many MMTV variants in mice.

We have recently shown that both wild-type MMTV produced from a mouse mammary tumour derived cell line as well as a replication competent MMTV vector carrying an eGFP gene can efficiently infect a number of cultured human cell lines including mammary tumour derived cell lines (Indik et al, 2005). A number of lines of evidence for specific, infection mediated transfer of MMTV rather than


190

a non-infection specific transfer have been provided (Table 2). The ability of MMTV to infect human cells opens up the possibility of developing MMTV as a mammary tumour and B-lymphocyte specific vector for use in gene therapy approaches for the treatment of human diseases.

Intriguingly, these findings also strengthen previously reported observations that MMTV DNA sequences can be found in between 37-42% of human breast tumours (Etkind et al, 2000; Lui et al, 2001; Melana et al, 2001; Ford et al, 2003),

Figure 4. Transgenic mouse carrying an MMTV-eGFP expression construct. Shown is a mouse carrying a transgene consisting of the MMTV LTR linked to the eGFP gene. Expression of eGFP can be seen specifically in the mammary glands.

Table 2. Evidence for true and specific infection of human cells by MMTV1

Action Result

Infection with:

wild type virus

specific PCR signals in infected human cells

eGFP carrying

replication competent virus eGFP expressing cells

------------------------------------------------------------------------------------------------------------------- Pre-treatment of virus with:

MMTV neutralising antibody Abolishes infection Heat Abolishes infection

Abolishes infection Virus with premature termination

codon in MMTV Env ---------------------------------------------------------------------------------------------------------------------- Sequencing of DNA from MMTV Typical of retroviral integration: integration sites from host genome - deletion of last 2bp of viral RNA

- duplication of 5bp at site of integration Human specific sequences found with no known mouse counterparts

1data from Indik et al, 2005


191

thus suggesting that MMTV infection may also play a role in breast tumour development in women. If these findings are verified, then an evaluation of MMTV antigen status in women may become a public health issue.

Acknowledgements The authors would like to thank the members of the

Research Institute for Virology and Biomedicine, the Christian Doppler Laboratory for Gene Therapeutic Vector Development and Austrianova Biotechnology that contributed to the work summarised in this review. This work was financed by the Christian Doppler Society and the FFG.

References Artelt P, Grannemann R, Stocking C, Friel J, Bartsch J and

Hauser H (1991) The prokaryotic neomycin-resistance-encoding gene acts as a transcriptional silencer in eukaryotic cells. Gene 99, 249-54.

Aurrekoetxea-Hernandez K and Buetti E (2004) Transforming growth factor beta enhances the glucocorticoid response of the mouse mammary tumor virus promoter through Smad and GA-binding proteins. J Virol 78, 2201-11.

Bowtell DDL, Cory S, Johnson GR and Gonda TJ (1988) Comparison of expression in hemopoietic cells by retroviral vectors carrying two genes. J Virol 62, 2464-73.

Byun J, Kim J-M, Kim S-H, Yim J, Robbins PD and Kim S (1996) A simple and rapid method for the determination of recombinant retrovirus titre by G418 selection. Gene

Therapy 3, 1018-20. Cavazzana-Calvo M, Hacein-Bey S, de Saint Basile G, Gross F,

Yvon E, Nusbaum P, Selz F, Hue C, Certain S, Casanova JL, Bousso P, Deist FL, Fischer A (2000) Gene therapy of human severe combined immunodeficiency (SCID) - X1 disease. Science 288, 669-72.

Coutelle C, Themis M, Waddington SN, Buckley SM, Gregory LG, Nivsarkar MS, David AL, Peebles D, Weisz B and Rodeck C (2005) Gene therapy progress and prospects: fetal gene therapy--first proofs of concept--some adverse effects. Gene Therapy 12, 1601-7.

Donello JE, Loeb JE and Hope TJ (1998) Woodchuck hepatitis virus contains a tripartite posttranscriptional regulatory element. J Virol 72, 5085-92.

Etkind P, Du J, Khan A, Pilliterri J and Wiernik PH (2000) Mouse mammary tumor virus-like env gene sequences in human breast tumors and in a lymphoma of a breast cancer patient. Clin Cancer Res 6, 1273-8.

Ford CE, Tran D, Deng Y, Ta VT, Rawlinson WD and Lawson JS (2003) Mouse mammary tumor virus-like gene sequences in breast tumors of Australian and Vietnamese women. Clin

Cancer Res 9, 1118-20 Günzburg WH and Salmons B (1992) Factors controlling the

expression of mouse mammary tumour virus. Biochem J

283, 625-32. Hacein-Bey-Abina S, von Kalle C, Schmidt M, Le Deist F,

Wulffraat N, McIntyre E, Radford I, Villeval JL, Fraser CC, Cavazzana-Calvo M, Fischer A (2003a) A serious adverse event after successful gene therapy for X-linked severe combined immunodeficiency. N Engl J Med 348, 255-6.

Hacein-Bey-Abina S, Von Kalle C, Schmidt M, McCormack MP, Wulffraat N, Leboulch P, Lim A, Osborne CS, Pawliuk R, Morillon E, Sorensen R, Forster A, Fraser P, Cohen JI, de Saint Basile G, Alexander I, Wintergerst U, Frebourg T, Aurias A, Stoppa-Lyonnet D, Romana S, Radford-Weiss I, Gross F, Valensi F, Delabesse E, Macintyre E, Sigaux F,

Soulier J, Leiva LE, Wissler M, Prinz C, Rabbitts TH, Le Deist F, Fischer A, Cavazzana-Calvo M (2003b) LMO2-associated clonal T cell proliferation in two patients after gene therapy for SCID-X1. Science 302, 415-9.

Hlavaty J, Portsmouth D, Stracke A, Salmons B, Günzburg WH and Renner M (2004b) Effects of sequences of prokaryotic origin on titre and transgene expression in retroviral vectors. Virology 330, 351-60.

Hlavaty J, Schittmayer M, Stracke A, Jandl G, Knapp E, Felber BK, Salmons B, Günzburg WH and Renner M (2005) Effect of post-transcriptional regulatory elements on transgene expression and virus production in the context of retrovirus vectors. Virology 341, 1-11.

Hlavaty J, Stracke A, Klein D, Salmons B, Günzburg WH and Renner M (2004a). Multiple modifications allow high titer, tissue-specific retroviral vector production. J Virol 78, 1384-92.

Huez I, Creancier L, Audigier S, Gensac MC, Prats AC and Prats H (1998) Two independent internal ribosome entry sites are involved in translation initiation of vascular endothelial growth factor mRNA. Mol Cell Biol 18, 6178-6190.

Indik S, Günzburg WH, Salmons B and Rouault F (2005) Mouse mammary tumor virus infects human cells. Cancer Res 65, 6651-9.

Karavanas G, Marin M, Salmons B, Gunzburg WH and Piechaczyk M (1998) Cell targeting by murine retroviral vectors. Crit Rev Oncol Hematol 27, 7-30.

Klein R, Ruttkowski B, Knapp E, Salmons B, Günzburg WH and Hohenadl C (2006) WPRE mediated enhancement of gene expression is promoter and cell line specific. Gene, in press

Lipnik K, Petznek H, Renner-Muller I, Egerbacher M, Url A, Salmons B, Günzburg WH and Hohenadl C (2005) A 470 bp WAP-promoter fragment confers lactation independent, progesterone regulated mammary-specific gene expression in transgenic mice. Transgenic Res 14, 145-58.

Liu B, Wang Y, Melana S, Pelisson I, Najfeld V, Holland JF and Pogo BG (2001) Identification of a proviral structure in human breast cancer. Cancer Res 61, 1754-9.

Melana SM, Holland JF and Pogo BG (2001) Search for mouse mammary tumor virus-like env sequences in cancer and normal breast from the same individuals. Clin Cancer Res 7, 283-4.

Mrochen S, Klein D, Salmons B, Nikol S, Smith JR and Günzburg WH (1997) Inducible expression of p21WAF-1/CIP-1/SDI-1 from a promoter-conversion retroviral vector. J Mol Med 75, 820-8.

Nappi F, Schneider R, Zolotukhin K, Smulevitch S, Michalowski D, Bear J, Felber BK, Pavlakis GN (2001) Identification of a novel posttranscriptional regulatory element by using a rev- and RRE-mutated human immunodeficiency virus type 1 DNA proviral clone as a molecular trap. J Virol 75, 4558-69.

Öztürk-Winder F, Renner M, Klein D, Müller M, Salmons B and Gunzburg WH (2002) The murine whey acidic protein promoter efficiently directs gene expression to human mammary tumors after retroviral transduction. Cancer Gene

Therapy 9, 421-31. Ross SR, Schofield JJ, Farr CJ and Bucan M (2002) Mouse

transferrin receptor 1 is the cell entry receptor for mouse mammary tumor virus. Proc Natl Acad Sci U S A 99, 12386-90.

Saller R, Öztürk-Winder F, Salmons B and Günzburg WH (1998) Construction and characterization of a hybrid mouse mammary tumor virus/murine leukemia virus based retroviral vector. J Virol 72, 1699-703.

Salmons B and Gunzburg WH (1993) Targeting of retroviral vectors for gene therapy. Human Gene Therapy 4, 129-41.

Smulevitch S, Michalowski D, Zolotukhin AS, Schneider R, Bear J, Roth P, Pavlakis, GN and Felber BK (2005)


192

Structural and functional analysis of the RNA transport element , a member of an extensive family present in the mouse genome. J Virol 79, 2356-2365.

Tabotta W, Klein D, Hohenadl C, Salmons B and Gunzburg WH (2001) Tightly controlled expression of transduced genes by reconstituting retroviral vectors. J Gene Medicine 3, 418-26.

Vivinus S, Baulande S, van Zanten M, Campbell F, Topley P, Ellis JH, Dessen P, Coste H (2001) An element within the 5’ untranslated region of human Hsp70 mRNA which acts as a general enhancer of mRNA translation. Eur J Biochem 268, 1908-1917.

Weber E, Anderson WF and Kasahara N (2001) Recent advances in retrovirus vector-mediated gene therapy: teaching an old vector new tricks. Curr Opin Mol Ther 3, 439-53.

Zhang Y, Rassa JC, deObaldia ME, Albritton LM and Ross SR (2003) Identification of the receptor binding domain of the mouse mammary tumor virus envelope protein. J Virol 77, 10468-78.

Zhao Y, Low W and Collins MKL (2000) Improved safety and titre of murine leukaemia virus (MLV)-based retroviral vectors. Gene Ther 7, 300-305.

Zhu Q and Dudley JP (2001) A retroviral model for tissue-specific transcription: lessons for gene therapy. Gene Ther

Mol Biol 6, 169-181.

Zufferey R, Donello JE, Trono D and Hope TJ (1999) Woodchuck hepatitis virus posttranscriptional regulatory element enhances expression of transgenes delivered by retroviral vectors. J Virol 73, 2886-92.

Walter H. Günzburg


193


The association of endothelial constitutive Nitric

Oxide Synthase polymorphisms with family history

of coronary heart disease in men

Research Article

Nasser M. Al-Daghri King Saud University College of Science, Biochemistry Department, Riyadh, Saudi Arabia

__________________________________________________________________________________

*Correspondence: Al-Daghri, Nasser M., Department of Biochemistry, College of Science, King Saud University, PO Box 2455,

Riyadh 11451, KSA; Tel: +96614675792 / +96614675939; Fax: +96614675931; Mobile: +966505417640; e-mail:

[email protected]

Key words: ecNOS gene, History of coronary heart disease, Physical activity, Type 2 Diabetes

Abbreviations: acute myocardial infarction, (AMI); coronary heart disease, (CHD); endothelial nitric oxide synthase, (ecNOS);

myocardial infarction, (MI); polymerase chain reaction, (PCR)

Received: 11 April 2006; Revised: 15 May 2006

Accepted: 10 July 2006; electronically published: July 2006

Summary It has been reported that endothelial nitric oxide synthase (ecNOS) gene polymorphism is associated with the risk of

CHD, acute myocardial infarction (AMI) and atherosclerosis but hitherto no subjects with a family history of CHD

have been examined. 292 native Saudi males of matching ages were drawn from normal, healthy male volunteers

attending the blood bank at Alshmasee and the King Khalid University Hospital in Riyadh, Saudi Arabia. Blood

samples were collected for the determination of lipids profiles using routine laboratory methods and Genotype was

determined by polymerase chain reaction and restriction fragment length polymorphism analysis. The genotype

frequencies for bb, ab and aa were 31.5, 53 and 5.5% respectively and the calculated allele frequencies for the

ecNOS4b (0.65) and ecNOS4a (0.35) were not statistically different. The subjects were divided according to the

family history of CHD, with an excess of individuals homozygous for bb and aa among the subjects who have a

history of CHD standing at 61% and 12%, compared with those who do not have a history of CHD (59% and 4%

respectively, p= 0.04). The ecNOS gene was found to be associated with family history of Coronary heart disease in

Saudis male subjects more attention to these patients should be considered.

I. Introduction Coronary Heart Disease (CHD) is a major public

health problem which has been associated with various

risk factors, including hypertension, hyperlipidaemia,

diabetes mellitus and smoking (Simons, 1986; Jorde,

1988) However, in some individuals, CHD is not

associated with conventional risk factors, suggesting that

other genetic factors are involved in the predisposition to

coronary atherosclerosis and its thrombotic complications

(Nora et al, 1980; Marenberg et al, 1994).

Several studies show a clustering of CHD risk factors

in the people of Saudi Arabia (Al-Nuaim, 1997; Khattab et

al, 1999; Musaiger, 2002; Al-Nozha et al, 2002; Hakim et

al, 2003; Al-Rukban, 2003; Al-Shehri et al, 2004). The

prevalence of diabetes mellitus and CHD in Saudis is 24%

and 6% respectively (Al-Nozha et al, 2004a, b). Osman,

(2000) and Al-Nuaim, (1997) have shown a high

prevalence of metabolic risk factors for CHD in Saudi

subjects and a regional variation in the prevalence of the

disease. Changes in lifestyle are clearly important to the

current epidemic of obesity, diabetes and CHD in Saudis,

but genetic factors may also contribute to the risk of CHD

in this population. Moreover, the prevalence of smoking in

Saudi Arabia is very high and has become a significant

public health problem there (Al-Nuaim, 1997; Osman,

2000). In another study in Saudi Arabia, it was found that

19% of stroke patients registered from 1989-1993 were

smokers (Al-Rajeh et al, 1998).

These essential roles of NO in vascular regulation

suggest that a derangement in endothelial NO synthesis

might lead to the development of atherosclerosis (Cooke et

al, 1992). It has been reported that the ecNOS gene a/b

polymorphism caused by four (allele ecNOSa) or five

(allele ecNOSb) repeats of a 27-base pair sequence in

intron 4 of the ecNOS gene is associated with the risk of

Al-Daghr: ecNOS polymorphisms with history of CHD in men

194

CHD, AMI (Thomas et al, 2002) and atherosclerosis

(Cooke et al, 1992).

The human ecNOS gene is located on chromosome

7q 35-36 and comprises 26 exons spanning 21 kb: A

number of variable tandem repeats and dinucleotide

repeats [(CA)n] have been identified in the ecNOS gene

(Janssens et al, 1992; Marsden et al, 1992; Sessa et al,

1992; Miyahara et al, 1994; Nadaud et al, 1994). Among

the reported polymorphisms in the endothelial ecNOS

gene, a close association has been shown to exist between

the allele (four repeats) in intron 4 and the onset of CHD

in an Australian population (Khattab et al, 1999). The

effects of conventional risk factors such as smoking,

hypertension, diabetes and HDL on the association

between the ecNOS gene and ischaemic stroke have been

determined in other populations (Bonnardeaux et al, 1995;

Wang et al, 1996; Asanuma et al, 2001; Basset et al,

2002).

Nitric oxide has recently been implicated in a number

of diverse physiological processes, including smooth

muscle relaxation, inhibition of platelet aggregation,

neurotransmission, immune regulation and penile erection

(Furchgott, 1989; Dudzinski et al, 2006). Nitric oxide is

produced from L-arginine by nitric-oxide synthase with a

concomitant production of L-citrulline. There appear to be

at least three distinct isoforms of nitric-oxide synthase

(Furchgott, 1989; Yui et al, 1991a,b; Iyanagi, 2005). All

three isoforms contain consensus sequences for the

binding of FMN, FAD, and NADPH cofactors, and the

structures of the isoforms have close homology to

cytochrome p-450 reductase. The NOSs N-terminus bind

tetrahydrobipoterine and heme, and the N- and C-terminal

domains are linked by a short sequence that binds

calmodulin (Bredt et al, 1991).

Hence, we investigated whether the polymorphism in

intron 4 of the ecNOS gene is an independent risk factor

for CHD in Saudi population.

II. Patients and methods A. Patients The subject population was drawn from normal, healthy

male volunteers attending the blood bank at Alshmasee and King

Khalid University Hospital in Riyadh, Saudi Arabia. Ethical

approval was obtained from the local institutions, and written

informed consent was obtained from each participant in the

study. Information on sociodemographic characteristics, personal

and family medical history and health-relevant behaviors,

including smoking, exercise and diet was obtained by a

standardized interview at the time of venesection. Height and

weight were measured and blood pressure was measured once

with a standard mercury sphygmomanometer.

Two 5 mL non fasting blood samples were obtained in

EDTA coated vacuum tubes. After centrifugation for 10 minutes

at 1000 rpm, plasma was stored at -20 oC in 1.5 mL aliquots; the

remaining red blood cells were stored at -20 oC in 4 mL tubes for

DNA extraction. Plasma total cholesterol, HDL-cholesterol and

triglycerides were determined by routine enzymatic methods

with a Roche modular analyzer. Apolipoproteins A I (apo A I)

and Apolipoproteins A II (apo A II) were measured by a

commercial immunoturbidmetric assay using a Roche modular

analyzer.

B. Genotyping Genomic DNA was extracted from buffy coats as described

previously (Hayden et al, 1987). The Taq I polymorphism was

originally described by Drayna and Lawan (Drayna, 1987). Ec

NOS genotypes were determined with minor modifications by a

polymerase chain reaction (PCR) using oligonucleotide primers

(sense: 5’-AGGCCCTATGGTAGTGCCTTT-3’; antisense, 5’-

TCTCTTAGTGCTGTGGTCAT-3’ Prizma Laboratory Products

Industry and Trade Co. LTD., Istanbul, TR) which flank the

region of the 27bp direct repeat in intron 4 as described

previously. Reactions were performed in a total volume of 24!L

containing 500ng genomic DNA, 10 pmol of each primer, 0.2mm

dNTP, 0.5U Taq DNA polymerase (MBI Fermentas Inc., New

York, NY). The thermocycling procedure (Perkin Elmer Cetus,

DNA Thermal Cycler 480, USA and Eppendorf Mastercycler

Personal 5332, Germany) consisted of initial denaturation at

95°C for 5 min, 35 cycles of denaturation for 94°C for 1 min.,

annealing at 55°C for 1 min and extension at 72°C for 1 min. The

PCR products were analyzed using 2% agarose gel

electrophoresis and visualized by ethidium bromide staining. The

large allele, ecNOS4b, contains 5 tandem 27bp repeats and the

smaller allele, ecNOS4a, contains 4 repeats. The sizes of the

PCR products were 393bp and 420bp respectively for the

ecNOS4a and ecNOS4b alleles.

C. Statistical analysis Statistical manipulations and sample difference testing

were carried out using SPSS version 10 for Windows (SPSS,

Evanston, IL, USA). Data were tested for normality using normal

probability plots and, if appropriate, transformed to produce a

normal distribution. Differences among genotypes were tested on

transformed data using one-way ANOVA. Due to multiple group

comparisons, the Bonferroni correction was used to ascertain the

statistically significant differences between the group means.

Correlations were investigated using Pearson’s correlation

coefficient. The frequencies of discrete variables such as

genotypes were compared by a chi-square test and of continuous

variables by t-test or analysis of variance. We used logistic

regression analysis for the association between presence of CHD

and polymorphism. The presence of CHD was regarded as the

dependent variable and the ecNOS4 polymorphism, gender,

hypertension, diabetes, age, lifetime smoking, BMI, lipids

parameters and lipoprotein levels were regarded as independent

variables.

This statistical test was also performed to examine whether

the genotype frequencies were in Hardy-Weinberg equilibrium.

III. Results The characteristics of the Saudi male subjects (N =

262) are shown in Table 1, for both the whole group and

for the three ecNOS genotypes. Comparison of age, BMI

and the incidence of several conventional risk factors for

CHD, including systolic and diastolic blood pressure,

lipids, glucose and lipoproteins between ecNOS genotypes

(aa + ab and bb) revealed no significant difference (Table

1).

The calculated allele frequencies for ecNOS4b and

ecNOS4a were 0.65 and 0.35 respectively. The genotype

frequencies for bb (0.35), ab (0.59) and aa (0.6) were

significantly different from their expected values (R2 =

11.6, p <0.01). The distribution of the three investigated

polymorphisms significantly deviated from the Hardy-

Weinberg equilibrium exhibiting 50% decrease in aa, 17%

decrease in bb, and 29.5% increase in ab genotypes as

compared to their respective expected frequencies.


195

Table 1. Demographic, biochemical and life-style characteristic of the populations and according to eNOS genotype. Data

shown are the mean (SD).

CHARACTERISTICS TOTAL BB AB AA

Numbers 262 92 154 16

Age (years) 29.4(8.4) 29.2(8.2) 30.7(9.6) 28.9(7.9)

BMI (Kg) 28.9(7.1) 28.5(8.6) 30.3(5.9) 28.9(6.7)

Current smoker (Numbers) 114 62 44 8

Family history of CHD (Numbers) 49 27 15 7

F. Glucose (mmol/L) 5.4(1.1) 5.8(0.8) 5.2(1.1) 5.5(1.2)

Cholesterol (mmol/L) 4.6(0.9) 4.7(1.0) 4.5(0.6) 4.5(0.9)

HDL (mmol/L) 0.97(0.3) .9(.2) 0.9(0.2) 0.9(0.3)

Triglyceride (mmol/L) 2.2(1.4) 2.3(1.6) 2.1(1.3) 2.1(1.2)

SPB 118.7(12.7) 120.9(12.8) 117.9(12.3) 117.6(13.0)

DPB 75.8(10.4) 74.7(9.8) 77.1(7.8) 75.9(11.4)

Hips (cm) 106.6(17.2) 106.9(27.2) 98.7(9.9) 106.6(9.2)

Waist (cm) 94.6(12.7) 98.7(13.9) 360.0(484.9)a 92.7(12.2)b

APOA1{mg/dl) 117.4(17.1) 115.8 (16.3) 119.2(16.9) 118.5(18.02)

APOA11{mg/dl) 43.7(7.2) 42.8(7.8) 45.2(10.9) 44.2(6.8)

ap= 0.001 (ANOVA) between groups 1 and 3. bp=0.01 between groups 2 and 3

Table 2. Clinical characteristics and metabolic parameters of Subjects without history of CHD (No CHD) and subjects

with history of CHD.

Characteristics N0 CHD CHD P value

Numbers 206 56

Age (years) 30.9(9.4) 28.7(7.8) 0.12

BMI (Kg) 27.9(9.02) 28.9(7.02) 0.51

Family history of CHD (Numbers) 0 56

F. Glucose (mmol/L) 5.4(1.2) 5.6(1.6) 0.576

Cholesterol (mmol/L) 4.6(0.9) 4.6(0.9) 0.68

HDL (mmol/L) 0.9(0.3) 0.9(0.2) 0.14

Triglyceride (mmol/L) 2.2(1.2) 2.2(1.4) 0.66

SPB 120.9(11.9) 118.7(12.6) 0.30

DPB 75.8(7.03) 75.6(11.2) 0.66

Hips (cm) 106.5(19.1) 105.3(9.04) 0.83

Waist (cm) 158.2(229.3) 94.2(13.2) 0.038

APOA1{mg/dl) 118.3(14.6) 118.6(17.4) 0.78

APOA11{mg/dl) 43.9(7.4) 44.2(7.1) 0.7

Data are presented as mean (SD)

Categorical distribution subjects according to HDL

level (Table 3) smoking habit (Table 4) and family

history of diabetes (Table 5) failed to show any significant

difference with respect to distribution of the ecNOS4a

genotype and allele prevalence. The subjects with the

history of CHD showed 61/ ba and 12/ aa as expand to

59% bb and 4% aa in the individual without the history of

CHD (P<0.04), clinical characteristic (Table 2). Where as

family history of CHD was significantly associated with

the homozygous presentation of alleles (Table 6). In

analyzing the dominant effect of the ecNOS4a allele, the

prevalence of the non-bb genotype (AA+BB) was found to

be significantly higher in the group which had a history of

CHD than in the control group (54%versus 64%, p< 0.05).

Stepwise regression for all the groups showed a

significant association (P<0.05) between the ecNOS

genotype and physical activity (in a group which took 20

minutes’ exercise daily), with R2 0.2.

IV. Discussion Several studies have investigated the relation

between ecNOS gene polymorphism and CHD, myocardial

infarction (MI) and atherosclerosis and have produced

varied or contradictory results (Tsukada et al, 1998;

Thomas et al, 2002). It was found that the 4a allele was


196

associated with CHD but not with previous MI (Wang et

al, 1997; Tsukada et al, 1998). Whereas, positive

associations of 4a compared with 4b were reported in

African-Americans with MI (Hooper et al, 1999),

Caucasians with MI and CHD (Fowkes et al, 2000),

Japanese patients with MI (Ichihara et al, 1998) and

Australians with severely stenosed arteries and a history of

MI (Wang et al, 1996). Other studies on German (Sigusch

et al, 2000) or Japanese (Elbaz et al, 2000) patients fails to

observe such an association. Since this polymorphism is in

a non-coding region, it could merely be a genetic marker

which is associated with the functional mutation. This is

the first study to have found a relationship between the

ecNOS gene and people with a history of CHD. The main

finding of the present study is that sequence

polymorphisms of the ecNOS gene locus are associated

with a history of CHD, suggesting the pathophysiological

of ecNOS 4a and 4b in the development of CHD in the

Saudi population. The functional significance of ecNOS

gene polymorphisms has been reported by several

investigators (Wang et al, 1996; Ichihara et al, 1998; Elbaz

et al, 2000; Sigusch et al, 2000; Yoshimura et al, 2000).

Table 3. Distribution of individuals between high and low HDL group for ecNOS polymorphism, the number of

Individuals is given for High HDL (HDL cholesterol >1.2 mmol/L) or low HDL (HDL cholesterol<1.1). This is also

expressed as a percentage of the total number of individuals in that group.

Low HDL group High HDL group

Polymorphism Numbers % Numbers %

BB 116 57 40 67

AB 74 37 17 28

AA 11 6 5 5

Chi-Sq=2.1 p-value=0.35 Df=2

Table 4. Distribution of individuals between subjects without history of CHD (No CHD) and subjects with history of CHD

(H.CHD). This is also expressed as a percentage of the total number of individuals in that group.

No CHD H. CHD


BB 125 59 34 61

AB 77 37 15 27

AA 9 4 7 12

Chi-Sq=6.2 p-value=0.044 Df=2

Table 5. Distribution of individuals between smoking and non smoking subject. This is also expressed as a percentage of

the total number of individuals in that group.

Non-smokers Smoking


BB 91 62 62 56

AB 48 33 44 38

AA 8 6 8 6

Chi-sq= 1.53 p-value= 0.47 DF=2

Table 6. Distribution of individuals between subjects without history of diabetes (No H.DM) and subjects with history of

diabetes (H.DM). This is also expressed as a percentage of the total number of individuals in that group.

No.H.DM H.DM


BB 100 64 58 54

AB 48 31 42 39

AA 8 5 8 7

Chi-sq=2.9 p-value = 0.23 DF=2


197

The genotype distribution of our subjects is within

the Hardy-Weinberg equilibrium. Our result also showed

significant differences in both genotype distribution and

allele prevalence between the two groups, with or without

a history of CHD. Elbaz and colleagues (2000) observed a

significant difference in the distribution of genotypes when

analysis were restricted to pairs of cases and matched

controls, both free of previous cardiovascular and

cerebrovascular history (cases: 50.0% GG, 40.1% GT,

9.9% TT; controls: 36.0% GG, 50.8% GT, 13.2% TT).

Moreover, Wang et al found that ecNOS genotype was

associated with a history of myocardial infarction (Wang

et al, 1996). Previous studies have also shown that ecNOS

gene polymorphism is responsible for variations in the

genetic control of the plasma concentration of nitric oxide

metabolites (Nava et al, 1995; Tsukada et al, 1998).

Moreover, nitric oxide can inhibit vascular smooth cell

proliferation (Sakar et al, 1995), which is responsible for

the synthesis and assembly of the macromolecules which

strengthen the fibrous cap. Therefore, there is a possibility

that the inhibition of smooth muscle cell proliferation with

changing ecNOS activity determined by ecNOS genotype

contributes to the formation of a friable fibrous cap (Libby,

1991). Finally, brief exercise training may alter the gene

expression for the enzyme, the constitutive endothelial NO

synthase, which forms NO and may be part of the vascular

adaptation seen after aerobic exercise training.

Furthermore, if there is a genetic predisposition to produce

NO, as in world class athletes or animals bred to race, NO

may contribute to spectacular exercise performance (Shen

et al, 1995). One potential mechanism which may

contribute to the enhanced production of nitrite in vessels

from exercised dogs may be the induction of the calcium-

dependent ecNOS gene (Sessa et al, 1995). In our study

we found an association between the ecNOS gene and

physical activity. The high prevalence of Obesity, diabetes

and CHD in Saudi (Al-Nuaim, 1997; Osman et al, 2000;

Al-Nozha et al, 2002, 2004a, b; Al-Rukban, 2003) can

explained the effect of the history of CHD on the

association between gene polymorphism and CHD

development so this polymorphism seems most useful for

future research in CHD patients.

References Al-Nozah M, Al-Daghri N, Bartlett WA, Al-Attas O, Al-

Maatouq M, Martin SC, Kumar S, Jones AF (2002) Serum

homocysteine concentration is related to diabetes mellitus,

but not to coronary heart disease, in Saudi Arabians.

Diabetes Obes Metab 4, 118-23.

Al-Nozha MM, Al-Maatouq MA, Al-Mazrou YY, Al-Harthi SS,

Arafah MR, Khalil MZ, Khan NB, Al-Khadra A, Al-

Marzouki K, Nouh MS, Abdullah M, Attas O, Al-Shahid

MS, Al-Mobeireek A (2004a) Diabetes mellitus in Saudi

Arabia. Saudi Med J 25, 1603-10.

Al-Nozha MM, Arafah MR, Al-Mazrou YY, Al-Maatouq MA,

Khan NB, Khalil MZ, Al-Khadra AH, Al-Marzouki K,

Abdullah MA, Al-Harthi SS, Al-Shahid MS, Nouh MS, Al-

Mobeireek A (2004b) Coronary artery disease in Saudi

Arabia. Saudi Med J 25, 1165-71.

Al-Rajeh S, Larbi EB, Bademosi O, Awada A, Yousef A, al-

Freihi H, Miniawi H (1998) Stroke register: experience from

the eastern province of Saudi Arabia. Cerebrovasc Dis 8,

86-89.

Al-Rukban MO (2003) Obesity among Saudi male adolescents in

Riyadh, Saudi Arabia. Saudi Med J 24, 27-33.

Al-Shehri SN, Saleh ZA, Salama MM, Hassan YM (2004)

Prevalence of hyperlipidemia among Saudi school children

in Riyadh. Ann Saudi Med 24, 6-8.

Asanuma K, Yokoyama K, Tsukada T, Takemoto F, Hara S,

Yamada A, Tomino Y (2001) An intron 4 gene

polymorphism in endothelial cell nitric oxide synthase might

modulate lipid metabolism in nondiabetic patients on

hemodialysis. Nephron 88, 39-43.

Basset el-EA, Berthoux P, Cecillon S, Deprle C, Thibaudin D,

De Filippis JP, Alamartin E, Berthou F (2002) Hypertension

after renal transplantation and polymorphism of genes

involved in essential hypertension: ACE, AGT, AT1 R and

ecNOS. Clin Nephrol 57, 192-200.

Bonnardeaux A, Nadaud S, Charru A, Jeunemaitre X, Corvol P,

Soubrier F (1995) Lack of evidence for linkage of the

endothelial cell nitric oxide synthase gene to essential

hypertension. Circulation 91, 96-102.

Bredt DS, Hwang PM, Glatt CE, Lowenstein C, Reed RR and

Snyder SH 1991 Cloned and expressed nitric oxide synthase

structurally resembles cytochrome p-450 reducatse. Nature

351(6329), 714-718.

Cooke JP, Singer AH, Tsao P, Zera P, Rowan RA, Billingham

ME (1992) Antiatherogenic effects of L-arginine in the

hypercholesterolemic rabbit. J Clin Invest 90, 1168-1172.

Drayna D, Lawn R (1987) Multiple RFLPs at the human

cholesteryl ester transfer protein (CETP) locus. Nucleic

Acids Res 15, 4698.

Dudzinski A, Igarashi J, Grief, D, and Michel T (2006) The

regulation and pharmacology of endothelial nitric oxide

synthase. Annual Review of Pharmacology and

Toxicology 46, 235-276.

Elbaz A, Poirier O, Moulin T, Chedru F, Cambien F, Amarenco

P (2000) Association Between the Glu298Asp Polymorphism

in the Endothelial Constitutive Nitric Oxide Synthase Gene

and Brain Infarction. Stroke 31, 1634-1639.

Fowkes FG, Lee AJ, Hau CM, Cooke A, Connor JM, Lowe GD

(2000) Methylene tetrahydrofolate reductase (MTHFR) and

nitric oxide synthase (ecNOS) genes and risks of peripheral

arterial disease and coronary heart disease: Edinburgh Artery

Study. Atherosclerosis 150, 179-185.

Furchgott RF (1989) Endothelium-derived relaxing and

contracting factors. FASEB J 3, 2007-2018.

Hakim IA, Alsaif MA, Alduwaihy M, Al-Rubeaan K, Al-Nuaim

AR, Al-Attas OS (2003) Tea consumption and the

prevalence of coronary heart disease in Saudi adults: results

from a Saudi national study. Prev Med 36, 64-70.

Hayden MR, Kirk H, Clark C, Frohlich J, Rabkin S, McLeod R,

Hewitt J (1987) DNA polymorphisms in and around the

APO-A1-CIII genes and genetic hyperlipidemias. Am J

Hum Genet 22, 245-251.

Hooper WC, Lally C, Austin H, Benson J, Dilley A, Wenger NK,

Whitsett C, Rawlins P, Evatt BL (1999) The relationship

between polymorphisms in the endothelial cell nitric oxide

synthase gene and the platelet GPIIIa gene with myocardial

infarction and venous thromboembolism in African

Americans. Chest 116, 880-886.

Ichihara S, Yamada Y, Fujimura T, Nakashima N, Yokota M

(1998) Association of a polymorphism of the endothelial

constitutive nitric oxide synthase gene with myocardial

infarction in the Japanese population. Am J Cardiol 81, 83-

86.

Janssens SP, Quertermous T, Bloch DB, Bloch KD (1992)

Cloning and expression of a cDNA encoding human

endothelium-derived relaxing factor/nitric oxide synthase. J


198

Biol Chem 267, 14519-145122, [Erratum in: J Biol Chem.

1992 Nov 5;267(31):22694].

Jorde LB (1988) Relation between family history of coronary

artery disease and coronary risk variables. Am J Cardiol 62,

708-13.

Iyanagi T (2005) Structure and function of NADPH-cytochrome

P450 reductase and nitric oxide synthase reductase domain.

Biochem Biophys Res Commun 338, 520-8.

Khattab MS, Abolfotouh MA, Alakija W, al-Humaidi MA, al-

Wahat S (1999) Risk factors of coronary heart disease:

attitude and behaviour in family practice in Saudi Arabia.

East Mediterr Health J 5, 35-45.

Libby PP (1991) Molecular bases of the acute coronary

syndrome. Circulation 91, 2844-2850.

Marenberg RN, Berkman LF, Floderus B, De Faire U (1994)

Genetic susceptibility to death from coronary heart disease in

a study of twins. N Engl J Med 330, 1041-1046.

Marsden PA, Heng HH, Scherer SW, Stewart RJ, Hall AV, Shi

XM, Tsui LC, Schappert KT (1992) Structure and

chromosomal localization of the human constitutive

endothelial nitric oxide synthase gene. J Biol Chem 268,

17478-17488.

Miyahara K, Kawamoto T, Sase K, Yui Y, Toda K, Yang LX,

Hattori R, Aoyama T, Yamamoto Y, Doi Y, et al (1994)

Cloning and structural characterization of the human

endothelial nitric-oxide-synthase gene. Eur J Biochem 223,

719-726.

Musaiger AO (2002) Diet and prevention of coronary heart

disease in the Arab Middle East countries. Med Princ Pract

2(11 Suppl), 9-16.

Nadaud S, Lathrop M, Soubrier F (1994) Gene structure,

polymorphism and mapping of the human endothelial nitric

oxide synthase gene. Biochem Biophys Res Commun 198,

1027-1033

Nava E, Luscher TF (1995) Nitric oxide in cardiovascular

disease. Ann Med 27, 343-351.

Nora JJ, Spangler RD, Nora AH, Kimberling WJ (1980) Genetic-

epidemiologic study of early-onset ischemic heart disease.

Circulation 61, 503-508.

Osman AK (2000) Risk factors of coronary artery disease in

different regions of Saudi Arabia. East Mediterr Health 6,

465-474.

Rahman Al-Nuaim A (1997) High prevalence of Metabolic risk

factors for cardiovascular diseases among Saudi population,

aged 30-64 years. Int J Cardiol 62, 227-235.

Sakar RW, Stanley JC (1995) Nitric oxide inhibition of

endothelial cell mitogenesis and proliferation. Surgery 118,

274-280.

Sessa WC, Harrison JK, Barber CM, Zeng D, Durieux ME,

D'Angelo DD, Lynch KR, Peach MJ (1992) Molecular

cloning and expression of a cDNA encoding endothelial cell

nitric oxide synthase. J Biol Chem 267, 15274-15276.

Sessa WC, Pritchard K, Seyedi N, Wang J, Hintze TH (1994)

Chronic exercise in dogs increases coronary vascular nitric

oxide production and endothelial cell nitric oxide synthase

gene expression. Circ Res 74, 349-53.

Shen W, Zhang X, Zhao G, Wolin MS, Sessa W, Hintze TH

(1995) Nitric oxide production and NO synthase gene

expression contribute to vascular regulation during exercise.

Med Sci Sports Exerc 27, 1125-1134.

Sigusch HH, Surber R, Lehmann MH, Surber S, Weber J, Henke

A, Reinhardt D, Hoffmann A, Figulla HR (2000) Lack of

association between 27-bp repeat polymorphism in intron 4

of the endothelial nitric oxide synthase gene and the risk of

coronary artery disease. Scand J Clin Lab 60, 229-235.

Simons LA (1986) Interrelations of lipids and lipoproteins with

coronary artery disease mortality in 19 countries. Am J

Cardiol 57, 5-10.

Thomas S, Birkhead A, Wang L (2002) Effect of ecNOS

polymorphisms and coronary artery disease upon exhaled

nitric oxide. J Mol Med 80, 181-186.

Tsukada T and Arai T (1998) Evidence of association of the

ecNOS gene polymorphism with plasma NO metabolite

levels in humans. Biochem Biophys Res Commun 245,

190-193.

Tsukada T, Yokoyama K, Arai T, Takemoto F, Hara S, Yamada

A, Kawaguchi Y, Hosoya T, Igari J (1998) Evidence of

association of the ecNOS gene polymorphism with plasma

NO metabolite levels in humans. Biochem Biophys Res

Commun 245, 190-193.

Wang XL, Badenhop RF, McCredie RM, Wilcken DE (1996) A

smoking-dependent risk of coronary artery disease associated

with a polymorphism of the endothelial nitric oxide synthase

gene. Nat Med 2, 41-45.

Wang XL, Mahaney MC, Sim AS, Wang J, Wang J, Blangero J,

Almasy L, Badenhop RB, Wilcken DE (1997) Genetic

contribution of the endothelial constitutive nitric oxide

synthase gene to plasma nitric oxide levels. Arterioscler

Thromb Vasc Biol 17, 3147-3153.

Yoshimura M, Yasue H, Nakayama M, Shimasaki Y, Ogawa H,

Kugiyama K, Saito Y, Miyamoto Y, Ogawa Y, Kaneshige T,

Hiramatsu H, Yoshioka T, Kamitani S, Teraoka H, Nakao K

(2000) Genetic risk factors for coronary artery spasm:

significance of endothelial nitric oxide synthase gene T-786C

and missense Glu298Asp variants. J Invest Med 48, 367-

374.

Yui Y, Hattori R, Kosuga K, Eizawa H, Hiki K, Kawai C

(1991a) Purification of nitric oxide synthase from rat

macrophages. J Biol Chem 266, 12544-12547.

Yui Y, Hattori R, Kosuga K, Eizawa H, Hiki K, Ohkawa S,

Ohnishi K, Terao S, Kawai C (1991b) Calmodulin-

independent nitric oxide synthase from rat

polymorphonuclear neutrophils. J Biol Chem 266, 3369-

3371.


199


Apoptotic signaling induced by Tiazofurin-an in

vitro study

Research Article

Sujata Pathak1, Himani Sharma1, Chandresh Sharma1, Hiremagalur N. Jayaram2,

Neeta Singh1,* 1Department of Biochemistry, All India Institute of Medical Sciences, New Delhi-110029, India 2Department of Biochemistry and Molecular Biology, Indiana University School of Medicine and Richard Roudebush

Veterans Affairs Medical Center-151, Indianapolis, Indiana IN 5122, USA

__________________________________________________________________________________ *Correspondence: Dr. Neeta Singh, Professor, Department of Biochemistry, Room No 3027A, All India Institute of Medical Science,

Ansari Nagar, New Delhi 110029, India; Tel: 91-11-26588663; Fax: 91-11-26594945; E mail: [email protected] Key words: Tiazofurin, apoptosis, mitochondria, cytochrome c

Abbreviations: apoptosis inducing factor, (AIF); cerebellar granule cells, (CGCs); human colorectal carcinoma, (RKO); inosine 5’

mono phosphate dehydrogenase, (IMPDH); nicotinamide 5’ mononucleotide adenylyltransferase, (NMNAT); phosphate-buffered saline,

(PBS); poly, (ADP-ribose) polymerase, (PARP); propidium iodide, (PI); Relative Units, (RU); thiazole-4-carboxamide adenine

dinucleotide, (TAD); Tiazofurin, (TR); Tris buffered saline, (TBS)

Received: 10 May 2006; Revised 02 June 2006 and 6 July 2006;

Accepted: 18 July 2006; electronically published: August 2006

Summary Tiazofurin (TR), is a novel anticancer agent exhibiting potent cytotoxic activity in malignant cell lines. It exhibits at

least two different mechanisms of action. First is by inhibition of inosine 5’ monophosphate dehydrogenase

(IMPDH), a rate-limiting enzyme for guanylate (GTP, dGTP) biosynthesis and second is by the induction of

apoptosis. But the mechanism of induction of apoptosis is not clear. The purpose of the present study was to

elucidate the apoptotic signaling induced by TR in different human cancer cell lines. The effect of TR was studied

on SiHa (human cervical cancer cell line), Hep2 (human laryngeal cancer cell line) and Ca Ski (human cervical

cancer cell line) cells. Morphological examination, flowcytometry and Caspase-3 assay were used for detection of

apoptosis. Expression of various proteins was seen by Western blotting. Our results reveal that TR at a dose of

100!M induces apoptosis in SiHa and Hep2 cells whereas for Ca Ski cells this dose is 150!M as studied by

morphology and flow cytometry. A downregulation of anti-apoptotic proteins Bcl-2 and Bcl-xL was observed

whereas the expression level of the pro-apoptotic protein Bax remained unaffected in all these cell lines. An

upregulation of p53 was observed while no change was seen on the level of apoptosis inducing factor (AIF). A

moderate increase in caspase-9 activity was seen. There was a significant increase in caspase-3 activity, which was

accompanied by PARP cleavage. Release of cytochrome c from the mitochondria to the cytosol was also observed.

The findings suggest that TR induces apoptosis in SiHa, Hep2 and Ca Ski cells via the intrinsic mitochondrial

pathway.

I. Introduction Apoptosis is a genetically controlled process of cell

death. Signaling for apoptosis occurs through multiple

independent pathways that are initiated either from

triggering events within the cell or from outside the cell.

Finally the apoptosis signaling pathways converge on a

common machinery of cell destruction that is activated by

a family of cysteine proteases (caspases) that cleave

proteins at aspartate residues, causing degradation of

cellular proteins and disassembly of the cell, leading to

morphological changes such as chromatin condensation,

nuclear shrinkage and the formation of apoptotic bodies

(Borner, 2003).

In general terms, apoptotic pathways can be sub-

divided into two categories- extrinsic apoptotic signals by

ligand engagement of cell surface receptors such as Fas

and TNF receptors, and intrinsic pathways activated by

signals emanating from cellular damage sensors (e.g. p53)

or development cues. Although the pathways activated by

extrinsic and intrinsic signals can overlap to some extent,

receptor ligation typically leads to recruitment of adaptor

proteins that promote caspase oligomerization and auto-

processing (Ashkenazi and Dixit, 1998). Intrinsic signals

Pathak et al: Apoptotic signaling induced by Tiazofurin-an in vitro study

200

usually operate by triggering the release of proteins from

the intermembrane space of the mitochondria to the

cytosol (Green and Reed, 1998). Most notable among

these is cytochrome c; binding of cytochrome c to a

central apoptotic regulator, Apaf-1 promotes

oligomerization of Apaf-1 and activation of caspase-9

(Budihardjo et al, 1999). Caspase -9 subsequently

activates effector caspases such as caspase -3, -6 and -7.

The molecular participants of apoptosis are located in

mitochondria, plasma membrane, cytosol, nucleus, with

interplay between these compartments. The pathways

converge at two main initiator caspases-8 and -9 to signal

via distinct receptor or mitochondrial mediated pathways

and activate the effectors pro-caspase-3 within the cytosol.

The release of mitochondrial proteins is blocked by the

anti-apoptotic Bcl-2 family members and promoted by

pro-apoptotic members. Majority of chemotherapeutic

agents trigger the mitochondrial pathway, but the death

receptors have also been reported to be involved in

chemotherapy induced apoptosis (Yuan and Whang, 2002;

Calviello et al, 2003).

Tiazofurin (TR: 2-!-D-ribofuranosylthiazole-4-

carboxamide) exhibits cytotoxicity in vitro. The

mechanism of action of TR is thought to be due to he

conversion to its active metabolite, an analogue of NAD,

thiazole-4-carboxamide adenine dinucleotide (TAD).

TAD, in turn is a potent inhibitor of inosine-5’-mono

phosphate dehydrogenase (IMPDH) which is a rate-

limiting enzyme involved in the synthesis of guanylates

(GTP and dGTP). Tiazofurin has been extensively studied both

in pre-clinical (Jayaram et al, 1999) and clinical studies (Tricot et

al, 1989; Wright et al, 1996), and has been approved for

treatment of patients with acute myeloid leukaemia in blast crisis

(Grifantini, 2000). Recently, studies from our laboratory

have shown that another IMPDH inhibitor benzamide

riboside possibly exerts its apoptotic effect through the

mitochondrial mediated pathway in human lung cancer

H520 cells (Khanna et al, 2004). The thrust of the present

study was to investigate the mechanism of induction of

apoptosis by TR using different human malignant cell

lines. An understanding of the mechanism of induction of

apoptosis with TR is of interest since this may help to

develop a novel approach to treat cancer.

A. Materials TR was obtained from the Drug Synthesis and Chemistry

Branch, Division of Cancer Treatment, National Cancer Institute,

Bethesda, MD, USA. The cell lines were obtained from National

Centre for Cell Science, Pune, India. Caspase-3 assay kit was

from Pharmingen, Germany and Caspase-8 and -9 substrates

were obtained from Genotech, USA. Western blot kit was

purchased from Promega Corporation, USA. Bcl-2, Bcl-xL, Bax,

p53, AIF and cytochrome c antibodies were obtained from Santa

Cruz, USA. PARP antibody was purchased from Neo Markers,

USA.

B. Cell culture and treatments Human malignant cell lines SiHa (human cervical cancer

cell line) and Hep2 (human laryngeal cancer cell line) were

grown in DMEM medium whereas Ca Ski (human cervical

cancer cell line) was grown in RPMI medium. The media was

supplemented with 10% fetal calf serum and antibiotics in a

humified atmosphere of 5% CO2 in air, at 370C. Logarithmically

growing cells were used for all experiments. TR was dissolved in

autoclaved double distilled water. The cells were treated with TR

for 24 hr. The IC50 of TR had been studied on the basis of MTT

assay and flow cytometry. The calculated IC50 has been used for

all subsequent experiments. Treatment with cisplatin in the above

cell lines was used as positive control. Normal human

lymphocytes were used as controls.

C. MTT (cell viability) assay The growth inhibitory effect of TR was assessed by the

MTT assay. Briefly, 1x104 cells were seeded in a 96-well

microtiter plate. Cells were then treated with different

concentrations (50!M, 100!M, 150!M and 200!M) of tiazofurin

for 24 hrs. 100!l of 5mg/ml of MTT was added followed by

incubation for 4 hrs at 37ºC. The formazan crystals thus formed

were dissolved in DMSO and the absorbance was measured at

570nm using an ELISA reader and 620nm as the reference

wavelength (Sen et al, 2005). IC50 of TR was found to be 100!M

for SiHa and Hep2 cells, whereas it was 150!M for Ca Ski cells.

D. Detection of apoptosis 1. Morphological analysis Apoptotic cell death was evaluated by observing

morphological changes typical of apoptosis by light microscopy

(Singh et al, 2002).

2. Flow cytometry Briefly, 2 x 106 cells were washed once in phosphate-

buffered saline (PBS) and fixed in 70% ethanol at -200C

overnight. Fixed cells were washed and resuspended in a buffer

containing 5 mg/ml propidium iodide (PI), 0.1% sodium citrate,

and 1% Triton-X-100. PI stained cells were analyzed using a

FACScan cytometer (Coulter) equipped with an argon laser using

Win MDI 2.8 software (Sharma et al, 2005).

3. Immunoblot analysis The levels of expression of Bcl-2, Bcl-xL, Bax, p53, AIF,

PARP and cytochrome c were determined in control and treated

cells by Western blotting as described previously (Sharma et al,

2005). Briefly, control and treated cells were washed twice in

PBS and lysed in RIPA lysis buffer containing protease and

phosphatase inhibitors. Protein quantification of the lysates was

done by Bradford’s method. Equal amounts of protein extracts

were then electrophoresed on 10-15% SDS-Polyacrylamide gel

depending upon the molecular weight of the protein, transferred

to nitrocellulose membrane, and nonspecific binding blocked

with 5% BSA and 5% FCS in Tris buffered saline (TBS) for

2.5hrs at 37ºC. The blot was washed with 0.05% Tween-20 in

TBS and then TBS for 10 min each. The blot was incubated with

primary antibodies at 4ºC overnight against the protein of interest

and then incubated with secondary antibody conjugated to

alkaline phosphatase for 2hrs at room temperature, rinsed with

0.05% Tween-20 in TBS, then with TBS. This was followed by

addition of AP buffer and the bands visualized by adding BCIP

and NBT. The bands were analyzed and quantitated using a "-

imager scanning densitometer (Alpha Innotech, USA). The

protein expression is expressed in Relative Units (RU). The

density of the control was taken as 1 and the results of treatments

were expressed in relation to the control.

E. Measurement of Cytochrome c release For cytochrome c determination, cytosolic fraction was

obtained by differential centrifugation. Cytochrome c was

detected by western blotting as described earlier (Sharma et al,

2005). Staurosporine treated HeLa cells were used as a positive

control for cytochrome c release.


201

F. Caspase-3, -8 and -9 activity assay Caspase-3, -8, -9 were measured by the direct assay for

caspase enzyme activity in the cell lysate using synthetic

fluorogenic substrate (Ac-DEVD-AMC; substrate for caspase-3;

Pharmingen, Germany; Ac-LETD-AFC, substrate for caspase-8

and Ac-LEHD-AFC, substrate for caspase-9; Genotech, USA) as

described by the manufacturer. Briefly, the cells were washed

with PBS and lysed in lysis buffer on ice for 20 min. Aliquots of

cell lysate (50-100!l) were then added to reaction buffer along

with 250 !M fluorogenic substrate) and incubated for 1 hr at

37oC. Amounts of fluorogenic AMC/AFC moiety released was

measured using a spectrofluorimeter (ex.380nm, em.420-460nm

for Caspase-3; ex.400nm, em.490-520nm for Caspase-8 & -9).

The results were expressed as Arbitrary Fluorescence Units/mg

protein (Sen et al, 2005).

G. Statistical analysis

Statistical analysis of the samples was done using the SAS

software. Paired t-test was used to analyze the difference in the

parameters between control and various treatments. A ‘p’ value

of less than 0.05 was considered to be statistically significant.

III. Results To explore the cytotoxicity of tiazofurin, we started

our study with the cell viability assay to determine the IC50

value in SiHa, Hep2 and Ca Ski cells. Figure 1 shows the

dose response study in SiHa, Hep2 and Ca Ski cells that

were treated with various concentrations of TR for a

period of 24 hours. The IC50 value of TR was found to be

100!M for SiHa and Hep2 whereas this value was found

to be 150!M in the case of Ca Ski cells. TR at its

respective dose for different cell lines, induced apoptotic

features in all the three cell lines as revealed by light

microscopy (Figure 2).

Figure 1. Cell viability of SiHa,

Hep2 and Ca Ski cells as measured

by MTT (3-(4,5-dimethylthiazol-2-

yl)-2,5-diphenyl tetrazolium

bromide) assay. TR: Tiazofurin. The

results are the mean ± SE of three

different experiments.

Figure 2. Morphological changes in a) SiHa, b) Hep2 and c) Ca Ski cells as revealed by light microscopy. The photographs are of

native, unstained cells, taken under an inverted microscope (200X).


202

Besides the morphological changes, apoptosis was also

quantitated by measuring the sub-diploid population of

cells by flowcytometry. TR treated cells showed 34.93%,

49.67% and 31.23% apoptosis in SiHa, Hep2 and Ca Ski

cells, respectively (Figure 3).

A. Tiazofurin downregulated Bcl-2 and

Bcl-xL expression without affecting Bax

expression level Since the anti-apoptotic and pro-apoptotic proteins

are important regulators of apoptosis, therefore we

analyzed their expression in treated as well as control

cells. We found that TR downregulated the expression of

the anti-apoptotic protein Bcl-2 by 1.33, 1.49 and 1.75 fold

and Bcl-xL by 1.69, 2.04and 1.32 fold in SiHa, Hep2 and

Ca Ski cells respectively as seen by Western blotting.

However, no significant change in the expression level of

Bax was observed in all the three cell lines (Figure

4a,b,c).

B. Tiazofurin treatment upregulated p53

expression, whereas it had no effect on AIF

levels An increase of 2.33, 1.71 and 1.54 fold in p53

protein level was observed in TR treated SiHa, Hep2 and

Ca Ski cells respectively (Figure 4d), whereas no

significant difference was observed in AIF levels after TR

treatment in the respective cell lines as observed by

Western blotting (Figure 4e).

C. Mitochondrial involvement An increase of 1.52, 1.81 and 1.7 fold in cytochrome

c level was seen in cytosolic extracts after TR treatment in

SiHa, Hep2 and Ca Ski cells respectively (Figure 4f)

suggesting the involvement of mitochondria in TR-

induced apoptosis.

D. PARP cleavage Since PARP cleavage is one of the biochemical

hallmarks of apoptosis, we investigated this cleavage in

our study and measured it by western blotting. After TR

treatment, a 1.47, 2.04 and 1.4 fold decrease was seen in

PARP 116 KDa band in SiHa, Hep2 and Ca Ski cells

respectively (Figure 4g).

E. TR increased caspase-3 and caspase-9

activity Since caspases are the key players in apoptotic

cascade we investigated the effect of TR on initiator and

the effector caspases. TR causes 3.09, 3.62 and 2.52 fold

increase in caspase-3 activity in SiHa, Hep2 and Ca Ski

cells whereas an increase of 1.81, 2.61 and 1.69 fold in

Caspase-9 activity was seen after TR treatment in the

respective cell lines. However, no significant increase in

caspase-8 level was seen after TR treatment in all the three

cell lines (Figure 5).

Figure 3. Percentage apoptosis in a) SiHa b) Hep2 and c) Ca Ski as observed by flowcytometry.


203

Figure 4. Densitometric analysis of protein expression of a)

Bcl-2, b) Bcl-xL, c) Bax, d) p53, e) AIF, f) cytochrome c

(cytosolic fraction) and g) PARP in control and treated cells as

measured by western blot analysis. The bars represent the

mean of three independent experiments± S.D. (*) indicates the

statistical significance (p <0.05).


204

Figure 5. Caspase-3, -8, and –9 activity assays in SiHa, Hep2 and Ca Ski cells.

IV. Discussion Apoptosis is a tightly controlled multistep

mechanism of cell suicide. It is critical in many

physiological and pathological contexts. In pathological

states, while a failure to undergo apoptosis may cause

abnormal cell outgrowth and malignancy, excessive

apoptosis may contribute to organ injury (Tatton and

Olanow, 1999; Lowe and Lin, 2000; Strasser et al, 2000).

Tumor cells often evade apoptosis by expressing several

anti-apoptotic proteins, downregulation of pro-apoptotic

genes and alteration in signaling pathways thereby

restricting therapy induced apoptosis. Thus insights into

apoptotic mechanism and the factors that affect them is

critical to design more potent, specific and effective cancer

therapies.

TR, a purine nucleoside analogue with the potential

for use in cancer therapy has been demonstrated to exhibit

dual mechanism of action (Grusch et al, 1999). One

involves the inhibition of IMPDH, the rate limiting

enzyme for GTP and dGTP synthesis that plays a major

role in DNA synthesis, cell proliferation and regulation,

and the other causes the induction of apoptosis (Novotny

et al, 2002). In the present study we analyzed the apoptotic

signaling mechanism induced by TR in SiHa, Hep2 and

Ca Ski cells.

Mitochondria plays an important role in the

regulation of cell death. For example, anti-apoptotic

members of the Bcl-2 family of proteins, such as Bcl-2

and Bcl-xL, are located in the outer mitochondrial

membrane and act to promote cell survival. Many of the

pro-apoptotic members of the Bcl-2 family, such as Bad

and Bax also mediate their effects though the

mitochondria, either by interacting with Bcl-2 and Bcl-xL,

or through direct interactions with the mitochondrial

membrane. In the present study it seems that the observed

downregulation of Bcl-2 and Bcl-xL was sufficient to

cause cytochrome c release from the mitochondria, as

there was no significant change in the protein expression

level of Bax. In conjunction with our study there are

several reports in the literature that have shown that

apoptosis is induced without causing any change in Bax

protein level in cerebellar granule cells (CGCs), human

colorectal carcinoma (RKO) cells and in human non-small

lung cancer (H520) cells (Gorman et al, 1999; Ji et al,

2001; Khanna et al, 2004).

In our study, TR induced caspase-9 activation

followed by activation of downstream effector caspase-3,

whereas only a limited, non-significant increase in

caspase-8 was observed in all the three cell lines. Hence it

appears that TR induces apoptosis via the mitochondrial

pathway followed by caspase-3 activation and this

activation was followed by cleavage of its substrate poly

(ADP-ribose) polymerase (PARP), an enzyme involved in

short-patch base excision repair. This PARP cleavage by

TR in our study is contrary to a report where TR has been

reported to exhibit PARP inhibitory effect (Yalowitz et al,


205

2002). But similar to our findings there are reports in

which IMPDH inhibitors have been shown to cause PARP

cleavage in human ovarian carcinoma cell lines (Grusch et

al, 1999; Hunakova et al, 2000). Moreover our results

clearly demonstrate that caspase-8 is not a requirement for

TR induced apoptosis in SiHa, Hep2 and Ca Ski cells.

Also a non-significant difference in the protein expression

level of AIF was observed in untreated and treated cells

therefore ruling out the possibility of involvement of this

protein in TR induced apoptosis. It appears to execute

apoptosis via the non-receptor mediated caspase activation

which is dependent on p53, as we observed a significant

increase in p53 expression levels in all the three cell lines.

Also there was a significant increase in cytochrome c after

TR treatments, which further supports the involvement of

mitochondria in TR induced apoptotic signaling pathway.

Similar to our findings, the IMPDH inhibitor TR has been

shown to induce apoptosis in various leukemic and human

colon carcinoma cell lines (Yalowitz et al, 2002; Colovic

et al, 2003; De Abreu et al, 2003; Wright et al, 2004). It

selectively inhibits tumor cell growth and induces

apoptosis in various human tumor cell lines. IMPDH

inhibitors are biochemically convenient in inhibiting

parallel pathways, thus their antitumor potential is

particularly high.

In conclusion, our results indicate that TR induces

apoptosis via the intrinsic mitochondrial pathway in SiHa,

Hep2 and Ca Ski cells. Also, the downregulation of anti-

apoptotic proteins such as Bcl-2 and Bcl-xL and the

upregulation of p53 which accompanied with activation of

initiator as well as effector caspases-9, -3 by TR suggest

its potential usefulness as a therapeutic for cancer

treatment.

References Ashkenazi A and Dixit VM (1998) Death receptors: signalling

and modulation. Science 281, 1305-1308.

Borner C (2003) The Bcl-2 protein family: sensors and

checkpoints for life or death decisions. Mol Immunol 39,

615-647.

Budihardjo I, Oliver H, Lutter M, Luo H and Whang X (1999)

Biochemical pathways of caspase activation during

apoptosis. Annu Rev Cell Dev Biol 15, 269-290.

Calviello G, di Nicuolo F, Piccioni E, Marcocci ME, Serini S,

Maggiano N, Jones KH, Cornwell DG, Palloza P (2003) #-

Tocopheryl quinone induces apoptosis in cancer cells via

caspase-9 activation and cytochrome C release.

Carcinogenesis 24, 427-433.

Colovic M, Sefer D, Bogdanovic A, Suvajdzic N, Jankovic G,

Atkinson HD, Milenkovic P (2003) In vitro sensitivity of

hematopoietic progenitors to tiazofurin in refractory acute

myeloid leukemia and in the blast crisis of chronic myeloid

leukemia. Cancer Lett 195, 153-159.

Gorman AM, Bonfoco E, Zhivotovsky B, Orrenius S, Ceccatelli

S (1999) Cytochrome C release and caspase-3 activation

during colchicines-induced apoptosis of cerebellar granule

cells. Eur J Neurosci 11, 1067-1072.

Green DR, Reed JC (1998) Mitochondria and apoptosis. Science

281, 1309-1312.

Grifantini M. (2000). Tiazofurine ICN Pharmaceuticals. Curr

Opin Investig Drugs 1, 257-262.

Grusch M, Rosenberger G, Fuhrmann G, Braun K, Titscher B,

Szekeres T, Fritzer-Skekeres M, Oberhuber G, Krohn K,

Hengstschaeger M, Kruptiza G, Jayaram HN (1999)

Benzamide riboside induces apoptosis independent of

Cdc25A expression in ovarian carcinoma N.1 cells. Cell

Death Differ 6, 736-744.

Hunakova L, Bies J, Sedlak J, Duraj J, Jakubikova J, Takacsova

X, Novotny L (2000) Differential sensitivity of ovarian

carcinoma cell lines to apptosis induced by the IMPDH

inhibitor benzamide riboside. Neoplasma 47, 274-279.

Jayaram HN, Cooney DA, Grusch M, Krupitza G. (1999)

Consequences of IMP dehydrogenase inhibition, and its

relationship to cancer and apoptosis. Curr Med Chem 6,

561-574. Ji C, Amarnath V, Peitenpol JA, Marnett LJ (2001) 4-

hydroxynonenal induces apoptosis via caspase-3 activation

and cytochrome c release. Chem Res Toxicol 14, 1090-

1096.

Khanna N, Jayaram HN, Singh N (2004) Benzamide riboside

induced mitochondrial mediated apoptosis in human lung

cancer H520 cells. Life Sci 75, 179-190.

Lowe SW, Lin AW (2000) Apoptosis in cancer. Carcinogenesis

21, 485-495.

Novotny L, Rauko P, Yalowitz JA, Szekeres T (2002) Antitumor

activity of Benzamide riboside in vitro and in vivo. Curr

Med Chem 9, 773-779.

Sen S, Sharma H, Singh N (2005) Curcumin enhances

Vinorelbine mediated apoptosis in NSCLC cells by the

mitochondrial pathway. Biochem Biophys Res Commun

33, 1245-1252.

Sharma H, Sen S, Singh N (2005) Molecular pathways in the

chemosensitization of Cisplatin by quercetin in human head

and neck cancer. Cancer Biol Ther 4, 949-55.

Singh N, Khanna N, Sharma H, Kundu S, Azmi S (2002)

Insights into the molecular mechanism of apoptosis induced

by TNF-" in mouse epidermal JB6-derived RT-101 cells.

Biochem Biophys Res Commun 295, 24-30.

Strasser A, O’conor L, Dixit VM (2000) Apoptosis signalling.

Annual Rev Biochem 69, 217-245.

Tatton WG, Olanow CW (1999) Apoptosis in neurodegenerative

diseases: the role of mitochondria. Biochem Biophys Acta

1410, 195-213.

Tricot GJ, Jayaram HN, Lapis E, Natsumeda Y, Nichols CR,

Kneebone P, Heerema N, Weber G, Hoffman R. (1989).

Biochemically directed-therapy of leukemia with tiazofurin,

a selective blocker of inosine 5'-phosphate dehydrogenase

activity. Cancer Res. 49, 3696-3701.

Wright DG, Boosalis MS, Waraska K, Oshry LJ, Weintraub

LR,Vosburgh E. (1996). Tiazofurin effects on IMP-

dehydrogenase activity and expression in the leukemia cells

of patients with CML blast crisis. Anticancer Res. 16:3349-

51. Wright DG, Boosalis M, Malek K, Waraska K (2004) Effects of

the IMP-dehydrogenase inhibitor, Tiazofurin, in bcr-abl

positive acute myelogenous leukemia. Part II. In vitro

studies. Leuk Res 28, 1137-43.

Yalowitz JA, Pankiewicz K, Patterson SE, Jayaram HN (2002)

Cytotoxicity and cellular differentiation activity of

methylenebis (phosphonate) analogs of tiazofurin and

mycophenolic acid adenine dinucleotide in human cancer

cell lines. Cancer Lett 181, 31-8. Erratum in: Cancer Lett

199, 107-8.

Yuan XJ, Whang YE (2002) PTEN sensitizes prostate cancer

cells to death receptor-mediated and drug-induced apoptosis

through a FADD-dependent pathway. Oncogene 21, 319-

327.


206


207


Effects of spatial configuration on tumor cells

transgene expression Research Article

Cecilia C. Casais, Armando L. Karara, Gerardo C. Glikin, and Liliana M. E.

Finocchiaro* Unidad de Transferencia Genética, Instituto de Oncología "Ángel H. Roffo", Universidad de Buenos Aires, Argentina

__________________________________________________________________________________ *Correspondence: Liliana M. E. Finocchiaro, Ph.D, Unidad de Transferencia Genética, Instituto de Oncología "A. H. Roffo" UBA, Av. San Martín 5481, 1417 Buenos Aires, Argentina; Telephone/FAX: 54 (11) 4580-2813; Email: [email protected] Key words: multicellular tumor spheroids, persistent gene expression, non-viral vectors Abbreviations: !-galactosidase, (!gal); analysis of variance, (ANOVA); cytomegalovirus immediate early promoter, (CMVie); LM05e spheroids, (LM05e/S); monolayers, (/M); simian virus 40 early promoter/enhancer, (SV40e); spheroids, (/S); three-dimensional, (3D)

Received: 10 April 2006; Revised: 26 June 2006

Accepted: 10 July 2006 electronically published: August 2006

Summary We investigated the impact of the multicellular architecture on transgene expression of LM05e and LM3

spontaneous Balb/c-mammary adenocarcinoma and HEp-2 human laryngeal squamous carcinoma cell lines. When

transferred from monolayers to spheroids, tumor cells strongly enhanced transient transgene expression, which

surprisingly was still detectable 75 days after lipofection. The cytomegalovirus immediate early promoter (CMVie)

yielded a very high !-galactosidase (!gal) transgene expression, which resulted 8-, 6- and 3-fold greater in LM05e,

LM3 and HEp-2 spheroids than the corresponding monolayers. The SV40 early promoter displayed both, a lower

spheroids/monolayers ratio and about 10% of !gal expression driven by CMVie. Cis-addition of Epstein Barr virus

EBNA-1/oriP cassette enhanced the CMVie-driven transgene expression only in human HEp-2. Deletion of a 325 bp

5’ fragment of the CMVie promoter dropped spheroids !gal expression to 5%. This effect was restored to 10-25%

or 25-60% by the insertion of one KCS (18 bp) or four myc-max consensus sequences (67 bp) respectively. When

spheroids disassembled and grew as monolayers, !gal activity dropped accordingly. Our results demonstrated that

the spatial configuration determined the expression enhancement and persistence in spheroids, being an event: fully

reversible, proportional to spheroid compactness and independent of plasmid integration into the host genome.

I. Introduction Multicellular spheroids are tissue-like structures of

cells, with no artificial substrate for cell attachment (Mueller-Klieser, 1997). These cell aggregates organized in vitro have a great potential for a number of clinical and biomedical applications (Sutherland, 1998; Santini and Rainaldi, 1999). This three-dimensional (3D) cell system has been widely used as a model for microenvironmental effects on basic biological mechanisms, such as the regulation of proliferation, metabolism, differentiation, cell death, invasion, angiogenesis or immune response (Bates et al, 2000; Fehlauer et al, 2004). Compared to conventional monolayer cultures, 3D-cell aggregates resemble more closely the in vivo situation with regard to cell shape and cell environment, which in turn can affect gene expression and biological behavior of the cells. These 3D-structures offer a versatile in vitro system of

intermediate complexity between monolayer cultures in

vitro and tumors in vivo. In brief, spheroids combine the relevance of organized tissues with the controlled environment of in vitro methodology (Mueller-Klieser, 1997; Bates et al, 2000). Furthermore, they mirror the radius and chemosensitivity of differentiating tumors in

vivo more closely than conventional cell cultures (Olive and Durand, 1994; Kolchinsky and Roninson 1997; Fehlauer et al, 2004). Being highly complex systems, their cellular properties are dependent on the origin of the tumor cells, their transformation state, and medium and growth conditions.

Non-viral vectors such as cationic lipids have

important safety advantages over viral approaches,

including their reduced immunogenicity, low cytotoxicity

and minimal capacity for insertional mutagenesis (Glover

et al, 2005). Although the efficacy of new cationic lipids

Casais et al: Transgene expression in multicellular spheroids

208

formulations is comparable to adenovirus vectors, it takes

many more copies of transgene to achieve a comparable

expression. Despite the relative in vivo efficacy and

variability frequently associated to these non-viral vectors,

that varies greatly depending on the targeted tissue, many

groups have demonstrated clinical efficacy using intra-

tumor cationic lipid mediated gene transfer (Gottesman

2003; Yoshida et al, 2004; O’Malley et al, 2005). We have developed 3D-cell cultures established from

LM05e and LM3 spontaneous Balb/c murine mammary adenocarcinoma cell lines (Karara et al, 2002; Finocchiaro et al, 2004) and from HEp-2, a well-established human derived laryngeal squamous carcinoma tumor cell line, as models to investigate how the spatial configuration of cells affects the expression level of a transfected gene.

In this work we present evidence showing that transiently lipofected tumor cells, when transferred from 2D- to 3D-cultures, displayed higher and prolonged expression achieved by non-viral plasmid-based vectors. This enhancement was reverted when the spheroids were disassembled and reorganized as monolayers, and would occur independently of vector structure or integration into the host genome.

II. Materials and Methods A. Cell cultures and growth Cell lines derived from M05 (LM05e), M3 (LM3) and

M38 (LM38) spontaneous Balb/c murine mammary adenocarcinomas; B16-F10 C57 murine melanoma (ATCC #CRL-76475), and HEp-2 (human laryngeal squamous carcinoma, ATCC #CCL-23) were cultured as monolayers and multicellular spheroids as described (Karara et al, 2002, Finocchiaro et al, 2004). The size of growing spheroids was estimated during a period of 75 days as the average of two diameters and the results were expressed as mean (of a minimum of 20 spheroid diameters) ± s.e.m. (n=4 independent assays).

B. DNA synthesis determinations DNA synthesis was evaluated in cells seeded as spheroids

in 96-well plates (5x104 cells/well) by 3H-thymidine (New England Nuclear, Boston, MA; 1 Ci/mmol) incorporation as described (Finocchiaro et al, 2004). 3H-thymidine (0.3 µCi/well) was added to the cultures at 8, 15, 30, 45 and 60 days and incubation lasted for 72 hours. Cells were harvested and radioactivity was measured in a !-scintillation counter.

C. Plasmids Plasmids pCMV! (MacGregor and Caskey, 1989) and

pCH110 (Hall et al, 1983) are commercial (Clontech, Mountain View, CA), carrying the E. Coli lacZ gene under CMVie and SV40e promoters respectively.

An Eco RI fragment containing the human Epstein-Barr virus oriP and EBNA-1 gene (under its own promoter) from p205MTCAT (Yates et al, 1985) was cloned at the Eco RI site of pCMV!, yielding pEBCMV!.

A Sal I – Bst YI fragment containing the human Epstein-Barr oriP and EBNA-1 gene from pREP4 (Invitrogen, Carlsbad, CA) was cloned together with a Sal I - Bam HI fragment containing the CMVie promoter from pRc/CMV (Invitrogen) at the Sal I site of pCMV!, yielding pEB2CMV!. In this plasmid EBNA-1 is under the CMVie promoter.

We created a series of promoter constructs containing various lengths of the CMVie promoter upstream of !gal reporter

gene. After deleting in CMVie the Eco RI – Nco I 5’- fragment (326 bp), oligodeoxynucleotides carrying (i) 4 copies of the myc-max consensus binding sequence (bold) (Sugaya et al, 1996): 5’-AATTCCCACCACGTGGTGCCTCCCACCACGTG

GTGCCTCCCACCACGTGGTGCCTCCCACCACGTGGTGCCTC-3’ or (ii) one copy of the kinase consensus sequence (KCS, bold) (Kuhen et al, 1998): 5’-AATTCAGGGAAGG

CGGAGTCCAAC-3’ were ligated to replace the removed fragment yielding pMYCCMV! and pKCSCMV! respectively. (iii) Fill-in and self-ligation of the Eco RI – NcoI sites yielded p"5´CMV!. On the other hand, the full-length CMVie promoter was deleted in pCMV! (between Eco RI and Sac I sites) and replaced by (iv) an oligodeoxynucleotide preserving the CMVie sequences TATA-BOX and Sp1-CS2, obtaining pTATA!. (v) By inserting in pTATA! the oligodeoxynucleotide with the 4 copies of the myc-max consensus sequence upstream of the TATA-BOX and Sp1-CS2 sequences, we obtained pMYCTATA!.

pCMVGM was obtained by replacing the lacZ gene in pCMV! by the hGM-CSF gene. A Not I - Not I fragment containing the lacZ gene was deleted from pCMV! and replaced by a suitable multiple cloning site, in which an Xho I - Hind III fragment containing the hGM-CSF gene was inserted. In a similar way, we replaced the lacZ gene in pCH110 (Kpn I - Bam

HI fragment) by the hGM-CSF gene through an intermediate multiple cloning site, creating pSVGM.

Plasmids were amplified, grown and purified as described (Finocchiaro et al, 2004). Plasmid constructs used in this work are schematically depicted in Figure 1.

D. Liposome preparation and in vitro

lipofection DC-Chol (3!(N-(N',N'-dimethylaminoethane)-carbamoyl

cholesterol) and DMRIE (1,2-dimyristyloxypropyl-3-dimethyl-hydroxyethilammonium bromide) were synthesized and kindly provided by BioSidus S.A. (Buenos Aires, Argentina). DOPE (1,2-dioleoyl-sn-glycero-3-phosphatidyl ethanolamine) was purchased from Sigma (St Louis, MO). Liposomes were prepared at lipid/co-lipid molar ratios of 1:1 (DMRIE:DOPE) or 3:2 (DC-Chol:DOPE) by sonication as described (Felgner et al, 1994; Gao and Huang, 1995). Optimal DNA:lipid ratios and lipid mixtures were determined for every cell line: LM05e and HEp-2 cells were transfected with a mixture of 3:1 DC-Chol:DOPE/ DMRIE:DOPE at 1:4 µg DNA/nmol lipid, and LM3 cells were transfected with an equimolar mixture of DC-Chol:DOPE/DMRIE:DOPE at 1:6 µg DNA/nmol lipid.

Lipoplexes (0.5 µg DNA/cm2) were prepared in 0.1 M Na2HPO4/NaH2PO4 buffer (pH 7.3) and applied to cultured cells at a density of 3x104 cells/cm2 (about 30% confluence) in a serum-free medium (OptiMEM, Gibco-BRL, Gaithersburg, MD). In co-lipofections, 0.25 µg DNA/cm2 of each plasmid was used. After 6-8 hours, the lipofection mixture was removed and medium with serum was added. 12-18 hours later, lipofected cells were trypsinized and some of them were seeded on the top of solidified agar to form spheroids (2-3 x 105 cells/ml) while the remaining ones were kept in monolayer cultures on regular plates (2-3 x 104 cells/cm2). Cells were incubated in regular culture conditions. Twice a week, culture medium was totally (monolayers) or partially (spheroids) replaced.

For stable expression, cells were lipofected with hIL-2 or lacZ gene carried by pRc/CMV (Invitrogene) as described above. After 48 h cells were selected with medium containing 500-700 µg/ml geneticin (Gibco-BRL). Single clones were isolated and tested for their hIL-2 or !gal expression by ELISA or ONPG assays as described below.


209

Figure 1. Plasmids. CMVie: human cytomegalovirus immediate-early promoter. lacZ: E. Coli lacZ gene (coding for !-galactosidase). pUC: prokaryotic plasmid backbone. EBNA-1: Epstein-Barr virus nuclear antigen 1 gene. EBNA-1pr: EBNA-1 promoter. oriP: Epstein-Barr virus eukaryotic origin of replication. 3'CMV: 3' region of CMVie promoter (Nco I - Sac I fragment). 4myc: 4 copies of the myc-max consensus binding sequence. KCS: KCS consensus sequence. TATA: Sp1-CS2 and TATA-box CMVie sequences. SV40e: Simian Virus 40 early promoter. hGM-CSF: human granulocyte-macrophage colony stimulating factor gene. pBR322: prokaryotic plasmid backbone. (See Materials and Methods for detailed construction)

E. !-Galactosidase assays To measure gene transfer efficiency, lipofected cells were

trypsinized, fixed in suspension, stained with 5-bromo-4-chloro-3-indolyl !-D-galactopyranoside (X-Gal, Sigma) by standard methods (Teifel and Friedl, 1995; Finocchiaro et al, 2004) and counted. The same fixation and staining procedure was performed onto spheroids in suspension for micrography (Finocchiaro et al, 2004).

For quantitative gene expression, trypsinized monolayers and untreated spheroids were collected, washed with PBS and divided in two fractions. One fraction was resuspended in hypotonic solution (10 mM HEPES, 10 mM KCl, 0.1 mM EDTA, 1 mM PMSF and 1 mM DTT) and sonicated for 5 seconds, and !gal activity was assayed with orthonitrophenyl 1-!-D-galactopyranoside (ONPG, Sigma) as described (Teifel and Friedl, 1995; Finocchiaro et al, 2004). The remaining fraction of each sample was resuspended in 0.1 N NaOH and total protein was measured as described (Bradford, 1976). Specific !gal activity was expressed as mU !gal/mg protein, as the mean ± s.e.m. of n independent assays measured by triplicate.

F. ELISA hGM-CSF assay Human recombinant GM-CSF secreted to the culture

medium was assayed by ELISA. Briefly, assays were performed in 96-well plates coated overnight at 4°C with 0.4 µg/well anti-hGM-CSF monoclonal antibody (R&D, Minneapolis, MN). Plates were subsequently blocked at room temperature with 2% BSA in PBS for 2 h. hGM-CSF samples and standards (purified recombinant hGM-CSF, R&D) were added and incubated overnight at 4°C. Then the samples were consecutively incubated with a biotinylated polyclonal anti-hGM-CSF antibody (20 ng/well) (R&D), streptavidin-peroxidase conjugate (Sigma) and a colorimetric substrate (OPD: o-phenylenediamine dihydrochloride, Gibco BRL). Absorbance was measured at 490 nm. Total protein was measured as described above. hGM-CSF levels were expressed as ng/mg protein/day, as the mean ± s.e.m. of n independent assays measured by triplicate.

G. Southern blot analysis Cells were lipofected with pCMV! or pEBCMV!

plasmids, cultured as spheroids over a 40-day period as

described, and genomic (Maniatis et al, 1982) and episomal (Hirt, 1967) DNA was extracted by standard methods. Portions (8 to 15 µg) of DNA were digested with Hind III, and fragments were electrophoresed on a 0.8% agarose gel and subjected to standard Southern transfer onto positively charged nylon membranes (GeneScreen, New England Nuclear). Hybridization was performed with a 32P-radiolabeled Eco RV - Sac I fragment (825-bp probe) of the lacZ gene contained in all !gal plasmids used.

H. Statistical analysis Results were expressed as mean ± standard error of the

mean (s.e.m.) (n: number of experiments corresponding to independent assays). Differences between groups were determined by analysis of variance (ANOVA).

III. Results and Discussion A. Tumor cells grew in vitro as

multicellular spheroids LM3, LM05e and LM38 (murine mammary

adenocarcinomas), B16 (murine melanoma), and HEp-2 (human laryngeal squamous carcinoma) cells readily formed spheroids when plated on the top of solidified agar. While LM05e and LM3 spheroid cells appeared intimately associated with each other and closely packed, HEp-2 formed more loosely associated cell aggregates in which single cells could be clearly distinguished (Figure

4). B16 initially formed lax aggregates, which became more compact beyond day 15 (Finocchiaro et al, 2004), and LM38 spheroids resulted similar to HEp-2 aggregates (data not shown).

Spheroids obtained from LM05e, LM3 and HEp-2 tumor cell lines revealed different growth potential (Figure 2). LM3 and HEp-2 aggregates showed extensive growth, increasing their diameter about 2.5-fold from day 4 to day 40, when they reached a plateau up to day 75. Conversely, compact LM05e spheres showed only a slight increase of 1.3-fold in diameter from day 4 to day 20, and then they reached a plateau up to day 75 (Figure 2a).


210

3D cell aggregates incorporate less 3H-thymidine than an equivalent amount of the corresponding monolayers (Finocchiaro et al, 2004). The rate of 3H-thymidine incorporation into DNA correlated with the diameter increase during the spheroid growing phase. Whereas LM05e spheroids (LM05e/S) displayed a very low 3H-thymidine incorporation rate over time, both LM3/S and HEp-2/S showed an initial higher rate at day 8 followed by a steady lower rate up to day 60 (Figure 2b). HEp-2/S doubled the LM3/S 3H-thymidine incorporation as total protein did, while both spheroids had similar diameters. Therefore, the higher 3H-thymidine incorporation by HEp-2/S should reflect a higher number of spheroids. LM05e/S showed low total amounts of protein, which correlates to their small size.

Total protein remained relatively constant over time in HEp-2/S and LM3/S, suggesting balanced growth and death rates. On the other hand, LM05e/S total protein decreased gradually over time, reaching 50% of the initial value at day 75. Considering that LM05e/S size did not decrease, this protein decay would be due to death of some small spheroids (Figure 2c).

B. Spheroids displayed enhanced and

persistent transgene expression In a previous study, we demonstrated that CMVie-

driven transgene expression in LM05e, LM3 and B16 spheroids was considerably higher than in their respective monolayers (Finocchiaro et al, 2004). To address this issue in greater detail, we compared the temporal course of CMVie and simian virus 40 early promoter/enhancer (SV40e) driven !gal expression in cells grown as monolayers (/M) or spheroids (/S). Before the development of long-lasting multicellular spheroid cultures generally, it was not possible to keep viable cells for more than two weeks in culture without active cell division, and transgene expression rapidly diluted over time. On the other hand, monolayers replating abolished most of transgene expression, which decreased between 10 to 100 times after two passages (data not shown). Therefore, we worked with monolayers that became mostly quiescent after reaching confluence, showing growth kinetics similar to spheroids: LM05e/M, LM3/M and HEp-2/M total protein increased 40, 50 and 70% respectively from day 8 to 15. A major advantage of spheroids is that they could be kept viable without replating for more than 75 days, while unreplated monolayer cultures started to detach and die beyond 15 days.

Figure 2. Growth parameters in spheroids. (a) Time course

of spheroids growth curves. Average spheroid diameters were calculated over 20 measurements in 4 independent assays. LM05e (!); LM3 (!); HEp-2 (!). LM3 and HEp-2 vs. LM05e: p<0.01.(b) 3H-thymidine incorporation into

spheroids DNA. LM05e (black bars), LM3 (gray bars) and HEp-2 (white bars) spheroids were 72 h pulsed with 3H-thymidine and harvested at each time point as described in Materials and Methods. Each point represents the mean ± s.e.m. of 4 determinations of the amount of 3H-thymidine incorporated into DNA. * p < 0.05 and ** p<0.01: with respect to LM05e o p < 0.05 and oo p<0.01: with respect to LM3 (c)

Time course of spheroids total protein. LM05e (!); LM3 (!); HEp-2 (!). Each value represents mean plus s.e.m. of 9 independent assays. LM3 and LM05e vs. HEp-2: p<0.05.


211

As shown in Figure 3a-c, the CMVie promoter directed higher-level reporter activity in cells grown as spheroids when compared to the same cells cultured as monolayers, displaying cell line specific patterns. In LM05e/S, !gal activity showed the highest expression levels with a maximum at day 8 after lipofection followed by a continuous decay that reached 10% of the maximal activity at day 75. LM3/S displayed a similar pattern with maximal !gal activity at days 4-8, and about 40% lower than LM05e/S. Then a relatively fast decay up to day 30 followed by a slow decay dropped the activity to 8% of the maximal activity at day 75. On the other hand, HEp-2/S

presented constant activity during the first 30 days after lipofection, followed by a slow decay that reached 37% of the maximal activity on day 75. Although HEp-2/S initial expression levels were only 10% of those of LM05e/S and about 20% of LM3/S, their slower decay over time determined that at day 75 HEp-2/S expression was similar to LM3/S and near 40% of LM05e/S.

In Figure 5a-c, pEBCMV! was compared to pCMV!. As expected, replicating pEBCMV! carrying an EBNA-1/oriP cassette displayed very different !gal activity patterns in rodent and human cells. In HEp-2

Figure 3. Effect of culture configuration on !gal reporter gene expression. Cultured cells were in vitro lipofected with pCMV! (n=14) or pCH110 (n=6) plasmids as indicated. Twenty-four hours later, part of the cells was then seeded on coated plates as spheroids (/S), while the other part was kept as monolayers (/M). In each time point, cells were homogenized and assayed for !gal activity as described in Materials and Methods. (a-c) Spheroids and monolayers !gal specific activity: expressed as mU/µg protein ± s.e.m of (n) independent assays after correction for background (pCMV!: n=14; pCH110: n=6). Spheroid pCMV! vs. pCH110: p<0.01 in the 3 cell lines. pCMV!: S (•)vs. M (!): p<0.01 in the 3 cell lines. pCH110: S (o)vs. M ("): p<0.01 in LM05e and LM3 from day 8 to 15. (d)

Spheroids !gal total activity: expressed as mU ± s.e.m. of 14 independent assays after correction for background. LM05e (!) and LM3 (!)vs. HEp-2 (!): p<0.01 up to 15 days after lipofection.


212

Although !gal activity in spheroids decreased over time, it is noteworthy that expression at day 75 was similar to monolayer expression at days 4-8 in all cell lines tested.

At day 4, !gal specific activity displayed by pCMV! resulted about 8-fold (LM05e), 6-fold (LM3) and 3-fold (HEp-2) greater in spheroids than the corresponding monolayers. In addition, pCMV! expression levels were longer standing in 3D- than 2D- cultures: at day 15, !gal activity was 109% (LM05e/S), 63% (LM3/S) and 117% (HEp-2/S) of that at day 4, while in monolayers, !gal activity relative to day 4 was 34, 21 and 45%, respectively. Taken together, these differences in levels and persistence of expression determined that, at day 15, !gal activity resulted 26-fold (LM05e), 14-fold (LM3) and 7-fold (HEp-2) greater in spheroids than in the corresponding monolayers. As it was the case in spheroids, monolayer maximal !gal activity in HEp-2 was lower than LM05e and LM3 (32 and 24% respectively).

The effect of spatial configuration resulted less dramatic when !gal was driven by SV40e promoter (pCH110), whose expression levels in spheroids were about 10% of pCMV!. Spheroid !gal expression was relatively constant over time in LM05e and HEp-2 cells, falling about 30% at day 15 in LM3.

In monolayers, differences between pCH110- and pCMV!- driven expression were smaller, with pCH110 displaying at day 4 after lipofection 26% of pCMV! activity in LM05e/M, 10% in LM3/M and 13% in HEp-2/M. SV40e-driven !gal activity was maximal in LM05e/M and LM3/M at day 4 followed by a 50% diminution at day 8 when a plateau was reached, while in HEp-2/M it remained constant from day 4 to day 15.

In both LM05e/S and LM3/S, SV40e-driven !gal activity was significantly higher, but in HEp-2/S was only slightly higher than their respective monolayers.

So, lower monolayers !gal expression with the two plasmids tested, was probably due to: (i) the decline in the percentage of transfected cells by transgene dilution during replication of the target population, and/or (ii) loss of the transgene by nuclease digestion or partitioning to non-nuclear compartments.

In general terms, cells growing as spheroids expressed significantly higher levels of !gal than the same cells in monolayers in all the assayed conditions, suggesting that 3D-configuration strongly enhanced transgene expression.

On the other hand, total spheroid !gal activity (mU) displayed a similar pattern to !gal specific activity (mU/mg protein). Maximal !gal total activity driven by CMVie promoter was comparable in LM05e/S and LM3/S (about 23 and 17 mU respectively) and much lower (about 6 mU) in HEp-2/S that displayed steady values from day 4 to 45 followed by a slow decay up to 50% on day 75. Nevertheless, total activity levels in the three assayed cell lines converged beyond day 45 (Figure 3d). It is worth to note that the relative values of maximum spheroid specific activity (mU/mg protein) among cell lines were maintained when expressed as total !gal activity (mU), demonstrating that they were not artificially produced by the differences in protein levels and that could be

attributed to actual variations of transgene expression. Therefore, we might suppose that the high expression in LM05e/S is a consequence of their low growth rate, slow plasmid loss kinetics and/or to the availability of the transcription/translation cellular machinery in quiescent cells. However, LM3/S have a growth pattern similar to HEp-2/S, but LM3/S maximum expression levels are about 6-fold higher than HEp-2/S and only 40% lower than LM05e/S, suggesting that a high expression rate is not in direct correlation with slow growth kinetics. On the other hand, taking into account that LM05e/S and LM3/S are clearly more compact than HEp-2/S, it can be suggested that the high expression correlates with the degree of compactness. Indeed, B16 (Finocchiaro et al, 2004) and LM38 (data not shown) spheroids, which are initially poorly compacted, display low initial expression levels.

The effects of spatial configuration on !gal reporter gene expression were confirmed by X-Gal staining of !gal-lipofected cells (Figure 4). The amount of X-Gal stained cells, clustered in defined regions throughout the spheroid, increased from day 1 to 15 after lipofection, and then displayed a first fast diminution from day 15 to 30 followed by a slow decay from day 30 to 75.

C. The EBNA-1/oriP cassette increased

the CMVie-driven !gal long-term expression

in human cells Since persistent gene expression is required for some

applications of gene therapy, we assayed the effect of some persistence elements and factors. We constructed pEBCMV!, an Epstein-Barr virus (EBV)-based vector carrying the EBV latent origin of replication for episomal persistence, oriP (about 2200 bp) and a replication initiation factor, EBNA-1 (EBV-encoded nuclear antigen 1). By binding to the cis-acting viral DNA element oriP in the Epstein-Barr virus genome, EBNA-1 enables plasmids to persist as multicopy episomes that attach to chromosomes during mitosis and enhances transcription from these EBV episomes (Yates et al, 1985; Kaneda et al, 2000; Tu et al, 2000).

In HEp-2 human cells, when equipping the plasmid with this cassette (pEBCMV!), there was a significant expression increase both in monolayers and spheroids from day 4 to 15. In HEp-2/S, !gal activity increased about 2-fold from day 4 to 15 after lipofection; then it reached a steady state up to day 30 when it started a slow decrease up to day 75 (about 70%). In murine LM3/S and LM05e/S, the cis-addition of the EBNA-1/oriP sequences not only did not modify pCMV! !gal expression in LM3/S but resulted in about 32% diminution with respect to pCMV! in LM05e/S, probably because the expression of EBNA-1 gene was employing an important fraction of the spheroid cellular machinery involved in gene expression and/or because of larger plasmids lower lipofection efficiency (Figure 5d). After high initial levels from day 4 to 15, !gal activity promptly decreased (about 90%) between day 15 and 75 in LM50e and LM3 spheroids since mouse genomes do not possess elements that allow replication and further segregation of the


213

Figure 4. Distribution of long-term !gal expression in spheroids. Representative micrographs of X-Gal stained LM05e, LM3 and HEp-2 spheroids at 4; 8; 15; 30; 45 and 60 days post-lipofection with pCMV!. Cells were transfected in vitro with lipoplexes containing pCMV!, harvested 24 h later and seeded on coated plates as multicellular spheroids. At each time point, specimens were fixed in suspension and stained with X-Gal, as described in Materials and Methods. The dark spheroid areas indicate !-galactosidase activity.


214

Figure 5. Effect of EBNA1/oriP persistence elements on !gal expression. (a-c) Time course of specific !gal reporter activity following lipofection with pCMV! (#,"), pEBCMV! ($,"), pEB2CMV! (",#) or pCMV!+pCMVGM (pCMV!/2) (%,&) plasmids in LM05e (a), LM3 (b) and HEp-2 (c) cells cultured as spheroids (main plot, black symbols) or monolayers (inserted plot, open symbols). At the indicated times, cells were homogenized and assayed for !gal activity as described in Materials and Methods. Results were expressed as mU of !gal activity/mg protein ± s.e.m. of (n) independent assays after correction for background (pCMV!: n=14; pEBCMV!: n=9; pEB2CMV!: n=8). Showing the P-values obtained by ANOVA test

PLASMID \ CELLS LM05e LM3 HEp-2

pCMV! vs. Spheroids Monolayer Spheroids Monolayer Spheroids Monolayer

pEBCMV! n.s. n.s. n.s n.s. p<0.05 (days 8-60)

p<0.05 (day 15)

pEB2CMV! p<0.05 (days 4-30)

n.s. p<0.05 (days 4-45)

n.s. n.s p<0.05 (day 4)

pCMV!/2 p<0.01 (days 4-45)

p<0.05 (days 4-8)

p<0.01 (days 4-45)

p<0.05 (days 4-8)

p<0.01 p<0.01 (days 4-8)

pCMV! /2 vs. pEBCMV! p<0.01

(days 4-15) p<0.05

(days 4-8) p<0.01

(days 4-15) p<0.01

(days 4-8) p<0.01

p<0.01

pEB2CMV! p<0.01

(days 4-15) p<0.05 (day 8)

p<0.05 (day 8)

p<0.05 (days 4-8)

p<0.01

n.s.

(d) Effect of EBNA1/oriP cassette on gene transfer efficiency: LM05e (gray bars), LM3 (white bars) and HEp-2 (light gray bars) cells transfected with pCMV!, pEBCMV! or pEB2CMV! lipoplexes were stained with X-Gal 48 h later and counted as described in Materials and Methods. The results were expressed as % of X-Gal blue staining cells ± s.e.m. of (n) independent experiments (pCMV!: n=16; pEBCMV!: n=9; pEB2CMV!: n=8). + p < 0.05 and ++ p<0.01: with respect to pCMV! in the same cell line. o p < 0.05 and oo p<0.01: with respect to LM05e/S respective plasmid.


215

replicated EBV oriP plasmids to daughter cells upon cell division (Yates et al, 1985; Tu et al, 2000). Despite the differences observed between pCMV! and pEBCMV! expression in spheroids at earlier times after lipofection, in the three cell lines values tended to converge on day 75.

On the other hand, in monolayers from day 4 to 15, pEBCMV! !gal activity decreased about 50% in LM05e and 70% in LM3 cells, while remained constant in HEp-2 cells.

As it was the case with pCMV!, pEBCMV! also displayed a remarkable increase of specific activity in spheroids with respect to monolayers: about 7-fold for LM05e, 5-fold for LM3 and 4-fold for HEp-2 at day 8. In an EBNA-1/oriP construct, the replacement of EBNA-1 promoter by the stronger CMVie promoter resulted in a 20-fold increase in EBNA-1 expression (Kaneda et al, 2000; Tu et al, 2000). So, to investigate if a higher amount of EBNA-1 could induce a greater enhancement of transgene expression, we constructed pEB2CMV!, a plasmid similar to pEBCMV! but with EBNA-1 under CMVie promoter. However, this construct resulted in less efficient !gal expression in the three cell lines (Figure 5a-

c), suggesting that (i) the amount of this regulating protein driven by its own original promoter was already enough for maximal !gal activity driven by CMVie; (ii) an excessive amount of EBNA-1 bound to oriP might inhibit nuclear retention and/or migration of the plasmid, presumably because of the formation of large complexes that cannot pass through the nuclear pore (Kaneda et al, 2000), (iii) the presence of this second CMVie promoter, competing for the same factors and (iv) of this CMVie-driven gene competing for the transcription/translation machinery, had a significant inhibitory effect on !gal expression. A similar effect was observed with pCMV! !gal expression, when co-transfected with a second plasmid carrying the human granulocyte-macrophage colony stimulating factor (hGM-CSF) gene under CMVie promoter. As shown in Figure 5a-c, co-expression of hGM-CSF under CMVie promoter caused a dramatic inhibition of !gal activity (about 90% inhibition in LM05e/S and LM3/S (day 8), and 70% in HEp-2/S (day 15)). This exceeded the expected diminution in expression levels due to half amount of plasmid used in co-lipofection experiments. However, pEB2CMV!-driven !gal expression in spheroids and monolayers was higher than !gal expression in pCMV!+pCMVGM co-lipofection (Figure 5a-c). In spheroids, these differences were about 6-fold in LM05e, 2-fold in LM3 and 3-fold in HEp-2 at day 8, while beyond 45 days values tended to converge. In monolayers this effect was weaker: pEB2CMV!-driven !gal expression was about 2-fold (LM05e), 3-fold (LM3) and 1.5-fold (HEp-2) higher than !gal expression from pCMV!+pCMVGM at day 8.

On the other hand, in each cell line, lipofection efficiency measured as X-Gal stained cells at day 1 partially correlated with !gal specific activity measured by the ONPG method (Figure 5d). Despite the fact that pCMV! displayed the highest efficiencies, larger pEB2CMV! and pEBCMV! plasmids resulted about 55-60% of pCMV!. The relative strengths of the constructs in

different cell lines were approximately the same, with LM05e being the most efficient for transgene expression followed by HEp-2 and LM3 (about 30 % of LM05e). It is worth to note that while LM3 and HEp-2 cells displayed similar lipofection efficiencies, the significantly higher total and specific !gal expression in LM3/S with respect to HEp-2/S would be related to the degree of spheroid compactness.

D. Persistent reporter activity was due to

sustained transgene expression To evaluate if !gal activity persistence was due to sustained transgene expression in addition to slow foreign protein turnover in the cytoplasm, we also analyzed the long-term expression of a secreting gene product such as hGM-CSF. By co-lipofection of pCMV! and pCMVGM, intracellular !gal expression was paralleled to extracellularly secreted cytokine produced by the hGM-CSF gene. As it occurred for !gal, the maximal hGM-CSF production in LM3 and LM05e spheroids appeared between days 4 and 15 with a fast decay up to day 30 followed by a slower decay up to day 75 (Figure 6a). Since 24 h hGM-CSF secretion after renewing the culture medium reflects the actual transgene expression rate, the equivalent kinetics of both transgenes in LM3 and LM05e spheroids confirmed that persistence was mainly due to continuous gene expression. But HEp-2 spheroids, whose expression levels were markedly lower than those of LM05e (about 10%), showed a maximal hGM-CSF production at day 4 followed by a continuous decay that dropped the expression to 5% of the initial level at day 40. When comparing the expression patterns of both transgenes, we can see that in HEp-2 cells hGM-CSF production dropped faster than !gal activity. Since the half-life of the !-galactosidase enzyme in some cell lines could reach several days (Klunder and Hulser, 1993), we can assume that persistence of HEp-2 !gal activity was partially due to its stability in cytoplasm. On the other hand, the continuous and long-term exposure of spheroid cells to high levels of secreted hGM-CSF could display unspecific mild toxic effect leading to down regulate its own expression or to hGM-CSF degradation. This result obtained with in vitro cultured HEp-2 spheroids strikingly paralleled in vivo G-CSF expression as measured in serum after i.v. injections of the G-CSF gene containing lipoplexes specially devised for long-term expression (Tu et al, 2000).

At day 8, monolayers displayed lower hGM-CSF production than spheroids in LM05e (about 3-fold) and in LM3 (about 20-fold), as occurred with !gal activity. Conversely, at day 4 the hGM-CSF production resulted equivalent in HEp-2 spheroids and monolayers. But in all cell lines monolayers production immediately dropped, while spheroid hGM-CSF production did it smoothly. This gave rise to greater differences between spheroids and monolayers at day 15: at this time, S/M production ratios were 118 for LM3, 20 for HEp-2 and 7 for LM05e.

As it was the case with the !gal gene, SV40e promoter drove a significantly lower hGM-CSF production than CMVie promoter with similar decay kinetics in all cell lines), and this production was lower in monolayers than in spheroids,


216

except in LM05e cells, where both S and M displayed similar production levels (Figure 6d-f).

Figure 6. Expression analysis of secreting human GM-CSF gene product. (a-c) Time course of specific !-galactosidase activity and hGM-CSF production after co-lipofection with pCMV! (circles) + pCMVGM (triangles) plasmids in LM05e, LM3 and HEp-2 cells cultured as spheroids (/S, black symbols) or monolayers (/M, open symbols). Data are expressed as a percentage over the !-gal activity or hGM-CSF production in spheroids at day 4. Each value represents mean ± s.e.m. of (n) independent assays (pCMV!: n=20; pCMVGM: n=9). Maximal !-gal activities (mU/mg protein): 64 (LM05e/S), 67 (LM3/S) 23 (HEp-2/S). Maximal hGM-CSF production (ng/106cells/day): 1568 (LM05e/S), 1185 (LM3/S), 783 (HEp-2/S). pCMV! vs. pCMVGM: p<0.01 at days 15 to 75 in HEp-2/S. pCMV! vs. pCMVGM: p<0.01 at days 8 to 15 in HEp-2/M. (d-f) Time course of hGM-CSF specific production after co-lipofection with pCMV! + pCMVGM (triangles) or pCH110 + pSVGM (squares) plasmids in LM05e, LM3 and HEp-2 cells cultured as spheroids (/S, black symbols) or monolayers (/M, open symbols). Each value represents mean ± s.e.m. of (n) independent assays (pCMVGM: n=9; pSVGM: n=4). pCMVGM vs. pSVGM: p<0.01 in the 3 lines.


217

E. The full-length CMVie promoter

mediated maximal transgene expression in

spheroids The control of transgene expression is a complex

process, dependent in part on the availability and/or activity of cellular factors and proximal sequences necessary for promoter function. The full-length CMVie promoter mediated a very high spheroid transgene expression of plasmid DNA for prolonged periods. To characterize some properties of CMVie promoter (533 bp), we designed a series of constructs derived from pCMV! (Figure 1) containing various lengths of the CMVie promoter upstream of !gal reporter gene: (i) p!5'CMV!: a construct containing the 3’ region of CMVie promoter that goes from Nco I to Sac I sites (208 bp), where the 5’ region between EcoR I and NcoI sites (325 bp) was deleted. This deleted region was substituted by (ii) four tandem repeats containing the myc-max consensus binding sequence (Sugaya et al, 1996), yielding pMYCCMV!, or (iii) 1 copy of the KCS sequence (Kuhen et al, 1998) (which binds factors released in presence of !-IFN), yielding pKCSCMV!. On the other hand, (iv) the full-length CMVie promoter was deleted and replaced by a minimal promoter containing the 3´CMVie sequences TATA-BOX and Sp1-CS2, obtaining pTATA!; and then (v) four tandem repeats of myc-max consensus binding sequence were added upstream, yielding pMYCTATA!.

The reporter gene activity of all these constructs was evaluated in monolayers and spheroids over a 75-day period (Figure 7).

Deletion of a 325 bp Eco RI - Nco I fragment (p!5'CMV!) strongly dropped the expression of the reporter gene driven by CMVie promoter in the three cell lines, either cultured as spheroids (more than 95% inhibition) or monolayers (about 80-85% inhibition). The insertion of 4 myc-max consensus sequences (67 bp) partially restored the CMVie promoter strength: 25% in LM05e/S and 50-60% in LM3/S and HEp-2/S. Since myc-max levels arise with proliferation and apoptosis, the lower activity of this construct in LM05e could be due to the lower growth rate of these cells as spheroids. Conversely, in monolayers this restoration was nearly total at day 4 in LM05e and HEp-2. Probably these cells express higher levels of myc-max proteins while proliferating.

The insertion of only 18 bp of the KCS sequence restored about 10-25% (spheroids) and 25-60% (monolayers) of the CMVie promoter activity. This specific behavior would be due to different levels of regulatory factors binding to promoters in 2D- and 3D-cultured cells.

On the other hand, because of the lack of enough regulatory elements, pTATA! could support only 10% of the pCMV! expression even after the insertion of 4 myc-max sequences (pMYCTATA!).

Four important conclusions may be drawn from these data: (i) the composition of the expression cassette was a major determinant of the levels of transgene expression, but did not affect its time extent; (ii) the full-length CMVie promoter mediated the best transgene expression

of plasmid DNA; (iii) transgene expression was dependent on the promoter and the number of regulating sequences; and (iv) spheroids always displayed higher transgene activity than the corresponding monolayers.

Here, we demonstrated that cells assembled as spheroids strongly enhanced transgene expression of all the tested plasmids, but perhaps the most surprising finding was that reporter expression was still detectable 75 days after lipofection. As far as we know, such in vitro

persistent transgene expression from non-viral vectors has not been reported previously.

F. The effects of culture configuration on

transgene expression were reversible When transferred from non-adhesive to regular cell

culture plates, spheroids tended to disassemble and grow as monolayers. The ability to form these monolayers was inversely correlated to the degree of compactness of spheroids: HEp-2 spheroids formed these monolayers more readily than LM05e or LM3, and this ability decreased in the three cell lines over the time, when spheroids became more compact.

Spheroids lipofected with pCMV! were transferred to regular plates at different times (4 to 37 days post-lipofection), and 7 days later, specific !gal activity was measured in both spheroids and the resulting monolayers (removing previously the remaining spheroids). As it can be seen in Figure 8, !gal activity in these monolayers dropped to similar values than control monolayers in all cell lines. At every time point, monolayers !gal activities were more than 90% lower than the parental spheroids from which they derived 7 days before, while if they continued as spheroids expression only dropped 5 to 50% in LM05e/S and HEp-2/S, and 15 to 75% in LM3/S from day 15 to 45. These results demonstrated that the expression enhancement tightly depends on spatial configuration and that it can be reversible. These findings were confirmed by microscopy (Figure 8, right panel). Eight days after lipofection spheroids were transferred to regular plates, and 2 to 4 days later, the remaining spheroids and the radially growing monolayers were X-Gal stained for !gal expression and photographed. As expected, intense staining can be seen in the remaining assembled spheroids, while monolayers showed few or no stained cells.

G. Long-term transgene expression

occurred independently of plasmid

integration into the host genome Genomic and episomal DNA of spheroids at day 40

post-lipofection with pCMV! and pEBCMV! were prepared and subjected to Southern blot analysis with a lacZ probe (as described in Materials and methods). The Southern transfer could not reveal any integration of plasmid vectors into the host genome and episomal plasmid was detected 40 days post-lipofection demonstrating that most of these lipofected plasmids remained as episomes (Figure 9).

On the other hand, pCMVhIL2 transiently lipofected LM3 cells produced at day 8: 36.5 ± 4.5 or 332.1 ± 47.8


218

ng hIL-2/mg protein/day as monolayers or spheroids respectively (n=7). Conversely, pRc/CMVhIL2 stably transfected LM3 and LM38 monolayers, expressed at day 4: 1.0 ± 0.4 and 2.3 ± 0.7 ng hIL-2/mg protein/day respectively (n=4). When transferred from monolayers to spheroids, the same stably transfected cells produced undetectable hIL-2 levels (<0.1 ng mg/mg protein/day). This opposite effect of spatial configuration on integrated

transgenes was confirmed by pRc/CMV! stably transfected LM3 cells. Whereas as monolayers !gal activity remained mostly constant (146±18 U/mg protein) from day 4 to 15 respectively, the same stably lipofected cells growing as spheroids presented similar levels from day 4 to 8 (133±19 U/mg protein), dropping to 42 % of the

Figure 7. Properties of a partially deleted/substituted

CMVie promoter. Specific !-galactosidase activity after lipofection with pCMV! (circles), pMYCCMV! (squares), pKCSCMV! (triangles), p"5'CMV! (rhombs), pMYCTATA! (squares, dotted line) or pTATA! (rhombs, dotted line) plasmids in LM05e, LM3 and HEp-2 cells cultured as spheroids (black symbols) or monolayers (open symbols). Each value represents mean ± s.e.m. of (n) independent assays (pCMV!: n=14, pMYCCMV!: n=9, pKCSCMV!: n=6, p"5'CMV!: n=8, pMYCTATA!: n=5, pTATA!: n=5).

Showing the P-values obtained by ANOVA test

PLASMID/CELLS LM05e LM3 HEp-2

pCMV! vs. Spheroids Monolayer Spheroids Monolayer Spheroids Monolayer

pMYCCMV! p<0.01 n.s. p<0.05 (days 45-75)

n.s. p<0.05 (days 8-15)

p<0.05 (days 8-15)

pKCSCMV! p<0.01 n.s. p<0.05 n.s. p<0.05 p<0.05 (days 8-15)

p"5'CMV!, pTATA! pMYCTATA!

p<0.01 p<0.05 p<0.01 p<0.05 p<0.01 p<0.05

p"5'CMV! , pTATA!

pMYCTATA! vs.

pMYCCMV! p<0.01 p<0.05 p<0.01 (days 4-30)

p<0.05 p<0.01 (days 4-60)

p<0.05 (days 4-8)

pKCSCMV! p<0.01 p<0.05 p<0.01 (days 4-15)

p<0.05 p<0.01 (days 4-60)

p<0.05 (days 4-8)


219

Figure 8. Effects of culture configuration reversion on transgene expression. Left panel: Specific !-galactosidase activity from LM05e, LM3 and HEp-2 spheroids (gray bars) and monolayers derived from the respective spheroids (white bars) at different times after lipofection with pCMV!. At each time point, the monolayers derived from disassembling spheroids seeded in regular culture plates 7 days before. Each value represents mean ± s.e.m. of 6 independent assays. Right panel: Representative micrographs of X-Gal stained LM05e, LM3 and HEp-2 disassembling spheroids and the radially growing monolayers at 11 days post-lipofection with pCMV!. (Spheroids were transferred to regular culture plates at day 8 post-lipofection). Dark spheroid areas indicate !-galactosidase activity.


220

Figure 9. Southern blot analysis of spheroid episomal DNA. Forty days post-lipofection with pCMV! or pEBCMV!; LM05e, LM3 and HEp-2 spheroids DNA was extracted, electrophoresed, blotted and hybridized as described in Materials and Methods. Cell lines and plasmids are indicated on the picture. M: Hind III digested plasmids as size markers. monolayers activity on day 15 (S: 69±11 M: 165±11 U/mg protein; p<0.001, n=4). These results agree with those reporting a reduced portion of producing cells in stably transfected spheroids with respect to the same cells growing as monolayers (Klunder and Hulser, 1993).

All these data support the hypothesis that the high transgene expression in spheroids was driven by episomal plasmids, since in the case of any plasmid integration; its contribution to transgene expression would be negligible.

IV. Conclusion

The results presented in this paper suggest that monolayer cultures and 3D- spheroids represent two very different experimental tumor models. The most surprising finding was that tumor cells assembled as spheroids provide an approach for achieving strongly enhanced and persistent transgene expression. As far as we know, such in vitro persistent transient transgene expression from non-viral vectors has not been reported previously. All the plasmids so far tested showed an improved transgene expression in spheroids that correlated with their degree of compactness. Then, the major reason for enhanced expression of a heterologous transgene should be searched on specific cellular properties that appear to be optimized when growing in three-dimensional aggregates with respect to flattened monolayer cells as: (i) spherical cell and nuclear shape, (ii) the cellular environment, (iii) the DNA conformation and packing, (iv) the accessibility and composition of transcription factors, (v) the transcriptional/post-transcriptional activation, (vi) the increased protein synthesis, and (vii) cell cycle times that can affect gene expression and biological behavior.

An exciting property of spheroids was that the reporter gene expression was maintained during all the spheroid life span and seemed to occur independently of plasmid integration into the host genome. The significant differences in the activities driven by different constructs observed at day 8 converged to similar low values after 30-60 days of spheroids incubation, indicating that beyond the promoter used, the 3D-configuration is the main responsible for long-term gene expression. It is noteworthy that spheroids transgene expression at day 75 not only was detectable but it was similar to monolayer expression at day 8 in all cell lines tested. At least four processes seem to be critical for spheroid efficient and sustained expression of a heterologous transgene. First, the ability of spheroid cells to retain transfected DNA. Second, a low decline in the percentage of transfected cells by transgene dilution during replication of slowly proliferating spheroids. Third, a low loss of the transgene by nuclease destruction or partitioning to non-nuclear compartments. Fourth, a low attenuation of promoter function leading to silencing of transgene expression.

Two questions arise from our data: How significant would be the spatial configuration effect on transgene expression in vivo where 3D-assembled differentiated cells present low replication rates and can be metabolically active for very long times? Could non-integrative non-viral gene transfer be useful for particular gene therapy applications that need long-term transgene expression?

Although the search for new vectors (viral and non-

viral) continues, cationic liposomes are among the most

interesting vectors for cancer gene therapy because they

are non-infective, have low immunogenicity, low toxicity

and high stability, as well as low cost and ease of


221

production (Yoshida et al, 2004; Glover et al, 2005). In

addition, cationic lipids demonstrated to be sufficiently

effective in some cancer gene therapy approaches to be

used in veterinary (Dow et al, 1998; Finocchiaro et al,

2005) and human (Bergen et al, 2003; Yoshida et al, 2004;

O’Malley et al, 2005) clinical trials. The most positive message emerging from this article

is that the 3D-configuration is the main responsible for long-term gene expression. Multicellular tumor spheroids, which mimic more closely in vivo solid tumors and micrometastases, are realistic experimental models to investigate many aspects of tumor biology (Mueller-Klieser, 2000; Finocchiaro et al, 2004). It is therefore plausible to speculate that non-viral plasmid transfer of in

vivo tumors can achieve enhanced long-term transgene expression. This was confirmed by the fact that early passages cultured cell lines derived from five spontaneous canine melanomas formed spheroids that expressed pCMV! 3- to 6-fold more efficiently than their respective monolayers during the first 15 days after transient lipofection. Conversely, preliminary results suggest that the expression enhancement observed in tumor spheroids did not occur in the non-tumor monkey kidney VERO cell line (ATCC #CCL 81), that displayed similar levels of !gal activity in spheroids and monolayers (19.5 ± 3.3 and 25.3 ± 4.5 mU/mg protein, respectively, n=13), during the first 15 days following transient lipofection.

The biological and clinical significance of these observations remains to be determined. Therefore, the next step is to evaluate how broad this effect is in human non-tumor and tumor cells of various histologies. If enhanced long-term spheroids transgene expression is characteristic of tumor spheroids, the possibility of a targeted gene therapy where tumor cells express higher levels of the delivered gene than normal tissue is open. In addition, whether after gene transfer a low probability event of plasmid integration occurs, it would not significantly contribute to transgene expression. All these observations encourage the implementation of non-viral gene therapy strategies for the delivery of therapeutic genes to tumors where high-level and fairly long-lasting gene expression is required.

Acknowledgments We thank Ana Bihary for technical assistance, Dr.

Gabriel Fiszman for hIL-2 stably transfected LM3 and LM38 and Dr. Alejandro Urtreger for !gal stably transfected LM3. This work was partially supported by a grant from FONCYT: BID1201/OC-AR # PICT 2002 -12084, and a grant from BioSidus S.A. A.L.K., G.C.G. and L.M.E.F. are members, and C.C.C. is a fellow of the Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET, Argentina).

References Bates RC, Edwards NS, Yates JD (2000) Spheroids and cell

survival. Critical Rev Oncol Hematol 36, 61-74. Bergen M, Chen R, Gonzalez R (2003) Efficacy and safety of

HLA-B7/beta-2 microglobulin plasmid DNA/lipid complex (Allovectin-7) in patients with metastatic melanoma. Expert

Opin Biol Ther 3, 377-384.

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72, 248-254.

Dow SW, Elmslie RE, Willson AP, Roche L, Gorman C, Potter

TA (1998) In vivo tumor transfection with superantigen plus

cytokine genes induces tumor regression and prolongs

survival in dogs with malignant melanoma. J Clin Invest 101, 2406–2414

Fehlauer F, Stalpers LJ, Panayiotides J, Kaaijk P, Gonzalez Gonzalez D, Leenstra S, van der Valk P, Sminia P (2004) Effect of single dose irradiation on human glioblastoma spheroids in vitro. Oncol Rep 11, 477-485.

Felgner JH, Kumar R, Sridhar CN, Wheeler CJ, Tsai YJ, Border R, Ramsey P, Martin M, Felgner PL (1994) Enhanced gene delivery and mechanism studies with a novel series of cationic lipid formulations. J Biol Chem 269, 2550-2561.

Finocchiaro LME, Bumaschny VF., Karara AL, Fiszman GL., Casais CC, Glikin GC (2004) Herpes simplex virus thymidine kinase/ganciclovir system in multicellular tumor spheroids. Cancer Gene Ther 11, 333-345.

Finocchiaro LME, Maminska ME, Castillo PJJ, Karara AL, Fiszman GL, Riveros MD, Glikin GC. (2005) Tumor vaccine

combined with cytokines and suicide gene therapy for canine

spontaneous melanoma. Mol Ter 11 (Suppl. 1), S270. Gao X, Huang L (1995) Cationic liposome-mediated gene

transfer. Gene Ther 2, 710-722. Glover DJ, Lipps HJ, Jans DA (2005) Towards safe, non-viral

therapeutic gene expression in humans. Nat Rev Gen 6,299-

310. Gottesman MM (2003) Cancer gene therapy: an akward

adolescence. Cancer gene Ther 10, 501-508. Hall CV, Jacob PE, Ringold GM, Lee F (1983) Expression and

regulation of Escherichia coli lacZ gene fusions in mammalian cells. J Mol Appl Genet 2, 101-109.

Hirt B (1967) Selective extraction of polyoma DNA from infected mouse cell cultures. J Mol Biol 26, 365-369.

Kaneda Y, Saeki Y, Nakabayashi M, Zhou WZ, Kaneda MW, Morishita R (2000) Enhancement of transgene expression by cotransfection of OriP plasmid with EBNA-1 expression vector. Hum Gene Ther 11, 471-479.

Karara AL, Bumaschny VF, Fiszman GL, Casais CC, Glikin GC, Finocchiaro LME. (2001) Lipofection of early passages of cell cultures derived from murine adenocarcinomas: in vitro and ex vivo testing of the thymidine kinase/ganciclovir system. Cancer Gene Ther 8, 96-99.

Klunder I, Hulser DF (1993) Beta-galactosidase activity in transfected Ltk- cells is differentially regulated in monolayer and in spheroid cultures. Exp Cell Res 207, 155-162.

Kolchinsky A, Roninson IB (1997) Drug resistance conferred by MDR1 expression in spheroids formed by glioblastoma cell lines. Anticancer Res 17, 3321-3328.

Kuhen KL, Vessey JW, Samuel CE (1998) Mechanism of Interferon Action: Identification of Essential Positions within the Novel 15-Base-Pair KCS Element Required for Transcriptional Activation of the RNA-Dependent Protein Kinase pkr Gene. J Virol 72, 9934–9939.

MacGregor GR, Caskey T (1989) Construction of plasmids that express E coli !-galactosidase in mammalian cells. Nucleic

Acids Res 17, 2365-2365. Maniatis T, Fritsch EF, Sambrook J (1982) Molecular Cloning, a

laboratory manual.; Cold Spring Harbor Laboratory, 280-281.

Mueller-Klieser W (1997) Three-dimensional cell cultures: from molecular mechanisms to clinical applications. Am J Physiol 273, C1109-C1123.

Mueller-Klieser W (2000) Tumor biology and experimental therapeutics. Critical Rev. Oncol Hematol 36, 123-139.


222

Olive PL, Durand RE (1994) Drug and radiation resistance in spheroids: cell contact and kinetics. Cancer Metastasis Rev 13, 121-138.

O’Malley BW Jr, Li D, McQuone SJ, Ralston R (2005) Combination Nonviral Interleukin-2 Gene Immunotherapy For Head and Neck Cancer: From Bench Top to Bedside. Laryngoscope 115,391-414.

Santini MT, Rainaldi G (1999) Three-dimensional spheroid model in tumor biology. Pathobiology 67, 48-157.

Sugaya S, Fujita K, Kikuchi A, Ueda H, Takakuwa K, Kodama S, Tanaka K (1996) Inhibition of tumor growth by direct intratumoral gene transfer of herpes simplex virus thymidine kinase gene with DNA-liposome complex. Hum Gene Ther 7, 223-230.

Sutherland R, Buchegger F, Schreyer M, Vacca A, Mach JP (1987) Penetration and binding of radiolabeled anti-carcinoembryonic antigen monoclonal antibodies and their antigen binding fragments in human colon multicellular tumor spheroids. Cancer Res 47, 1627-1633.

Sutherland RM (1998) Cell and environment interactions in tumor microregions: the multicell spheroid model. Science 240, 177-184.

Teifel M, Friedl P (1995) New lipid mixture for efficient lipid-mediated transfection of BHK cells. Biotechniques 19, 79-82.

Tu G, Kirchmaier AL, Liggitt D, Liu Y, Liu S, Yu WH, Heath TD, Thor A, Debs RJ (2000) Non-replicating Epstein-Barr virus-based plasmids extend gene expression and can improve gene therapy in vivo. J Biol Chem 39, 30408-30416.

Yates JL, Warren N, Sugden B (1985) Stable replication of plasmids derived from Epstein-Barr virus in various mammalian cells. Nature 313, 812-815.

Yoshida J, Mizuno M, Wakabayashi T (2004) Interferon-! gene

therapy for cancer: Basic research to clinical application.

Cancer Sci 95, 858-865.


223


Use of lectin as an anchoring agent for adenovirus-

microbead conjugates: Application to the

transduction of the inflamed colon in mice Research Article

Alan Jerusalmi, Samuel J. Farlow and Takeshi Sano* Center for Molecular Imaging Diagnosis and Therapy and Basic Science Laboratory, Department of Radiology, Beth Israel

Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts, USA

__________________________________________________________________________________

*Correspondence: Takeshi Sano, Ph.D., Beth Israel Deaconess Medical Center, 77 Avenue Louis Pasteur, Harvard Institutes of

Medicine 118, Boston, Massachusetts 02115, USA; Tel: +1-617-667-0142; Fax: +1-617-975-5560; e-mail [email protected] Key words: Adenoviral vectors; virus-microbead conjugates; lectin; interleukin-10; inflammatory bowel disease

Abbreviations: 2,4,6-trinitrobenzenesulfonic acid, (TNBS); 4'-6-diamidino-2-phenylindole, (DAPI); 5-bromo-4-chloro-3-indoyl-!-D-

galactopyronoside, (X-gal); concanavalin A, (Con A); cytomegalovirus, (CMV); enzyme-linked immunosorbent assay, (ELISA);

inflammatory bowel disease, (IBD); interleukin-10, (IL-10); phosphate-buffered saline, (PBS)

Received: 18 July 2006; Revised: 21 August 2006

Accepted: 23 August 2006; electronically published: August 2006

Summary Virus-mediated delivery of therapeutic transgenes to the inflamed colon offers a great potential to serve as an

effective therapeutic strategy for inflammatory bowel disease (IBD). However, the transduction of the inflamed

colon by viral vectors upon intra-colonical administration is generally poor, primarily because of the inability of

administered viral vectors to associate stably with the colonic tissue. We investigated if the use of adenoviral vectors

in the form of virus-microbead conjugates could enhance the transduction efficiency of the inflamed colon. In

particular, a lectin, concanavalin A (Con A), was tested as an anchoring agent for adenovirus-microbead

conjugates. The co-attachment of Con A allowed adenovirus-microbead conjugates to associate stably with target

cells when analyzed in vitro. Intra-colonical administration of adenovirus-microbead conjugates containing Con A

resulted in efficient transduction of the inflamed colon, while little transduction was seen with adenovirus-

microbead conjugates without Con A or free adenoviral vectors. When adenoviral vectors carrying the mouse

interleukin-10 gene were used, local interleukin-10 levels became considerably higher upon intra-colonical

administration of adenovirus-microbead conjugates containing Con A. These results demonstrate that Con A can

serve as an effective anchoring agent for adenovirus-microbead conjugates and suggest that adenovirus-microbead

conjugates containing Con A may be useful for efficient delivery of therapeutic transgenes to the inflamed colon for

the therapy of IBD.

I. Introduction Over the course of the last few years, we have

developed a novel gene transfer technology, in which

adenoviral vectors are attached stably to the surfaces of

microbeads (nanoparticles) using the extremely strong

(strept)avidin-biotin interaction and delivered to target

cells in the form of adenovirus-microbead conjugates

(Pandori et al, 2002; Pandori and Sano, 2005). When

analyzed in vitro, such adenovirus-microbead conjugates

showed infectivities equivalent to or even greater than

adenoviral vectors used free in solution. In particular, the

infectivity for target cells, which are poorly permissive to

infection by free adenoviral vectors, can be enhanced

considerably. In addition, the use of microbeads as virus

carriers allows the co-attachment of other materials to the

microbead surface to enhance or control the functionality

of the adenovirus-microbead conjugates. In the present

study, we investigated if this gene transfer technology with

adenovirus-microbead conjugates could be used for

efficient transduction of the inflamed colon by adenoviral

vectors toward its application to gene therapy of

inflammatory bowel disease (IBD), such as Crohn’s

disease and ulcerative colitis (for reviews, Podolsky, 2002;

Strober et al, 2002; Bouma and Strober, 2003; Dignass et

al, 2004; Korzenik and Podolsky, 2006).

The colorectal system is potentially an attractive

target for in vivo somatic gene therapy since it is readily

accessible externally. However, the presence of the

mucous coat on the epithelium and the dynamic fluidic

Jerusalmi et al: Adenovirus-microbead conjugates containing lectin

224

properties of the colorectal system act as barriers for the

access to the colonic tissue by viral vectors that are

administered intra-colonically. In IBD, chronic intestinal

inflammation occurs, which causes severe destruction of

the mucosal layer. This exposes the colonic tissue, making

it directly accessible by viral vectors that are administered

intra-colonically. However, the dynamic fluidic properties

of the colorectal system limit the direct, stable contact of

administered viral vectors with the colonic tissue. This

considerably reduces the overall transduction efficiency of

the colonic tissue by viral vectors. Thus, previous attempts

for intra-colonical delivery of viral vectors to the inflamed

colon involved the use of large amounts of viral vectors to

achieve sufficient levels of transgene expression (Lindsay

et al, 2003; Wirtz et al, 1999, 2002). This suggests that, if

viral vectors could be made capable of associating stably

with colonic cells, the transduction of the colonic tissue by

viral vectors could be enhanced considerably. In the

present study, we tested if intra-colonical administration of

adenoviral vectors in the form of virus-microbead

conjugates could enhance the transduction of the inflamed

colon. In particular, we investigated if the co-attachment

of an anchoring agent to adenovirus-microbead conjugates

could provide the conjugates with the abilities to associate

stably with the colonic tissue and to transduce the

inflamed colon efficiently. We chose a lectin,

concanavalin A (Con A), as a potential anchoring agent.

Con A, isolated from Canavalia ensiformis (Jack bean)

seeds, binds to "-D-glucopyranosyl and "-D-

mannopyranosyl moieties, which exist abundantly in

carbohydrate chains on the cell surfaces (Lis and Sharon,

1986, 1998; Sharon and Lis, 1989, 1995). We previously

showed that the co-attachment of Con A can restore the

ability of adenovirus-microbead conjugates containing

chemically inactivated adenoviral vectors to associate

stably with target cells (Pandori and Sano, 2005). We

hypothesized that the co-attachment of Con A allows

adenovirus-microbead conjugates to associate stably with

the colonic tissue upon intra-colonical administration,

resulting in efficient transduction of the inflamed colon.

II. Materials and Methods A. Adenoviral vectors Two adenoviral vector constructs, both of which are

derived from adenovirus serotype 5 with the deletion of the viral

E1 and E3 genes, were used in this study. One adenoviral vector

construct, Ad5.CMV-LacZ (Qbiogene, Montreal, Canada),

carries the bacterial lacZ (!-galactosidase) gene under the control

of the human cytomegalovirus (CMV) immediate/early

promoter. The other adenoviral vector construct, Ad5.CMV-

IL10, carries the mouse interleukin-10 (IL-10) gene containing

the coding sequence for the signal peptide under the control of

the CMV immediate/early promoter (a generous gift from Dr.

Andrea Gambotto, University of Pittsburgh School of Medicine).

B. Cell lines The following four cell lines were used as targets: HeLa

(human cervical adenocarcinoma), COLO 205 (human colorectal

adenocarcinoma), MIP-101 (human colonic carcinoma), and

SW620 (human colorectal adenocarcinoma). These cell lines

were obtained from the American Type Culture Collection

(Manassas, VA, USA), except for MIP-101 that is a generous gift

from Dr. Peter Thomas, Boston University School of Medicine.

HeLa and SW620 cells were maintained in Dulbecco’s modified

Eagle’s medium (BioWhittaker) supplemented with 10% fetal

bovine serum (BioWhittaker). COLO 205 and MIP-101 cells

were maintained in RPMI 1640 (BioWhittaker) supplemented

with 10% fetal bovine serum, 4.5 mg/ml glucose, 1.5 mg/ml

sodium bicarbonate, and 10 mM 4-(2-hydroxyethyl)-1-

piperazineethanesulfonic acid.

C. Preparation of adenovirus-microbead

conjugates with and without the co-attachment of

Con A Adenovirus-microbead conjugates were prepared by the

method described previously (Pandori et al, 2002). Briefly,

purified adenoviral vectors (Ad5.CMV-LacZ or Ad5.CMV-IL10)

were biotinylated using sulfo-NHS-LC-biotin (Pierce) at 20

#g/ml, at which concentration the viral infectivity can be

maintained (Pandori et al, 2002; Hobson et al, 2003). After non-

virion-associated biotinylation reagent was removed by repeated

ultrafiltration, the resulting biotinylated adenoviral particles were

attached to avidin-coated polystyrene microbeads (diameter, 0.48

#m; specific gravity, 1.06 g/cm3; Spherotech) at appropriate

ratios. The co-attachment of Con A to the microbead surfaces

was done by the addition of excess biotinylated Con A (Vector

Laboratories) to adenovirus-microbead conjugates (2.5 #g

biotinylated Con A per 1.67 x 107 microbeads), followed by the

removal of unbound Con A. The addition of excess biotinylated

Con A is essential for the prevention of the formation of

aggregates, which have considerably reduced infectivity. Under

these conditions, the surfaces of the microbeads, to which

adenoviral vectors had been attached, should be saturated with

biotinylated Con A.

D. Infectivity analysis of adenovirus-

microbead conjugates containing Ad5.CMV-LacZ The infectivity of adenovirus-microbead conjugates with

and without the c-attachment of Con A, prepared using

Ad5.CMV-LacZ as above, was analyzed on HeLa and COLO

205 cell lines. Cells were cultured in wells (5 x 104 cells per

well) at 37 °C for 24 hr. An appropriate amount of adenovirus-

microbead conjugates or free Ad5.CMV-LacZ was applied to

each well (the actual amount of adenoviral particles added to

each well is given in the legends to Figures 1 and 3). Cells were

incubated for 37 °C for 48 hr, fixed with 0.5% glutaraldehyde,

and stained for !-galactosidase (LacZ) activity using X-gal (5-

bromo-4-chloro-3-indoyl-!-D-galactopyronoside) as the

substrate. The numbers of infected cells, which were stained

blue, were counted under a light microscope.

E. Cell-binding analysis of adenovirus-

microbead conjugates Adenovirus-microbead conjugates with and without the co-

attachment of Con A were prepared using Ad5.CMV-LacZ at 50

adenoviral particles per microbead, as described above. These

conjugates were applied to HeLa and COLO 205 cells grown at

37 °C on glass cover slips. At 4 hr and 24 hr after the application

of adenovirus-microbead conjugates, cells were washed with

PBS (phosphate-buffered saline) and fixed with 4%

paraformaldehyde. Cell nuclei were stained with DAPI (4'-6-

diamidino-2-phenylindole; blue fluorescence), and stained cells

were examined under a fluorescence microscope with

appropriate filters (Axioscop 2, Carl Zeiss). Association of

adenovirus-microbead conjugates with target cells can be

detected by cell-associated red fluorescence, derived from the

microbeads used that contain a rhodamine derivative.


225

F. Analysis of in vitro production of mouse

IL-10 upon transduction by adenovirus-

microbead conjugates containing Ad5.CMV-IL10 Adenovirus-microbead conjugates with and without the co-

attachment of Con A were prepared using Ad5.CMV-IL10 at 50

adenoviral particles per microbead, as above. The ability of these

conjugates to produce mouse IL-10 upon transduction was

analyzed by using three colonic cell lines (COLO 205, MIP-101,

and SW620), along with HeLa cells, as targets. Cells were

cultured in wells (5 x 104 cells per well) at 37 °C for 24 hr.

Appropriate amounts of adenovirus-microbead conjugates with

and without the co-attachment of Con A, along with free

Ad5.CMV-IL10, were applied to target cells (the actual amount

of adenoviral particles added to each well is given in the legend

to Figure 5). Cells were incubated at 37 °C for 24 hr, and the

amounts of mouse IL-10, which had been produced and secreted

into the culture media, were determined quantitatively by

enzyme-linked immunosorbent assays (ELISA) (OptEIA Mouse

IL-10 ELISA kit; BD Pharmingen). Purified recombinant mouse

IL-10 (BD Pharmingen) was used as the standard for

quantitation.

G. Transduction of the inflamed colon in

mice upon intra-colonical administration of

adenovirus-microbead conjugates containing

Ad5.CMV-LacZ All animal procedures were carried out in accordance with

NIH guidelines following approval by the Harvard Medical Area

Standing Committee on Animals. Adenovirus-microbead

conjugates with and without the co-attachment of Con A were

prepared using Ad5.CMV-LacZ at 50 adenoviral particles per

microbead, as above. A mouse acute colitis model was prepared

by intra-colonical administration of 0.75 mg TNBS (2,4,6-

trinitrobenzenesulfonic acid), dissolved in 100 #l of 50% ethanol

(TNBS-induced colitis) (Jurjus et al, 2004), into Balb/c mice (6 -

8 weeks old; Taconic) by enema. At 48 hr after the

administration of TNBS, adenovirus-microbead conjugates with

and without the co-attachment of Con A, along with free

Ad5.CMV-LacZ, were administered intra-colonically into mice

by enema (5 x 108 adenoviral particles in 100 #l PBS per mouse).

At 48-hr post-administration, mice were euthanized, and their

colons were collected. The colon samples were frozen in tissue

freezing media (Tissue-Tek O.C.T. compound, Miles), followed

by the preparation of cryosections (thickness, 5-7 #m). These

colon sections were subjected to the analysis of transduction by

Ad5.CMV-LacZ or the detection of microbeads, used as

adenovirus carriers. For transduction analysis, colon sections

were stained for !-galactosidase activity using X-gal as the

substrate, with counter-staining with neutral red. Stained colon

sections were examined under a light microscope. For the

detection of microbeads (red fluorescence), colon sections were

counter-stained with DAPI and examined under a fluorescence

microscope.

H. Production of mouse IL-10 in the inflamed

colon upon intra-colonical administration of

adenovirus-microbead conjugates containing

Ad5.CMV-IL10 Adenovirus-microbead conjugates with and without the co-

attachment of Con A were prepared using Ad5.CMV-IL10 at 50

adenoviral particles per microbead, as described above. These

adenovirus-microbead conjugates, along with free Ad5.CMV-

IL10, were administered intra-colonically into mice with TNBS-

induced colitis by enema (1 x 109 adenoviral particles in 100 #l

PBS per mouse) (3 mice per sample). At 24-hr post-

administration, mice were euthanized, and their colons were

collected. Each colon sample was homogenized in 2 ml of 0.25

mM Tris-Cl (pH 7.8) using a glass Potter homogenizer. The

resulting homogenates were centrifuged at 4 °C at 1,600 x g for

20 min, and the supernatants were subjected to the quantitation

of mouse IL-10 by ELISA in triplicate (OptEIA Mouse IL-10

ELISA kit), as described in F above. The total protein contents of

the supernatants were also determined by the protein assay

method of Bradford (Bradford, 1976) using bovine serum

albumin as the standard.

III. Results A. Effect of the number of viral particles

per microbead on the infectivity of

adenovirus-microbead conjugates First, we analyzed the effect of the number of

adenoviral particles per microbead on the infectivity of

adenovirus-microbead conjugates using cultured cells. An

adenoviral vector construct carrying the lacZ (!-

galactosidase) gene (Ad5.CMV-LacZ) was used.

Adenovirus-microbead conjugates were prepared by the

method, described in the Materials and Methods section, at

varying numbers of adenoviral particles per microbead.

The infectivity of the resulting adenovirus-microbead

conjugates, along with free Ad5.CMV-LacZ as a control,

was analyzed in vitro using two cell lines, HeLa

(moderately permissive to infection by free adenoviral

vectors) and COLO 205 (very poorly permissive to

infection by free adenoviral vectors) (Fechner et al, 2000)

(Figure 1). On HeLa cells, the infectivity of adenovirus-

microbead conjugates was approximately 60 - 70% of that

of free Ad5.CMV-LacZ. However, the infectivity of the

conjugates was hardly affected by the number of

adenoviral particles per microbead tested (up to 50

adenoviral particles per microbead). In contrast, when

COLO 205 cells were used as targets, the infectivity of

adenovirus-microbead conjugates slightly increased with

increasing the number of adenoviral particles per

microbead. At 50 or 100 adenoviral particles per

microbead, the infectivity of the conjugates became even

higher than that of free Ad5.CMV-LacZ. However, the

overall effect of the number of adenoviral particles per

microbead on the infectivity of adenovirus-microbead

conjugates was found to be relatively small in the range

tested (up to 100 adenoviral particles per microbead), in

agreement with a previous study (Pandori et al, 2002).

From these results, we decided to use adenovirus-

microbead conjugates containing 50 adenoviral particles

per microbead in subsequent experiments.

B. Effect of the co-attachment of Con A

on the cell-binding ability and the infectivity

of adenovirus-microbead conjugates The effect of the co-attachment of Con A on the

ability of adenovirus-microbead conjugates to associate

with target cells was analyzed using HeLa and COLO 205

cells as targets. Adenovirus-microbead conjugates with

and without the co-attachment of Con A were prepared

using Ad5.CMV-LacZ at 50 adenoviral particles per

microbead. These conjugates were applied to target cells,

and cell-associated red fluorescence, derived from the

microbeads that contain a rhodamine derivative (red


226

fluorescence), was visualized under a fluorescence

microscope (Figure 2). When Con A was attached to

adenovirus-microbead conjugates, the amount of cell-

associated red fluorescence became greater then that seen

with adenovirus-microbead conjugates without Con A for

both HeLa and COLO 205 cells. In particular, the co-

attachment of Con A allowed adenovirus-microbead

conjugates to associate efficiently with COLO 205 cells,

for which no appreciable association of the conjugates was

seen in the absence of the co-attachment of Con A. This

result demonstrates that the co-attachment of Con A can

considerably enhance the ability of adenovirus-microbead

conjugates to associate with target cells, in agreement with

a previous study with adenovirus-microbead conjugates

containing chemically inactivated adenoviral vectors

(Pandori and Sano, 2005).

The infectivity of adenovirus-microbead conjugates

was also investigated in the absence and presence of the

co-attachment of Con A using HeLa and COLO 205 cells

as targets. Adenovirus-microbead conjugates with and

without Con A were applied to target cells. At 48-hr post-

application, cells were analyzed for lacZ expression

(Figure 3). Adenovirus-microbead conjugates showed

higher infectivities than free Ad5.CMV-LacZ on both

HeLa and COLO 205 cells. The co-attachment of Con A

to adenovirus-microbead conjugates further enhanced the

infectivity of the conjugates. These results reveal that the

co-attachment of Con A makes adenovirus-microbead

conjugates capable of associating more efficiently with

target cells, resulting in enhanced transduction of the cells.

C. In vivo transduction of the inflamed

colon in mice by adenovirus-microbead

conjugates containing Ad5.CMV-LacZ The ability of adenovirus-microbead conjugates to

transduce the inflamed colon was investigated in vivo

using a mouse TNBS-induced colitis model. Adenovirus-

microbead conjugates with and without the co-attachment

of Con A were prepared using Ad5.CMV-LacZ at 50

adenoviral particles per microbead. These conjugates,

along with free Ad5.CMV-LacZ, were administered intra-

colonically by enema into mice with TNBS-induced colitis

(a total of 5 x 108 adenoviral particles per mouse). No

appreciable effect on the health and behavior of mice was

seen upon intra-colonical administration of free

Ad5.CMV-LacZ and its microbead conjugates with and

without the co-attachment of Con A until they were

euthanized. When free Ad5.CMV-LacZ was used, no

appreciable transduction was detected in colon sections

(Figure 4A). Similarly, little transduction of the colon was

seen when adenovirus-microbead conjugates without the

co-attachment of Con A was administered intra-

colonically (Figure 4B). In contrast, the use of

adenovirus-microbead conjugates containing Con A

resulted in efficient transduction of colonic cells (Figures

4C and 4D). Transduction was seen primarily near the

surfaces of mucosal layers, to which administered

adenovirus-microbead conjugates should have easy access

due to their destruction caused by colonic inflammation.

Colon sections were also analyzed under a

fluorescence microscope for the presence of adenovirus-

microbead conjugates. When adenovirus-microbead

conjugates were used without the co-attachment of Con A,

few red fluorescence spots, derived from the microbeads

used that contain a rhodamine derivative, were seen in

colon sections (Figure 4E). In contrast, red fluorescent

spots were seen in many colon sections when adenovirus-

microbead conjugates with Con A were administered

intra-colonically (Figure 4F). This result reveals that

adenovirus-microbead conjugates can associate stably with

Figure 1. Effect of the number of viral particles per microbead on the infectivity of adenovirus-microbead conjugates. Adenovirus-

microbead conjugates were prepared using Ad5.CMV-LacZ at varying numbers of adenoviral particles per microbead. The infectivity of

the resulting adenovirus-microbead conjugates were analyzed on HeLa and COLO 205 cell lines. Cells were cultured in wells (5 x 104

cells per well) at 37 °C for 24 hr. Adenovirus-microbead conjugates, along with free Ad5.CMV-LacZ, were applied to each well (2 x 107

adenoviral particle per well for HeLa cells, and 2 x 108 adenoviral particles per well for COLO 205 cells), and cells were incubated at 37

°C for 48 hr. Cells were stained for !-galactosidase activity using X-gal as the substrate, and the number of infected cells in each well

was counted under a light microscope. Each datum shown is the average number of infected cells per well with a standard deviation (n =

8 for HeLa cells, and n = 9 for COLO 205 cells).


227

Figure 2. Enhancement of the ability of adenovirus-microbead conjugates to associate with target cells by the co-attachment of Con A.

Adenovirus-microbead conjugates with and without the co-attachment of Con A were prepared using Ad5.CMV-LacZ at 50 adenoviral

particles per microbead. These conjugates were applied to HeLa and COLO 205 cells. At 4 hr and 24 hr after the application of

adenovirus-microbead conjugates, cells were washed and fixed. Then, cell nuclei were stained with DAPI (blue fluorescence), and

stained cells were examined under a fluorescence microscope with appropriate filters. Association of adenovirus-microbead conjugates

with target cells can be detected by cell-associated red fluorescence, derived from the microbeads used that contain a rhodamine

derivative (red fluorescence). Representative images are shown.

Figure 3. Enhancement of the infectivity of adenovirus-microbead conjugates by the co-attachment of Con A. Adenovirus-microbead

conjugates with and without the co-attachment of Con A were prepared using Ad5.CMV-LacZ at 50 adenoviral particles per microbead.

The infectivity of these conjugates was analyzed on HeLa and COLO 205 cells. Cells were cultured in wells (5 x 104 cells per well) at 37

°C for 24 hr. Adenovirus-microbead conjugates, along with free Ad5.CMV-LacZ, were applied to each well (5 x 107 adenoviral particles

per well for HeLa cells, and 5 x 108 adenoviral particles per well for COLO 205 cells), and cells were incubated at 37 °C for 48 hr. Cells

were stained for !-galactosidase activity using X-gal as the substrate, and the number of infected cells in each well was counted under a

light microscope. Each datum shown is the average number of infected cells per well with a standard deviation (n = 12). A, free

Ad5.CMV-LacZ; B, adenovirus-microbead conjugates without the co-attachment of Con A; C, adenovirus-microbead conjugates with

the co-attachment of Con A.

the colonic tissue upon administration into the inflamed

colon and transduce colonic cells efficiently if Con A is

co-attached to the conjugates. Without the co-attachment

of Con A, adenovirus-microbead conjugates have a limited

ability to transduce the colonic tissue, similar to free

adenoviral vectors. These results demonstrate that Con A

can serve as an efficient anchoring agent for adenovirus-

microbead conjugates, providing the conjugates with the

ability to transduce the colonic tissue efficiently upon

intra-colonical administration.

D. In vitro production of mouse IL-10

upon transduction by adenovirus-microbead

conjugates containing Ad5.CMV-IL10 Experimental results with Ad5.CMV-LacZ above

(Figure 4) suggest that adenovirus-microbead conjugates

containing Con A could be useful for the delivery of

therapeutic transgenes to the inflamed colon for the

therapy of IBD. To test this, we used an adenoviral vector

construct carrying the gene for a potent anti-inflammatory

factor, IL-10. IL-10 is a promising therapeutic agent for


228

IBD, particularly for Crohn's disease. IL-10 has potent

immuno-suppressive and anti-inflammatory activities and

plays a key role in mucosal immuno-regulation, inhibiting

both the innate and cell-mediated inflammatory responses

(de Waal Malefyt et al, 1992; Moore et al, 2001). IL-10

also inhibits the synthesis of pro-inflammatory cytokines,

such as tumor necrosis factor-", IL-2, IL-3, and interferon-

$, the elevated expression of which is seen in IBD

patients. IL-10 knockout mice (IL-10-/-) spontaneously

develop an enterocolitis with multi-focal inflammatory

lesions throughout the gastrointestinal tract (Kuhn et al,

1993; Spencer et al, 1998). This strongly suggests the

potential therapeutic effectiveness of IL-10 for IBD.

Initially, the ability of adenovirus-microbead

conjugates, prepared using Ad5.CMV-IL10, to produce

the encoded IL-10 upon transduction of target cells was

analyzed in vitro. Three colonic cell lines, COLO 205,

MIP-101 (poorly permissive to infection by free

adenoviral vectors), and SW620 (very poorly permissive

to infection by free adenoviral vectors), along with HeLa

cells, were used as targets. Adenovirus-microbead

conjugates with and without the co-attachment of Con A

(50 adenoviral particles per microbead), along with free

Ad5.CMV-IL10 as a control, were applied to target cells.

At 24-hr post-administration, the amount of mouse IL-10,

which had been expressed and secreted into the culture

media, was determined quantitatively by ELISA (Figure

5). When adenovirus-microbead conjugates without Con A

were used, the amount of mouse IL-10 produced was

slightly reduced, as compared to free Ad5.CMV-IL10. In

contrast, the production of mouse IL-10 became

significantly greater for all of the cell lines when

Ad5.CMV-IL10 was used in the form of adenovirus-

microbead conjugates containing Con A. These results

demonstrate that the use of adenovirus-microbead

conjugates containing Con A can considerably enhance the

transduction of colonic cell lines by Ad5.CMV-IL10,

resulting in efficient production of the encoded mouse IL-

10.

Figure 4. In vivo transduction of the inflamed colon in mice by Ad5.CMV-LacZ upon intra-colonical administration of adenovirus-

microbead conjugates with and without the co-attachment of Con A. Adenovirus-microbead conjugates with and without the co-

attachment of Con A were prepared using Ad5.CMV-LacZ at 50 adenoviral particles per microbead. These conjugates, along with free

Ad5.CMV-LacZ, were administered intra-colonically into mice with TNBS-induced colitis by enema (a total of 5 x 108 adenoviral

particles per mouse). At 48-hr post-administration, mice were euthanized, and colon cryosections were prepared. For transduction

analysis, colon sections were stained for !-galactosidase activity using X-gal as the substrate, with counter-staining with neutral red (A -

D). Stained colon sections were examined under a light microscope. A, free Ad5.CMV-LacZ; B, adenovirus-microbead conjugates

without the co-attachment of Con A; C and D, adenovirus-microbead conjugates with the co-attachment of Con A. For the detection of

microbeads (red fluorescence), colon sections were counter-stained with DAPI (blue fluorescence) and examined under a fluorescence

microscope (E and F). E, adenovirus-microbead conjugates without the co-attachment of Con A; F, adenovirus-microbead conjugates

with the co-attachment of Con A. Representative images are shown.


229

Figure 5. Enhanced production of mouse IL-10 by cells upon transduction by adenovirus-microbead conjugates with the co-attachment

of Con A. Adenovirus-microbead conjugates with and without the co-attachment of Con A were prepared using Ad5.CMV-IL10 at 50

adenoviral particles per microbead. Three colonic cell lines (COLO 205, MIP-101, and SW620), along with HeLa cells, were used as

targets. Cells were cultured in wells (5 x 104 cells per well) at 37 °C for 24 hr. Adenovirus-microbead conjugates, along with free

Ad5.CMV-LacZ, were applied to each well (5 x 107 adenoviral particles per well for HeLa cells; 5 x 108 adenoviral particles per well for

COLO 205 and SW620 cells; 3 x 108 adenoviral particles per well for MIP-101 cells). Cells were incubated at 37 °C for 24 hr, and the

amounts of mouse IL-10, produced and secreted into culture media, were determined quantitatively by ELISA. Each datum shown is the

total amount of mouse IL-10 produced per well with a standard deviation (n = 6). A, Free Ad5.CMV-IL10; B, adenovirus-microbead

conjugates without the co-attachment of Con A; C, adenovirus-microbead conjugates with the co-attachment of Con A.

Figure 6. Local IL-10 levels in the inflamed colons upon intra-

colonical administration of adenovirus-microbead conjugates

with and without the co-attachment of Con A. Adenovirus-

microbead conjugates with and without the co-attachment of

Con A were prepared using Ad5.CMV-IL10 at 50 adenoviral

particles per microbead. These conjugates, along with free

Ad5.CMV-IL10, were administered intra-colonically into mice

with TNBS-induced colitis by enema (a total of 1 x 109

adenoviral particles per mouse). At 24-hr post-administration,

colon homogenates were prepared from mice, and the amounts

of IL-10 in the colon homogenates were determined by ELISA.

Each datum shown is the average amount of mouse IL-10 in

the colon homogenate, normalized at 1 mg total protein, with a

standard deviation. A, control (without the administration of

Ad5.CMV-IL10); B, free Ad5.CMV-IL10; C, adenovirus-

microbead conjugates without the co-attachment of Con A; D,

adenovirus-microbead conjugates with the co-attachment of

Con A.


230

E. Local production of IL-10 in the

inflamed colon upon intra-colonical

administration of adenovirus-microbead

conjugates containing Ad5.CMV-IL10 Adenovirus-microbead conjugates containing Con A

were used to test if local IL-10 levels in the colons of mice

with TNBS-induced colitis could be raised upon intra-

colonical administration of the conjugates. Adenovirus-

microbead conjugates with and without Con A (50

adenoviral particles per microbead), along with free

Ad5.CMV-IL10, were administered intra-colonically into

mice with TNBS-induced colitis (a total of 1 x 109

adenoviral particles per mouse). No appreciable changes

of the health and behavior were seen with mice upon intra-

colonical administration of free Ad5.CMV-IL10 and its

microbead conjugates with and without the co-attachment

of Con A. At 24-hr post-administration, the local level of

mouse IL-10 in the colon was determined quantitatively

by ELISA (Figure 6). When free Ad5.CMV-IL10 was

used, the level of mouse IL-10 in the colon became

slightly higher than that of control mice, which received

no adenoviral vectors. The use of adenovirus-microbead

conjugates without Con A slightly reduced the local IL-10

level in the colon, as compared to that of control mice. In

contrast, when Ad5.CMV-IL10 was administered intra-

colonically in the form of adenovirus-microbead

conjugates containing Con A, the amount of IL-10 in the

colon was raised considerably to a level that is almost an

order of magnitude higher than that of control mice.

We also tested if either avidin-coated microbeads,

used as virus carriers, or Con A, used as an anchoring

agent for adenovirus-microbead conjugates, contributed to

the elevated IL-10 level in the colon, seen with intra-

colonical administration of adenovirus-microbead

conjugates containing Con A above. In particular, Con A

might have contributed to the elevated IL-10 level in the

colon since repeated, intravenous administration of Con A

can induce IL-10 production (Louis et al, 2000).

Biotinylated Con A was attached to avidin-coated

microbeads to saturate the microbead surface, followed by

the removal of unbound Con A. The resulting avidin-

coated microbeads containing Con A were administered

intra-colonically into mice with TNBS-induced colitis by

enema (a total of 2 x 107 microbeads in 100 #l PBS per

mouse; the same amount of microbeads as that used for

adenovirus-microbead conjugates containing Ad5.CMV-

IL10 above). At 24-hr post-administration, mice were

euthanized, and the local IL-10 levels in the colons were

determined quantitatively by ELISA. No appreciable

changes in the local IL-10 levels were seen, as compared

to control mice that received PBS alone (P > 0.4),

suggesting that neither avidin-coated microbeads nor

conjugated Con A induced the production of IL-10 in the

colon (data not shown). These results indicate that the

elevated IL-10 level in the colon upon intra-colonical

administration of adenovirus-microbead conjugates

containing Con A (Figure 6) was indeed derived from the

transduction of the colon by Ad5.CMV-IL10. These

results reveal that intra-colonical administration of

Ad5.CMV-IL10 in the form of adenovirus-microbead

conjugates containing Con A allows for efficient

transduction of the colon with TNBS-induced colitis,

raising the local IL-10 level considerably.

IV. Discussion We have demonstrated that the use of adenovirus-

microbead conjugates containing Con A allows for

efficient transduction of the inflamed colon by adenoviral

vectors upon intra-colonical administration by enema. The

co-attachment of Con A as an anchoring agent has shown

to be essential for enhanced transduction of the inflamed

colon by adenovirus-microbead conjugates. Without the

co-attachment of Con A, adenovirus-microbead conjugates

showed a limited ability to transduce the inflamed colon,

and their transduction efficiency was similar to that of free

adenoviral vectors. These results suggest the potential for

the gene transfer technology with adenovirus-microbead

conjugates containing Con A to serve as an effective

means for the delivery of therapeutic transgenes to the

inflamed colon for the therapy of IBD. In addition, the size

of adenovirus-microbead conjugates and the use of Con A

as an anchoring agent could effectively inhibit systemic

absorption of the conjugates. This could reduce

uncontrolled migration of adenoviral vectors to and

subsequent transduction of non-target organs.

Furthermore, since adenovirus-microbead conjugates

containing Con A have higher infectivity and broader

tropism than free adenoviral vectors, a smaller amount of

adenoviral vectors should be needed to achieve a given

level of transgene expression. Hence, the use of

adenovirus-microbead conjugates containing Con A for

the delivery of therapeutic transgenes to the inflamed

colon could also offer safety enhancement by minimizing

both undesirable transduction of non-target organs and the

number of adenovirus vectors required.

With an efficient transduction system for the

inflamed colon now in hand, it should be possible to

investigate, rigorously, the effect of local expression of the

IL-10 and other therapeutic genes in the colon on the

amelioration of established colitis. Studies are currently in

progress by using a few different mouse colitis models,

including the one with TNBS-induced colitis used in this

study, to ask if the intra-colonical delivery of Ad5.CMV-

IL10 to the inflamed colon in the form of adenovirus-

microbead conjugates containing Con A could offer

enhanced amelioration of colitis. These studies address

several key questions, including the relationship between

the local levels of IL-10 in the colon and the therapeutic

effect on established colitis and whether the use of

adenoviral vectors in the form of adenovirus-microbead

conjugates containing Con A could minimize uncontrolled

migration of viral particles to non-target organs. In

addition, what cell types in the colon can be transduced by

adenoviral vectors upon intra-colonical administration of

adenovirus-microbead conjugates containing Con A is

being determined, since this serves as a critical factor that

determines the persistency of the expression of the IL-10

and other therapeutic genes.

Acknowledgments We would like to thank Andrea Gambotto for


231

providing Ad5.CMV-IL10, Andrew Keates for the

instructions on the preparation of a mouse colitis model,

and Peter Thomas for providing the MIP-101 cell line. We

also thank Khashayarsha Khazaie, William Faubion, Cox

Terhorst, and Mark Pandori for useful suggestions. AJ was

supported by a training grant from the National Cancer

Institute (CA59367; awarded to Dr. Melvin E. Clouse).

This work was supported, in part, by the Broad Medical

Research Program of The Eli and Edythe L. Broad

Foundation (IBD-0078).

References Bouma G and Strober W (2003) The immunological and genetic

basis of inflammatory bowel disease. Nature Rev Immunol

3, 521-533.

Bradford MM (1976) A rapid and sensitive method for the

quantitation of microgram quantities of protein utilizing the

principle of protein-dye binding. Anal Biochem 72, 248-254.

de Waal Malefyt R, Yssel H, Roncarolo MG, Spits H and de

Vries JE (1992) Interleukin-10. Curr Opin Immunol 4, 314-

320.

Dignass AU, Baumgart DC and Sturm A (2004) Review article:

the aetiopathogenesis of inflammatory bowel disease--

immunology and repair mechanisms. Aliment Pharmacol

Ther 20 Suppl 4,9-17.

Fechner H, Wang X, Wang H, Jansen A, Pauschinger M,

Scherubl H, Bergelson JM, Schultheiss HP and Poller W

(2000) Trans-complementation of vector replication versus

Coxsackie-adenovirus-receptor overexpression to improve

transgene expression in poorly permissive cancer cells. Gene

Ther 7, 1954-1968.

Hobson DA, Pandori MW and Sano T (2003) In situ transduction

of target cells on solid surfaces by immobilized viral vectors.

BioMed Central Biotechnol 3, 4.

Jurjus AR, Khoury NN and Reimund J-M (2004) Animal models

of inflammatory bowel disease. J Pharmacol Toxicol

Methods 50, 81-92.

Korzenik JR and Podolsky DK (2006) Evolving knowledge and

therapy of inflammatory bowel disease. Nature Rev Drug

Discov 5, 197-209.

Kuhn R, Lohler J, Rennick D, Rajewsky K and Muller W (1993)

Interleukin-10-deficient mice develop chronic enterocolitis.

Cell 75, 263-274.

Lindsay JO, Ciesielski CJ, Scheinin T, Brennan FM and

Hodgson HJ (2003) Local delivery of adenoviral vectors

encoding murine interleukin 10 induces colonic interleukin

10 production and is therapeutic for murine colitis. Gut 52,

363-369.

Lis H and Sharon N (1986) Lectins as molecules and as tools.

Annu Rev Biochem 55, 35-67.

Lis H and Sharon N (1998) Lectins: Carbohydrate-specific

proteins that mediate cellular recognition. Chem Rev 98,

637-674.

Louis H, Le Moine A, Quertinmont E, Peny MO, Geerts A,

Goldman M, Le Moine O and Deviere J (2000) Repeated

concanavalin A challenge in mice induces an interleukin 10-

producing phenotype and liver fibrosis. Hepatology 31, 381-

390.

Moore KW, de Waal Malefyt R, Coffman RL and O'Garra A

(2001) Interleukin-10 and the interleukin-10 receptor. Annu

Rev Immunol 19, 683-765.

Pandori MW, Hobson DA and Sano T (2002) Adenovirus-

microbead conjugates possess enhanced infectivity: a new

strategy for localized gene delivery. Virology 299, 204-212.

Pandori MW and Sano T (2005) Chemically inactivated

adenoviral vectors that can efficiently transduce target cells

when delivered in the form of virus-microbead conjugates.

Gene Ther 12, 521-533.

Podolsky DK (2002) Inflammatory bowel disease. New Engl J

Med 347, 417-429.

Sharon N and Lis H (1989) Lectins as cell recognition molecules.

Science 246, 227-234.

Sharon N and Lis H (1995) Lectins–proteins with a sweet tooth:

functions in cell recognition. Essays Biochem 30, 59-75.

Spencer SD, Di Marco F, Hooley J, Pitts-Meek S, Bauer M,

Ryan AM, Sordat B, Gibbs VC and Aguet M (1998) The

orphan receptor CRF2-4 is an essential subunit of the

interleukin 10 receptor. J Exp Med 187, 571-578.

Strober W, Fuss IJ and Blumberg RS (2002) The immunology of

mucosal models of inflammation. Annu Rev Immunol 20,

495-549.

Wirtz S, Becker C, Blumberg R, Galle PR and Neurath MF

(2002) Treatment of T cell-dependent experimental colitis in

SCID mice by local administration of an adenovirus

expressing IL-18 antisense mRNA. J Immunol 168, 411-

420.

Wirtz S, Galle PR and Neurath MF (1999) Efficient gene

delivery to the inflamed colon by local administration of

recombinant adenoviruses with normal or modified fibre

structure. Gut 44, 800-807.


232


233


Replicating minicircles: Generation of nonviral

episomes for the efficient modification of dividing

cells Research Article

Kristina Nehlsen#,§, Sandra Broll# and Juergen Bode* GBF, German Research Centre for Biotechnology, Mascheroder Weg 1, D-38124 Braunschweig

__________________________________________________________________________________

*Correspondence: Juergen Bode, GBF, German Research Centre for Biotechnology, Mascheroder Weg 1, D-38124 Braunschweig,

Germany; Tel +49(0)531 6181 5200; Fax +49(0)531 6181 5002; [email protected]

Key words: replicating episome, nonviral vector, minicircle, S/MAR, maintenance element, segregation

Abbreviations: Luria-Bertani media, (LB); origins of replication, (ORIs); population doublings, (PDs); prototype episome, (pEPI);

scaffold/matrix attachment region, (S/MAR); stress-induced duplex destabilization, (SIDD)

§This work is part of the STREP-program in the EU-FW6 “Episomal Vectors as Gene Delivery Systems for Therapeutic

Application” (“EpiVector”)

#both authors contributed equally

Received: 23 August 2006; Accepted: 8 September 2006; electronically published: September 2006

Summary Nonviral replicating circular episomes are a rather new addition to the field of mammalian expression vectors.

After their establishment, which conventionally requires an initial phase under selection pressure, these entities

utilize the replication apparatus of the host cell to replicate in accord with the cell cycle. The requirements of a

selection agent, the gradual inactivation by cellular defense mechanisms, and a limited cloning capacity (up to 5 kb

could be realized for the prototype) have remained the critical parameters. Here we introduce a site-specific

recombination-based strategy that permits the excision of prokaryotic vector parts after the parental construct has

been amplified as a plasmid. The remaining 4 kb ´minicircle´ consists of only one active transcription unit and a

scaffold/matrix attachment region (S/MAR). In contrast to the parent plasmid vector it can be established in the

absence of selection, it is not subject to epigenetic silencing and it replicates stably without a sign of integration. In

further contrast to available minicircles that are maintained only in non-dividing tissues our minicircle represents

the first example that is suited for the modification of dividing cells and tissues due to its association with the

nuclear matrix and its authentic segregation.

I. Introduction Gene therapy is dedicated to the treatment or

prevention of disease through gene transfer. To this end,

several methods are explored based on viral vectors or

"naked" DNA. Viruses have the natural inclination to

invade human cells and deposit their genome in the

nucleus. They would be the preferred vectors for

applications in gene therapy in the absence of distinct

drawbacks: viruses may trigger the immune system and

some of them interfere with the expression of essential

genes by integration. Although the past decade has

brought vector technology a long way from the early days

of using wild-type viruses, even today the associated

problems could not be fully resolved and this is one reason

that alternatives gain increasing attention. As a potential

solution episomes have emerged. However, until recently

the only replicating episomes were of viral origin and

needed viral (and thereby oncogenic) factors for their

propagation (Bode et al, 2001).

A more general problem goes back to the fact that

eukaryotes have evolved elaborate defense systems to

protect the integrity of their genomes and to fight the

expression of ectopic transcription units. In mammals, the

insertion of retroviral DNA, the incorporation of repeat

arrays and the co-introduction of prokaryotic vector parts

are the major triggers of transcriptional silencing

processes. In case of retroviruses it has been suggested

that the cell recognizes structural features of integration

intermediates. Additional defense strategies go back to the

fact that dinucleotide frequencies in mammals differ from

Nehlsen et al: Replicating minicircles

234

those of other organisms, especially regarding the

abundance of CpG dinucleotides. In general, the DNA of

higher eukaryotes is impoverished in these motifs relative

to bacteria, for which the abundance is in accord with

statistical expectations. Most silencing processes are

accompanied by the methylation of CpGs, which may be

preceded by histone H3 methylation at Lys-9 (Fuks et al,

2003). A methylation center in turn can trigger chromatin

condensation spreading to a downstream promoter to

provide it with a heterochromatin-like structure – at least

in the cases where such a process is not blocked by an

intervening insulator element (Goetze et al, 2005).

Typically, a high level of transgene expression is

detected shortly after DNA has been delivered to target

cells, but this expression is silenced, within a few weeks,

even though vector DNA may remain in an

extrachromosomal state. The short duration and the

shutdown of transgene expression are important

limitations that have to be overcome for many potential

clinical gene therapy applications. We and others have

applied chromosome-based and epigenetic principles for

the optimal utilization of the transcription and replication

apparatus of mammalian cells (review: Bode et al, 2003;

Jackson et al, 2006). According to this concept, transgenes

are introduced in the form of an autonomous domain,

which, in its extreme, is a circular, nonviral episome with

a single domain boundary (S/MAR).

One of the fundamental properties ascribed to

S/MARs is their strand-separation potential (Bode et al,

1992, 2006), which is the likely reason for the fact that

these elements are regularly found in association with

origins of replication (ORIs). This ORI-support capacity

has been exploited to develop pEPI, one of the first

examples of a plasmid-based episomal vector that

replicates extrachromosomally (Piechaczek et al, 1999).

Available evidence indicates that this vector class recruits,

via the huIFN-! 5´ S/MAR, components of the cellular

replication apparatus to support an authentic segregation

(Baiker et al, 2000). Following these pilot studies we have

started to refine the system by reducing its size to the

absolutely required minimum. We demonstrated that for

pEPI most sequences apart from the (correctly oriented)

egfp gene and the S/MAR element are not required for

episomal maintenance and expression (Nehlsen, 2004) and

that a largely functional S/MAR can be assembled from

150 bp modules (Jenke et al, 2004, Bode et al, 2006). The

latter plasmid performed replication comparable to pEPI

but it did not express the egfp-gene to any measurable

extent – possibly due to the fact that transcription of the

150 bp repeats leads to mRNA instability.

Here we resume these efforts by the generation of

“minicircles” via a deletion of prokaryotic sequences after

the vector has been amplified, as a plasmid, in a bacterial

producer strain. The deletion comprises the resistance

marker, which, in case of the original pEPI-vector, is

essential for establishing the plasmid in the recipient cell

(Figure 1 and Papapetrou et al, 2006). Although

convenient and efficient, such a selection routine would

not be compatible with most gene therapeutic regimens.

We will demonstrate that the deletion strategy supports the

establishment and maintenance of functional, replicating

episomes in the absence of selection pressure even in

rapidly dividing cells. It also overcomes the rapid

epigenetic inactivation, which presents a major

impediment to the application of the parent plasmid-type

“pEPI”-vector. These and related properties of the

minicircle will be demonstrated exemplarily for three

prototype cell lines (CHO – transformed chinese hamster

ovary cells; HEK293 - human transformed primary

embryonal kidney cells; NIH3T3 – immortal but non-

transformed clone from mouse embryonic fibroblasts)

where it can be established in the absence of any selection

pressure.

II. Materials and methods A. Plasmids and strains Escherichia coli strain MM294Flp (MM294 (CGSC #6315

(294-FLP: F–, !–, supE44, endA1, thi-1, hsdR17, lacZ:cI857-

FLP)) (Buchholz et al, 1996) was kindly provided by Francis

Stewart (University of Dresden): Flp recombinase gene under the

control of !PR-promoter was inserted into the bacterial lacZ gene

using the gene replacement technique as described by Buchholz

et al (Buchholz et al, 1996).

B. Minicircle production and purification A single colony of Escherichia coli MM294Flp was transformed

with the maxicircle (Figure 3A) and grown overnight in a

shaking incubator at 30°C in Luria-Bertani media (LB)

containing 25 mg/ml Kanamycin. Cells were pelleted at 4000

rpm before resuspension in 4:1 (v/v) LB. After washing, cells

were re-pelleted at 4000 rpm and resuspended in 2:1 (v/v) fresh

LB. Flp expression was initiated by incubation at 40°C for 20

min. Incubation of bacteria was continued for 2.5 h at 35°C in a

shaking incubator (180 rpm). This period was succeeded by a

second initiation step at 40°C for 20 min and incubation was

continued for an additional 1.5 h at 35°C.

The superhelical status of the vector turned out to be a

relevant parameter for episomal establishment and therefore

various procedures, CsCl gradient centrifugation, Qiagen

mediprep system and Capillary Gel Electrophoresis, were

initially explored for its preparation. It was found that all three

procedures could be applied with similar success in the context

of our protocol. For present work the pool of DNA products was

digested by HindIII, which linearizes the maxicircle and the

miniplasmid but not the minicircle. Undigested supercoiled

minicircle could then be separated from the linearized maxicircle

and the bacterial miniplasmid by agarose gel electrophoresis

(Figure 3B´). The respective band was excised from the gel and

the DNA was extracted using the Qiagen Gel Purification Kit. A

further purification step, the application of ATP dependent

nuclease, could be applied to free the gel-extracted minicircle

from nicked or linear contaminants (Figure 3B´´). To this end 42

ml of the extract were provided with 5 ml 10"Plasmid SafeTM

reaction buffer, 2 ml of 25 mM ATP and 1 ml Plasmid-SafeTM

ATP-dependent DNAse (all materials from Epicentre / Biozym

Scientific GmbH). After shaking (37°C) supercoiled DNA was

recovered by the QIAquick PCR purification kit according to the

manufacturer´s instructions.

C. Cell culture -NIH 3T3 cells (ACC59; population doubling time 20 h)

were cultured in Dulbecco's modified Eagle's medium containing

10% fetal calf serum, 20 mM glutamine, 60 µg of penicillin/ml,

and 100 µg of streptomycin/ml.


235

Figure 1. Performance of a 6.4 kb plasmid as replicating episome. A. Constitution of the parental vector. The function of the well-

characterized pEPI-vector (here called “maxicircle”) depends on a S/MAR (here the 2 kb element upstream to the human interferon-b

gene, symbolized by the hook symbol) and a transcription unit (here: egfp). Transcription has to traverse part of the S/MAR as indicated.

The role (if any) of the second transcription unit (neor) and of the plasmid (pUC) origin (upper box) in episomal maintenance is one

subject of this study. The basic vector has been provided with two identical 48 bp FRT wildtype-sites (half arrows) permitting the Flp-

induced deletion of the intervening sequence, i.e. the conversion of the maxicircle into a minicircle and a miniplasmid (Figure 3).

Abbrevations: PSV40, SV40 promoter/enhancer driving the neomycin/kanamycin encoding gene as a selection marker for mammalian

cells or E. coli, resp.; ORIpuc, plasmid origin of treplication; Pcmv, CMV promoter driving the egfp coding unit; FRT, full (48 bp) Flp-

recombinase target sites. B. Maxicircles are lost in the absence of selection. After lipofection according to the GenePorterTM protocol

the persistence of maxicircles strictly depends on selection in G418 (500µg/ml) (compare traces “Maxicircle +” and “Maxicircle – “).

Minor expression levels of the neor/kanr unit are known to suffice for G418 resistance. Among the resistant cells 40% also express

measurable levels of egfp as indicated. If an initial selection period is discontinued after 12 population doublings (“Maxicircle +/-“) a

decrease of expression levels and of episomal persistence is noted at a rate that is largely reduced relative to the “Maxicircle -“ case. C.

Dependence of pEPI-type maxicircles on selection. Lanes 2 contains a loading control, i.e. 100 pg of linearized episome DNA in the

presence of 4 µg genomic DNA from non-transfected CHO K1 cells. Lane 1 is a corresponding control for the minicircle. Lanes 3 and 4

(taken from cells 20 PDs after lipofection) show that pEPI can be maintained if CHO-K1 cells are kept under selection pressure

(+G418). Lane 5 demonstrates the total loss of the maxicircle after 20 PDs in the absence of the drug (-G418). Left and right panels

show size markers, lane “wt” shows non-transfected (“empty”) cells.

-CHO-K1 cells (ACC110; population doubling time 24 h)

were cultured in a 1:1 mixture of Nut. Mix F12 (HAM) medium

with GlutaMAX (Gibco) and Dulbecco's modified Eagle's

medium which were both supplemented with 10% fetal calf

serum, 20 mM glutamine, 60 µg of penicillin/ml, and 100 µg of

streptomycin/ml.

-HEK293 cells (ACC305; average population doubling

time 24 h) were cultured in Minimal Essential Medium

containing Earle's salts supplanted by 20 mM glutamine, 60 µg of

penicillin/ml, 100 µg of streptomycin/ml and 10% fetal calf

serum.

D. Transfection

Since electroporation was found to seriously interfere with

the superhelical status and thereby to promote integration into the

genome, we optimized a lipofection protocol as this method

generated the highest proportion of cells for which expression

was exclusively due to the episome and not accompanied by

inadvertent integration events. For mini- and maxicircle-transfer

to 5"104 cells on a 6-well culture plate 1 µg of DNA was diluted

to 50 ml by ‘DNA diluent’ and left for 5 min at room

temperature. In a different vial 10 µl of GenePORTERTM2 -

reagent (Genlantis) were mixed with 40 µl of serum free

medium. The DNA-solution was added, without vortexing, to the

GenePORTERTM2 -solution. After a 10 minute incubation at


236

room temperature the mixture was carefully pipetted onto the

cells with 1 ml of serum free medium. After 4 hours an

additional ml (containing 20 % FCS) was added to reach a final

concentration of 10 % FCS. Medium exchange was performed

the following day and selection with G418 (CHO-K1: 500 µg/ml;

NIH3T3: 700 µg/ml) was applied where applicable.

E. FACS analysis The intrinsic fluorescence of the GFP-protein is used for

the analysis of expression levels in living cells. To this end non-

confluent cells were trypsinized and collected in EPICS (PBS,

10 % heat inactivated FCS) buffer. Cells were collected by

centrifugation (5 min, 1000 rpm) in a Heraeus-Christ minifuge

before they were diluted to 1"107 ml in EPICS-buffer. Propidium

iodide (2 mM) was used to stain and exclude dead cells. eGFP

fluorescence was excited by irradiation at 488 nm. Sorted cells

were kept for four days in the presence of Gentamycin (5 µl/ml

of a stock containing 10 mg/ml).

F. Localization and episomal status of

transgenes FISH-analysis: Cells were grown to 60-80 % confluence

and split one day before the preparation of metaphase spreads.

Colcemide was added to a final concentration of 40 ng/ml

medium and the culture was subjected to a 4 hour incubation at

37°C. After trypsinization the cell pellets were incubated in 2M

NaCl/KCl (1:1) for 1 minute, centrifuged at 1200 rpm for 5

minutes, fixed three times in MeOH/Acetic acid (3:1) and

incubated overnight at 4°C. An additional three fixation steps

with MeOH/Acetic acid were performed by applying the solution

on pre-cooled slides. Hybridization of the slides was done with a

labelled nick-translated pEpi-plasmid DNA probe using

SpectrumRed (Invitrogen) and counter stained with 10 µl of

DAPI (0.187 µg/ml in Vectashield mounting medium).

G. Southern blot analysis High molecular weight DNA was harvested from 1x106

cells and digested with the respective restriction enzyme. The

genomic as well as extrachromosomal DNA was then separated

on 0.8 % agarose gels, blotted and hybridized with a 32P-labeled

SV40-DNA probe.

F. Epigenetic reactivation experiments Cells were seeded at a densitiy of 1x105 and incubated in

medium containing either Butyrate (5 mM), TSA (165 nM) or 5-

AzaC (24µM). Reactivation of eGfp-expression is determined by

FACS-analysis after 48 hours.

III. Results A. General properties The prototype episome (pEPI) does not depend on

any viral factor and it divides in synchrony with cellular

replication (Schaarschmidt et al, 2004). Its function

depends on a S/MAR element by which the replication

apparatus of the host cell can be recruited and utilized (see

Figure 1A). Authentic segregation into daughter cells is

supported by the S/MAR´s capacity to act as a

maintenance element (Bode et al, 2001). Beyond these

properties S/MARs are proven tools to restrict epigenetic

silencing via DNA-methylation/histone deacetylation

(Dang et al, 2000).

Previous experiments have shown that in this case

the S/MAR function depends on its (at least partial)

transcription, which may support its conversion to the

single-stranded state. For pEPI an artificial termination

site has been localized within the 2 kb S/MAR sequence

after 800 bp (Figure 1A and Nehlsen 2004). In addition,

the direction of transcription was shown to matter: if the

egfp transcription unit was inverted by the use of Cre

recombinase in combination with two inversely oriented

lox P sites, only the original orientation was maintained as

an episome whereas the inverse one was lost without

indications for an integration.

Meanwhile pEPI-type vectors have emerged as

potential tools for applications in gene therapy and their

performance has recently been evaluated for dividing cells

of the haematopoietic system (Papapetrou et al, 2006;

review: Papapetrou et al, 2005). These studies show that,

in the absence of initial selection, at most 1% of

replicating cord blood cells retain the vector after 28 days

suggesting that it is poorly maintained in progeny cells. In

fact, a selection step has to be applied for establishing this

episome, which may be compatible with the modification

of cells ex vivo but not in vivo. Our data in Figure 1B

support these principles by using rapidly dividing CHO

cells, for which most data of pEPI-type vectors have been

derived. In our model experiment the vector is lost during

12 population doublings (PDs; see Figure 1B and lane 5

in Figure 1C). On the other hand, an initial selection in

G418 is sufficient to enrich a subpopulation of cells that

continues to propagate even in the absence of the drug,

although, under these conditions, a >50% loss of

expressing cells is observed over 50 PDs (“Maxicircle +/-

“). A stable subpopulation of cells can finally be obtained

if transfected cells are selected in the permanent presence

of 500 µg/ml of G418 (Figure 1B, trace “Maxicircle +”).

Over some years our experiments have indicated an

inverse relation between episome size and –stability,

especially regarding the superhelical state during freezing-

thawing cycles, which frequently caused problems for the

maxicircle (S. Broll, unpublished; see Discussion). To

improve this situation we started different approaches such

as the design and construction of a minimal S/MAR

element that could be obtained by oligomerizing a

S/MAR-module, a so called ´unpairing element´ (UE; see

Jenke et al, 2004), or the deletion of sequences that are

exclusively needed for plasmid amplification in bacteria.

For present work we decided to leave the S/MAR element

constant since artificial S/MARs with repetitive sequences

caused unexpected complications regarding egfp

expression (Nehlsen, unpublished). As a consequence, we

will compare below a pEPI-like ´maxicircle´ with a

´minicircle´ that is the result of excising all sequences that

are only required for producing the plasmid precursor.

B. Scaffold/Matrix attachment regions (S/MARs)

All S/MARs, whether they are located within a

chromatin domain or at its borders, share a common

criterion: they consist of a more or less regular succession

of DNA-unpairing elements at which the double strand

separates under negative superhelical tension (Bode et al,

2006). These UEs together constitute the architecture that


237

is required for the accommodation of prototype nuclear

matrix proteins (Bode et al, 2003). This feature is

illustrated by the SIDD (stress-induced-duplex

destabilization) profiles in Figures 2A and 2B, which are

routinely recorded for the negative superhelicity that is

typically present in a plasmid (Bode et al, 2006). The

coding region (egfp) has no propensity to separate strands,

in contrast to the transcriptional termination site, which is

highly destabilized. Previous contributions have

demonstrated that these are common features found for

any gene and have revealed the functional background of

such an architecture (Bode et al, 2006). In this respect it is

intriguing to note that the minicircle is destabilized over its

entire length with the sole exception of the egfp-tract.

C. Minicircles generated in bacteria

An E. coli strain (MM294Flp) with the Flp-

recombinase gene under the control of a heat-inducible

promoter (Buchholz et al, 1996) was kindly provided by

Francis Stewart (University of Dresden). We applied this

system for the amplification of the 6.4 kb pEPI-derivative

in Figure 3A, which had been provided with equi-directed

FRT-sites (half-arrows) and for which the egfp coding unit

was promoter-free. This setup guarantees that the only

specimens expressing eGFP will be those that underwent

excision and it overcomes any ambiguity that could be

ascribed to remainders of the educt.

The Flp-mediated recombination between the FRT

sites was triggered by a shift to 40°, which served to

eliminate the intervening sequences and to pose the egfp

unit under the control of the SV40 promoter. As a result, a

fluorescent 4.1 kb episome (´minicircle´) and a 2.3 kb

Figure 2. Molecular components necessary for episomal replication: Structural analyses. The molecular constitution and stress-

induced duplex destabilization (SIDD-) profiles are shown for the 6.4 kb parental plasmid from Figure 3A (A) and for the minicircle

(B). A value G(x)=0 kcal/mol would mean strand separation at the respective site under a standard superhelix density of " = -0.05 (Bode

et al, 2006). Note that the minicircle is destabilized throughout with the exception of the egfp coding region.


238

Figure 3. Generation of the minicircle by Flp-mediated recombination A. The principle. Flp recombinase is induced in E. coli strain

MM294-Flp by the temperature shift cycle (30° ! 40° ! 35°) described in “Materials and Methods”. The “minicircle” is generated from

the eukaryotic sequence parts (lower box in Figure 1A) and a “miniplasmid” from the plasmid parts. This process places the egfp

reporter gene under the control of the SV40 promoter. Abbreviations other than those in Figure 1A: PA-SV40 and PA-HSV-tk:

polyadenylation signals derived from SV40 or the HSV-tk gene, resp.. B. Analyses (B´) The reaction mixture is treated with HindIII

(lane 3) whereby the educt and the miniplasmid are linearized and converted to substrates of ATP-dependent DNase; the supercoiled

minicircle remains unaffected. For analytical purposes lane 2 shows a digest by BamHI which linearizes all species except the

miniplasmid. (B´´) Supercoiled minicircles after extraction from an electrophoretic gel; the effect of ATP-dependent DNase. The

lane marked “-“ shows (from top to bottom) traces of a sc minicircle-dimer, the lin minicircle, the sc minicircle and traces of lin

miniplasmid.

´miniplasmid´ were generated (Figure 3A). While the

minicircle contains the S/MAR and the egfp-tract, the

miniplasmid carries the prokaryotic sequences together

with the neor/kanr selection gene. This situation is

analyzed in Figure 3B´ after digestion with HindIII (single

cut in the parental construct and the miniplasmid leaving a

supercoiled minicircle) and with BamHI (single cut in the

parental plasmid and in the minicircle).

Figure 3B´´ demonstrates that superhelical, circular

DNA can efficiently be purified by ATP-dependent DNase

(Wilcox et al, 1976). Under standard reaction conditions

this enzyme rapidly degrades duplex linear DNA. It also

utilizes energy from ATP hydrolysis to move along the

DNA and to unwind regions of the molecule, releasing

large partially or totally single-stranded fragments on

which it acts as an endonuclease; duplex circular DNA is

not a substrate (Wilcox e t al, 1976)). In our example we

demonstrate the ultimate purification of a minicircle that

has been separated by gel electrophoresis, followed by

extraction using the QUIAquick procedure. Alternatively,

crude plasmid DNA was treated with HindIII as for

Figure 3B´ (trace 3) and all DNAs except the minicircle

were directly removed by ATP-dependent DNAse. All

following experiments are based on the first variant in

order to suppress any kind of integration that might follow

the transfer of linear DNA remainders.

Figure 4A compares situations in which either the

maxicircle (Figure 1A) or preparations of the minicircle

were transferred and analyzed at various time points.

Starting with a 40-45% contribution of fluorescent cells

(lipofection transfer efficiency) five population doublings

(PDs) were allowed for the establishment of episomes

before fluorescent cells were recovered by FACSorting.

Detailed analyses started after 12 PDs, at which time a

functional minicircle was left in 70% of the cells while

fluorescent maxicircles persisted in less than 10% of the

cell population. During the subsequent 40 PDs the

minicircles showed a stable propagation whereas the fate

of the maxicircles strictly depended on the treatment of

cells: Figure 4A demonstrates a close to complete loss in

the absence of selection while continued selection in G418

media led to the enrichment of a subpopulation in which

both the egfp and the neor cassette were expressed.

Essentially similar results were obtained for human

embryonic kindney (HEK293; Figure 5A) and murine

NIH3T3 cells (Figure 5B). For HEK293 cells the

minicircle is seen to yield a broad though stable population

between 32 and 60 PDs whereas the maxicircle-transfected

cells show a continuous drift to lower expression levels.


239

This drift can be reversed, to a large extent, by the addition

of (R)-Trichostatin A (TSA), an established inhibitor of

histone deacetylases that permits histone (re-)acetylation

(Schlake et al, 1994). The same treatment for the

minicircle population leaves the FACS-profile unchanged

indicating that only the maxicircle is subject to epigenetic

inactivation. NIH3T3 cells, an immortal but non-

transformed, contact inhibited cell line, reveals the most

clearcut differences between the systems: while the

minicircle is stably expressed between 32 and 55 PDs, the

maxicircle has undergone an almost complete shutoff

already at 32 PDs.

The copy number of pEPI-type vectors is low

(Baiker et al, 2000) but stably maintained during cell

divisions (Schaarschmidt et al, 2004). In Figure 6 we

show FISH analyses comparing the properties of maxi-

and minicircles. For the minicircles we consistently find

sharp fluorescent spots in association with the metaphase

chromosomes. The same is true for the majority of

maxicircle-containing cells but there are notable

exceptions, where intense doublets on both chromosome

arms indicate occasional integration events of the plasmid-

type vectors during continued cultivation. An example is

given in the upper right section of Figure 6.

Figure 4. Long-term expression of replicating episomes in CHO-K1 cells after a single FACS-enrichment of eGfp-expressing

cells. A. After a 5-days period of ´episome establishment´ fluorescent cells are recovered by FACSorting. Measurements start at day 12

when 65% of fluorescent cells are left for the minicicle, and 3% for the maxicircle (here: the pEPI-vector shown in Figure 1A). If the

latter population is kept under selection pressure (G418) the fluorescent subpopulation becomes dominant and reaches 60% after 53

population doublings. In case of the minicircle selection is neither possible nor required as the population is perfectly stable at the 65%

level over the entire time interval. B. Southern blot-analysis for episomally replicating mini- and maxicircles in CHO-K1-cells. Lanes 1-

4: Minicircle from four separate transfection experiments of the minicircle after 26 PDs and linearization with BamHI. Lanes 5, 6

corresponding analyses for the maxicircle kept for 26 PDs in the presence or absence of G418, respectively. Size marks indicate the 7.1

kb pEPI-vector and the 4.1 kb minicircle derived from the pEPI-derivative as shown in Figure 3A; the corresponding lanes “PMini” and

“PMaxi” are loading controls i.e. 100 pg of linearized episome DNA in the presence of 4 #g genomic DNA from non-transfected CHO K1

cells, lane “wt” shows just the genomic DNA. C. Episomes (mini- or maxicircles as indicated) in CHO-K1 cells were analyzed in two

parallel transfection experiments after 18 or 32 population doublings (18 PD or 32 PD, resp.) in the absence of selection pressure

(“Minicircle” / “Maxicircle –“) according to section A. Both experiments demonstrate a faster inactivation of the maxicircle. If selection

pressure is applied from the time of sorting (5 PDs) on (situation “Maxicircle +”), an expressing population emerges that approaches the

level of the minicircle population (see the continuous shift from trace 18 PD to 32 PD and 60 PD).


240

Figure 5. Persistence and expression of plasmid vectors and minicircles in two other cell lines. A. Analyses corresponding to

Figure 4 but for HEK293 cells. For the left-hand transfection experiments minicircles and maxicircles were analyzed after 32 and 60

PDs. After 60 PDs cells were subjected to treatments with either 165 nM (R)-Trichostatin A (“TSA”) or 24 mM 5-Aza-cytidine

(“AzaC”) as indicated and re-analyzed after an additional 48 h in the presence of these drugs. B. NIH3T3 cells: FACS-analyses for mini-

and maxicircles after 32 and 55 PDs. For the minicircle the profiles remain nearly unchanged in this interval. For the maxicircle a

complete shutoff is noted already after 32 PDs.

IV. Discussion While there is significant progress in the

modification by episomal DNA of slowly-dividing tissues

like liver, muscle and brain, maintenance problems have

so far limited the use of nonviral episomes for dividing

cells, for instance of the hematopoietic system (Papapetrou

et al, 2005, 2006). For liver, the most advanced vehicles

appear to be “minicircles”, small circular vectors that are

exclusively composed from eukaryotic sequences. In

contrast to linear DNA, minicircles do not concatemerize

and are less prone to integration. It is also known that,

owing to their superhelical status, they are better

transcriptional templates than linear DNA (Weintraub et

al, 1986).

Based on this rationale M. A. Kay and coworkers

could demonstrate that transgene expression levels in non-

replicating minicircles are not only 45-560 fold higher but

also more persistent compared to conventional plasmids

(Chen et al, 2003; Riu et al, 2005). The authors applied a

critical test to prove the episomal state of these vectors, i.e.

a 2/3 hepatectomy upon which almost every hepatocyte

undergoes one or two cell doublings until the liver mass is

reconstituted. It was shown that during cell cycling the

minicircles were lost in accord with their non-integrated

(episomal) status (Chen et al, 2001). The results clearly

demonstrate that this class of vectors is not functionally

attached to chromosomal DNA, which would otherwise

provide the required centromere function (Bode et al,

2001) and they anticipate the category of problems that

have to be overcome if episomal vectors are to be used for

the modification of proliferating cells. To be effective it is

required that the new genetic material not only replicates

but that it is also actively retained through cell division

and passed on to daughter cells. These considerations have

set the stage for the present study.

In past work we have already defined the essential

components of an episome that replicates once per cell

cycle (Schaarschmidt et al, 2004), i.e. an active

transcription unit and a S/MAR while the SV40 origin

function was found to be dispensable (Nehlsen 2004). In a

computer-assisted way analogous to Figure 2 S/MAR

elements were designed such that they can accommodate

components of the nuclear scaffold / nuclear matrix,

among these scaffold-attachment factor A (SAF-A /

hnRNP-U; Jenke et al, 2001, 2004). These interactions

mediate the association of the vector with the chromosome

arms enabling an effective segregation into the daughter

cells (maintenance function, see Bode et al 2001). Other

established S/MAR functions are the capacity to reduce

epigenetic silencing and to promote histone

hyperacetylation (Klehr et al, 1992). Interestingly, the

performance of S/MARs can be boosted by the application

of histone deacetylase inhibitors such as (R)-Trichostatin

A (TSA), butyrate (Schlake et al, 1994) or by certain

derivatives (e.g. phenylbutyrate) that have found use for

therapeutical applications (Gore et al, 1997). These

activities depend – at least in part – on S/MAR


241

conformational changes that are brought about by a nearby

active transcription unit (see Figure 1A).

Our present series of experiments expands the

knowledge about the essential vector components. It has

been shown before that a S/MAR that is at least partially

traversed by the transcription machinery is essential while

either the deletion (Baiker et al, 2000) or the inversion

(Nehlsen, 2004) of the transcription unit lead to

integration. Here we show, for the first time, that

minicircles but not maxicircles give raise to a stable

population of cells as long as they contain a single active

gene (egfp) and the S/MAR (Figure 4A). Together these

results prove that, while a second transcription unit (here:

neor/kanr) is compatible with the episomal status, it is not

required as it can be deleted together with the prokaryotic

vector parts (including the pUC origin of replication,

ORIpUC). The resulting minicircles provide an increased

cloning capacity, which according to preliminary

observations may be as high as 7 – 8 kb and even higher in

cases the subunits of a protein can be encoded by separate

episomes (Nehlsen, 2004). They also have an improved

long-term- (Figure 4A) and physical stability

(transformed cells resist multiple freezing-thawing cycles;

S. Broll, unpublished). Most important, however, they can

be transferred into the dividing cells and established in the

absence of any selection pressure, meeting a major

requirement of gene therapeutic applications.

The criteria that are sometimes used to establish the

episomal status are subject to considerable contention.

Among these is i - a full-length PCR amplification, which

would give the same result in case the transgenes had

integrated as a head-to-tail multimeric concatemer – a

typical concomitant of the classical Ca++-phosphate

transfection procedure. ii - A clear-cut Southern-blot

signal is a more stringent criterion as additional bordering

fragments would arise in case of integration. Inspecting

Figure 4B, we can state that, considering the low copy

number in our clone mixtures, background-signals are

negligible for the minicircles (lanes 1-4 in Figure 4B refer

to four independently prepared clone mixtures, lanes 5 and

6 exemplify the maxicircle). Where present, most of this

background arises during the establishment phase as a

probable consequence of some non-superhelical

contaminants. iii - The common extraction procedure

according to Hirt leads to the enrichment of non-integrated

DNA - at least at early passages. The efficiency of this

protocol decreases with time since continued rounds of

replication can give raise to extrachromosomal chains

(concatenates) even in case of the viral systems (Klehr and

Bode, 1988). iv - A plasmid-rescue, i.e. a re-transfer of

circular episomes from CHO cells to E. coli, has been

suggested as yet another criterion. This procedure is not

feasible in our case since the present concept demands that

minicircles do not contain the necessary bacterial DNA

components. Even more important, it may be ambiguous

again since integrated concatemers may generate circular

specimens due to intramolecular recombination (Wegner

et al, 1989).

For these reasons we have put emphasis on the FISH-

visualization of transgenes on metaphase spreads, which

had proven its potential before (Baiker et al, 2000). In this

approach we either get multiple sharp spots in association

with the chromosomes when we have to deal with intact

episomes; this association is lost if the preparation

involves shear forces (Baiker et al, 2000). Alternatively,

we find a single intense signal indicating the typical co-

integration of multiple copies immediately subsequent to

DNA transfer (Baiker et al, 2000). In our present series of

experiments (Figure 6) we find the first situation. For the

maxicircle there are some exceptions where an additional

intense doublet of spots (one on each chromatid) indicates

integration events that happen during continued cultivation

and replication.

In accord with current concepts (Chen et al, 2003,

Riu et al, 2005) all our results suggest that the stability of

the replicating minicircle can be ascribed to the absence of

prokaryotic vector parts. The observation (Figure 5A) that

an epigenetic re-activation by TSA is effective for the

maxicircle (pEPI) but not for the minicircle is in accord

with this explanation. We have to mention, however, that

another difference exists between the episomes that we

compare in Figure 4: the egfp-unit is driven by the CMV

promoter in the maxicircle (pEPI) but by the SV40

promoter in the minicircle. This difference permitted our

deletion strategy and the detection of fluorescence arising

from this process (Figure 3A). Even more important,

however, maintenance of the SV40 unit was dictated by

the fact that nuclear transfer of plasmid DNA is facilitated

by the association of ubiquitous transcription factors with

this sequence and the subsequent exposure of their NLS

signals (Vacik et al, 1999). This study also demonstrated

that the CMV promoter is inactive in this respect (Vacik et

al, 1999). Therefore, if we had chosen to drive the egfp

unit by the CMV promoter in both cases, facilitated

nuclear pore passage would have been abolished for the

minicircle but maintained for the maxicircle where PSV40

drives the selection gene. A completely different series of

experiments would have to be developed to trace

promoter-specific susceptibilities to epigenetic silencing.

We do not anticipate this kind of promoter-specific effects,

however, since both the CMV- (Grassi et al, 2003) and the

SV40-sequences (Broday et al, 1999) are subject to

methylation-dependent inactivation.

While one transcription unit is sufficient to mediate

episomal maintenance, the example of pEPI-type vectors

shows that a second transcription unit is at least

compatible with such a status. Experiments with pEPI

(Figure 1A) derivatives and two antibody chain genes in

place of the egfp-unit, each controlled by a separate

promoter, point into the same direction (Nehlsen,

unpublished). A logical extension of our findings will

therefore be the generation of a two-transcription unit

minicircle devoid of plasmid sequences. In this case egfp

will be the ´gene on duty´ that provides for the required

conformational changes at the S/MAR. A second complete

transcription unit, the ´gene of interest´, will be added at

an upstream position. Cells containing this vector can be

traced or isolated by FACS as in the present study, while

the GOI is expressed in parallel. Again, this approach will

require knowledge on the performance of promoter(-

combination)s in the context of a replicating episome.


242

Figure 6. Copy numbers and status of maxi- and minicircles: FISH analyses. FISH-analysis were performed 55PDs after

transfection (cf. the final situation in Figure 4A). The control (box with “empty” CHO-K1 and HEK293 cells) shows no signals. In

contrast, the majority of transfected cells showed clear fluorescent signals. For the maxicircles there are single, chromosome-associated

signals and, in about 40% of all cells, also intense doublets that cover corresponding positions on both chromosome arms and are

therefore indicative of eventual integration. All minicircle preparations show signals throughout the metaphase spread and copy numbers

that are comparable with the maxicircle situation. However, in the minicircle case there is no indication of integration events. Average

copy numbers have been derived from 10-20 individual metaphase spreads and are given together with their standard deviation.

There are intriguing indications that multiple nuclear

association sites may exist for the episomes, which vary in

their properties. In the present study this has first become

apparent during the Figure 1B experiments where we find

a certain contribution of non-egfp expressing (but G418-

resistant) cells. A similar phenomenon seems to hold for

HEK293 cells (Figure 5A), where a narrow range of copy

numbers (1-3 per cell) is associated with a wide range of

expression levels (more than two orders of magnitude). On

the basis of the FACS-profiles in Figure 4C and 5 in

comparison with the FISH analyses in Figure 6, it is

therefore tempting to speculate that points of association

are highly defined and maintained over many generations.

Other classes of less appropriate sites may exist in the

“transient expression phase” during which the non-

functional sites are abandoned. In case of the minicircles

this phase has terminated after 10 PDs or even before

(Figure 4A). For maxicircles, on the other hand, active

selection has to be applied in order provide a selective

advantage for the rare subpopulation in which the

maxicircle is propagated in an active state.

In summary, concepts have become available to

improve plasmid-based, replicating episomes up to the

stage where they support the predictable and long-term

expression of transgenes also in dividing cells. These

strategies will not only overcome detrimental effects of

prokaryotic sequences but will also take into account the

targeting capacity of S/MAR(-derivatives) or related

elements by which subnuclear structures can be addressed

for an optimized transcriptional capacity.

Acknowledgments We thank Wolfgang Deppert (Pette Institute

Hamburg) for the initial spark that started this project and

the group of Hans-Joachim Lipps (University of Witten-

Herdecke) for the cooperation over many years. The help

of Silke Winkelmann during the generation of FISH-data

is gratefully acknowledged. Particular thanks go to our

colleagues Armin Baiker (now Max-von-Pettenkofer

Institute, University of Munich) and Christoph Piechaczek

(now Miltenyi, Bergisch-Gladbach) for their interest and

advice, to Francis Stewart for E. coli strain MM294Flp


243

together with the relevant protocols, and to Martin Schleef

(PlasmidFactory D-33607 Bielefeld) for performing the

capillary electrophoresis mentioned under II-B.

References Baiker A, Maercker C, Piechaczek C, Schmidt SBA, Bode J,

Benham C and Lipps HJ (2000) Mitotic stability of a human

scaffold/matrix attached region containing episomal vectors

is provided by association with nuclear matrix. Nat Cell Biol

2, 182-184.

Bode J, Fetzer CP, Nehlsen K, Scinteie M, Hinrich BH, Baiker

A, Piechazcek C Benham C and Lipps HJ (2001) The

Hitchhiking Principle: Optimizing episomal vectors for the

use in gene therapy and biotechnology. Gene Ther Mol Biol

6, 33-46.

Bode J, Goetze S, Ernst E, Huesemann Y, Baer A, Seibler J. and

Mielke C (2003a) Architecture and utilization of highly-

expressed genomic sites, New Comprehensive

Biochemistry 38: Gene Transfer and Expression in

Mammalian Cells, Chap 20, pp551-572 (G. Bernardi, and S.

Makrides, Eds). Elsevier, Amsterdam.

Bode J, Goetze S, Heng H, Krawetz SA and Benham C (2003b)

From DNA structure to gene expression: Mediators of

nuclear compartmentalization and –dynamics. Chromosome

Res 11, 435-445.

Bode J, Kohwi Y, Dickinson L, Joh T, Klehr D, Mielke C and

Kohwi-Shigematsu T (1992). Biological significance of

unwinding capability of nuclear matrix-associating DNAs.

Science 255, 195-197.

Bode J, Winkelmann S, Goetze S, Spiker S, Tsutsui K, Bi C, AK

P. and Benham C (2006) Correlations Between

Scaffold/Matrix Attachment Region (S/MAR) Binding

Activity and DNA Duplex Destabilization Energy. J Mol

Biol 358, 597-613.

Broday L, Lee YW. and Costa M (1999) 5-Azacytidine induces

transgene silencing by DNA methylation in chinese hamster

cells. Mol Cell Biol 19, 3198-3204.

Buchholz F, Angrand PO and Stewart AF (1996) A simple assay

to determine the functionality of Cre or FLP recombination

targets in genomic manipulation constructs. Nucleic Acids

Res 24, 3118-3119.

Chen ZY, He CY, Erhardt A and Kay MA (2003) Minicircle

DNA vectors devoid of bacterial DNA result in persistent

and high-level transgene expression in vivo. Mol Ther 8,

495-500.

Chen ZY, Yant SR., He CY, Meuse L, Shen S, and Kay MA

(2001) Linear DNAs concatemerize in vivo and result in

sustained transgene expression in mouse liver. Mol Ther 3,

403-410.

Dang Q, Auten J and Plavec I (2000) Human beta interferon

scaffold attachment region inhibits de novo methylation and

confers long-term, copy number-dependent expression to a

retroviral vector. J Virol 74, 2671-2678

Fuks F, Hurd PJ, Wolf D, Nan X, Bird AP and Kouzarides T

(2003) The Methyl-CpG-binding Protein MeCP2 Links DNA

Methylation to Histone Methylation. J Biol Chem 278,

4035-4040.

Goetze S, Baer A, Winkelmann S, Nehlsen K, Seibler J., Maass

K and Bode J (2005) Genomic bordering elements: their

performance at pre-defined genomic loci. Mol Cell Biol 25,

2260-2272.

Gore SD, Samid D and Weng LJ (1997). Impact of the putative

differentiating agents sodium phenylbutyrate and sodium

phenylacetate on proliferation, differentiation, and apoptosis

of primary neoplastic myeloid cells. Clin Cancer Res 3,

1755-1762.

Grassi G, Maccaroni P, Meyer R, Kaiser H, D'Ambrosio E,

Pascale E, Grassi M, Kuhn A, Di Nardo P, Kandolf R and

Küpper JH (2003) Inhibitors of DNA methylation and

histone deacetylation activate cytomegalovirus promoter-

controlled reporter gene expression in human glioblastoma

cell line U87. Carcinogenesis 24, 1625-1635.

Jackson DA, Juranek S and Lipps HJ (2006) Designing Nonviral

Vectors for Efficient Gene Transfer and Long-Term Gene

Expression. Mol Ther in press.

Jenke BH, Fetzer CP, Joensson F, Fackelmayer FO, Conradt

HC., Bode J and Lipps HJ (2001). An episomally replicating

vector binds to the nuclear matrix protein SAF-A in vivo.

EMBO Reports 3, 349-354.

Jenke AW, Stehle IM., Eisenberger T, Baiker A, Bode J,

Fackelmeyer FO. and Lipps HJ (2004). Nuclear

scaffold/matrix attached region modules linked to a

transcription unit are sufficient for replication and

maintenance of a mammalian episome. Proc Natl Acad Sci

USA, 101, 11322-11327.

Klehr D and Bode J (1988) Comparative Evaluation of Bovine

Papilloma Virus (BPV) Vectors for the Study of Gene

Expression in Mammalian Cells. Mol Gen (Life Science

Adv) 7, 47 52.

Klehr D, Schlake T, Maass K and Bode J (1992) Scaffold-

Attached Regions (SAR elements) Mediate Transcriptional

Effects Due to Butyrate. Biochemistry 31, 3222-3229.

Nehlsen K (2004). Molekulare Grundlagen der episomalen

Replikation: Charakterisierung zirkulärer, nichtviraler

Vektoren. Dissertation Technische Universität

Braunschweig.

Papapetrou EP, Zoumbos NC, Athanassiadou A (2005) Genetic

modification of hematopoietic stem cells with nonviral

systems: past progress and future prospects, Gene Ther

Suppl 1, 118-30.

Papapetrou E, Ziros PG, Mitcheva ID, Zoumbos NC and

Athanassiadou A (2006) Gene transfer into human

hematopoietic progenitor cells with an episomal vector

carrying an S/MAR element. Gene Ther 13, 40–51.

Piechaczek C, Fetzer C, Baiker A, Bode J and Lipps HJ (1999) A

Vector Based on the SV40 origin of replication and

chromosomal S/MARs replicates episomally in CHO cells.

Nucleic Acid Res 27, 426-428.

Riu E, Grimm D, Huang Z and Kay MA (2005) Increased

maintenance and persistence of transgenes by excision of

expression cassettes from plasmid sequences in vivo. Hum

Gene Ther 16, 558-570.

Schaarschmidt D, Baltin J, Stehle IM, Lipps H J and Knippers R

(2004) An episomal mammalian replicon: sequence-

independent binding of the origin recognition complex.

EMBO J 23, 191-201.

Schlake T, Klehr-Wirth D, Yoshida M, Beppu T and Bode J

(1994) Gene expression within a chromatin domain: The role

of core histone hyperacetylation. Biochemistry 33, 4197-

4206.

Vacik J, Dean BS, Zimmer WE and Dean DA (1999) Cell-

specific nuclear import of plasmid DNA. Gene Ther 6,

1006-1014.

Wegner M, Zastrow G, Klavinius A, Schwender S, Müller F,

Luksza H, Hoppe J, Wienberg J and Grummt F (1989) Cis-

acting sequences from mouse rDNA promote plasmid DNA

amplification and persistence in mouse cells: implication of

HMG-I in their function. Nucleic Acid Res 17, 9909-9932.

Weintraub H, Cheng PF and Conrad K (1986) Expression of

transfected DNA depends on DNA topology. Cell 46, 115-

122.

Wilcox KW and Smith HO (1976) Mechanism of DNA

degradation by the ATP-dependent DNase from Hemophilus

influenzae. J Biol Chem 251, 6127-6134.


244


245


Cloning, Expression and Purification of a novel anti-

angiogenic factor-Tumstatin Research Article

Chongbi Li1,*, Liming Yang2, Hongli Jia3

1The Center of Biopharmaceutical Research and Development of Zhaoqing University, 526061, China (PR) 2Institute of Microbiology, Chinese Academy of Sciences, Beijing 100080, China (PR) 3The Institute of Microbiology and Epidemiology, Academy of Military Medical Sciences, Beijing 100071, China (PR)

__________________________________________________________________________________

*Correspondence: Chongbi Li, Biochemistry and Molecular Biology, The Center of Biopharmaceutical Research and Development of Zhaoqing University, 526061, China (PR); Tel: (86-0758)2752578; E-mail: [email protected]

Key words: tumstatin, cloning and expression; IMAC Abbreviations: immobilized metal-chelating affinity chromatography, (IMAC); Luria-Bertani, (LB); noncollagenous 1, (NC1); Reverse transcription, (RT); vascular endothelial growth factor, (VEGF)

This study has laid a foundation for manufacturing anti-tumor based on Tumstatin.

Received: 29 May 2006; Revised: 12 June and 13 July 2006

Accepted: 17 August 2006; electronically published: September 2006

Summary Tumor progression may be controlled by various fragments derived from noncollagenous 1 (NC1) C-terminal

domains of type IV collagen. Tumstatin peptide is an angiogenesis inhibitor derived from type IV collagen and

inhibits in vivo neovascularization induced by vascular endothelial growth factor (VEGF), Here, we firstly showed

the expression, cloning and purification of tumstatin from Chinese abortus kidney tissue by RT-PCR, and the

construction of pET-His expressive plasmid in prokaryotic cells. Also its’ activity was examined by mouse

antiserum against native Tumstatin. The results indicated E.coli BL21(DE3)plysS/ pET-His-tumstatin was induced

3 h by 0.2 mmol/L IPTG at 30°C, and got a high-level expression of 37.9%. The Tumstatin protein was one-step

purified by immobilized metal-chelating affinity chromatography (IMAC) and its purity was above 95%. Western

blot identified it’s right.

I. Introduction Tumstatin is a ramification of basement membrane

proteins in human body (28Kda, an endogenously

produced a third ! chain of basement membrane collagen,

type IV). It inhibited specific for the protein synthesis of

endothelial cells (Maeshima et al, 2002). In the experiment

on rats, it showed that Tumstatin could inhibit tumor

growth (Maeshima et al, 2000), and anti-tumor activity of

Tumstatin was also verified (Maeshima et al, 2002). A

physician, J. Folkman in Harvard medical collage in USA

firstly mentioned the theory inhibiting tumors through

angiogenesis. He thought that if the blood vessels of

tumors were inhibited, tumors could not get hyperplasia,

metastasis instead of shrinking. Tumstatin prevents

angiogenesis through inhibition of endothelial cell

proliferation and promotion of apoptosis with no effect on

migration, whereas endostatin prevents endothelial cell

migration with no effect on proliferation. Therefore, it

probably fit for curing many types of cancers. Because of

the distinct properties of tumstatin and endostatin, it

indicated that they had diverse antiangiogenic actions

(Sudhakaret al 2003).

Up to now, few of the structure, characteristics and its’ protein knowledge of tumstatin has been known, and in particular, the report on the gene of tumstatin from Chinese human tissues has not been found yet.!Additionally, Purification of bioactive recombinant protein

from E. coli

has been recognized challenging. Our!

strategy would center on the optimization of the E. coli

expression system because of its higher efficiency!"#!

expressing foreign proteins as compared with the other

systems. The study showed the cloning, expression, purification and its’ activity of tumstatin from Chinese kidney tissues. It would lay a theoretical foundation for the clinical application on tumstatin.

II. Materials and methods A. Material, bacterial strains and reagents The kidney tissue of abortus fetus were collected from

associated hospital in medical college Inner Mongolia. PET-His

Li et al: Cloning, expression and Purification of Tumstatin

246

expressive vector, E.coli host strain, DH5!, and BL21(DE3)plysS stored in our laboratory, RNA purified kit (Shanghai Huashun Co), pGEM-Tvector kit, T4 DNA ligase and plasmid purified kit (Promega), restriction enzyme, BamH I, Nhe I (NEB), Taq plus DNA polymerase, dNTPs, X-gal, IPTG and agarose( biotechnology Co, Shanghai), DL2000 DNA molecular weight marker and multi clone antibody(invitrogen), HRP-labaled IgG of sheep against mouse(Huamei Co in Beijing).

B. Combined buffer 20 mmol/L NaH2PO4, 500mmol/L NaCI, pH 7.4, Washing

buffer NaH2PO420 mmol/L, NaCI 500 mmol/L, imidazole 500 mmol/L, pH 7.4.

C. Sequencing and cloning of Tumstatin 1. Synthesis and designing of the primers A pair of primers was designed according to the sequence

from GenBank (No. AF258351), tum1: 5"-CGGGATCCCCAGGTTTGAAAGG-3"and tum2: 5"-GGCTAGCGTGTCTTTTCTTCATGCACA-3", underlined nucleotides indicated the recognized sites of restriction enzyme as BamHI, NheI. Amplified the fragment of gene was about 750 nt long.

2. Preparation of template Total RNA of kidney from Chinese abortus fetus was

isolated with RNA extract kit. Reverse transcription (RT) would carried out when the content and purity were qualified. It did according to the instruction of the RT kit. PCR would be done with the cDNA synthesized as a template.

3 Cloning and sequencing of Tumstatin SuperScriptTM First-Strand Synthesis System for RT-PCR

(Invitrogen) E.coli Top10 was grown on Luria-Bertani (LB) medium and incubated at 37" under aeration. Amplification reactions were performed in a total volume of 50 ml containing 100 #M (each) dATP, dCTP, dGTP, and dTTP, 25 pmol of each primer, 2 ng of pLSC400 DNA, 2.5 U of Pwo DNA polymerase

(Boehringer, Mannheim, Germany), and the corresponding 1$ Pwo buffer. Reactions were carried out with a Perkin-Elmer thermocycler by using initial denaturation at 94°C for 5 min, followed by 5 cycles consisting of 94°C for 30s, 46°C for 30s, and 72°C for 80s and followed by 25 cycles consisting of 94°C for 30s, 55°C for 30s, and 72°C for 80s a final extension step consisting of 72°C for 10 min. The amplified products were identified by electrophorsis of 1% agarose. Each DNA was further purified by treatment with phenol-chloroform as described by Sambrook et al, 1989. Plasmid DNA was isolated from the recombinant E.coli by a method described previously (Sambrook et al, 1989). DNA sequences were determined by the

dideoxy chain termination method with sequencing kits (Biotechnology Co, Shanghai). The purpose product by PCR was ligated with GEM-T vector, then transformed to E.coli DH5! competent cells by the method of CaCl2. And recombinant were selected through blue and white spots, and identified by situ-PCR and endoenzyme digesting. The positive recombinant plasmid would be sequenced by Biotechnology Co, Shanghai.

D. Construction and inducing expression of

pET-His-tumstatin plasmid The extracted plasmid containing tumstatin gene, pGEM-

T/tum was digested with BamHI and NheI. Tumstatin DNA was recollected and cloned into expressive vector, pET-His digested with the same two enzymes, that contained an NcoI site and a PstI recognition sequence within the forward and reverse primers, respectively. The amplified product was digested with NcoI and

PstI and cloned into expressive vector, pET-His digested with the same two enzymes mentioned above and ligated to generate

plasmids pET-His-tumstatin. The plasmids were subsequently transferred to E coli cells. The recombinants were selected and identified named pET-His-tumstatin. The pET-His-tumstatin were also transferred to E.coli BL21 (DE3) plysS competent cells. and the positive bacteria were identified by PCR. The bacteria selected were incubated in LB medium induced with IPTG in different concentrations of 0.2, 0.4, 0.6, 0.8 mmol/L at the same time. And the bacteria were sampled 0.2ml once each before and after inducing. The samples were precipitated and cellular proteins were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The quantity of expression was analyzed by Gel imaging instrument made in Japan.

E. Tumstatin purification To determine Tumstatin activities, the engineering E.coli

added in 1000 ml of LB culture with a 1/100 volume. And E.coli

was grown at 37°C to an optical density of 0.5 at 570 nm. The culture was added with a final concentration of 0.2 mmol/L IPTG at 37°C for 3h. The cell culture were pelleted by centrifugation at 5000 $ g for 10 min, and the cells were resuspended in 100ml of 30mM PBS buffer, and centrifugation at 5000 $ g for 10 min, and resuspended as above mentioned. Cell lysis was carried out by ultrosonic way. And the cell fragments were removed by centrifugation at 13,000 $ g for 30 min. The supernatant is run through a volume of 5 ml HiTrap chelating Ni-NTA column (Amersham Pharmacia). ÄKTA FPLC purifying system for protein would be connected with the column. The column is then washed with the washing buffer, followed by elution of the bound protein from the column using the elution buffer. Finally, the column is re-equilibrated with washing buffer. washing or eluting, the compounds down the column by varying the eluting solvent using a flow rate of 1ml/min. And all the fractions were pooled with an absorbance > ~0.03. And the tumstatin solution was concentrated using Ultrafree-15 concentrators of 10kDa. The Ultrafree-15 concentrators are used to concentrate protein samples based on a technique known as ultrafiltration. These disposable devices hold up to 15 ml of sample at a time and can be centrifuged at 2,000 $ g for 15 min, and the step was repeated for 3 times (refer to the Ultrafree-15 manual for more information). The samples were pooled and resolved with sterilized PBS of 10ml. The samples were analyzed by the gel of 15 % SDS-PAGE and also quantified with the method of Bradford.

F. Identification of Tumstatin 1. Western blot of tumstatin

After running SDS-PAGE (Sambrook et al, 1989), the extracts were transferred to nitrocellulose membrane (Sigma).

Blots were stained firstly with Ponceau dye for 2 min and then developed with first antibody (antiserum against V5 from mice), followed by staining with secondary antibody (horseradish peroxidase labeled anti-mouse IgG).

2. Detection using indirect ELISA For visualization, nitro blue tetrazolium/5-bromo-4-chloro-

3-indolyl phosphate was used. Tumstatin (450 µg/ml) were diluted at 1:100, 1:200, 1:400 and 1:800 respectively, and added 100 µl each hole on plate of 96 holes at 4" overnight. Next day, the plate was blocked with 3% bovine serum albumin in Tris buffered saline with 0.1% Tween 20 for 1 h and incubated with 100 µl first antibody (polyclone against-mouse antiserum)at 1:500 dilutions for 30min at 37". After washing with PBST, it also was incubated with 100 µl of HRP labeled anti-mouse IgG at 1:1000 dilutions and washed as above mentioned. A drop of


247

developing fluid A and B were added respectively for 5min followed by adding a drop of terminal reactive fluid. OD values were determined at 450nm.The positive was determined according to the ratio of experimental holes to negative holes if the ratios were larger than 2.1.

3. Antitumor effect of Tumstatin Twenty 7-week-old male Kun Ming mice without thymus

gland per group were used as test animals. And kidney tumor induction was performed as follows. 786-0 nephrosarcoma cells were subcutaneously transplanted to the back region, and attacking numbers of nephrosarcoma cell were 2#106. After a week of injections, when the tumor growth volume was up to 600-700mm3, the ten mice were injected tumstatin of 6 mg/kg subcutaneously in the back region a time, and once a day for ten time injections. however, the another ten mice were only

injected with 0.9% normal saline (vehicle) at the same

time. Tumor growth volume (width #length #0.52) needed to be determined with vernier caliper on a daily basis.

III. Results A. Cloning and sequencing of tumstatin PCR product of tumstatin would run electrophoresis

using 1% agarose, the result showed the 700bp fragment presenting, and it was the same as anticipation. It found the nucleotides of the 96th was mutated T$C but nonsense mutation (Figure 1).

B. Construction of expression vector The fragment of pGEM-T/tum-digested with BamHI

and NheI was cloned into pET-His plasmid, and ligation product were transformed DH5! competent cells. Thus 5 monoclonal colony were selected and identified by PCR. DNA of positive plasmid was extracted and digested with BamHI and NheI. An objective fragment of 741 bp was finally identified (Figure 2).

C. Expression and induction of

recombinant tumstatin To investigate the regulation of tumstatin expression

by IPTG and time, recombinant E.coli was each grown in three batches by shaking conditions for approximately 3h. Through several conditions obtimization, concentrations of IPTG added was 0.2 mmol/L IPTG and inducing time

was 3h at 30". The quantity of expression recombinant protein in gross protein was about 35.66. It also presented either inclusion bodies or soluble proteins (Figure 3).

Figure 1. Electrophoresis of PCR. 1.DL2000 DNA Marker, 2. PCR product of tumstatin, 3. negative control.

Figure 2. Vector pET-His-tumstatin digested with BamHI and NheI 1. DL2000 DNA Marker, 2. pET-His-tumstatin/ BamHI and NheI, 3. pET-His-tumstatin, 4. pET-His.

Figure 3. SDS-PAGE of

plysS/pET-His-tumstatin in

BL21(DE3). 1. Molecular marker, 2. Sample before induction, 3 Sample after adding 0.2 mmol/L IPTG, 4. Sediment sample from ultrosolic way destruction after induction 3h, 5 Supernatant sample from ultrosolic way destruction after induction 3h.


248

D. Purification of Tumstatin Purification of human tumstatin was achieved using

the IMAC column with 6#His tag, and the column was washed with 200 mmol/L imidazole gradient elution buffer.15ml eluted fluid were obtained and concentrated. Furthermore, the absorbance of concentrated fluid at 280 nm and the method of Bradford (Kirazov et al, 1993; Liu, 2001) provided identical values for the protein concentrations (850 #g/ml). 25mg of purified tumstatin were obtained in all, and sheet scanning of the resulting purified tumstatins indicated that the proteins were more than 95% pure (Figure 4).

E. Identification of Tumstatin protein Western blot indicated visible band the position 29

kDa around (Figure 4), and also indicated the purified tumstatin protein had been recognized by specific polyclonal antibody. Furthermore, the results of indirect ELISA showed that tumstatin also could be detected when it was a 1:1000 dilution (0.085 mg). It consequently was identified the activity of tumstatin through its’ immunoreaction.

F. In Vivo antitumor effect of Tumstatin To assess the antitumor activity of the obtained

tumstatin, the Kun Ming mice without thymus gland were inoculated 786-0 nehrosarcoma cells as carcinoma model in this study. After comparing the tumor growth volume between the experimental group and the control one, it was found that a substantial inhibitory effect was observed in mice treated with tumstatin(Fig 5), and the degree of

inhibition appeared to be similar (610±98.6 mm3 in the experimental group instead 1100±155.2mm3 in the control one). There was a significant difference between them (t test, p<0.05). These results suggest that an expression and purification system for tumstatin protein from E. coli has been successfully established in a laboratory setting.

Figure 4. Purification and western blot of soluble Tumstatin 1. low MW marker, 2. purified Tumstatin, 3. Western blot of Tumstatin

Figure 5. In vivo antitumor effect of tumstatin.


249

IV. Discussion In the present study, a single copy of Chinese human

tumstatin-encoding gene was transformed into the vector of laboratory strain of E coli BL21 and constitutively expressed under the induction of IPTG. And biologically active human tumstatin can be achieved in the E.coli expression system, whereas a high yield (8050 µg/ml culture) and a high purity (>95%). And also a protocol for purification of human tumstatin protein from E. coli as a inclusion body form was shown. Furthermore the in vivo

antitumor effect of the purified protein are comparable to those of the control, there is a significant difference. The results showed that the IPTG-inducible T7 lac promoter used in our system has previously been shown to be highly efficient in expressing heterologous proteins, including

tumstatin. Additionally, with the conventional purification protocol described previously, the cultured bacteria are lysed under denaturing condition (8 M urea), and the dissolved tumstatin is then subject to bound to a Ni-NTA column chromatography for His tag-specific purification. And after the recombinanat protein was extracted through the column and also passed through a step of ultrafiltration with Ultrafree-15 ultrafiltration tube (Millipore). Through these steps, a purified recombinant tumstatin could be achieved. However, the purified protein precipitates during the dialysis that eliminates urea from the solvent system. In this study, a purification approach was taken the advantages of inclusion body formation in the tumstatin-expressing E. coli cells. Usually, inclusion bodies are insoluble or biologically inactive molecules, however, in our approach, highly purified tumstatin could be dissolved and used the experiment. Although soluble endostatin prepared from a yeast system is being used in ongoing phase I clinical trials, the low yield (approximately 20 mg/liter culture) and high cost of the system have made it

difficult to produce in quantities that are realistic for comprehensive clinical evaluation and application.

This study outlines a strategy for the cloning, expression and isolation of a soluble form of tumstatin. Additionally, it showed that the purified recombinant protein has an antitumor effect in vivo at a low dose level (6 mg/kg /d). However, past report show that the 20mg/kg/d dose of purified endostatin given gives a significant tumor growth inhibition. Through comparasion, the purified recombinant tumstatin is better than endostatin. Our results presented in this report offer an

alternative method that will prove valuable in helping to determine the clinical activity of tumstatin. Thus, we anticipate that this recombinant tumstatin will have potency over an antitumor curing field .

The yield and purity of this antitumor protein produced from the reported procedure allow its virtual application at different laboratory levels. The established protocol also has the potential to be adapted to a larger scale production.

References Darland DC, D'Amore PA (1999) Blood vessel maturation:

vascular development comes of age. J Clin Invest 103, 157-158.

Kirazov LP, Venkov LG, Kirazov EP (1993) Comparison of the Lowry and the Bradford protein assays as applied for protein estimation of membrane-containing fractions. Anal Biochem 208, 44-48.

Liu C (2001) Introduction of tissue soluble protein. In: Handbook of Protein Technology (ed. by W. Wang & W.F. Fan) Science Press of China, Beijing, pp. 172-183.

Maeshima Y, Colorado PC, Torre A, Holthaus KA, Grunkemeyer JA, Ericksen MB, Hopfer H, Xiao Y, Stillman IE, Kalluri R (2000) Distinct antitumor properties of a type IV collagen domain derived from basement membrane. J

Biol Chem 275, 21340-21348. Maeshima Y, Manfredi M, Reimer C, Holthaus KA, Hopfer H,

Chandamuri BR, Kharbanda S, Kalluri R (2001) Identification of the anti-angiogenic site within vascular basement membrane-derived tumstatin. J Biol Chem 276, 15240-15248.

Maeshima Y, Sudhakar A, Lively JC, Ueki K, Kharbanda S, Kahn CR, Sonenberg N, Hynes RO, Kalluri R (2002) Tumstatin, an endothelial cell-specific inhibitor of protein synthesis. Science 295, 140-3.

O'Reilly MS, Boehm T, Shing Y, Fukai N, Vasios G, Lane WS, Flynn E, Birkhead JR, Olsen BR, Folkman J (1997) Endostatin: an endogenous inhibitor of angiogenesis and tumor growth. Cell 88, 277-285.

Sambrook J, Fritsch E and Maniatis T (1989) Molecular cloning: A laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

Sudhakar A, Sugimoto H, Yang C, Lively J, Zeisberg M, Kalluri R (2003) Human tumstatin and human endostatin exhibit distinct antiangiogenic activities mediated by alpha-V-beta-3 and alpha-5-beta-1 integrins. Proc Nat Acad Sci 100, 4766-4771.


250


251


Plasmodium and host carbonic anhydrase:

molecular function and biological process Research Article

Viroj Wiwanitkit Department of Laboratory Medicine, Faculty of Medicine, Chulalongkorn University, Bangkok Thailand 10330

__________________________________________________________________________________

*Correspondence: Viroj Wiwanitkit, M.D., Department of Laboratory Medicine, Faculty of Medicine, Chulalongkorn University,

Bangkok, Thailand 10330; Tel: 662 256 4136; Fax: 662 218 3640; e-mail: [email protected] Key words: human, Plasmodium falciparum, carbonic anhydrase, function

Abbreviations: Carbonic anhydrase, (CA); Mouse Genome Informatics, (MGI); Saccharomyces Genome Database, (SGD);

Received: 8 August 2006; Revised: 25 September 2006

Accepted: 29 September 2006; electronically published: November 2006

Summary Carbonic anhydrase (CA) is an enzyme that catalyzes an interconversion of CO2 and HCO3-. CA is present at high

levels in humans and Plasmodium spp. However, the function of CA in malarial infection is not well characterized.

Here, the author used a new gene ontology technology to predict molecular function and biological process of CA.

Using GoFigure server, the molecular function and biological process of human and P. falciparum CA are

predicted. Comparing to human CA, the P. falciparum CA has similar molecular functions as carbonate

dehydratase activity and zinc ion binding. Although the basic sequences for human and P. falciparum CA are totally

different, the molecular functions are similar. This finding implies that any treatment aiming at blocking the

functions of P. falciparum CA can affect human CA. Thus any drug targeting at P. falciparum CA might not be a

magic bullet. The more specific structural antagonist that can directly block amino acid of P. falciparum CA is more

favorable.

I. Introduction Carbonic anhydrase (CA) is an enzyme that catalyzes

an interconversion of CO2 and HCO3-. CA is present at

high levels in humans and Plasmodium spp

(Reungprapavut et al, 2004). Existence of at least three

isozymes was demonstrated in P. falciparum and a rodent

malarial parasite P. berghei (Reungprapavut et al, 2004).

Krungkrai et al found that the parasite enzyme activity was

sensitive to well-known sulfonamide-based inhibitors of

both bacterial and mammalian enzymes. They noted that

the enzyme inhibitors had antimalarial effect against in

vitro growth of P. falciparum (Krungkrai et al, 2002).

Reungprapavut et al noted that P. falciparum carbonic

anhydrase was a possible target for chemotherapy

(Reungprapavut et al, 2004).

In malarial infection, CO2 is essential for the growth

of intraerythrocytic malarial parasite to synthesize

pyrimidine through CO2 fixation and regulate intracellular

pH and CO2 transport across the plasma membrane of

erythrocytes, which are facilitated by CA (Sein and

Aikawa, 1998). However, the function of the CA in

malarial infection is not well characterized. Krungkrai et al

noted that a full understanding host and parasite CA

promised advances in malarial treatment (Sein and

Aikawa, 1998). Here, the author used a new gene ontology

technology to predict the molecular function and

biological process of this enzyme.

!!. Materials and methods A. Getting the sequence The database Unitprot (Bairoch et al, 2005) was used for

data mining of the amino acid sequence for human host and P.

falciparum CA.

B. Prediction of molecular function and

biological process The author performed prediction of molecular function and

biological process of human and P. falciparum CA using a novel

gene ontology prediction tool, GoFigure (Bairoch et al, 2005).

GoFigure is a computational algorithm tool which was recently

developed in gene ontology (Bairoch et al, 2005). The tool

accepts an input DNA or protein sequence, and uses BLAST to

identify homologous sequences in gene ontology annotated

databases (Bairoch et al, 2005). The approach uses a BLAST

search to identify homologs in public databases that have been

annotated with gene ontology terms (Bairoch et al, 2005). These

include: SwissProt, Flybase (Drosophila), the Saccharomyces

Genome Database (SGD), Mouse Genome Informatics (MGI)

and Wormbase (nematode) (Bairoch et al, 2005). The contents of

Wiwanitkit: Plasmodium and host carbonic anhydrase

252

results will show molecular function as well as biological process

of the studied protein (Bairoch et al, 2005). The prediction of

molecular function and biological process were presented and

compared.

III. Results A. Sequence From searching of the database Uniprot, sequence of

human and P. falciparum CA was derived as shown in

Figure 1.

B. Prediction of molecular function and

biological process Using GoFigure server, the molecular function and

biological process in human and P. falciparum CA is

predicted. The molecular function and biological process

of human and P. falciparum CA are presented in Figure 2

and Figure 3, respectively. The molecular function of

human CA is “Carbonase dehydratase activity”, “Zinc ion

binding” and “Lyase activity” and the molecular function

of P. falciparum CA is “Carbonase dehydratase activity”,

and “Zinc ion binding”. The biological processes of

human and P. falciparum CA are “One carbon compound

metabolism” and “One carbon compound metabolism”,

respectively.

IV. Discussion CA is an enzyme that is believed to have a significant

role in malarial infection. The malarial parasite P.

falciparum encodes for an alpha-carbonic CA possessing

catalytic properties distinct of that of the human host,

which was only recently purified (Krungkrai et al, 2002).

CA inhibitors are possible effective antimalarial drug

(Krungkrai et al, 2005). Recently, Krungkrai et al said that

the vital contribution of CA to parasite survival made the

enzyme an attractive target for therapeutic evaluation

(Krungkrai et al, 2001). In addition, there are some current

researches on the possible use of CA inhibitors to kill

cancer kills. The possible mechanisms are inhibition of

CA isozymes which predominate in tumor cell

membranes, perhaps causing acidification of the

intercellular milieu, or inhibition of intracellular isozymes

which provide bicarbonate for the synthesis of nucleotides

and other essential cell components (Supuran et al, 2001).

Roles of both host and parasite CA in cellular level

metabolism during a malarial infection have been

proposed (Sein and Aikawa, 1998; Sein and Aikawa,

1998). Until present, the function of P. falciparum CA,

correlating to human CA, is not well explored and there is

a need for better understanding function of these proteins.

In this work, the author explores and compares the

potential functions of malarial and human carbonic

anhydrase by gene ontology.

Based on recent advance in the genomics technology,

current microarray technology permits examination of

gene expression patterns of ten thousands of genes

(Bairoch et al, 2005). A challenge facing the biologist

interpreting such data is recognizing the function of many

of the hits identified in a single experiment (Khan et al,

2003). While one can check the literature, a rapid means to

get some idea of potential function of a gene product is to

obtain the ontology terms that describe the gene (Khan et

al, 2003). The gene ontology is developed for this specific

purpose. Many gene ontology tools have been constructed

and launched. Here, the author used a gene ontology tool

to perform a comparative study on the predicted function

of human and P. falciparum CA. This bioinformatics

approach may be of interest to predict gene

functions as an enormous inflow of information is derived

from current genome projects on malarial organisms.

Figure 1. Sequence of human and P. falciparum CA.


253

Figure 2. Expected molecular function of human CA.

Figure 3. Expected biological process of Plasmodium falciparum CA.

Wiwanitkit: Plasmodium and host carbonic anhydrase

254

Compared to human CA, the P. falciparum CA has

similar molecular functions as carbonase dehydratase

activity and zinc ion binding. However, human CA has

additional significant activity as lyase activity. It is a well

known fact that crucial enzymes such as lactate

dehydrogenase (LDH) are highly conserved among the

species and throughout evolution and thus it is not

surprising that this applies also to CA. Although the basic

sequences for human and P. falciparum CA are totally

different, the molecular functions are similar. This implies

that any treatment aiming at blocking the functions of P.

falciparum CA can affect human CA. Thus any drug

targeting at P. falciparum CA might not be a magic bullet.

More specific structural antagonist that can directly block

amino acid of P. falciparum CA is more favorable.

However, some concerns on this conclusion should

be addressed. While the enzymes may have similar or

identical functions among the species, there can be

substrates that are preferred by the mammalian or the

protozoan enzyme. For example, the quantification of

growth inhibition of anti-malarial drugs is often done

measuring LDH activity in the parasitized red blood cells.

There is ample quantity of LDH in human red blood cell,

but the substrates used by the parasitic LDH are highly

selective for the parasitic enzyme. Thus, one can envision

that screening for an anti-malarial drug would compare the

various candidate drugs in regards to their ability to inhibit

at lower concentrations the protozoan CA than compared

to the mammalian CA. Overall, in order to give

significance to the conclusion, it has to evaluate whether

the enzymes have same substrate specificity and whether

all anti-malarial drugs have the same dose range of

toxicity when tested on parasite cultures and on

mammalian cell cultures.

Indeed, three of fourteen CA isozymes detected in

mammalians have been identified in P. falciparum

(Reungprapavut et al, 2004). This can confirm that human

CA and P. falciparum CA share common substrates. This

can be the reason for the fact that there are issues with

currently marketed sulfonamide drugs on undesirable side

effects (Lee et al, 2004; Sheth, 2004). Based on the basic

principles of chemical reaction in organic chemistry, the

dose ranges of the same antimalarial drugs for the same

enzymatic blocking reaction of enzymes using the same

substrate depend directly on those enzymes. Basically, the

molecular weight of human CA is significantly higher than

P. falciparum CA. This implies that the amount of CA

inhibitors for human CA is more than that of P. falciparum

CA. Therefore, it can imply that CA inhibitors inhibit at

lower concentrations the protozoan CA than compared to

the mammalian CA. However, the ideal CA inhibitors

should be selective for the reactions without identical

substrate between host and parasite. An ultimate proof of

the biological functions would still require biochemical

experiments. Further experimental studies are needed

before making a conclusion on this topic. Nevertheless,

the findings in this study not only support the previous

knowledge on malarial CA but also give the new view on

the function of malarial CA.

References Bairoch A, Apweiler R, Wu CH, Barker WC, Boeckmann B,

Ferro S, Gasteiger E, Huang H, Lopez R, Magrane M, Martin

MJ, Natale DA, O'Donovan C, Redaschi N, Yeh LS (2005)

The Universal Protein Resource (UniProt). Nucleic Acids

Res 33, D154-9.

Khan S, Situ G, Decker K, Schmidt CJ (2003) GoFigure:

automated Gene Ontology annotation. Bioinformatics 19,

2484-5.

Krungkrai J, Scozzafava A, Reungprapavut S, Krungkrai SR,

Rattanajak R, Kamchonwongpaisan S, Supuran CT (2005)

Carbonic anhydrase inhibitors. Inhibition of Plasmodium

falciparum carbonic anhydrase with aromatic sulfonamides:

towards antimalarials with a novel mechanism of action?

Bioorg Med Chem 13, 483-9.

Krungkrai S, Rochanakij S, Prapunwattqana P, Krungkrai J

(2002) Carbonic anhydrase in Plasmodium falciparum and

Plasmodium berghei. Presented at In: InCob, ed. The

International Conference on Bioinformatics: North-South

Networking. Bangkok: InCob, 2002; 158

Krungkrai SR, Suraveratum N, Rochanakij S, Krungkrai J (2001)

Characterisation of carbonic anhydrase in Plasmodium

falciparum. Int J Parasitol 31, 661-8.

Lee AG, Anderson R, Kardon RH, Wall M (2004) Presumed

“sulfa allergy” in patients with intracranial hypertension

treated with acetazolamide or furosemide: cross-reactivity,

myth or reality? Am J Ophthalmol 138, 114-118.

Reungprapavut S, Krungkrai SR, Krungkrai J (2004)

Plasmodium falciparum carbonic anhydrase is a possible

target for malaria chemotherapy. J Enzyme Inhib Med

Chem 19, 249-56.

Sein KK, Aikawa M (1998) The pivotal role of carbonic

anhydrase in malaria infection. Med Hypotheses 50, 19-23.

Sheth RD (2004) Metabolic concerns associated with

antiepileptic medications. Neurology 63,S24-S29.

Supuran CT, Briganti F, Tilli S, Chegwidden WR, Scozzafava A

(2001) Carbonic anhydrase inhibitors: sulfonamides as

antitumor agents? Bioorg Med Chem 9, 703-14.

Viroj Wiwanitkit


255


Isolation of genes controlling apoptosis through

their effects on cell survival Research Article

Gwyn T. Williams1,*, Jane P. Hughes1,3, Victoria Stoneman1,4, Claire L. Anderson1,

Nicola J. McCarthy1 Mirna Mourtada-Maarabouni1, Mark Pickard1, Vanessa L.

Hedge1, Ian Trayner2, Farzin Farzaneh2

1Institute for Science and Technology in Medicine, Huxley Building, Keele University, Keele, ST5 5BG, UK 2King's College London, Department of Haematological and Molecular Medicine, The Rayne Institute, 123 Coldharbour

Lane, London SE5 9NU, UK 3Present address; Neurology and GI Centre of Excellence for Drug Discovery, GlaxoSmithKline Research and

Development Limited, New Frontiers Science Park, Third Avenue, Harlow CM19 5AW, Essex, UK 4Present address; Department of Medicine, University of Cambridge, ACCI Level 6 Box 110, Addenbrookes Hospital,

Hills Road, Cambridge, UK

__________________________________________________________________________________

*Correspondence: Prof. Gwyn T. Williams, Institute for Science and Technology in Medicine, Huxley Building, Keele University,

Keele, ST5 5BG, UK; Phone 44-1782-583032; Fax 44-1782-583516; E-mail [email protected]

Key words: apoptosis, forward genetics, functional cloning, retroviral insertional mutagenesis, oncogenes, tumour suppressor genes

Abbreviations: Complementary DNA, (cDNA); Factor-dependent continuous cell line from the Paterson Institute, (FDCP-1);

Interleukin-3, (IL-3); Phytohaemagglutinin, (PHA); Polymerase chain reaction, (PCR); Receptor for activated protein kinase C 1,

(RACK1); Retroviral insertional mutagenesis, (RIM); Vacuolar ATPase, (vATPase); Walter and Elisa Hall Institute-105.726, (WEHI-

105.726)

Received: 25 October 2006; Revised: 30 November 2006

Accepted: 12 December 2006; electronically published: December 2006

Summary The identification of the most suitable molecular targets for gene and drug therapy is the crucial first step in the

development of new disease treatments. The rational identification of such targets depends on a detailed

understanding of the pathological changes occuring at the molecular level. We have applied forward genetics

approaches to the identification of the critical genes involved in the control of apoptosis in mammalian cells, since

defective control of apoptosis underlies many diseases, including cancer and neurodegenerative diseases. We have

identified two groups of genes by their effects on cell survival using retroviral cDNA functional expression cloning

and retroviral insertional mutagenesis. The identification of these novel genes opens up new areas for apoptosis

research and subsequently for the development of new gene and drug therapies.

I. Introduction Apoptosis is now recognised as central to

mammalian cell biology in general- no picture of any

human or other mammalian system can be accepted as

complete without some consideration of the potential role

played by apoptosis. Apoptosis is consequently of

profound significance in physiology, pathology and

therapeutic medicine.

The analysis of the molecular mechanisms involved

in apoptosis is therefore of great importance in developing

gene and drug therapies for the many diseases where the

control of apoptosis is perturbed. Apoptosis dysfunction

occurs, for instance, in neurodegenerative diseases (too

much apoptosis) and in autoimmune and neoplastic

diseases (too little apoptosis) (Williams and Smith, 1993;

Thompson, 1995; Hale et al, 1996;). Much cancer therapy,

to quote an important example, relies on inducing

apoptosis in tumour cells (Kerr et al, 1994). Since our

knowledge of the molecular control of apoptosis is still

incomplete, the identification of the genes involved in cell

death and survival is of major importance in defining

targets for rational design of gene and drug therapies.

The control of apoptosis is complex (e.g. Hengartner,

2000) and involves many genes. Some of these genes are

now relatively well characterised, e.g. the bcl-2 family

(Cory and Adams, 2002) and the caspase family

(Thornberry and Lazebnik, 1998), but it is likely that many

others have yet to be identified. Many strategies, such as

isolation of proteins through their affinity for known

components of the apoptosis machinery, are currently

Williams et al: Isolation of genes controlling apoptosis

256

being used to identify the missing molecules. We have

chosen to identify genes controlling apoptosis and cell

survival through the biological effects of the genes

themselves on mammalian cells. This approach,

sometimes known as forward genetics (Stark and Gudkov,

1999), is independent of previous knowledge and both can

and does result in the identification of entirely novel and

unpredicted components. This strategy also focuses

automatically on those components which can actually

affect the cell death/survival decision within the cell, as

distinct from those associated with cell death but not

having any controlling role. It is this first group which are

likely to be of the greatest biological and clinical

importance and which provide the best targets for gene

and drug therapies.

Earlier work from Kimchi and co-workers using this

sort of strategy resulted in the isolation of several

important genes (Deiss et al, 1995; Cohen et al, 1997)

including DAP-kinase, which can play an important role in

metastasis (Inbal et al, 1997). Other groups have also used

this approach, resulting in the isolation of several

interesting and important genes (e.g. Hitoshi et al, 1998).

We have used two related approaches within this general

strategy; firstly, we have transfected cDNA libraries in

expression vectors into clonal mammalian cells which are

uniformly susceptible to apoptosis stimuli (Figure 1). The

isolation and analysis of the cDNA clones expressed by

cells which survive the stimulation of apoptosis identifies

candidate apoptosis-controlling genes. The activity of

these genes can later be confirmed by isolation of the

sequence, re-cloning into an expression vector and

expressing in fresh host cells which are then challenged

with apoptosis stimuli. Secondly, we have infected clonal

apoptosis-sensitive cell lines with retroviruses and again

induced apoptosis under conditions where fewer than 1 in

104 host cells normally survive (Figure 2). In this case, the

amplification of the host DNA flanking the inserted

retrovirus using inverse PCR allows the identification of

the gene affected by the insertion to produce the apoptosis-

resistant phenotype. Our use of these two strategies

resulted in the identification of several known apoptosis-

controlling genes. The additional isolation of a larger

number of genes not previously known to be involved in

this process indicates that many more components of the

cellular apoptosis-controlling machinery still remain to be

identified.

II. Materials and methods A. Cell culture The W7.2 mouse thymoma cell line, originally derived

from line WEHI-105.726 (Danielsen et al, 1983), and the FDCP1

haemopoietic cell line (Dexter et al, 1980), used as hosts were

grown in RPMI 1640 with 10% fetal calf serum (Hyclone, UT,

USA) at 370C in a 5% CO2 humidified incubator. FDCP-1

medium was supplemented with mouse IL-3 (Dexter et al, 1980;

McCarthy, 1993). Both cell lines were cloned in soft agar

(McCarthy, 1993; Mourtada-Maarabouni et al, 2003) and

apoptosis-sensitive clones containing less than 1 in 104 apoptosis-

resistant cells were identified and grown to produce large stocks

which were stored in liquid nitrogen. These target cells were

used after thawing and a minimal number of subcultures in order

to minimise the appearance of spontaneously apoptosis-resistant

cells. The clones used in the present study were FDCP-1B, which

had an even lower frequency of spontaneous IL-3 independence

of 2(±1.9) x10-6) (McCarthy, 1993), and W7.2c (Mourtada-

Maarabouni et al, 2003).

Figure 1. Production of apoptosis-deficient cell clones by retroviral cDNA library functional expression cloning.


257

Figure 2. Different pathways for production of apoptosis-deficient cell clones by retroviral insertional mutagenesis (RIM).

B. cDNA functional expression cloning Target cells were treated with 90 ng/ml tunicamycin at 3 x

105 cells/ml for 18 hours and washed before infection with

retrovirus. Two different cDNA expression libraries were used,

both in the pRUFneo retroviral expression vector (Rayner and

Gonda 1994). cDNA for the first library was derived from human

bone marrow stromal cells (Zannetino et al, 1996), and for the

second library from FDCP1 cells (Rayner and Gonda, 1994)). !2

ecotropic murine packaging cells producing the libraries seeded

at 5 x 106 cells per 225cm2 flask were grown overnight to about

60% confluence and "-irradiated using a 60Co source (2500cGy).

The supernatant was removed and 25ml of W7.2c cell suspension

was added with 8µg/ml polybrene for 3 days co-culture. The

cells in suspension were centrifuged and washed before being

stored in aliquots in liquid nitrogen.

C. Selection of apoptosis-resistant clones Several selection protocols were employed at different

times to allow the identification of a range of different apoptosis-

resistant mutant cells. Selection with "-radiation was carried out

using a 60Co radiation source delivering a dose of 500-1000 cGy.

Selection with dexamethasone (20- 50nM) was carried out for 6

days, after which time the cells were washed to remove the

dexamethasone prior to cloning in soft agar (Mourtada-

Maarabouni et al, 2003). Continuous treatment with

dexamethasone during cloning was avoided since this would not

allow the isolation of cells resistant to the apoptosis-inducing

effects alone- any colonies growing in the continuous presence of

dexamethasone would have to be resistant to its cytostatic effects

as well.

Selection of W7.2c cells with Phytohaemagglutinin (PHA;

HA16, Murex Biotech UK), either as the sole stimulus or after

irradiation or dexamethasone treatment, was carried out by

including the PHA in the soft agar cloning dishes at final

concentrations of 5-10µg/ml.

cDNA inserts from apoptosis-resistant clones were

amplified by PCR, using primers complementary to the adjoining

vector, and sequenced (Mourtada-Maarabouni et al, 2003).

D. Retroviral Insertional Mutagenesis (RIM) Target W7.2c and FDCP-1B cells were infected with the

retroviral vector pBABEpuro (Morgenstern and Land, 1990)

produced in the ecotropic packaging cell line GP+E86 (Miller

and Miller, 1992). Target cells were pre-incubated with

tunicamycin and washed before co-culture with gamma-

irradiated packaging cells for 2 days in the presence of

polybrene. After several infection cycles, infected W7.2c cells

were washed and selected as above. Infected FDCP-1B cells

were washed 3 x to remove IL-3 and incubated for 24 hours prior

to cloning in soft agar; cells were incubated for a total of 7 days

without IL-3, and IL-3 was then added to the soft agar. The site

of retroviral insertion in surviving clones was determined by

inverse PCR.

III. Results and Discussion A. cDNA functional expression cloning The use of techniques which depend on an unbiased

screen based solely on the function of the gene has the

potential to identify many genes which act by highly

diverse mechanisms. This diversity is demonstrated in

Table 1 which lists 18 genes isolated from W7.2c cells

which survived apoptotic stimuli. They are therefore

candidate apoptosis-regulating genes. However it is likely

that several will be false positives- e.g. isolated from cells

fortuitously carrying genomic mutations giving resistance

to apoptosis. For several of the clones however, apoptosis-

suppressing activity has been confirmed by re-expressing

the inserts in fresh host cells and challenging with

apoptosis-inducing stimuli (e.g. Protein phosphatase 4,

RACK1 and rFau (antisense to Fau).


258

The sequences isolated by cDNA functional

expression cloning include full protein-coding sequences,

such as Onzin/PLAC8, as well as partial coding

sequences, such as Protein Phosphatase 4, and antisense

sequences, such as rFau. These sequences can be assumed

to modulate apoptosis in very different ways. PLAC8/

Onzin, for example, is likely to act as an inhibitor of

apoptosis (Rogulski et al, 2005), whereas the partial

mRNA sequence of Protein Phosphatase 4 identified

appears to act by inhibiting the activity of endogenous pro-

apoptotic Protein Phosphatase 4 (Mourtada-Maarabouni et

al, 2003). The partial antisense sequence of Fau identified

is likely to suppress apoptosis by hybridising to the mRNA

of endogenous pro-apoptotic Fau (Mourtada-Maarabouni

et al, 2004).

Table 1. Candidate apoptosis-regulating genes identified by cDNA functional expression cloning

Gene name(s) cDNA library

selected

Challenge for

isolation

Host cell for

isolation

cDNA

originally

isolated

Confirmation of

effects on cell

survival

PPP4C; Protein

Phosphatase 4,

catalytic subunit

Mouse FDCP1 cDNA

in retroviral vector

pRUFneo (Rayner

and Gonda, 1994)

Dexamethasone

followed by "-

radiation

W7.2c (Mourtada-

Maarabouni et al,

2003)

Partial,

sense

Yes (Mourtada-

Maarabouni et al,

2003)

Fau; MNSFbeta Mouse FDCP1 cDNA


pRUFneo (Rayner

and Gonda, 1994)

Dexamethasone

followed by "-

radiation

W7.2c (Mourtada-

Maarabouni et al,

2003)

Partial,

antisense

Yes

(Mourtada-

Maarabouni et al,

2004)

Gnb2l1/RACK1

; Receptor for

Active C Kinase

1

Mouse FDCP1 cDNA


pRUFneo (Rayner

and Gonda, 1994)

"-radiation

followed by

PHA

W7.2c (Mourtada-

Maarabouni et al,

2003)

Partial,

sense

Yes (Mourtada-

Maarabouni et al,

2005)

Atp6v1e1;

Vacuolar/

lysosomal

ATPase, subunit

E

Mouse FDCP1 cDNA


pRUFneo (Rayner

and Gonda, 1994)

"-radiation

followed by

PHA

W7.2c (Mourtada-

Maarabouni et al,

2003)

Partial,

sense

Yes

(Anderson and

Williams, 2003)

Gas5; Growth

Arrest Specific

transcript 5

Mouse FDCP1 cDNA


pRUFneo (Rayner

and Gonda, 1994)

"-radiation W7.2c (Mourtada-

Maarabouni et al,

2003)

Not

applicable

-

Plac8; Onzin;

C15

Mouse FDCP1 cDNA


pRUFneo (Rayner

and Gonda, 1994)

"-radiation

followed by

PHA

W7.2c (Mourtada-

Maarabouni et al,

2003)

Full

coding

sequence,

sense

Yes (Rogulski et

al, 2005)

Limk2; LIM-

motif-containing

protein kinase 2

Mouse FDCP1 cDNA


pRUFneo (Rayner

and Gonda, 1994)

Cloning in PHA W7.2c (Mourtada-

Maarabouni et al,

2003)

Partial,

sense

-

Fus; Tls; Pigpen Mouse FDCP1 cDNA


pRUFneo (Rayner

and Gonda, 1994)

"-radiation

followed by

PHA

W7.2c (Mourtada-

Maarabouni et al,

2003)

Partial,

sense

-

Ucp2;

Uncoupling

protein 2

Mouse FDCP1 cDNA


pRUFneo (Rayner

and Gonda, 1994)

Dexamethasone

followed by

PHA

W7.2c (Mourtada-

Maarabouni et al,

2003)

Partial,

sense

-

Prtn3; mPR3;

Proteinase 3

Mouse FDCP1 cDNA


pRUFneo (Rayner

and Gonda, 1994)

Etoposide W7.2c (Mourtada-

Maarabouni et al,

2003)

Partial,

sense

-

HTRA1;

PRSS11; HTRA

serine peptidase

1

Human bone marrow

stromal cells

(Zannettino et al,

1996)

PHA W7.2c (Mourtada-

Maarabouni et al,

2003)

Partial,

sense

-


259

Gene name(s) cDNA library

selected

Challenge for

isolation

Host cell for

isolation

cDNA

originally

isolated

Confirmation of

effects on cell

survival

RPLP1;

Ribosomal

protein, large,

P1

Human bone marrow

stromal cells

(Zannettino et al,

1996)


Maarabouni et al,

2003)

Full

coding

sequence,

sense

-

TncRNA;

Trophoblast-

derived

noncoding RNA

Human bone marrow

stromal cells

(Zannettino et al,

1996)


Maarabouni et al,

2003)

Not

applicable

-

S100A6; S100

calcium binding

protein A6

(calcyclin)

Human bone marrow

stromal cells

(Zannettino et al,

1996)


Maarabouni et al,

2003)

Partial,

sense

-

SEC61A1;

HSEC61;

protein transport

protein SEC61

alpha subunit

Human bone marrow

stromal cells

(Zannettino et al,

1996)


Maarabouni et al,

2003)

Partial,

sense

-

HNRPD;

AUF1A;

Heterogeneous

nuclear

ribonucleoprotei

n D; AU-rich

element RNA

binding protein

1

Human bone marrow

stromal cells

(Zannettino et al,

1996)


Maarabouni et al,

2003)

Partial,

sense

-

TNFAIP8; GG2-

1, SCC-S2,

MDC-3.13;

Tumor necrosis

factor, alpha-

induced protein

8

Human bone marrow

stromal cells

(Zannettino et al,

1996)


Maarabouni et al,

2003)

Partial,

sense

-

GMFB; Glia

maturation

factor beta

Human bone marrow

stromal cells

(Zannettino et al,

1996)


Maarabouni et al,

2003)

Partial,

sense

-

CTSD; CPSD;

Cathepsin D

Human bone marrow

stromal cells

(Zannettino et al,

1996)


Maarabouni et al,

2003)

Partial,

sense

Yes, e.g. Liaudet-

Coopman et al,

2006

In other cases, mutated/truncated proteins may be

produced which can have either dominant negative

inhibitory activity, or which may be constitutively

activated.

The anti-apoptotic effect of the partial sense protein

phosphatase 4 sequence was confirmed by isolation of the

cDNA insert from the genomic DNA of the corresponding

W7.2c clone using PCR and subsequent expression in

fresh host cells (Mourtada-Maarabouni et al, 2003). Many

of the proteins important in the control of apoptosis are

regulated by phosphorylation and dephosphorylation, e.g.

the Bcl-2 family of apoptosis regulators (e.g. Deng et al,

1998; Chiang et al, 2001). The identification of Protein

Phosphatase 4 as functionally important in apoptosis

suggests that it may act on one or more of these. The

sequence antisense to Fau is also of particular significance

since a Fau antisense sequence is also found in the Finkel-

Biskis-Reilly murine sarcoma virus (Finkel et al, 1976).

The anti-apoptotic effect of Fau antisense sequences, and

the pro-apoptotic effects of Fau, have been confirmed

directly (Mourtada-Maarabouni et al, 2004). Fau may

therefore act as a tumour suppressor, and down-regulation

of Fau may be important in oncogenesis.

One of the cDNA sequences isolated by sequential

selection with "-radiation and PHA is a partial cDNA for

the receptor for activated protein kinase C (RACK1),


260

which includes the 3'-untranslated sequence of the mRNA.

Although this sequence does not contain the full coding

sequence of RACK1, it up-regulates endogenous RACK1,

presumably by interacting with endogenous regulatory

molecules. Studies on the expression of full length

RACK1 have confirmed its anti-apoptotic activity, which

may be related to its established interactions with Src

kinases (Chang et al, 2002), integrins (Liliental and

Chang, 1998) or other molecules (Mourtada-Maarabouni

et al, 2005).

Vacuolar ATPase subunit E was identified in two

separate screens. Firstly, by temporary withdrawal of IL-3

from BAF-3 IL-3-dependent cells (Anderson and

Williams, 2003) and, independently, by selection of W7.2c

cells with "-radiation followed by PHA. In both cases the

suppression of apoptosis appeared to be due to indirect

effects on the endogenous vATPase through regulatory

molecules which modulate the activity of the vATPase.

This proton pump can affect both cytoplasmic and

vacuolar/lysosomal pH, as well as other aspects of cell

metabolism (reviewed by Nishi and Forgac, 2002).

B. Retroviral Insertional Mutagenesis

(RIM) The information which has flowed from the human

and mouse genome projects over the past few years has

been very valuable in allowing the rapid identification of

the sites of retroviral insertion in cells showing resistance

to apoptosis (Table 2). This has made it possible to

identify the flanking sequences obtained by inverse PCR

(e.g. Nowrouzi et al, 2006; Shin et al, 2004) and so to

suggest the identity of novel candidate apoptosis-

regulating genes. Two of the genes identified by RIM have

been shown to be involved in the control of apoptosis.

Firstly, Notch1 has been shown to play a crucial role in the

control of cell fate, including the control of apoptosis (e.g.

Jundt et al, 2002). Secondly, the insulin-like growth factor

receptor (Igf1r) has been shown to regulate apoptosis and

to play an important role in oncogenesis in many tissues

(e.g. Roschier et al, 2001). Spink2, on the other hand,

could not be demonstrated to play any significant role in

apoptosis in the Jurkat human T-cell line, or in the TF-1

human growth factor dependent cell line (Hedge and

Williams, unpublished work). This serves as a reminder

that the candidate apoptosis-regulating genes listed in both

Table 1 and Table 2 are bound to include some false

positives. Further studies are required in each case to

confirm or refute the potential roles in apoptosis control.

In the present paper we have confirmed that forward

genetics, either using cDNA functional expression cloning

or using RIM, is a very valuable strategy for the analysis

of the molecular controls on apoptosis. In several cases,

entirely unpredicted genes have been identified, each of

which opens up a new avenue for apoptosis research.

Since regulation of apoptosis is crucial to many diseases,

this molecular dissection of apoptosis identifies novel

targets for the gene and drug therapy of these diseases.

Acknowledgments We thank the Wellcome Trust and BBSRC UK for

financial support and Dr. Janet Meredith for subcloning

candidate genes.

Table 2. Candidate apoptosis-regulating genes identified by retroviral insertional mutagenesis

Mouse chromosome

insertion

Gene closest to

insertion

Gene sequence

associated with

insertion

Confirmation of

effects on cell survival

10 Cdh23; Cadherin-23;

Otocadherin (insertion

into intron)

GI:24475914 -

3 Gstm1; Glutathione-S-

Transferase Mu-1

(insertion into intron)

GI: 68051724

-

2 Notch1 GI :31543331 Yes, e.g. Jundt et al,

2002

14 Pheromone receptor

V3R6

GI:26083204 -

5 Spink2; Serine

peptidase inhibitor,

Kazal type 2

GI:34304086

-

7 Igf1r; insulin-like

growth factor I receptor

GI:3025893 Yes, e.g. Roschier et al,

2001


261

References Anderson C L and Williams G T (2003) Apoptosis gene hunting

using retroviral expression cloning. SciWorld J 3, 51-58.

Chang B Y, Harte R A, Cartwright C A (2002) RACK1: a novel

substrate for the Src protein-tyrosine kinase. Oncogene 21,

7619-7629.

Chiang C W, Harris G, Ellig C, Masters S C, Subramanian R,

Shenolikar S, Wadzinski B E, Yang E (2001) Protein

phosphatase 2A activates the proapoptotic function of BAD

in interleukin-3-dependent lymphoid cells by a mechanism

requiring 14-3-3 dissociation. Blood 97, 1289-1297.

Cohen O, Feinstein E, Kimchi A (1997) DAP-kinase is a Ca2+

calmodulin-dependent cytoskeletal-associated protein kinase

with cell death-inducing functions that depend on its catalytic

activity. EMBO J 16, 998-1008.

Cory S, Adams J M (2002) The BCL2 family: Regulators of the

cellular life-or-death switch. Nat Rev Cancer 2, 647-656.

Danielsen M, Peterson D O, Stallcup M R (1983) Immunological

selection of variant mouse lymphoid cells with altered

glucocorticoid responsiveness. Mol Cell Biol 3, 1310-1316.

Deiss L P, Feinstein E, Berissi H, Cohen O, Kimchi A (1995)

Identification of a novel serine threonine kinase and a novel

15-kd protein as potential mediators of the gamma-

interferon-induced cell-death. Genes Dev 9, 15-30.

Deng X, Ito T, Carr B, Mumby M, Stratford May Jr M (1998)

Reversible phosphorylation of Bcl2 following interleukin-3

or bryostatin 1 is mediated by direct interaction with PP2A. J

Biol Chem 273, 34157-34163.

Dexter T M, Garland J, Scott D, Scolnick E, Metcalf D (1980)

Growth of factor-dependent hematopoietic precursor cell-

lines. J Exp Med 152. 1036-1047.

Finkel M P, Reilly Jr C A, Biskis B O (1976) Recent Results

Cancer Res 54, 92-103.

Hale A J, Smith C A, Sutherland L C, Stoneman V E A,

Longthorne V L, Culhane A C, Williams G T (1996)

Apoptosis: Molecular regulation of cell death. Eur J

Biochem 236, 1-26.

Hengartner M O (2000) The biochemistry of apoptosis. Nature

407, 770-776.

Hitoshi Y, Lorens J, Kitada S I, Fisher J, LaBarge M, Ring H Z,

Francke U, Reed J C, Kinoshita S, Nolan G P (1998) Toso, a

cell surface specific regulator of Fas-induced apoptosis in T

cells. Immunity 8, 461-471.

Inbal B, Cohen O, PolakCharcon S, Kopolovic J, Vadai E,

Eisenbach L, Kimchi A (1997) DAP kinase links the control

of apoptosis to metastasis. Nature 390, 180-184.

Jundt F, Anagnostopoulos I, Forster R, Mathas S, Stein H,

Dorken B (2002) Activated Notch1 signaling promotes

tumor cell proliferation and survival in Hodgkin and

anaplastic large cell lymphoma. Blood 99, 3398-3403.

Kerr J F R, Winterford C M, Harmon B V (1994) Apoptosis - its

significance in cancer and cancer-therapy. Cancer 73, 2013-

2026.

Liaudet-Coopman E, Beaujouin M, Derocq D, Garcia M,

Glondu-Lassis M, Laurent-Matha V, Prebois C, Rochefort H,

Vignon F (2006) Cathepsin D: newly discovered functions of

a long-standing aspartic protease in cancer and apoptosis.

Cancer Letts 237, 167-179.

Liliental J, Chang DD (1998) Rack1 a receptor for activated

protein kinase C interacts with integrin beta subunit. J Biol

Chem 273, 2379-2383.

McCarthy N J, (1993) Apoptosis induced by cancer

chemotherapeutic drugs and its genetic suppression. D. Phil

(University of Birmingham).

Miller D G and Miller A D (1992) Tunicamycin treatment of

CHO cells abrogates multiple blocks to retrovirus infection

one of which is due to a secreted inhibitor. J Virol 66, 78-84.

Morgenstern J P, Land H (1990) Advanced mammalian gene-

transfer - high titer retroviral vectors with multiple-drug

selection markers and a complementary helper-free

packaging cell-line Nucl Acid Res 18, 3587-3596.

Mourtada-Maarabouni M, Kirkham L, Farzaneh F, Williams G T

(2004) Regulation of apoptosis by fau revealed by functional

expression cloning and antisense expression. Oncogene 23,

9419-9426.

Mourtada-Maarabouni M, Kirkham L, Farzaneh F, Williams G

T, (2005) Functional expression cloning reveals a central role

for the receptor for activated protein kinase C 1 (RACK1) in

T cell apoptosis. J Leuk Biol 78, 503-514.

Mourtada-Maarabouni M, Kirkham L, Jenkins B, Rayner J,

Gonda T J, Starr R, Trayner I, Farzaneh F, Williams G T

(2003) Functional expression cloning reveals proapoptotic

role for protein phosphatase 4. Cell Death Diff 10, 1016-

1024.

Nishi T, Forgac M (2002) The vacuolar (H+)-ATPases - Nature's

most versatile proton pumps. Nat Rev Mol Cell Biol 3, 94-

103.

Nowrouzi A, Dittrich M, Klanke C, Heinkelein M, Rammling M,

Dandekar T, von Kalle C, Rethwilm A (2006) Genome-wide

mapping of foamy virus vector integrations into a human cell

line. J Gen Virol 87, 1339-1347.

Rayner J R, Gonda T J (1994) A simple and efficient procedure

for generating stable expression libraries by cDNA cloning in

a retroviral vector. Mol Cell Biol 14, 880-887.

Rogulski K, Li Y J, Rothermund K, Pu L X, Watkins S, Yi F H,

Prochownik E V (2005) Onzin a c-Myc-repressed target

promotes survival and transformation by modulating the Akt-

Mdm2-p53 pathway. Oncogene 24, 7524-7541

Roschier M, Kuusisto E, Suuronen T, Korhonen P, Kyrylenko S,

Salminen A (2001) Insulin-like growth factor binding protein

5 and type-1 insulin-like growth factor receptor are

differentially regulated during apoptosis in cerebellar granule

cells. J Neurochem 76, 11-20.

Shin M S, Fredrickson T N, Hartley J W, Suzuki T, Agaki K, and

Morse H C (2004) High-throughput retroviral tagging for

identification of genes involved in initiation and progression

of mouse splenic marginal zone lymphomas. Cancer Res 64,

4419-4427.

Stark G R, Gudkov A V (1999) Forward genetics in mammalian

cells: functional approaches to gene discovery. Hum Mol

Genet 8, 1925-1938.

Thompson C B (1995) Apoptosis in the pathogenesis and

treatment of disease. Science 267, 1456-1462.

Thornberry N A, Lazebnik Y (1998) Caspases: Enemies within.

Science 281, 1312-1316.

Williams G T, Smith C A (1993) Molecular regulation of

apoptosis - genetic controls on cell-death. Cell 74, 777-779.

Zannettino A C W, Rayner J R, Ashman L K, Gonda T J,

Simmons P J (1996) A powerful new technique for isolating

genes encoding cell surface antigens using retroviral

expression cloning. J Immunol 156, 611-620.


262


263


The prevalence of antibiotic resistance in anaerobic

bacteria isolated from patients with skin infections Research Article

Gita Eslami*, Fatemeh Fallah, Hossein Goudarzi and Masoumeh Navidinia Microbiology Department, Medical Faculty Shaheed Beheshti University of Medical Science & Pediatric Infectious

Research Center Tehran- Iran

__________________________________________________________________________________

*Correspondence: Gita Eslami Ph.D, Associate Professor, Microbiology Department, Medical Faculty of Shaheed Beheshti University,

Evin Street, Charman High way, Tehran-Iran; Tel: 0098-21-23872556; Fax: 009821-2413042; E-mail: [email protected]

Key words: Antibiotic resistance, anaerobic bacteria, skin infection

Received: 2 September 2005; Revised: 01 August 2006

Accepted: 17 August 2006; electronically published: December 2006

Summary

Antibiotic resistance in Anaerobic bacteria and the lack of proper outline to treatment of anaerobic infections have

been increased in recent years, In this study 100 patients with skin infections (10-60 years old) were considered.

Specimens were collected in the sterile condition and transported and cultured in the Thioglycolate media. After

growing and staining of bacteria (gram staining) from selective media, bacteria were cultured in the differentiated

media. Strains that were isolated, undergone antibiogram test (Kirby bauer method). Skin infections are usually

polymicrobial involving aerobic and anaerobic bacteria. Common aerobic and anaerobic facultative bacteria

contained: Staphylococcus aureus (37.3%), non coagolase Staphylococci (8.5 %), group A streptococci (16.3 %),

group D enterococci (5.7%), E.coli (15.6 %), enterobacter-spp (5.6%), citrobacter-spp (0.8%), Pseudomonas

aeruginosa (6.9%), proteus-spp (2.7%), others (0.6%). Predominant anaerobic bacteria contained:

Peptostreptococcus-spp (42.5%), pigmented prevotella and Porphyromon-spp (5.4%), Fusobacterium (7.6%)

Bacteroides-spp (23.2%), Clostridium-spp (18.4%), Propionebacteriom acnes (2.1%), others (0.8%). Atibiogram

test was done on aerobic-anaerobic facultative bacteria. Susceptibility of these bacteria were as following:

Cefizoxim100%, Ciprofloxcin 98%, Ceftazidim 82%, Tobramycin 47%, and Amikacin 33%. And their resistance to

Gentamycin was 97%, Penicillin 93%, Cloxacillin 86%, and Erythromycin 62%. In anaerobic bacteria,

susceptibility to Ciprofloxacin was 100%, Ceftyzoxim 100, Ceftazidim 91% Rifampin 76%, Colistin 67%, and their

resistance to Penicillin was 95%, Erythromycin 83%, Cloxacillin 85%. Susceptibility of both anaerobic and aerobic

bacteria to Ceftizoxim was 100 %, so we suggest this drug for treatment of many skin infections.

I. Introduction Anaerobic bacteria are important because they

dominate the diagnose flora. They are commonly found in

different infections. Some of these infections are serious

and have high mortality rate (Brook, 1995; Finegold,

1995; Summanen et al, 1995). It has to be paid more

attention to anaerobic infections because special

precautions are needed for appropriate collection and

transport of specimens. Isolation and identification of

anaerobic bacteria can be complex, difficult, labor-

intensive, and expensive. The majority of these infections

have caused mixtures of numerous strains of aerobic and

anaerobic bacteria. Interpreting culture to establish the

extent, to which any one particular anaerobe in the mixture

is contributing to infection, is difficult (Brook et al, 1997;

Wexler and Finegold, 1998). Treatment considerations for

these mixed anaerobic infections are difficult and causing

even more problem with increasing resistance among these

groups of organisms. A number of antimicrobials have

poor or no activity against some bacteria (Wexler et al,

1998; Chau, 1999; Nichols et al, 1999). Failure to provide

antibacterial coverage against the anaerobes in a mixed

aerobic-anaerobic infection may lead to inadequate

response. This could, of course, be attributed to another

factor such as the possibility of an untrained abscess

(Holten and Onusko, 2000). The therapeutic approach in

anaerobic infections is complex and involves modification

of the local environment of the infected site and the use of

appropriate antibacterial agents.

Surgical management, particularly drainage and

debridement is an important aspect of treatment of the

most anaerobic infections. In a large number of soft tissue

infections, anaerobes may play an important role. Among

these are superficial infections of the skin and skin

Eslami et al: Antibiotic resistance in anaerobic bacteria isolated from patients with skin infections

264

structures such as cellulites, infected cutaneous ulcer,

infected sebaceous or inclusion cysts, hidradenitis

supportive, pyoderma, paronychia, and tropical ulcer

(Goldstein et al, 2002). The choice of single-agent therapy

of mixed infections is ideally based on local data of

susceptibility patterns of the bacteria involved in these

infections.

II. Materials and methods This descriptive study was performed at faculty of

medicine in medical university of shaheed Beheshti and medical

sciences from March 2002 through 2003. In this research, 100

patients with skin infections including samples of ulcer (in foot,

gluteal, nose, under breast, knee elbow), abscesses (from

inguinal, neck, perianal, nose), pastula, acnes and bullea were

examined.

Collecting was done with syringe and swabs. All of

specimens were transferred to transport media. Swab specimens

were homogenized in a small amount of broth. Aspirates were

thoroughly mixed before inoculation. For transport media

Tripticase soy broth for aerobic bacteria and Thioglycolate broth

for anaerobic bacteria were used. Then we cultured these

specimens in blood agar, (with L-cysteine, yeast extract vitamin

k and hemin), selective media bile-esculin agar which is

anaerobic blood agar containing Kanamycin to inhibit facultative

gram negative rods and Vancomycin to inhibit gram positive

bacteria, chocolate agar and Mac conkey agar, for first screening.

Therefore, we used 6 plates for each specimen; 3 plates for

aerobic condition that were examined after 24 h and 3 plates for

anaerobic. Plates must be immediately placed in anaerobic jars

condition (jar with gas pack generates H2 gas and a cold

palladium catalyst converts remaining O2 to water) and examined

after 48-72 h. After growing of the colonies, we stained colonies

of bacteria with gram staining and determined shape of bacteria.

Then we used specific culture and test for identifying type of

bacteria. In the mean time we used aerobic and anaerobic

condition. When we identified type of bacteria which caused

infections, we performed antibiogram test by Kirby-Bauer

method (gel diffusion test) in blood or chocolate agar with

Muller-Hinton base agar. After 24 h for aerobic and 48-72 h for

anaerobic bacteria, we reported susceptibility of bacteria to

antibiotic disk.

III. Results We examined 100 samples from patients with ulcer

(in foot, Gluteal, nose, under breast, knee, and elbow),

abscesses (from inguinal, neck, perianal, nose), pastula,

acnes, bullea. In our research, we examined 58 specimens

from women (Figure 1) and 42 specimens from men with

age between 10-60 years old (Figure 2). Common aerobic

and anaerobic facultative bacteria (Figure 3) were:

Staphylococcus aureus (37.3%), non coagolase

Staphylococci (8.5 %), group A Streptococci (16.3 %),

group D Enterococci (5.7%), E.coli (15.6 %),

Enterobacter-spp (5.6%), Citrobacter- spp (0.8%),

Pseudomonas aeruginosa (6.9%), Proteus-spp (2.7%),

others (0.6%) (Figure 4).

Figure 1. The symptoms in infectious skin in women

Figure 2. The age of patients with skin infection


265

Figure 3. Microbiology of specimens from patients with skin infection

Figure 4. The prevalence of aerobic bacteria isolated from patients with skin infection

Predominant anaerobic bacteria were:

Peptostreptococcus-spp (42.5%), pigmented Prevotella and

Porphyromon-spp (5.4%), Fusobacterium (7.6%)

Bacteroides-spp (23.2%), Clostridium-spp (18.4%),

Propionebacteriom acnes (2.1%), others (0.8%) (Figure 5).

Atibiogram test was done on aerobic-anaerobic

facultative bacteria.

Susceptibility of these bacteria were as following:

Cefizoxim100%, Ciprofloxcin 98%, Ceftazidim 82%,

Tobramycin 47%, and Amikacin 33%. And their

resistance to Gentamycin was 97%, Penicillin 93%,

Cloxacillin 86%, and Erythromycin 62% (Figure 6). In

anaerobic bacteria, susceptibility to Ciprofloxacin was

100%, Ceftyzoxim 100, Ceftazidim 91% Rifampin 76%,

Colistin 67%, and their resistance to Penicillin was 95%,

Erythromycin 83%, Cloxacillin 85% (Figure 7).

Susceptibility of both anaerobic and aerobic bacteria to

Ceftizoxim was 100 %, so we suggest this drug for

treatment of many infections.

Figure 5. The prevalence of anaerobic bacteria isolated from patients with skin infection


266

Figure 6. The prevalence of antibiotic susceptibility aerobic bacteria isolated from patients with skin infection

Figure 7. The prevalence of antibiotic susceptibility anaerobic bacteria isolated from patients with skin infection

IV. Discussion Expecting exact correlation of laboratory results with

clinical outcome is not realistic. Infections involving

anaerobes are typically polymicrobial (Caceres et al, 1999;

Bryskier, 2001; Ueno et al, 2002); It is often not necessary

to eradicate all of the organisms to gain a cure.

Appropriate surgical manipulation, the patients general

health status, and the microenvironment at the site of the

infection will have a significant impact on the outcome,

regardless of whether a particular isolate is susceptible to

the antimicrobial. The aims of this study were to

determine the antimicrobial susceptibility pattern and to

study the role of bacteria which had been isolated from the

cultures which had been taken from different skin

infections.

In many studies of skin and soft tissue,

Staphylococcus aureus was the most common pathogen.

Group A Streptococci ranks as a second common

pathogen in gram positive cocci (Caceres et al, 1999;

Chau, 1999; Goldstein et al, 2002; Ueno et al, 2002). In

our study we found S.aureus (37.3%) and streptococcus

pygenes (16.3%). Other reports showed that the isolation

rates of Bacteroides Fragilis group organism have recently

been increasing in both primary and post operative

infection (Caceres et al, 1999; Bryskier, 2001; Goldstein et

al, 2002) and Peptosterptococci typically are the most

common isolated anaerobic bacteria (Wexler and

Finegold, 1998; Wexler et al, 1998; Chau, 1999). We

isolated Peptostreptococci (43%) and Bacteroides group

organism (23.2%), which is as same as the other reports.

Nevertheless, accurate information regarding the efficacy

of a certain agent in inhibiting or killing the organism will

certainly give useful clinical information for choice of a

therapeutic agent. A consensus group of infectious disease

clinicians concluded that in the most serious infections

involving anaerobes, susceptibility test results correlate

with the clinical response. The mechanisms by which

anaerobic bacteria become resistant to !lactames

antibiotics are similar to those described in aerobes and

include the production of ! lactames, changes in penicillin

G binding proteins, and changes in outer membrane


267

permeability to ! lactames (Holten and Onusko, 2000;

Bryskier, 2001). Antibacteria therapy must cover the key

pathogens. Some compounds have significant activity

against both aerobic and anaerobic microorganisms

(Caceres et al, 1999; Chau, 1999; Goldstein et al, 2002;

Ueno et al, 2002). The antibiogram test of anaerobic and

aerobic isolated from Iranian patients with skin infection

was determined by using the most common antimicrobial

agents used in Iran.

In our survey, it was shown that anaerobic and

aerobic facultative bacteria resistance rate were:

Cloxacillin (86%), Penicillin (93%), Gentamycin (97%)

and susceptibility were Ceftizoxim (100%), Ciprofloxacin

(98%).

In anaerobic bacteria, resistance to penicillin were

(95%), Cloxacillin (85%), Erthromycin (83%), and

susceptibility to Ciprofloxacin, Ceftyzoxim were (100%),

Ceftazidim (91%).

We concluded that, in skin infections which are

composed of both aerobic and anaerobic bacteria,

Ciprofloxacin, Ceftyzoxim were highly active drugs that

could eradicate the major pathogens bacteria found from

skin infection in Iranian patients.

In conclusion, the results of the present investigation

show a high level of resistance in aerobes and anaerobes

bacteria. This may be the result of the extensive antibiotic

used in patients.

References Brook I (1995) Microbiology of secondary bacterial infection in

scabies lesions. J Clin Microbiol 33, 2139-2140. Brook I, Frazier EH, Yeager JK (1997) Microbiology of

nonbullous impetigo. Pediatr Dermatol 14, 192-5. Bryskier A (2001) Anti-anaerobic activity of antibacterial agents.

Expert Opin Investig Drugs 10, 239-67.

Caceres M, Carrera E, Palma A, Berrios G, Weintraub A, Nord

CE (1999) Antimicrobial susceptibility of anaerobic and

aerobic bacteria isolated from patients with mixed infections

in Nicaragua. Rev Esp Quimioter 12, 332-9. Chau JC (1999) Combating bacterial resistance in skin and skin-

structure infection: importance of !-lactamase inhibition. Am

J Ther 6, 13-18. Finegold SM (1995) Anaerobic infections in humans: an

overview. Anaerobe 1, 3-9. Goldstein EJ, Citron DM, Merriam CV, WarrenY, Tyrrell KL,

Gesser RM (2002) General microbiology and in vitro

susceptibility of anaerobes isolated from complicated skin-

structure infections from complicated skin and skin -structure

infections in patients enrolled in a comparative trail of

eratapennem versus piperacillin-tazobactam. Clin Infect Dis

35(suppl 1):S119-25. Holten KB, Onusko EM (2000) Appropriate prescribing of oral

!-lactam antibiotics. Am Fam Physician 62, 611-20. Nichols RL, Graham DR, Barriere SL, Rodgers A, Wilson SE,

Zervos M, Dunn DL, Kreter B (1999) Treatment of

hospitalized patients with complicated gram-positive skin

and skin structure infections: two randomized, multicentre

studies of quinupristin/dalfopristin versus cefazolin, oxacillin

or vancomycin. Synercid Skin and Skin Structure Infection

Group. J Antimicrob Chemother 44, 263-73.

Summanen PH, Talan DA, Strong C, McTeague M, Bennion R,

Thompson JE, Vaisanen ML, Moran G, Winer M, Finegold

SM (1995) The bacteriology of skin and soft tissue

infections: a comparison of infections in intravenous drug

abusers and nonintravenous drug abusers. Clin Infect Dis 20

(Suppl 2), S279-S282.

Ueno K, Kato N, Kato H (2002) The status of research on

anaerobes in Japan. Clin Infect Dis 35 (supply 1), 828-35. Wexler HM, Molitoris E, Molitoris D, Finegold SM (1998) In

vitro activity of levofloxacin against a selected group of

anaerobic bacteria isolated from skin and soft tissue

infections. Antimicrob Agents Chemother 42, 984-6. Wexler HM, Finegold SM (1998) Current susceptibility patterns

of anaerobic bacteria. Yonsei Med J 39, 495-501.


268


269


Transfection of the anti-apoptotic gene bcl-2 inhibits

oxidative stress-induced cell injuries through

delaying of NF-!B activation

Research Article

Shinobu Yanada1, Masashi Misumi1, Yasukazu Saitoh1, Yasufumi Kaneda2,

Nobuhiko Miwa1,* 1Laboratory of Cell-Death Control BioTechnology, Faculty of Life and Environmental Sciences, Prefectural University of

Hiroshima, Hiroshima 727-0023, Japan 2Division of Gene Therapy Science, Graduate School of Medicine, Osaka University Medical School, 2- 2 Yamada-oka,

Suita, Osaka, Japan

__________________________________________________________________________________

*Correspondence: Nobuhiko Miwa, Ph.D., Laboratory of Cell-Death Control BioTechnology, Faculty of Life and Environmental

Sciences, Prefectural University of Hiroshima, 562 Nanatsuka, Shobara, Hiroshima 727-0023, Japan; Tel and Fax: +81-824-74-1754; E-

mail: [email protected]

Key words: Bcl-2, NF-!B, H2O2, oxidative stress, apoptosis

Abbreviations: artificial viral envelope, (AVE); Dulbecco’s modified Eagle’s medium, (DMEM); enhanced chemiluminescence, (ECL);

electrophoretic mobility shift assay, (EMSA); post-ischemic reperfusion, (I/R); reactive oxygen species, (ROS); hemagglutinating virus

of Japan, (HVJ); human Bcl-2, (hBcl-2); terminal deoxyribonucleotidyl transferase (TdT)-mediated dUTP nick-end labeling, (TUNEL);

tert-butyl hydroperoxide, (t-BuOOH)

Received: 25 November 2006; Revised: 16 December 2006

Accepted: 22 December 2006; electronically published: December 2006

Summary We investigated the relation between endogenous NF-!B and exogenous overexpressed Bcl-2 in rat fibroblastic cells

(Rat-1) in response to H2O2 after confirming the cytoprotective effect of Bcl-2 against oxidative stresses such as in

vitro treatment with H2O2 and in vivo hepatic post-ischemic reperfusional (I/R) injury. Exogenous Bcl-2, which was

expressed by hemagglutinating virus of Japan (HVJ)-artificial viral envelope (AVE) liposome-mediated gene

transfer of human bcl-2 that was incorporated into an SV2 vector, prevented I/R-induced hepatic injuries such as

cellular DNA strand cleavages more effectively than the non-transfection treatment. The bcl-2-transfected Rat-1

fibroblasts exerted the cytoprotective effect against H2O2 of 50-250 uM more markedly than the SV2 vector-

transfected or non-transfected counterpart cells. Immunocytochemical analysis and electrophoretic mobility shift

assay (EMSA) showed that intracellular activation of NF-!B in bcl-2-transfectants was repressed more appreciably

than in SV2-transfectants at a period as early as 30 min after H2O2 stimulation, but, at advanced periods of 90 and

120 min, was increasingly exhibited up to the similar and exceeding levels relative to those of SV2-transfetants,

respectively. Thus the prevention by the anti-apoptotic gene bcl-2 against oxidative stress-induced injury may be

attributed at least partly to the repressed early activation and/or the delayed activation of NF-!B. The results

provide the foundation for redox-mediated gene therapies using bcl-2 gene directing at ameliorative effects against

oxidative stress-induced injuries.

I. Introduction Bcl-2, a mammalian homologue of the anti-apoptotic

gene ced-9 in C. elegans, is localized mainly to the

mitochondrial membrane (Hockenbery et al, 1990; Akao

et al, 1994), and is known to be a key regulator for

apoptosis, functioning as an anti-apoptotic protein with the

ability to protect against a variety of physiologic or

pathologic insults and environmental stimuli (Vaux et al,

1988; Reed, 1994; Tsujimoto, 2003). A number of

mechanisms have been proposed to explain the ability of

Bcl-2 to suppress apoptosis (Oltvai et al, 1993; Yang et al,

1997; Shimizu et al, 1998). The localization of Bcl-2 at the

loci of free radical generation such as mitochondria may

correlate with its ability to protect the subcellular

organization (Gross et al, 1999) and to function as an

apparent anti-oxidant agent against oxidative stress that

Yanada et al: Exogenous Bcl-2 inhibition through delayed activation of NF-!B

270

may induce apoptosis (Hockenbery et al, 1993;

Voehringer et al, 2000; Jang et al, 2003).

We previously showed that in vitro cytoprotective

effects of human Bcl-2 (hBcl-2) against oxidants such as

the tert-butylhydroperoxide (t-BuOOH) or post-hypoxic

anoxia-induced oxidative injury (Saitoh et al, 2003a,b).

And we recently demonstrated that in vivo inhibitory

effects of hBcl-2 on ischemia-reperfusion (I/R) injury

involve the repression of increased reactive oxygen

species (ROS) (Yanada et al, 2004 and 2005). However,

we have not demonstrated definite inhibitory mechanism

against oxidative stress by Bcl-2, and it has been in a state

of controversy.

As a hint to elucidate the mechanism underlying cell-

death inhibition by Bcl-2, it is able to cite the ubiquitous

eukaryotic transcription factor, NF-!B which regulates

expression of numerous cellular genes that play important

roles in mediating/regulating immune and stress responses,

inflammation, apoptosis, proliferation and cell survival

(Baeuerle et al, 1994 and 1996). In addition, NF-!B is

known to be activated by oxidative stress, which is

generated by ROS such as H2O2 and O2-, resulting in

occurrence of apoptosis and/or necrosis in correspondence

to balance with inherent anti-oxidative cellular defense

(Wang et al, 2002).

In the present study, after confirming the inhibitory

effect of Bcl-2 on in vivo oxidative stress, to investigate

the practical mechanisms involved in Bcl-2 cytoprotection

against H2O2-induced oxidative stress, we focused on the

relations between activation of endogenous NF-!B and

exogenous overexpressing Bcl-2 in rat fibroblastic cells.

". Materials and methods A. Plasmid DNA As a plasmid vector, pC"j-SV2 and pC"j-bcl-2 (12.5 kbp,

13.5 kbp; [Tsujimoto, 1989]) was used as previously described

(Yanada et al, 2004). Human bcl-2 cDNA (1.0 kbp) was inserted

into the EcoRI sites of SV40 early promoter in the pC"j-SV2.

The plasmids were amplified in Escherichia coli DH5a. Both

plasmids were kindly provided by Dr. Shoji Yamaoka of Tokyo

Med. Dent. Univ. and Dr. Yoshihide Tsujimoto of Osaka Univ.,

respectively.

B. In vivo oxidative stress model; I/R

operation of rat livers Male Wistar rats weighting 250 to 300 g (8-weeks old)

were purchased from Japan SLC, Shizuoka, Japan, and were

housed at 22 ± 2# for 12 hr light-dark cycle with access to

water and food. They were used in experiments following

adjustment to these conditions for at least 3 days and were fasted

overnight before the experiments. I/R operation was performed

as previously described (Eguchi et al, 2003; Yanada et al, 2004

and 2005). An approximately 70% region of the whole liver was

made ischemic by clamping both portal vein and the hepatic

artery, and resultantly ROS was generated in the ischemic livers

(Eguchi et al, 2003).

C. In vivo transfection of plasmids encoding

bcl-2 gene For preparing gene transfection’s vector, hemagglutinating

virus of Japan (HVJ)-artificial viral envelope (AVE) liposome

was prepared as described (Saeki et al, 1997; Yanada et al,

2005). Prepared HVJ-AVE liposome mixture (200 $g of plasmid

DNA and 65 $g of HMG-1, 2 mixture [Wako Pure Chemicals

Industries, Osaka]) was injected into the liver via the portal vein

by cannulation. The transfection ratio into hepatocytes by this

cannulation was approximately 20-30% on the second day after

transfection. The transfected genes were expressed around the

portal vein of median and left lobes at 2 days after transfection

(Yanada et al, 2005). At the time, therefore, livers were quarried

and analyzed.

D. TUNEL assay Cell death associated with I/R-induced hepatic injuries was

analyzed by terminal deoxyribonucleotidyl transferase (TdT)-

mediated dUTP nick-end labeling (TUNEL) assay using the In

situ Apoptosis Detection Kit (TaKaRa, Shiga, Japan) according

to the manufacture’s protocol as described (Yanada et al, 2005).

Sections of the caudal and median lobes in the I/R-receiving rat

livers were prepared at 150 min after reperfusion, and were

evaluated by TUNEL assays as compared with those of non-

transfected and bcl-2-transfected rats. Sections were examined

under a laser scanning confocal fluorescence microscope [MRS-

600 Cosmos; Carl Zeiss, Oberkochen, Germany (Bio-Rad,

Hercules, CA)] at a 100-fold magnification, and expressed in

pseudo-color from red (scarcely stained) via yellow (weakly

stained) to purple (most strongly stained) by processing of

fluorescence intensity with an NIH-Image software for

evaluation of the degree of apoptosis. And to elucidate degrees of

I/R-induced DNA strand cleavages, images were analyzed and

expressed by histogram.

E. Cell culture Rat fibroblastic cells, Rat-1 (Topp, 1981) were used as a

parent type, and were kindly provided by Dr. Shoji Yamaoka of

Tokyo Med. Dent. Univ. Rat-1 cells (non-transfectants, WT)

were cultured in complete medium, Dulbecco’s modified Eagle’s

medium (DMEM, Nissui Pharmaceutical Co., Ltd., Tokyo,

Japan) containing 10% heat-inactivated fetal bovine serum (FBS;

GIBCO BRL, Grand Island, NY), 4 mM L-glutamine, 50 $g/ml

penicillin, and 50 $g/ml streptomycin at 37# in a humidified

atmosphere of 95% air and 5% CO2. To make stable bcl-2-

overexpressed transfectants or SV2 (the empty vector without

encoding bcl-2) transfectants, Rat-1-SV2 cells, pC"j-SV2 or

pC"j-bcl-2 was introduced into Rat-1 cells by the calcium

phosphate precipitation method, respectively as described (Paker

et al, 1979). Briefly, 1.5 x 105 cells of Rat-1 were seeded into a

35-mm dish. At 16 hr after seeding, 275 $l of 2 M Ca2+ solution

containing plasmid DNA (pC"j-bcl-2 or pC"j-SV2, 10 $g each)

and 275 $l of 2 x HBS was mixed under supplying air. The DNA

mixture solution was poured into the cells. After 1-2 days, the

cells were washed twice with phosphate-buffered saline [PBS(-)],

and subcultured into 100-mm dishes at appropriate cell

concentration in complete medium containing 600 $g/ml

Geneticin disulfate (G418; Wako) at 37# in a humidified

atmosphere of 95% air and 5% CO2. Medium was changed at

every 3 days. After 2 weeks, single colony picked up using a

cloning cup (Iwaki Co., Tokyo), and cultured to be grown up and

become near-confluent. Bcl-2 expression levels of our prepared-

bcl-2- transfectants were compared with the level of bcl-2-stable

transfectants, b5 cells (a kind gift from Dr. Shoji Yamaoka of

Tokyo Med. Dent. Univ.), and the cells which expressed the

same level as that of b5 cells were selected out of some candidate

colonies.

F. Western blotting Western blotting was performed for analysis of bcl-2

expression of Rat-1 and our picked up- SV2- or bcl-2-


271

transfectant, as previously described (Saitoh et al, 2003a,b). Cells

were washed twice with PBS and lysed with an ice-cold buffer

containing 50 mM Tris- HCl (pH 7.5), 150 mM NaCl, 1 mM

DTT, 1 mM PMSF, 1% IGEPALCA-630, 1% SDS, 4 mM

leupeptin, and 3 $M pepstatin A. After being three times freeze-

thawed, the lysate was centrifuged at 20,000 g for 5 min at 4#

and the supernatant was collected. The amount of protein was

measured using DC Protein Assay kit (Bio-Rad). The cell lysates

were resuspended in buffer containing 62.5 mM Tris-HCl (pH

6.8), 15% glycerol, 10% %-mercaptoethanol, 0.005%

bromophenol blue, and 4% SDS. Then the cell lysates were

boiled for 3 min and applied to a 12% SDS–polyacrylamide gel,

and the separated proteins were blotted to 0.45-$m thick

polyvinylidene difluoride (PVDF) membranes (Millipore).

Nonspecific binding was blocked by incubating the membranes

for 2 hr at room temperature in a blocking buffer containing 50

mM Tris-HCl (pH 7.5), 3% bovine serum albumin, and 150 mM

NaCl. The membranes were then stained with the 1: 2,500

diluted mouse monoclonal antibody against human Bcl-2

(product #sc-509; Santa Cruz Biotechnology, CA) in blocking

buffer overnight at 48# with agitation. After they were washed

three times with washing buffer containing 50 mM Tris (pH 7.9),

100 mM NaCl, and 0.05% Tween-20, the membranes were

incubated with the 1: 3,000 diluted horseradish peroxidase-

conjugated anti-mouse IgG antibody in a blocking buffer for 30

min at room temperature. After they were washed twice with the

washing buffer, the membranes were washed with the blocking

buffer. The specific bands were detected using an enhanced

chemiluminescence (ECL) detection system (Amersham-

Pharmacia Biotech, England, UK), and blots were exposed to

Hyperfilm MP (Amersham) for 0.5–2 min. Laser scanning

densitometry was conducted for semiquantitative analysis of the

data. Approximately equivalent amounts of loaded proteins were

confirmed by the densitometric values of some randomly

selected bands on the Coomassie Brilliant Blue-stained gel.

G. Cell viability assay Cell viability of Rat-1 and SV2- or bcl-2-transfected cells

was measured by WST-1 method as previously described (Saito

et al, 2003a and b). Briefly, the cell layer in a dish was incubated

with WST-1 (2-(4-iodophenyl)- 3-(4-nitrophenyl)-5-(2,4-

disulfophenyl)-2 H-tetrazolium, monosodium salt) (Dojin

Laboratories Co., Kumamoto, Japan) solution at 1:10 volume of

phenol red-free culture medium for 3 hr at 37#. Viable cells

with activity of mitochondrial dehydrogenases such as succinate

dehydrogenage are capable of reducing the WST-1 dye to

generate the yellowish formazan. At the end of incubation

period, the absorbance of each sample was measured at 450 nm

with an absorbance plate reader (Bio-Rad), and the absorbance

values detected have been demonstrated to be proportional to

viable cell numbers. Since there was no difference in the basal

viability (mitochondrial dehydrogenase activity) between non-

transfectants and transfectants, the values obtained from control

cultures (non-treated non-transfectants and transfectants) are

represented as 100% viability. The values of treated cultures are

expressed as a percentage of those versus the corresponding

control cells.

H. Detection of the activation of NF-!B:

Electrophoretic mobility shift assay Nuclear protein extraction was performed as described

previously (Yang et al, 1995). Electrophoretic mobility shift

assay (EMSA) was performed with specific gel-shift assay

system of NF-!B (Promega, Madison, WI). The double-stranded

oligonucleotide probe containing the specific wild-type DNA

binding domain for NF-!B was as follows:

5’-TTTCTAGGGACTTTCCGCCTGGGGACTTTCCAG-

3’. The oligonucleotides were labeled with [&-32P]dATP

(Pharmacia) using the Klenow fragment of DNA polymerase I

(Takara, Tokyo) and purified using a gel-filtration column

(MicroSpin G-25, Pharmacia).

I. Visualized detection of activation of NF-

!B: Immunocytochemical staining Cells of 3.8 x 103 were seeded into each well of 8 well

chamber slide (Nunc. Inc., Roskilde, Denmark), after 24-hr

incubation, the cells were treated with H2O2 at 100 $M for 2 hr.

After further 24-hr incubation, the intracellular activation of NF-

!B in SV2-transfectants and bcl-2- transfectants was analyzed at

0, 15, 30 and 90 min. Briefly, the cells were washed twice in

PBS(-), and fixed with 4.5% paraformaldehyde in PBS(-) for 15

min, and subsequently washed with PBS(-). Cells were then

treated with 0.5% Triton X-100 in PBS(-) for 20 min, and were

thereafter treated with anti-rat NF-!B, p65 subunit (c-20) rabbit

polyclonal antibody (product # sc-372, Santa Cruz

Biotechnology Inc., CA) at a final concentration of 0.5 $g/ml in

3% bovine serum albumin (BSA, Sigma) in PBS(-) at 37# for 1

hr in humidified atmosphere. Cells were then washed with 0.05%

Triton X-100 in PBS(-), and subsequently were incubated with

the secondary antibody, an FITC-conjugated anti-rabbit IgG goat

antibody (product #55646, Organon Technika Co.) at a final

concentration of 0.1 $g/ml in 3% BSA in PBS(-) at 37# for 40

min. The preparations were thereafter washed three times with

PBS(-) for 10 min and mounted in PermaFluor aqueous

mounting medium (Immnunon, Pittsburgh, PA). The slides were

examined on a confocal laser scanning fluorescence microscope

[MRS-600 Cosmos; Carl Zeiss (Bio-Rad)] equipped with an

argon laser as the light source, and then were analyzed with

Photoshop 4.0J and NIH Image softwares.

III. Results A. In vivo protective effect of Bcl-2 on

ischemia-reperfusion (I/R) in rat non-

transfected livers and bcl-2-transfected livers Tissue sections of I/R-operated livers were made at

150 min after reperfusion, and comparison was made

within two groups: bcl-2-transfected, and the non-

transfected livers as analyzed by TUNEL method (Figure

1). Apoptotic TUNEL-positive cells, indicated by purple

or deep blue dots, were markedly observed in the median

lobes of non-transfected livers, concomitantly with the

nuclear condensation in the vicinity of the portal vein

(Figure 1Ab). In contrast, in the median lobes of bcl-2-

transfected livers and the caudal lobes of non- and bcl-2-

transfected livers, TUNEL-positive cells were scarcely

observed (Figures 1Aa, c and d). The I/R-induced DNA

strand cleavage 3’-OH terminals, indicative of a symptom

for apoptotic cells, were also detected by histogram

analysis (Figure 1Bb). Apoptotic cells were observed to

be significantly diminished in the median lobes of bcl-2-

transfected livers, and were not detected by histogram

analysis (Figure 1Bd). Thus, exogenously transfected bcl-

2 is suggested to markedly prevent I/R-induced cellular

DNA strand cleavages.

B. Expression of Bcl-2 in Rat-1 cells, SV2-

or bcl-2-transfectants To investigate the relationship between endogenous

NF-!B and exogenous hBcl-2 after stimulation of ROS,


272

we made bcl-2-transfectants, and analyzed Bcl-2

expression without ROS stimulation by western blotting

(Figure 2). Bcl-2 expression in bcl-2-transfectants was

markedly overexpressed when compared to their non-

transfected and SV2-transfected Rat-1 cells. In addition,

when compared to expression of Bcl-2 stable expressed

cell line, b5 cells, it was confirmed that the Bcl-2

expression level of our picked up-bcl-2 transfectants was

similar to that of b5 cells (data not shown).

C. Protective effect of bcl-2 genes against

H2O2–induced cell death in Rat-1, SV2- or bcl-

2- transfectants To examine the role of bcl-2 genes in the cytotoxic

response to H2O2, Rat-1 and SV2- and bcl-2- transfected

cells were exposed to the indicated concentrations of H2O2

(0–250 $M) for 2 hr. After the indicated exposure time,

cells were incubated for 24 hr in fresh medium, and then

were assessed for the cell viability by WST-1 assay.

Treatment with H2O2 for 2 hr decreased the cell viability of

both the parent and bcl-2-transfected cells in a dose-

dependent manner (Figure 3). Cell viability of bcl-2-

transfected cells was more markedly retained than that of

the parent Rat-1 or SV2-transfected cells against H2O2 -

induced injuries, and was slightly increased than the

initiate level at 100 and 125 $M of H2O2.

Figure 1. Cellular DNA cleavages in paraffin-embedded tissue sections of non-transfected and bcl-2-transfected livers after post-

ischemic reperfusion (I/R) as assayed by TUNEL method (A). The sections of the caudal (non-ischemia; a, c) and median lobes

(ischemia treatment; b, d) of the I/R-receiving rat livers were prepared at 150 min after the beginning of reperfusion, and were evaluated

for non-transfected rats (a, b), and bcl-2-transfected rats (c, d) by TUNEL assays. Sections were examined under a confocal fluorescence

microscope at a 100-fold magnification, and expressed in pseudo-color from red (scarcely stained) via yellow (weakly stained) to purple

(most strongly stained) by processing of fluorescence intensity with an NIH-Image software for evaluation of the degree of DNA 3’-OH

cleavage terminals as an indicator for apoptosis. The scale indicates 50 $m. To detect I/R-induced DNA strand cleavages, images were

analyzed to be expressed in histograms (B). All data shown are typical of 3-4 sheets of micro-slices per each examined groups that

showed the same staining degree among three independent experiments.

Figure 2. Expression of exogenous human Bcl-2 in wild type (Rat-1 cells; WT), SV2- and bcl-2- transfected cells. After establishment

of transfectants, each cell population was analyzed for expression of Bcl-2 without oxidative stimulation by western blotting using an

anti-hBcl-2 antibody.


273

Figure 3. Dependences of cell viability of Rat-1, SV2- and bcl-2-transfected cells on treatment with H2O2. At 24 hr after stimulation of

different H2O2 concentration (0-250 $M), cell viability in each cell population was evaluated by mitochondrial dehydrogenase-based

WST-1 assay. And microscopic views of SV2- and bcl-2-transfected cells with treatment of H2O2 (0, 100 and 125 $M) show together.

The scale in the image indicates 50 $m.

D. Bcl-2 affects intracellular activation of

NF-!B at initiate period after stimulation of

H2O2 To elucidate the cytoprotective mechanism of Bcl-2,

we examined whether activations of NF-!B in non- or bcl-

2-transfectants would be occurred when both cells were

exposed to 100 $M of H2O2. The intracellular activation of

NF-!B in SV2- and bcl-2-transfectants was analyzed at 0-

120 min by EMSA system. In SV2-transfectants,

intracellular activations of NF-!B were rapidly and

strongly occurred at 30 min, but, in bcl-2-transfectants,

were detected weakly at 0 and 30 min (Figure 4).

However, at 90 and 120 min after stimulation, intracellular

activation of NF-!B was strongly detected in both cells

(Figure 4). Moreover, interestingly, NF-!B activation in

bcl-2-transfectants was markedly occurred than that in

SV2-transfectants (Figure 4). These results suggest that

Bcl-2 affected intracellular activation of NF-!B at an

initiate period after stimulation of H2O2. And to visualize

the expression and intracellular distribution of NF-!B

under stimulation of H2O2, immunocytochemical analysis

using polyclonal antibody which recognized a p65 subunit

of NF-!B was performed. At 15 and 30 min after the

stimulation, intracellular activation of NF-!B was

appreciably detected in SV2-transfectants, but weakly

observed in bcl-2-transfectants. At 90 min after the

stimulation, in both SV2-transfectant and bcl-2-

transfectant, translocation of NF-!B into the nucleus was

observed (Figure 4), showing the consistence with results

of EMSA.


274

Figure 4. Time course analysis of

DNA binding activities of NF-!B in

SV2- and bcl-2-transfected cells by

electrophoretic mobility shift assay

(EMSA) after stimulation of H2O2. The

cells were treated with H2O2 at 100 $M

for 2 hr. The intracellular activation of

NF-!B in SV2- and bcl-2-transfectants

was analyzed at 0-120 min. Nuclear

protein extraction of each cell was

analyzed at different time after

stimulation of H2O2 by EMSA using

specific gel-shift assay system.

IV. Discussion In the present study, exogenous Bcl-2 prevented I/R-

induced apoptosis in rat livers. And our prepared-bcl-2-

transfectants have the preventive effect against cell

injuries induced with 50 -250 $M of H2O2. Additionally,

the in vitro examination in bcl-2-transfectants by

immunocytochemical analysis and EMSA showed that

Bcl-2 repressed intracellular activation of NF-!B at an

initiate period after stimulation of H2O2, although NF-!B

activation was quickly and strongly occurred in SV2-

transfectants. And at 90 and 120 min after stimulation,

NF-!B activation in bcl-2-transfectants were more

remarkably detected than that in SV2-transfectants,

suggesting that the transient repressive effect of exogenous

Bcl-2 on an early NF-!B activation might be attributed to

the avoidance from the subsequent destiny to oxidative

injuries.

We showed using TUNEL method with histogram

analysis that exogenous Bcl-2 has the in vivo preventive

potential against I/R injury (Figure 1). In our previous

study, it has firstly reported that inhibitory effect of Bcl-2

in combination with the Bcl-2-associated athanogene 1

protein, BAG-1 can be evaluated by the same method

(Yanada et al, 2005). These results suggest histogram

analysis with by the same method can easily and usefully

quantify I/R-induced apoptosis. Furthermore, it suggests

that transfection by Bcl-2 alone is a useful strategy for

gene therapy against I/R injury.

Regarding the in vitro examination to investigate the

relation between Bcl-2 and NF-!B, we took a notice of

H2O2 as an ROS stimulant, which is known to less

difficultly penetrate through the living membrane and be

generated when the cells are exposed to oxidative stress

such as I/R. The cytoprotective effect of exogenous Bcl-2

against H2O2-induced injuries was obtained, and

accentuated for H2O2 as low as 100 and 125 $M, as shown

by the hormesis-like enhancement in cell viability of bcl-

2-transfectants over the initiate level (Figure 3). It seems

that this increase depends on the increase in viable cells

with activity of mitochondrial dehydrogenase by the

stimulation of H2O2, which is known at higher doses to

lower the electric potential at the mitochondrial membrane

through a depolarization effect. Recently, it has been

reported by our laboratory that treatment with H2O2 of

lower concentrations enhances the maximum cell

population doubling level of human skin keratinocytes

together with slow-down of age-dependent shortening of

telomeric DNA (Yokoo et al, 2004), suggesting a trace

H2O2-induced benefit effects such as telomere protection

and enhanced bcl-2 expression in common through a

feeble oxidant-induced bottom-up effect on the emergent

antioxidant ability.

And exogenous Bcl-2 repressed intracellular

activation of NF-!B at an initial period after stimulation of

H2O2, although activation of NF-!B was occurred in SV2-

transfectant (Figure 4). Activation of NF-!B has been

reduced under the existence of in the presence of the

intracellular antioxidant in Rat-1 cells after stimulation of

ROS as previously reported (Nagao et al, 2000).

Additionally, we have previously detected intracellular

ROS accumulation in Rat-1 cells when the cells were

exposed to the alkyl hydroperoxide t-BuOOH or operated

with hypoxia-reoxygeneration which occurred

accumulation of ROS such as H2O2 resulting in cell death

(Saitoh et al, 2003b). At this time, in b5 cells (bcl-2-stable

transfectants), intracellular accumulation of ascorbic acid

was enhanced than in the parental cells, Rat-1, suggesting

that intracelluar anti-oxidants may be indirectly related

with overexpression of bcl-2 (Saitoh et al, 2003a)

assumedly owing to lowering of demand for scavenging of

cell-death-derived secondarily generated extra ROS.

Moreover, at 90 and 120 min after stimulation of H2O2,

although activation of NF-!B was detected in both bcl-2-

and SV2-transfetants, the activation in bcl-2-transfectants

remarkably increased than that of SV2-transfectants in

particular (Figure 5). High constitutive DNA binding and

transcriptional activities of NF-!B were observed in rat

pheochromocytoma PC12 cells overexpressing bcl-2 gene

after stimulation of H2O2 (Jang et al, 2004), which mostly

supports our results in spite of difference in cell lines.


275

Figure 5. Immunocytochemical analysis of the transcriptional factor NF-!B in SV2- and bcl-2-transfected cells after stimulation with

H2O2. The intracellular activation of NF-!B in SV2- and bcl-2-transfectants was analyzed at 0, 15, 30 and 90 min after 2 hr treatment

with H2O2 at 100 $M. The slides were examined on a confocal laser scanning fluorescence microscope ([MRS-600 Cosmos] equipped

with an argon laser as the light source), and expressed in pseudo-color similarly as in Fig. 1. The scale indicates 50 $m. Data shown are

typical of 3-4 sheets of micro-slices per each group that showed the similar staining degree among three independent experiments.

These results suggest the possibility that constitutive

activation of redox-sensitive transcription factor NF-!B

acts as survival signal in bcl-2-overexpressing cells.

Currently, NF-!B has been attempted as a target of

gene therapy in several diseases such as nephritis, liver

failure and glioblastomas (Tomita et al, 2000; Robe et al,

2004; Higuchi et al, 2006). On the other hand, an

experimental gene therapy using mitochondrial superoxide

dismutase gene is reported to significantly reduce acute

liver damage and be associated with redox activation of

NF-!B, suggesting a benefit effect against oxidative

stress-induced hepatic injuries (Zwacka et al, 1998). We

have demonstrated the possibility of gene therapy against

oxidative stress-induced injuries using Bcl-2 as a putative

function as an antioxidant, which prevents apoptosis by

controlling ROS through increase of intracellular

antioxidant (Yanada et al, 2004 and 2005). And in the

present study, showed that transfection of bcl-2 repressed

intracellular activation of NF-!B at an initiate period after

stimulation of H2O2, resultantly H2O2 induced-cell death

was inhibited. Taken together, exogenous Bcl-2 may be

able to control indirectly the transcription factor NF-!B,

because Bcl-2 acts as a multiplier or consumption-saver

for intracellular antioxidants. Thus, it is possible that an in

vivo transfection of bcl-2 is useful as one of some

strategies for gene therapy against oxidative stress-induced

injury together with gene therapy using mitochondrial

superoxide dismutase gene, which controls the

intracellular redox state after stimulation of oxidative

stress.

Acknowledgments The authors thank Dr. Rika Ouchida and Dr. Norio

Nagao of Prefectural University of Hiroshima, for their

technical assistance and encouragement. The present study

was supported in part by a Grant-in-Aid for Exploratory

Research from the Ministry of Education, Science and

Culture of Japan to N.M.

References Akao Y, Otsuki Y, Kataoka S, Ito Y, Tsujimoto Y (1994)

Multiple subcellular localization of bcl-2: detection in

nuclear outer membrane, endoplasmic reticulum membrane,

and mitochondrial membranes. Cancer Res 54, 2468-2471.

Baeuerle PA and Baltimore D (1996) NF-!B: ten years after.

Cell 87, 13-20.

Baeuerle PA and Henkel T (1994) Function and activation of

NF-!B in the immune system. Annu Rev Immunol 12, 141-

179.

Eguchi M, Miyazaki T, Masatsuji-Kato E, Tsuzuki T, Oribe T,

Miwa N (2003) Cytoprotection against ischemia-induced

DNA cleavages and cell injuries in the rat liver by pro-

vitamin C via hydrolytic conversion into ascorbate. Mol Cell

Biochem 252, 17-23.

Gross A, Mcdonnell JM, Korsmeyer SJ (1999) BCL-2 family

members and the mitochondria in apoptosis. Genes Dev 13,

1899–1911.

Higuchi Y, Kawakami S, Oka M, Yamashita F, Hashida M

(2006) Suppression of TNF! production in LPS induced

liver failure in mice after intravenous injection of cationic

liposomes/NF!B decoy complex. Pharmazie 61,144-147.

Hockenbery D, Nunez G, Milliman C, Schreiber RD, Korsmeyer

SJ (1990) Bcl-2 is an inner mitochondrial membrane protein

that blocks programmed cell death. Nature 348, 334-336.


276

Hockenbery DM, Oltvai ZN, Yin XM, Milliman CL, Korsmeyer

SJ (1993) Bcl-2 functions in an antioxidant pathway to

prevent apoptosis. Cell 75, 241-251.

Jang JH and Surh YJ (2003) Potentiation of cellular antioxidant

capacity by Bcl-2: implications for its antiapoptotic function.

Biochem Pharmacol 66, 1371-1379.

Jang JH and Surh YJ (2004) Bcl-2 attenuation of oxidative cell

death is associated with up-regulation of gamma-

glutamylcysteine ligase via constitutive NF-!B activation. J

Biol Chem 279, 8779-8786.

Nagao N, Etoh T, Yamaoka S, Okamoto T, Miwa N (2000)

Enhanced invasion of Tax-expressing fibroblasts into the

basement membrane is repressed by phosphorylated

ascorbate with simultaneous decreases in intracellular

oxidative stress and NF-!B activation. Antioxid Redox

Signal 2, 727-738.

Oltvai ZN, Milliman CL, Korsmeyer SJ (1993) Bcl-2

heterodimerizes in vivo with a conserved homolog, Bax, that

accelerates programmed cell death. Cell 74, 609-619.

Paker BA and Stark GR (1979) Regulation of simian virus 40

transcription: sensitive analysis of the RNA species present

early in infections by virus or viral DNA. J Virol 31, 360-

369.

Reed JC (1994) Bcl-2 and the regulation of programmed cell

death. J Cell Biol 124, 1–6.

Robe PA, Bentires-Alj M, Bonif M, Rogister B, Deprez M,

Haddada H, Khac MT, Jolois O, Erkmen K, Merville MP,

Black PM, Bours V (2004) In vitro and in vivo activity of the

nuclear factor-!B inhibitor sulfasalazine in human

glioblastomas. Clin Cancer Res 10, 5595-5603.

Saeki Y, Matsumoto N, Nakano Y, Mori M, Awai K, Kaneda Y

(1997) Development and characterization of cationic

liposomes conjugated with HVJ (Sendai virus): reciprocal

effect of cationic lipid for in vitro and in vivo gene transfer.

Hum Gene Ther 8, 2133-2141.

Saitoh Y, Ouchida R, Miwa N (2003a) Bcl-2 prevents

hypoxia/reoxygenation-induced cell death through

suppressed generation of reactive oxygen species and

upregulation of Bcl-2 proteins. J Cell Biochem 90, 914-924.

Saitoh Y, Ouchida R, Kayasuga A, Miwa N (2003b) Anti-

apoptotic defense of bcl-2 gene against hydroperoxide-

induced cytotoxicity together with suppressed lipid

peroxidation, enhanced ascorbate uptake, and upregulated

Bcl-2 protein. J Cell. Biochem 89, 321–334.

Shimizu S, Eguchi Y, Kamiike W, Funahashi Y, Mignon A,

Lacronique V, Matsuda H, Tsujimoto Y (1998) Bcl-2

prevents apoptotic mitochondrial dysfunction by regulating

proton flux. Proc Natl Acad Sci USA 95, 1455-1459.

Tomita N, Morishita R, Tomita S, Gibbons GH, Zhang L,

Horiuchi M, Kaneda Y, Higaki J, Ogihara T, Dzau VJ (2000)

Transcription factor decoy for NF!B inhibits TNF-&-induced

cytokine and adhesion molecule expression in vivo. Gene

Ther 7, 1326-32.

Topp WC (1981) Normal rat cell lines deficient in nuclear

thymidine kinase. Virology 113, 408 -411.

Tsuboniwa N, Morishita R, Hirano T, Fujimoto J, Furukawa S,

Kikumori M, Okuyama A, Kaneda Y (2001) Safety

evaluation of hemagglutinating virus of Japan-artificial viral

envelope liposomes in nonhuman primates. Hum Gene Ther

12, 469-487.

Tsujimoto Y (1989) Overexpression of the human BCL-2 gene

product results in growth enhancement of Epstein-Barr virus-

immortalized B cells. Proc Natl Acad Sci 86, 1958-1962.

Tsujimoto Y (2003) Cell death regulation by the Bcl-2 protein

family in the mitochondria. J Cell Physiol 195, 158-167.

Vaux DL, Cory S, Adams JM (1988) Bcl-2 gene promotes

haemopoietic cell survival and cooperates with c-myc to

immortalize pre-B cells. Nature 335, 440–442.

Voehringer DW and Meyn RE (2000) Redox aspects of Bcl-2

function. Antioxid Redox Signal 2, 537-550.

Wang T, Zhang X, Li JJ (2002) The role of NF-!B in the

regulation of cell stress responses. Int Immunopharmacol

2, 1509-1520.

Yanada S, Saitoh Y, Kaneda Y, Miwa N (2004) Cytoprotection

by bcl-2 Gene Transfer against Ischemic Liver Injuries

Together with Repressed Lipid Peroxidation and Increased

Ascorbic Acid in Livers and Serum. J Cell Biochem 93,

857-870.

Yanada S, Sasaki M, Takayama S, Kaneda Y, Miwa N (2005)

Hemagglutinating virus of Japan-artificial viral envelope

liposome-mediated cotransfer of bag-1 and bcl-2 genes

protects hepatic cells against ischemic injury through BAG-

1-assisted preferential enhancement of bcl-2 protein

expression. Hum Gene Ther 16, 627-633.

Yang J, Liu X, Bhalla K, Kim CN, Ibrado AM, Cai J, Peng TI,

Jones DP, Wang X (1997) Prevention of apoptosis by Bcl-2:

Release of cytochrome c from mitochondria blocked.

Science 275, 1129-1132.

Yang JP, Merin JP, Nakano T, Kato T, Kitade Y, Okamoto T

(1995) Inhibition of the DNA-binding activity of NF-!B by

gold compounds in vitro. FEBS Lett 361, 89-96.

Yokoo S, Furumoto K, Hiyama E, Miwa N (2004) Slow-down of

age-dependent telomere shortening is executed in human

skin keratinocytes by hormesis-like-effects of trace hydrogen

peroxide or by anti-oxidative effects of pro-vitamin C in

common concurrently with reduction of intracellular

oxidative stress. J Cell Biochem 93, 588-597.

Zwacka RM, Zhou W, Zhang Y, Darby CJ, Dudus L, Halldorson

J, Oberley L, Engelhardt JF (1998) Redox gene therapy for

ischemia/reperfusion injury of the liver reduces AP1 and NF-

!B activation. Nat Med 4, 698-704.

gene therapy & molecular biology volume 10 issue b

Documents

usa tel

usa ghosh

usa georgiev

usa barranger

usa crouzet

usa getzenberg

usa davie

usa caiafa