gene therapy & molecular biology volume 8 issue b

GENE THERAPY &

MOLECULAR BIOLOGY

FROM BASIC MECHANISMS TO

CLINICAL APPLICATIONS

Volume 8

Number 2

December 2004

Published by Gene Therapy Press

GENE THERAPY & MOLECULAR BIOLOGY FREE ACCESS www.gtmb.org

!!!!!!!!!!!!!!!!!!!!!!!!!

Editor Teni Boulikas Ph. D.,

CEO Regulon Inc.

715 North Shoreline Blvd.

Mountain View, California, 94043

USA

Tel: 650-968-1129

Fax: 650-567-9082

E-mail: [email protected]

Teni Boulikas Ph. D.,

CEO, Regulon AE.

Gregoriou Afxentiou 7

Alimos, Athens, 17455

Greece

Tel: +30-210-9853849

Fax: +30-210-9858453


!!!!!!!!!!!!!!!!!!!!!!!!!

Assistant to the Editor Maria Vougiouka B.Sc.,


Alimos, Athens, 17455

Greece

Tel: +30-210-9858454

Fax: +30-210-9858453


!!!!!!!!!!!!!!!!!!!!!!!!! Associate Editors Aguilar-Cordova, Estuardo, Ph.D., AdvantaGene, Inc., USA

Berezney, Ronald, Ph.D., State University of New York at Buffalo, USA

Crooke, Stanley, M.D., Ph.D., ISIS Pharmaceuticals, Inc, USA

Crouzet, Joël, Ph.D. Neurotech S.A, France

Gronemeyer, Hinrich, Ph.D. I.N.S.E.R.M., IGBMC, France

Rossi, John, Ph.D., Beckman Research Institute of the City of Hope, USA

Shen, James, Ph.D., Institute of Molecular Biology, Academia Sinica, Taipei, Taiwan, Republic of China & University of

California at Davis, USA.

Webb, David, Ph.D., Celgene Corporation, USA

Wolff, Jon, Ph.D., University of Wisconsin, USA

!!!!!!!!!!!!!!!!!!!!!!!!!

Editorial Board Akporiaye, Emmanuel, Ph.D., Arizona Cancer

Center, USA

Anson, Donald S., Ph.D., Women's and Children's

Hospital, Australia

Ariga, Hiroyoshi, Ph.D., Hokkaido University,

Japan

Baldwin, H. Scott, M.D Vanderbilt University

Medical Center, USA

Barranger, John, MD, Ph.D., University of

Pittsburgh, USA

Black, Keith L. M.D., Maxine Dunitz Neurosurgical

Institute, Cedars-Sinai Medical Center, USA

Bode, Jürgen, Gesellschaft für Biotechnologische

Forschung m.b.H., Germany

Bohn, Martha C., Ph.D., The Feinberg School of

Medicine, Northwestern University, USA

Bresnick, Emery, Ph.D., University of Wisconsin

Medical School, USA

Caiafa, Paola, Ph.D., Università di Roma “La

Sapienza”, Italy

Chao, Lee, Ph.D., Medical University of South

Carolina, USA

Cheng, Seng H. Ph.D., Genzyme Corporation, USA

Clements, Barklie, Ph.D., University of Glasgow,

USA

Cole, David J. M.D., Medical University of South

Carolina, USA

Chishti, Athar H., Ph.D., University of Illinois

College of Medicine, USA

Davie, James R, Ph.D., Manitoba Institute of Cell

Biology;USA

DePamphilis, Melvin L, Ph.D., National Institute of

Child Health and Human, National Institutes of Health,

USA

Donoghue, Daniel J., Ph.D., Center for Molecular

Genetics, University of California, San Diego, USA

Eckstein, Jens W., Ph.D., Akikoa Pharmaceuticals

Inc, USA

Fisher, Paul A. Ph.D., State University of New York,

USA

Galanis, Evanthia, M.D., Mayo Clinic, USA

Gardner, Thomas A, M.D., Indiana University

Cancer Center, USA

Georgiev, Georgii, Ph.D., Russian Academy of

Sciences, USA

Getzenberg, Robert, Ph.D., Institute Shadyside

Medical Center, USA

Ghosh, Sankar Ph.D., Yale University School of

Medicine, USA

Gojobori, Takashi, Ph.D., Center for Information

Biology, National Institute of Genetics, Japan

Harris David T., Ph.D., Cord Blood Bank, University

of Arizona, USA

Heldin, Paraskevi Ph.D., Uppsala Universitet,

Sweden

Hesdorffer, Charles S., M.D., Columbia University,

USA

Hoekstra, Merl F, Ph.D., Epoch Biosciences, Inc.,

USA

Hung, Mien-Chie, Ph.D., The University of Texas,

USA

Johnston, Brian, Ph.D., Somagenics, Inc, USA

Jolly, Douglas J, Ph.D., Advantagene, Inc.,USA

Joshi, Sadhna, Ph.D., D.Sc., University of Toronto

Canada

Kaltschmidt, Christian, Ph.D., Universität

Witten/Herdecke, Germany

Kiyama, Ryoiti, Ph.D., National Institute of

Bioscience and Human-Technology, Japan

Krawetz, Stephen A., Ph.D., Wayne State

University School of Medicine, USA

Kruse, Carol A., Ph.D., La Jolla Institute for

Molecular Medicine, USA

Kuo, Tien, Ph.D., The University of Texas M. D.

Anderson Cancer USA

Kurachi Kotoku, Ph.D., University of Michigan

Medical School, USA

Kuroki, Masahide, M.D., Ph.D., Fukuoka

University School of Medicine, Japan

Lai, Mei T. Ph.D., Lilly Research Laboratories USA

Latchman, David S., PhD, Dsc, MRCPath

University of London, UK

Lavin, Martin F, Ph.D., The Queensland Cancer

Fund Research Unit, The Queensland Institute of

Medical Research, Australia

Lebkowski, Jane S., Ph.D., GERON Corporation,

USA

Li, Jian Jian, Ph.D., City of Hope National Medical

Center, USA

Li, Liangping Ph.D., Max-Delbrück-Center for

Molecular Medicine, Germany

Lu, Yi, Ph.D., University of Tennessee Health Science

Center, USA

Lundstrom Kenneth, Ph.D. , Bioxtal/Regulon, Inc.

Switzerland

Malone, Robert W., M.D., Aeras Global TB Vaccine

Foundation, USA

Mazarakis, Nicholas D. Ph.D., Oxford BioMedica,

UK

Mirkin, Sergei, M. Ph.D., University of Illinois at

Chicago, USA

Moroianu, Junona, Ph.D., Boston College, USA

Müller, Rolf, Ph.D., Institut für Molekularbiologie

und Tumorforschung, Phillips-Universität Marburg,

USA

Noteborn, Mathieu, Ph.D., Leiden University, The

Netherlands

Papamatheakis, Joseph (Sifis), Ph.D., Institute of

Molecular Biology and Biotechnology

Foundation for Research and Technology Hellas, USA

Platsoucas, Chris, D., Ph.D., Temple University

School of Medicine, USA

Rockson, Stanley G., M.D., Stanford University


Poeschla, Eric, M.D., Mayo Clinic, USA

Pomerantz, Roger, J., M.D., Tibotec, Inc., USA

Raizada, Mohan K., Ph.D., University of Florida,

USA

Razin, Sergey, Ph.D., Institute of Gene Biology

Russian Academy of Sciences, USA

Robbins, Paul, D, Ph.D., University of Pittsburgh,

USA

Rosenblatt, Joseph, D., M.D, University of Miami


Rosner, Marsha, R., Ph.D., Ben May Institute for

Cancer Research, University of Chicago, USA

Royer, Hans-Dieter, M.D., (CAESAR), Germany

Rubin, Joseph, M.D., Mayo Medical School

Mayo Clinic, USA

Saenko Evgueni L., Ph.D., University of Maryland

School of Medicine Center for Vascular and

Inflammatory Diseases, USA

Salmons, Brian, Ph.D., (FSG-Biotechnologie GmbH),

Austria

Santoro, M. Gabriella, Ph.D., University of Rome

Tor Vergata, USA

Sharrocks, Andrew, D., Ph.D., University of

Manchester, USA

Shi, Yang, Ph.D., Harvard Medical School, USA

Smythe Roy W., M.D., Texas A&M University

Health Sciences Center, USA

Srivastava, Arun Ph.D., University of Florida

College of Medicine, USA

Steiner, Mitchell, M.D., University of Tennessee,

USA

Tainsky, Michael A., Ph.D., Karmanos Cancer

Institute, Wayne State University, USA

Sung, Young-Chul, Ph.D., Pohang University of

Science & Technology, Korea

Taira, Kazunari, Ph.D., The University of Tokyo,

Japan

Terzic, Andre, M.D., Ph.D., Mayo Clinic College of

Medicine, USA

Thierry, Alain, Ph.D., National Cancer Institute,

National Institutes of Health, France

Trifonov, Edward, N. Ph.D., University of Haifa,

Israel

Van de Ven, Wim, Ph.D., University of Leuven,

Belgium

Van Dyke, Michael, W., Ph.D., The University of

Texas M. D. Anderson Cancer Center, USA

White, Robert, J., University of Glasgow, UK

White-Scharf, Mary, Ph.D., Biotransplant, Inc., USA

Wiginton, Dan, A., Ph.D., Children's Hospital

Research Foundation, CHRF , USA

Yung, Alfred, M.D., University of Texas, USA

Zannis-Hadjopoulos, Maria Ph.D., McGill Cancer

Centre, Canada

Zorbas, Haralabos, Ph.D., BioM AG Team, Germany

!!!!!!!!!!!!!!!!!!!!!!!!!

Associate Board Members

Aoki, Kazunori, M.D., Ph.D., National Cancer Center

Research Institute, Japan

Cao, Xinmin, Ph.D., Institute of Molecular and Cell

Biology, Singapore

Falasca, Marco, M.D., University College London,

UK

Gao, Shou-Jiang, Ph.D., The University of Texas

Health Science Center at San Antonio, USA

Gibson, Spencer Bruce, Ph.D., University of Manitoba,

USA

Gra•a, Xavier, Ph.D., Temple University School of

Medicine, USA

Gu, Baohua, Ph.D., The Jefferson Center, USA

Hiroki, Maruyama, M.D., Ph.D., Niigata University

Graduate School of Medical and Dental Sciences, Japan

MacDougald, Ormond A, Ph.D., University of

Michigan Medical School, USA

Rigoutsos, Isidore, Ph.D., Thomas J. Watson Research

Center, USA

For submission of manuscripts and inquiries:

Editorial Office

Teni Boulikas, Ph.D./ Maria Vougiouka, B.Sc.


Alimos, Athens 17455

Greece

Tel: +30-210-985-8454

Fax: +30-210-985-8453

and electronically to

[email protected]

Instructions to authors:

Gene Therapy and Molecular Biology (GTMB) FREE ACCESS www.gtmb.org

Scope

Gene Therapy and Molecular Biology, bridging various fields is one of the most rapid with free access at

gtmb.org.

The scope of Gene Therapy and Molecular Biology is to promote interaction between researchers in the

fields of Gene Therapy and Molecular Biology providing rapid publication of review articles and research

papers. Articles (both invited and submitted) review or report novel findings of importance to a general

audience in gene therapy, molecular medicine, gene discovery, and molecular biology with emphasis to

molecular mechanisms. The journal will accept papers on all aspects of gene therapy, including gene

delivery systems, gene therapy of cancer and other diseases (e.g. CFTR, hemophilia, AIDS, restenosis) at

the clinical, preclinical or cell culture stage, gene discovery, cancer immunotherapy, DNA vaccines, use

of DNA regulatory elements in gene transfer, cell therapy and transplantation, arraying technologies &

DNA chips, peptide libraries and drug discovery related to gene therapy, cell targeting, gene targeting,

therapy with oligonucleotides (antisense, ribozymes, triplex). The authors are encouraged to elaborate on

the molecular mechanisms that govern a gene therapy approach. Gene Therapy and Molecular Biology

will also publish articles on, transcription factors, DNA replication, recombination, repair, chromatin,

nuclear matrix, DNA regulatory regions, locus control regions, protein phosphorylation, signal

transduction, development, and on molecular mechanism of human disease. To make the publication

attractive authors are encouraged to include color figures.

Type of articles

Both review articles and original research articles will be considered. In addition, short 1-2 page news &

views will also be considered for publication. Original research articles should contain a generous

introduction in addition to experimental data. The articles contain information important to a general

audience as the volume is also addressed to researches outside the field. There is no limit on the length of

the articles provided that the subject is interesting to a general audience and covers exhaustively a field.

The typical length of each manuscript is a approximately 4-20 printed page including Figures and

Tables. This is 12-60 manuscript pages.

Charges, Complimentary reprints & Subscriptions

There are no charges for color figures or page numbers. Corresponding authors get a one-year free

subscription (hard copy) plus 25 reprints free of charge. The free subscription can be renewed for

additional years by having one paper per year accepted for publication.

The free electronic access to articles published in " Gene Therapy and Molecular Biology " to a big

general audience, the attractive journal title, the speed of the reviewing process, the no-charges for page

numbers or color figure reproduction, the 25 complimentary reprints, the rapid electronic publication, the

embracing of many fields in gene therapy (from molecular mechanisms to clinical trials), the high quality

in depth reviews and first rate research articles and most important, the eminent members of the Editorial

Board being assembled are prognostic factors of a big success for GTMB.

Sections of the manuscript

Each manuscript should have a Title, Authors, Affiliation, Corresponding Author (with Tel, Fax, and E-

mail), Summary, key words , running title and Introduction; review articles are subdivided into

headings I, II, III, etc. (starting with I. Introduction) subdivided into A, B, C, and further subdivided using

1, 2, 3, etc. You can further subdivide into 1, 2, 3, etc. Research articles are divided into Summary; I.

Introduction; II. Materials and Methods III. Results; IV. Discussion; Acknowledgments; and References.

Please include in your text citations the name of authors and year in parenthesis; for three or more authors

use: (name of first author et al, with year); for two authors please use both names. Please delete hidden

text for references. In the reference list, please, type references with year and Journal in boldface and

provide full title of the article such as:

Buschle M, Schmidt W, Berger M, Schaffner G, Kurzbauer R, Killisch I, Tiedemann J-K, Trska B,

Kirlappos H, Mechtler K, Schilcher F, Gabler C, and Birnstiel ML (1998) Chemically defined, cell-free

cancer vaccines: use of tumor antigen-derived peptides or polyepitope proteins for vaccination. Gene

Ther Mol Biol 1, 309-321.

To avoid delays it is essential to submit an electronic and a hard copy version of your manuscript via e-

mail and mail in a floppy, CD-ROM or ZIP, containing the manuscript that will be used to typeset the

paper. Please include in the digital media: Tables, if any, (preferably as a Microsoft Word text) and Figure

legends. Please use Microsoft Word, font “Times” (Mac users) or “Times New Roman” (PC users) and

insert Greek or other characters using the “Insert/Symbol” function in the Microsoft Word rather than

simple conversion to font “Symbol”. Please boldface Figure 1, 2, 3 etc. as well as Table 1, 2, etc.

throughout the text. Please provide the highest quality of prints of your Figures; whenever possible,

please provide in addition an electronic version of your figures.

Article contributors are kindly requested to provide a color (or black/white) photo of themselves

(preferably 4x5 cm or any size) or a group photo of the authors, as we shall include these in the

publication

Submission and reviewing

Peer reviewing is by members of the Editorial Board and external referees. Please suggest 2-3 reviewers

providing their electronic addresses, mailing addresses and telephone/fax numbers. Authors are sent page

proofs.

Gene Therapy and Molecular Biology is published in on high quality paper, hardbound, and with

excellent reproduction of color figures.

Reviewing is completed within 5-15 days from receiving the manuscript.

Articles accepted without revisions (i.e., review articles) will be published online (www.gtmb.org) in

approximately 1 month following submission.

Please submit an electronic version of full text and figures preferably in jpeg format. The electronic

version of the figures will be used for the rapid reviewing process. High quality prints or photograph of

the figures and the original with one copy should be sent via express mail to the Editorial Office.

Editorial Office

Teni Boulikas, Ph.D./ Maria Vougiouka, B.Sc.


Alimos, Athens 17455

Greece

Tel: +30-210-985-8454

Fax: +30-210-985-8453

and electronically to

[email protected]

The free electronic access to articles published in "GTMB" to a big general audience, the attractive

journal title, the speed of the reviewing process, the no-charges for page numbers or color figure

reproduction, the 25 complimentary reprints, the rapid electronic publication, the embracing of many

fields in cancer, the anticipated high quality in depth reviews and first rate research articles and most

important, the eminent members of the Editorial Board being assembled are prognostic factors of a big

success for the newly established journal.

Table of contents

Gene Therapy and Molecular Biology

Vol 8 Number 2, December 2004

Pages Type of

Article Article title Authors (corresponding author is in

boldface)

319-326 Research

Article Phosphorothioated CpG

Oligonucleotide induced hemopoietic

changes in mice

Priya Aggarwal, Ruma Ray and Pradeep

Seth

327-334 Research

Article Development of HIV-1 subtype C Gag

based DNA vaccine construct

Priti Chugh and Pradeep Seth

335-342 Review

Article Targeting retroviral vector entry by

host range extension

Katja Sliva and Barbara S.Schnierle

343-350 Review

Article Role of the Brn-3a and Brn-3b POU

family transcription factors in cancer

David S. Latchman

351-360 Review

Article Angiogenic gene therapy in the

treatment of ischemic cardiovascular

diseases

Tamer A. Malik, Cesario Bianchi, Frank

W. Sellke

361-368 Review

Article Targeting Myc function in cancer

therapy

William L. Walker, Sandra Fernandez

and Peter J. Hurlin

369-384 Review

Article Transfection pathways of nonspecific

and targeted PEI-polyplexes

Vicent M. Guillem and Salvador F.

Ali•o

385-394 Review

Article c-myc: a double-headed Janus that

regulates cell survival and death

Rosanna Supino and A. Ivana Scovassi

395-402 Research

Article DNA-based vaccine for treatment of

intracerebral neoplasms

Terry Lichtor, Roberta P Glick, InSug

O-Sullivan, Edward P Cohen

403-412 Research

Article The involvement of H19 non-coding

RNA in stress: Implications in cancer

development and prognosis

Suhail Ayesh, Iba Farrah, Tamar

Schneider, Nathan de-Groot1 and

Abraham Hochberg

413-422 Research

Article PSA promoter-driven conditional

replicationcompetent adenovirus for

prostate cancer gene therapy

Guimin Chang and Yi Lu

423-430 Research

Article A platform for constructing

infectivity-enhanced fiber-mosaic

adenoviruses genetically modified to

express two fiber types

Marianne G. Rots, Willemijn M.

Gommans, Igor Dmitriev, Dorenda

Oosterhuis, Toshiro Seki, David T.

Curiel, Hidde J. Haisma

431-438 Review

Article Internal ribosome entry sites in cancer

gene therapy

Benedict J Yan and Caroline GL Lee

439-450 Research The pathway of uptake of SV40 Chava Kimchi-Sarfaty, Susan Garfield,

Article pseudovirions packaged in vitro: from

MHC class I receptors to the nucleus

Nathan S. Alexander, Saadia Ali, Carlos

Cruz, Dhanalakshmi Chinnasamy, and

Michael M. Gottesman

451-464 Review

Article The importance of PTHrP for cancer

development

Jürgen Dittmer

465-474 Review

Article Gene-based vaccines for

immunotherapy of prostate cancer -

lessons from the past

Milcho Mincheff and Serguei Zoubak

475-486 Research

Article An erythroid-specific chromatin

opening element increases "-globin

gene expression from integrated

retroviral gene transfer vectors

Michael J. Nemeth and Christopher H.

Lowrey

487-494 Research

Article Decreased tumor growth using an IL-

2 amplifier expression vector

Xianghui He, Farha H Vasanwala, Tom

C Tsang, Phoebe Luo1, Tong Zhang and

David T Harris

495-500 Research

Article Multiple detection of chromosomal

gene correction mediated by a

RNA/DNA oligonucleotide

Alvaro Galli, Grazia Lombardi, Tiziana

Cervelli and Giuseppe Rainaldi

501-508 Review

Article Nitric oxide and endotoxin-mediated

sepsis: the role of osteopontin

Philip Y. Wai and Paul C. Kuo

509-514 Research

Article Feasibility to delineate distribution of

solution injected intraprostatic using

an ex-vivo canine model

Charles J. Rosser, Noriyoshi Tanaka, R.

Jason Stafford, Roger E. Price, John D.

Hazle, Motoyoshi Tanaka, Ashish M.

Kamat, Louis L. Pisters

515-522 Review

Article ER stress and the JNK pathway in

insulin resistance

Hideaki Kaneto, Yoshihisa Nakatani,

and Munehide Matsuhisa

523-538 Review

Article Molecular insight into human

heparanase and tumour progression

Erich Rajkovic, Angelika Rek, Elmar

Krieger and Andreas J Kungl

539-546 Research

Article Two dimensional gel electrophoresis

analyses of human plasma proteins.

Association of retinol binding protein

and transthyretin expression with

breast cancer

Karim Chahed, Bechr Hamrita, Hafedh

Mejdoub, Sami Remadi, Anouar Chaïeb

and Lotfi Chouchane

Gene Therapy and Molecular Biology Vol 8, page 319

319

Gene Ther Mol Biol Vol 8, 319-326, 2004

Phosphorothioated CpG Oligonucleotide induced

hemopoietic changes in miceResearch Article

Priya Aggarwal1, Ruma Ray2 and Pradeep Seth1*

Departments of Microbiology1 and Pathology2, All India Institute of Medical Sciences, New Delhi-110029, India

__________________________________________________________________________________

*Correspondence: Pradeep Seth MD FAMS FNASc, Professor and Head, Dept of Microbiology, All India Institute of Medical

Sciences, New Delhi-110029; Phone: 91-11-26588714; Fax: 91-11-26588641; Email [email protected],

[email protected]

Key words: CpG motifs; 1826-ODN; Splenomegaly; Hemopoiesis

Abbreviations: cytotoxic T lymphocyte, (CTL); extramedullary hemopoiesis, (EMH); human immunodeficiency virus, (HIV);

oligodeoxynucleotides, (ODNs); pathogen-associated microbial patterns, (PAMPs); reactive follicular hyperplasia, (RFH); Toll like

receptors, (TLRs)

Received: 17 May 2004; Accepted: 25 May 2004; electronically published: May 2004

SummaryBacterial DNA and the synthetic CpG-oligodeoxynucleotides (ODNs) derived thereof have attracted attention

because they activate cells of the adaptive immune system (lymphocytes) and the innate immune system

(macrophages). They induce a Th1 biased immune response upon activation of the immune cells. In this paper we

addressed whether unmethylated phosphorothioated CpG ODN (for example 1826 CpG-ODNs) affected

hemopoiesis. We observed an overall Th1 dominant response upon in-vitro stimulation of naïve splenocytes with

1826-ODN. Immunizing mice with immunostimulatory CpG motifs led to transient splenomegaly, with a maximum

increase of spleen weight at 4 weeks post immunization. Thereafter the splenomegaly regressed. The induction of

splenomegaly by CpG-ODNs was dose-dependent with the maximum spleen weights recorded at the 250 µg

immunizing dosage of 1826-ODN. In addition, the splenomegaly was also associated with dose dependent

extramedullary hemopoiesis and reactive follicular hyperplasia in the spleens and lymph nodes, which could be of

therapeutic relevance particularly in patients with life threatening chronic and persistent infectious diseases like

visceral leishmaniasis and HIV infection.

I. IntroductionCpG oligodeoxynucleotides (ODNs) are a novel

pharmacotherapeutic class with profound

immunomodulatory properties. CpG ODN shows Th1

biased immune responses and promise as vaccine adjuvant

and in the treatment of asthma, allergy, infection, and

cancer. Several groups have studied the effect of CpG

ODNs on the various arms of the immune system: B cells,

T cells, NK cells, and dendritic cells (Krieg et al, 1995;

Ballas et al, 1996; Davis et al, 1998). They have also

studied its effect on the release of various cytokines

important from an immunological standpoint. Overall CpG

induces a Th1 like pattern of cytokine production that is

dominated by IL-12 and IFN-! with little secretion of Th2

cytokines. Recent work demonstrates the powerful

adjuvant effect of CpG-ODNs, which can be used to

trigger protective and curative Th1 responses in vivo (Chu

et al, 1997; Lipford et al, 1997a, b; Zimmermann et al,

1998). When combined with specific antigen in-vivo, CpG

ODNs can serve as a strong stimulus for T-cell activation,

as well as for proliferation of antigen specific cytotoxic T

lymphocyte (CTL) effectors.

It is known that bacterial stimuli (Lipopolysaccharide

or Complete Freunds Adjuvant containing heat-killed

mycobacteria) can trigger increased splenic hemopoiesis

(McNeill et al, 1970; Apte et al, 1976; Staber et al, 1980),

possibly via macrophage-derived hemopoietic growth

factors that stimulate the generation and mobilization of

the blood cells necessary to combat bacterial infections

(Morrison et al, 1995). Here, we show that 1826-CpG-

ODNs displayed the capacity to potentiate hemopoiesis. In

addition, we observed that Phosphorothioated-ODNs with

CpG motifs cause splenomegaly in Balb/c mice. We

conclude that CpG ODN likely exerts systemic effects on

spleens and lymph nodes.

II. Materials and methodsA. CpG Motifs (1826-ODN)An unmethylated, phosphorothioated CpG motif, 1826-

ODN, (5’-TCCATGACGTTCCTGACGTT-3') was synthesized

commercially (Biosynthesis, USA). This ODN has 2 CpG motifs

separated by 7 bases in between them. The ODN preparation had

< 0.1 EU of endotoxin per milligram of ODN as assessed by a

Limulus Amebocyte Lysate assay - E-TOXATE (Sigma, USA).

Aggarwal et al: CpG oligonucleotide, induced hemopoietic changes in mice

320

B. Animals6-8 weeks old, inbred female Balb/c mice were purchased

from National Central for Laboratory Animal Sciences, National

Institute of Nutrition, Hyderabad, India.

C. In vitro stimulatory effect of 1826-ODN on

naïve murine spleen cellsNormal mice were euthanised with an overdose of

pentobarbital and spleens were removed aseptically. The spleen

cells were collected, enumerated and resuspended in RPMI

medium with 10% FCS to the required concentration. One

million naïve spleen cells from unimmunized Balb/c mice, were

plated in each well of a six-well tissue culture plate and

incubated with different doses on 1826-ODN in duplicate wells

(2,10,50 and 250µg/well). The control wells did not contain any

ODN. The culture supernatants were collected at 24,36,48 and 72

hours for quantification of secreted IL-2, IFN-!, IL-4 and IL-10

by murine cytokine ELISA kits (R&D Systems) according to the

manufacturer's instructions.

D. Immunization of miceFive mice per group were injected with different doses of

1826-ODN (2,10,50 and 250µg/mouse) intradermally. The mice

were boosted with the same dose two weeks later. The control

mice received normal saline intradermally. Mice were sacrificed

at 4, 6, 8 and 24 weeks post-immunization respectively and

spleen and lymphnodes were collected for histopathology. For

determination of splenomegaly, fat and contiguous tissue around

the spleens was trimmed off and the spleens were weighed.

E. HistopathologyAfter removal, the spleens and lymphnodes were fixed in

10% neutral-buffered formalin and subsequently fine sections (5-

µ thick) were taken for histopathology. The tissue sections were

then processed in Histokinette machine (Leica TP1020) for

microscopic evaluation. This processing included fixation in 70%

ethanol for 1 hour followed by 80% and absolute ethanol for 1

hour each. Then they were treated with acetone and xylene for 1

hour each, for the clearing of tissues. Finally, they were

impregnated with melted paraffin wax (60°-62°C) for 1 hour.

The tissue sections were mounted on slides, and stained with

hematoxylin and eosin.

III. ResultsA. In vitro stimulatory effect of 1826-

ODN on naïve murine spleen cellsNonspecific stimulatory effect of the 1826-ODN was

evaluated quantitatively on naïve spleen cells, by

evaluating release of Th1 and Th2 cytokines in the culture

supernatants (Figure 1) . Murine IL-2 was detectable only

with 2µg of 1826-ODN. The IL2 level showed a steady

increase with the increasing incubation time and was 265

pg/ml at 72 hours. On the other hand, only 20 pg/ml of IL-

2 was detected at 72 hours with 10 µg dose of the ODN.

Similarly, higher amounts of IFN-! levels were also

detected with 2-µg dose.

Th2 cytokine, IL-10, was secreted in relatively

higher amounts at all doses in comparison to the other

cytokines. The maximum secretion was seen with 2 µg

dose with the values of 115, 490, 405 and 510 pg/ml at 24,

36, 48 and 72 hours time points respectively. The IL-10

cytokine levels were comparatively low with 10 µg dose

of ODN. With the increasing dose of ODN to 50 and 250

µg, the IL-10 cytokine secretion levels further decreased.

The IL-10 cytokine levels at 250-µg dose were barely

detectable. On the other hand, IL-4 cytokine secretion was

not detected in the culture supernatants at all doses at all

time points. Control wells, incubated without ODN did not

show any secretion of either IL-10 or IL-4 cytokines.

B. Mouse splenomegaly assaySplenomegaly was observed to be highly dose

dependent (Figure 2) . There was a significant increase in

the spleen weights with the increasing dose of 1826-ODN

at all time points. Maximum spleen weights were recorded

at 4 weeks time point. Thereafter, the spleen size and

weight decreased significantly over time during next 5

months. Massive splenomegaly was observed with the

250-µg dose of 1826-ODN at 4 weeks time point with an

average spleen weight of 0.65338 +/- 0.075049 grams,

Figure 1 In-vitro stimulatory effect of 1826-ODN on the naïve splenocytes. Culture supernatants were tested for the presence of secreted

murine Th1 (IFN-! and IL-2) and Th2 cytokines (IL-10 and IL-4).


321

which was 9.6 times more than the average spleen weight

of mice injected with normal saline. At 6 months time

point also, the average spleen weight for 250-µg dosage

was 1.5 folds greater than the average spleen weight of

mice injected with normal saline. On the other hand

splenic weights of mice immunized with 2µg, 10µg and

50µg doses of 1826-ODN at 4 weeks time point were 4.8,

3.2 and 3 folds more than the spleen weight of mice

injected with normal saline, respectively.

C. HistopathologyHistological changes were studied in the spleens at 6

weeks time point and in both spleens and lymph nodes at 6

months time point (Table 1a and b). Spleens showed

increasing degree of extramedullary hemopoiesis (EMH)

and reactive follicular hyperplasia (RFH) with prominent

germinal centers with the increasing doses of 1826-ODN

(Figure 3a). EMH was diagnosed by the presence of

immature hemopoietic precursors including

megakarycytes (Figure 3c). There was a prominent

expansion of white pulp of the spleens and formation of

germinal centers with all the doses of 1826-ODN as

compared to the spleens of mice injected with normal

saline, which were histologically normal (Figure 3e).

Spleens of mice injected with 250-µg-1826-ODN showed

severe degree of reactive follicular hyperplasia with EMH

(Figure 3b). Red pulp showed histiocytes with abundant

eosinophilic cytoplasm. There were prominent germinal

centers. Numerous megakaryocytes were present in the red

pulp. The spleens of mice at 6 months time point also

showed EMH but to a lesser degree than that observed at 6

weeks time point. Here also, the degree of reactive

hyperplasia increased with the increasing dose of 1826-

ODN, with maximum at 250 µg CpG ODN dosage.

Figure 3(c) shows EMH with megakaryocyte formations

in the spleen section of 10-µg dose of ODN. Figure 3(d)

Figure 2 Mouse splenomegaly assay. The mice were immunized with different doses of 1826 ODN (2µg (group 1), 10µg (group 2),

50µg (group 3), 250µg (group 4)) intradermally. The control group (group 5) received normal saline. The spleens were harvested at 4

weeks, 6 weeks 8 weeks and 24 weeks post immunization and weighed. Each group had 5 mice. The average spleen weight is expressed

in grams.

Table 1a. Observation chart showing the histological changes in the respective spleen and lymph node sections of mice

injected with escalating doses of 1826-ODN (a) at 6 weeks time point (b) at 6 months time point post immunization.

2 µg ODN 10 µg ODN 50 µg ODN 250 µg ODN Normal Saline

Spleen *Reactive follicles *Reactive follicles *Expansion of

white

*Severe degree of Histologically

normal

*Prominent

expansion

*Prominent white

pulp

pulp with reactive reactive follicular

of white pulp *Hyperplasia follicular

hyperplasia

hyperplasia

* Extramedullary *Red pulp shows

hemopoiesis histiocytes with

abundant

eosinophilic

cytoplasma

*Prominent

germinal

centers

*Formation of

Megakaryocytes

* Extramedullary

hemopoiesis


322

Table 1b.

2 µg ODN 10 µg ODN 50 µg ODN 250 µg ODN Normal Saline

Spleen Histologically normal Extramedullary

hemopoiesis

*Formation of

Megakaryocytes

Extramedullary

hemopoiesis

*Formation of

Megakaryocytes

*Severe degree of

reactive follicular

hyperplasia

* Formation of germinal

centers

* Small epitheloid cells

granuloma with in

center of reactive

white pulp.

Extramedullary

hemopoiesis

*Formation of

Megakaryocytes

*Severe degree of

reactive follicular

hyperplasia

*Formation of

Megakaryocytes in

red

pulp

Histologically

normal

Lymph Node Histologically normal Sinus histiocytosis lymph node not found * Few reactive

secondary follicles

with germinal

center

Histologically

normal

Figure 3 Reactive follicular hyperplasia with the formation of secondary follicle having prominent germinal center in spleen from mice

injected with (a) 50µg and (b) 250 µg of 1826-ODN at 6 weeks time point (40X). The arrows are demarcating an expanding follicle.


323

Figure 3(c) Extramedullary hemopoiesis with the formation of megakaryocytes (arrows) in the spleen from mice injected with 10ug of

1826-ODN at 6 months time point (40X). (d) Granuloma formation (arrows) with small epitheloid cells in the spleen from mice injected

with 50 ug of 1826-ODN at 6 months time point (e) Spleen from mice injected with normal saline (40X).


324

Figure 4(a) Focal sinus histiocytosis in lymph node from mice injected with 10 µg of 1826-ODN at 6 months time point (40X) The

arrow is pointing towards a collection of histiocytes. (b) the lymph node from mice injected with normal saline (40X).

shows the spleen section of mice injected with 50 µg ODN

dose, at 6 months time point, where granuloma can be

seen with small epitheloid cells.

IV. DiscussionIn this study, we describe and characterize the in

vitro cytokine response of spleen cells and in vivo

extramedullary hemopoiesis in spleen and lymph nodes in

mice induced by CpG-ODNs. Specific CpG sequences

appear to be important for elicitation of Th1-type

immunity and enhancement of vaccine efficacy. As our

understanding about the mechanisms of action of various

CpG-ODN improves, it should be possible to predict

effects on immune responses in vivo based on the results

of in vitro assays. At the present time, in vitro assays are

most useful in initially screening CpG-ODN for

immunostimulatory activity and to determine its

optimizing dosage to use in in vivo models. In our study,

CpG-ODN 1826 induced significant Th1 cytokine

responses (IFN-! and IL-2) in vitro, on splenocytes from

normal mice. The induction of cytokines by the naïve

spleen cells can be explained by the presence of Toll like

receptors (TLRs) on the cells. These evolutionary

conserved receptors, homologues of the Drosophila Toll

gene, recognize highly conserved structural motifs only

expressed by microbial pathogens, called pathogen-

associated microbial patterns (PAMPs). Stimulation of

TLRs by PAMPs initiates a signaling cascade that

involves a number of proteins, such as MyD88 and IRAK

(Medzhitov et al, 1997). TLR9, which is localized


325

intracellularly, is involved in the recognition of specific

unmethylated CpG-ODN sequences. This signaling

cascade leads to the activation of the transcription factor

NF-kB that induces the secretion of pro-inflammatory

cytokines and effector cytokines that direct the adaptive

immune response. There may be physiologic or pathologic

conditions where TLR-9 would be expressed in

nonimmune cells, in which they would be expected to

become CpG responsive. Carlow et al, (1998) has

described CpG-induced stimulation of L cells, which are

of stromal origin, to produce IFN-! upon transfection with

plasmid DNA. Bacterial DNA or a CpG ODN has also

been reported to induce human gingival fibroblasts to

activate NF"B and secrete IL-6 (Takeshita et al, 1999).

The only cells that are directly activated upon exposure to

CpG DNA are the TLR-9 expressing cells like B cells and

pDC (Bauer et al, 2001; Krug et al, 2001). Klinman et al,

(1996) has also shown that a DNA motif consisting of an

unmethylated CpG motif rapidly stimulates B cells in a

polyclonal and antigen-nonspecific fashion, to produce IL-

6 and IL-12, CD4+ T cells to produce IL-6 and IFN-!, and

NK cells to produce IFN-! in-vitro. CpG PTO

(phosphorothioated) was most effective in inducing in-

vitro proliferation of splenocytes. The IL-12 p40 levels

peaked at 500nM concentration ODN with cytokine levels

of 7500pg/ml after 36 hours of incubation. Similarly, the

IL-6 levels peaked to 7000pg/ml at 1000nM concentration

of ODN (Zimmermann et al, 2003). Zelenay et al, (2003)

have also shown that 1826 ODN induced naïve

splenocytes to secrete high levels of IL-6 and IL-12 and

modest levels of IFN-! in-vitro.

Splenomegaly phenomenon was transient and highly

dose dependent. There was a significant increase in the

spleen weights with the increasing dose of CpG motifs

reaching maximum at 4 weeks post-immunization and

thereafter regressing gradually over next 20 weeks.

Massive splenomegaly was observed in the mice injected

with 250-µg dose of 1826-ODN at 4 weeks time point

with a 9.6 fold increase in the splenic weight as compared

to that of mice injected with normal spleen. An antisense

ODN against the rev gene of the human

immunodeficiency virus (HIV) caused a profound degree

of B cell proliferation and massive splenomegaly in-vivo

in mice (Branda et al, 1993). Mice treated with high doses

of immune stimulatory phosphorothioated CpG ODN

developed massive splenomegaly and increased spleen

granulocyte macrophage colony forming units (GM-

CFUs) and early erythroid progenitors (burst-forming

units-erythroid) (Sparwasser et al, 1999). Treatment of

rodents with phosphorothioate oligodeoxynucleotides

induces a form of immune stimulation characterized by

splenomegaly, lymphoid hyperplasia, hyper-!-

globulinemia and mixed mononuclear cellular infiltrates in

numerous tissues. Splenomegaly and B-lymphocyte

proliferation increased with the dose or concentration of

oligodeoxynucleotides (Monteith et al, 1997).

Splenomegaly appeared to occur, at least in part, as a

result of stimulation of B-lymphocyte proliferation.

Bhagat et al, (2003) have also reported splenomegaly in

Balb/c mice to the extent of 153 mg after 48 hours of

subcutaneous injection of a single dose of 5mg/kg

immunomers.

In the spleen sections of mice at 6 weeks time point,

there was increasing degree of extramedullary

hemopoiesis and reactive follicular hyperplasia with

prominent germinal centers, with the increasing doses of

1826-ODN. Thus, the transient splenomegaly observed in

CpG motifs injected mice was dose dependent and

associated with extramedullary hemopoiesis. CpG ODN

has a profound effect on hematopoietic function. CpG-

ODNs activate dendritic cells and macrophages to secrete

large amounts of hemopoietically active cytokines,

including IL-6, GM-CSF, IL-1, IL-12, and TNF-# (Ballas

et al, 1996; Aggarwal and Seth, unpublished data). To

date, it is unclear which of these cytokines, singly or

synergistically, triggers the extramedullary hemopoiesis

described here. It is also conceivable that CpG-ODNs

target bone marrow stroma cells to release hemopoietically

active cytokines. CpG-ODNs, which are operationally

similar to LPS, may trigger extramedullary hemopoiesis

via the induction of cytokines mobilizing BM progenitor

cells to the spleen (Apte et al, 1976; Tokunaga et al,

1992). Even before the identification of the CpG motif,

several investigators using antisense ODN noted the

induction of sequence-specific extramedullary

hematopoiesis and induction of hematopoietic colony

formation (Hatzfeld et al, 1991; McIntyre et al, 1993).

More recently, these effects were shown to be CpG

specific. Histologically, an increased number of large

immature blasts and erythroblasts were detected, reaching

maximum at day 6, suggesting hemopoietic activity

(Sparwasser et al, 1999).

Our findings in this study demonstrate that

phosphorothioate oligonucleotide 1826-ODN exerts

stimulatory effects in mouse model. Recent data from our

laboratory also suggest that CpG-ODNs potentiate the

immune responses induced by HIV-1 Indian Subtype C

vaccine constructs in mice (manuscript under preparation)

perhaps by augmenting the hemopoiesis. Thus, it may be

possible to use CpG-ODN as therapeutic agents in patients

with early or limited HIV disease.

AcknowledgmentsThis study was supported by the research grant from

the Department of Biotechnology, Ministry of Science and

technology, Govt. of India, under Prime minister's, Jai

Vigyan Mission Program.

ReferencesApte R N, Galanos C, Pluznik DH (1976) Lipid A, the active part

of bacterial endotoxins in inducing serum colony-stimulating

activity and proliferation of splenic granulocyte/macrophage

progenitor cells. J Cell Physiol 87, 71-78.

Ballas ZK, Rasmussen WL, Krieg AM (1996) Induction of NK

activity in murine and human cells by CpG motifs in

oligodeoxynucleotides and bacterial DNA. J Immunol 157,

1840–1845.

Bauer S, Kirschning CJ, Hacker H, Redecke V, Hausmann S,

Akira S, Wagner H, Lipford GB (2001) Human TLR9

confers responsiveness to bacterial DNA via species-specific

CpG motif recognition. Proc Natl Acad Sci USA 98,


326

9237–9242.

Bhagat L, Zhu FG, Yu D, Tang J, Wang H, Ekambar R, Zhang

KR, and Agrawal S (2003) CpG penta- and

hexadeoxyribonucleotides as potent immunomodulatory

agents. Biochem Biophys Res Commun 300, 853-861.

Branda RF, Moore AL, Mathews L, Mc- Cormack JJ, Zon G

(1993) Immune stimulation by an antisense oligomer

complementary to the rev gene of HIV-1. Biochem

Pharmacol 45, 2037–2043.

Carlow DA, Teh SJ, Teh HS (1998) Specific antiviral activity

demonstrated by TGTP, a member of a new family of

interferon-induced GTPases. J Immunol 161, 2348–2355.

Chu RS, Targoni OS, Krieg AM, Lehmann PV, Harding CV

(1997) CpG oligodeoxynucleotides act as adjuvants that

switch on T helper (Th1) immunity. J Exp Med 186, 1623-

1631.

Davis HL, Weeratna R, Waldschmidt TJ, Tygrett L, Schorr J,

Krieg AM, Weeranta R (1998) CpG DNA is a potent

enhancer of specific immunity in mice immunized with

recombinant hepatitis B surface antigen. J Immunol 160,

870-876. Erratum in: J Immunol (1999) 162, 3103.

Weeranta R [corrected to Weeratna R].

Hatzfeld J, Li ML, Brown EL, Sookdeo H, Levesque JP,

O’Toole T, Gurney C, Clark SC, Hatzfeld A (1991) Release

of early human hematopoietic progenitors from quiescence

by antisense transforming growth factor $1 or Rb

oligonucleotides. J Exp Med 174, 925–929.

Klinman D, Yi A K, Beaucage SL, Conover J and Krieg AM

(1996) CpG motifs present in bacterial DNA rapidly induce

lymphocytes to secrete Interleukin 6, interleukin 12, and

interferon !. Proc Nat Acad Sci USA 93, 2879-2883.

Krieg AM, Yi AK, Matson S, Waldschmidt TJ, Bishop GA,

Teasdale R, Koretzky GA, Klinman DM (1995) CpG motifs

in bacterial DNA trigger direct B-cell activation. Nature

374, 546–549.

Krug A, Towarowski A, Britsch S, Rothenfusser S, Hornung V,

Bals R, Giese T, Engelmann H, Endres S, Krieg AM,

Hartmann G (2001) Toll-like receptor expression reveals

CpG DNA as a unique microbial stimulus for plasmacytoid

dendritic cells which synergizes with CD40 ligand to induce

high amounts of IL-12. Eur J Immunol 31, 3026–3037.

Lipford GB, Bauer M, Blank C, Reiter R, Wagner H, Heeg K

(1997a) CpG-containing synthetic oligonucleotides promote

B and cytotoxic T cell responses to protein antigen: a new

class of vaccine adjuvants. Eur J Immunol 27, 2340-2344.

Lipford GB, Sparwasser T, Bauer M, Zimmermann S, Koch ES,

Heeg K, Wagner H (1997b) Immunostimulatory DNA:

sequence-dependent production of potentially harmful or

useful cytokines. Eur J Immunol 27, 3420-3426.

McIntyre KW, Lombard-Gillooly K, Perez JR, Kunsch C,

Sarmiento UM, Larigan JD, Landreth KT, Narayanan R

(1993) A sense phosphorothioate oligonucleotide directed to

the initiation codon of transcription factor NF-"B p65 causes

sequence-specific immune stimulation. Antisense Res Dev

3, 309–322.

McNeill TA (1970) Antigenic stimulation of bone marrow

colony-forming cells. Immunology 18, 61-72.

Medzhitov R, Preston-Hurlburt P, Janeway CA Jr. (1997) A

human homologue of the Drosophila Toll protein signals

activation of adaptive immunity. Nature 388, 394-397.

Monteith DK, Henry SP, Howard RB, Flournoy S, Levin AA,

Bennett CF, Crooke ST (1997) Immune stimulation--a class

effect of phosphorothioate oligodeoxynucleotides in rodents.

Anticancer Drug Des 12, 421-432.

Morrison SJ, Uchida N, Weissman IL (1995) The biology of

hematopoietic stem cells. Annu Rev Cell Dev Biol 11, 35-

71.

Sparwasser T, ltner LH, Koch ES, Luz A, Lipford GB, and

Wagner H (1999) Immunostimulatory CpG-

Oligodeoxynucleotides Cause Extramedullary Murine

Hemopoiesis. J Immunol 162, 2368–2374.

Staber FG, Metcalf D (1980) Cellular and molecular basis of the

increased splenic hemopoiesis in mice treated with bacterial

cell wall components. Proc Natl Acad Sci USA 77, 4322-

4325.

Takeshita A, Imai K, Hanazawa S (1999) CpG motifs in

Porphyromonas gingivalis DNA stimulate interleukin-6

expression in human gingival fibroblasts. Infect Immun 67,

4340–4345.

Tokunaga T, Yano O, Kuramoto E, Kimura Y, Yamamoto T,

Kataoka T, Yamamoto S (1992) Synthetic oligonucleotides

with particular base sequences from the cDNA-encoding

proteins of Mycobacterium bovis BCG induce interferons

and activate natural killer cells. Microbiol Immunol 36, 55-

66.

Zelenay S, Elias F and Flo J (2003) Immunostimulatory effects

of plasmid DNA and synthetic oligodeoxynucleotides. Eur J

Immunol 33, 1382-1392.

Zimmermann S, Egeter O, Hausmann S, Lipford GB, Röcken M,

Wagner H, Heeg K (1998) CpG oligonucleotides trigger

curative Th1 responses in lethal murine leishmaniasis. J

Immunol 160, 3627-3630.

Zimmermann S, Heeg K, and Dalpke A (2003)

Immunostimulatory DNA as adjuvant: efficacy of

phosphodiester CpG oligonucleotides is enhanced by 3’

sequence modifications. Vaccine 21, 990-995.

Dr. Pradeep Seth


327


Development of HIV-1 subtype C Gag based DNA

vaccine constructResearch Article

Priti Chugh1 and Pradeep Seth*Department of Microbiology, All India Institute of Medical Sciences, New Delhi-110029

__________________________________________________________________________________*Correspondence: Pradeep Seth MD FAMS FNASc, Professor and Head, Dept of Microbiology, All India Institute of Medical

Sciences, New Delhi-110029; Phone: 91-11-26588714; Fax: 91-11-26588641; Email [email protected],

[email protected]

1. Current address: Priti Chugh, MSc. Ph.D, University of Texas Southwestern Medical Center, Hamon Center for Therapeutic Oncology

Research, 6000 Harry Hines Blvd. NB8.206, Dallas TX 75390-8593

Key words: gag, DNA vaccine, CMV promoter, Virus like particles (VLPs)

Abbreviations: cytomegalovirus, (CMV); immediate early, (IE); kilodalton, (kD); phosphate buffered saline, (PBS); room temperature,

(RT); virus like particles, (VLPs)

Received: 26 April 2004; Accepted: 2 June 2004; electronically published: July 2004

Summary

Recently, the success of genetic immunization as a novel means to induce protective immunity has been

demonstrated. DNA vaccines mimic antigen presentation closely to the natural history of viral infection. This is

particularly relevant in infectious diseases where-in cell mediated immunity plays a larger role in protection, such

as HIV-1 infection. In this paper we present the work done towards development of a gag based DNA immunogen

for local circulating HIV-1 subtype C viruses in India. Gag gene was cloned under the control of CMV promoter in

a mammalian expression plasmid vector. The other main features of the expression cassette in the construct

pJWgagprotease49587 are bovine growth hormone polyadenylation signal and a t-PA leader signal. The construct

was confirmed for expression in vitro by various means, p24 antigen capture assay, immunoblotting and electron

microscopy. The TEM studies on transiently transfected COS-7 cells showed the presence of virus like particles

(VLPs) as a consequence of gene expression from the construct pJWgagprotease49587. This finding is the first

report of VLPs for a subtype C based gag construct. We expect that this construct will be able to prime a good

immune response when used in in-vivo mice studies owing to the formation of virus like particles from the construct

in vitro.

I. IntroductionOf the various infectious diseases that are responsible

for morbidity and mortality, AIDS is deemed to be the

fourth-biggest killer. HIV/AIDS is not a homogenous

pandemic. Human immunodeficiency virus HIV-1, the

causative organism has remained particularly elusive

owing to the sheer diversity of viral evolution. The varied

subtypes and more varied distribution have had profound

impacts on the strategies being devised to control the

spread of HIV infection. Most of the world's HIV infection

is located in the developing world. Of these, most

infections occur within the non-B HIV subtypes. Subtype

C accounts for more than 50% of overall infections

worldwide (Tatt et al, 2001). It is needed to direct

resources towards the research of virus evolution,

pathogenesis, treatment and preventive/therapeutic

vaccines of different HIV-1 clades.

The need for developing a potent immunogen from

the local circulating types is becoming more and more

apparent with the evidence of differences in the rates of

transmission and severity of disease among different

clades. The current rapid spread of subtype C viruses has

raised questions about the role of subtypes on disease

progression and transmission. The presence of three NF-

kB binding sites in subtype C viruses suggests that they

might have a replication advantage. In India, infection rate

at 0.8% of the total adult population is still low, but due to

large population it transforms into large numbers. The use

of existing therapies in the developing world is limited

owing to their high cost (Dayton et al, 2000).

Nucleic acid vaccination offers a simple and

effective means of immunization. DNA plasmids encoding

foreign proteins have been successfully administered

either by direct intramuscular injection or with various

adjuvants and excipients, and by biolistic immunization.

Chugh and Seth: Gag gene construct in mammalian expression vector

328

DNA vaccines have several distinct advantages,

presentation of target protein by MHC-I and MHC-II

pathways, synthesis of immunogen in their native with

appropriate post-translational modifications, ease in

manufacturing process and greater shelf life of DNA as

compared to proteins. This approach is particularly

relevant to tumor antigens and viral immunogens.

Gag gene is one of the most conserved regions of

HIV-1 genome and hence it is a good target for cross clade

immune responses. It encodes for group antigen core

protein. 1.5 Kb gene gives rise to a 55-kilodalton (kD)

Gag precursor protein, also called pr55, which is

expressed from the unspliced viral mRNA and later

processed into the respective p24, p17, p6 proteins by the

viral encoded protease. In studies with HIV infected

individuals, HEPS and LTNPs, helper and cytotoxic

responses to gag epitopes have been defined (Gotch et al,

1990; Jhonson et al, 1991; Kalams et al, 1999).

Plasmids used as DNA vaccines, in general contain a

strong eukaryotic promoter, such as cytomegalovirus

(CMV) immediate early (IE) (Chapman et al, 1991) and

polyadenylation signal from bovine growth hormone,

which increases expression. Immune response elicited by

DNA vaccination depends on route of immunization, it is

largely Th1 type, and this is particularly beneficial since

Th1 type of immune response has been implicated in

control of HIV infection. In this study we present the

construction of a gag based plasmid immunogen in a

mammalian expression vector and verification of its

expression.

II. Materials and methodsA. Plasmid, cells and reagentsThe vector used in the study, pJW4304, was a kind gift

from Dr J. I. Mullins, University of Washington, Seattle, USA.

COS-7 cells for in vitro expression studies were obtained from

NCCS, Pune, India.

B. Cloning of gag gene into pJW4304The integrated HIV-1 proviral DNA from PBMCs of HIV

infected asymptomatic individual (Disease stage: A1, CD4

counts: 534/µl) was taken as a template for PCR and a 4.35 kb

gag-pol (nt139 – nt4495) product was obtained by a set of nested

PCRs using forward primers, MSF12:

5’AAATCTCTAGCAGTGGCGCCCGAACAG3’ [1-27],

GagFP01: 5’TTTGACTAGCGGAGGCTAGCAGGAGAGAG

ATGGGT3’ [139-173] and reverse primers PolRP06:

5’AAAACCATCCATTAGCTCTCCTTGAAACAT3’ [4471-

4500], PolRP01: 5’CATCCATTAGCTCTCCTTGAAACATAC

ATA 3’ [4466-4495]. The amplification profile was as follows:

denaturation [at 92°C for 15sec], annealing (at 52°C for 30 sec]

and extension [at 68°C for 4min] for 25 cycles followed by final

extension for 7 minutes at 68°C. The amplification product was

cloned into TA cloning pGEMT easy vector (Promega, USA) as

per the manufacturer’s instructions (Figure 1A). The construct

was verified in pGEMTeasy by PCR and restriction digestions.

The construct was double digested with Nhe1 and BamH1

enzymes resulting in the release of a 2.3kb Gag-protease

fragment. This fragment was cloned into mammalian expression

vector, pJW4304, by directional cohesive ends ligation (Figure

2A). The presence of insert in the plasmid pJWgagprotease-

49587 was confirmed by PCR for gag and protease genes,

restriction digestions and DNA sequencing.

C. In vitro expression studiesCOS-7 cells were transfected using lipofectin reagent (Life

technologies) according to the manufacturer’s instructions.

Briefly, 5µg plasmid DNA was constituted with lipofectin

reagent at a concentration of 10µg/ml in DMEM (without FCS

and antibiotics) and overlaid on 40-50% confluent COS-7 cells.

The cells were incubated with the transfection mix for 6-8 hrs at

37°C, 5% CO2 and then fresh medium was supplemented

(DMEM 10% FCS, 2mM glutamine and antibiotics). The cells

and supernatants were harvested at different time points 24, 36,

48, 72 and 96 hrs and stored at -20°C for further evaluation.

COS-7 cells transfected with vector pJW4304 alone and the

plasmid containing envelope gp120 gene, pJWSK3, (Arora et al,

2001) comprised the controls in the study.

D. p24 antigen capture ELISAThe supernatants were checked for presence of p24 antigen

by p24 antigen capture ELISA (Innogenetics Belgium)

performed as per the manufacturer’s instructions. Briefly, 100µl

of sample and the standard (provided in the kit) were aliqoted

into the wells coated with anti p24 monoclonal antibody and

incubated at 37°C in a humidified chamber for an hour. The

wells were then washed thoroughly five times and tapped to

remove traces of wash buffer. Thereafter 100µl of HRP

conjugated anti p24 monoclonal antibody was added to the wells

and the plate was incubated for an hour at 37°C followed by 5X

washing again. In the next step 100µl of substrate solution was

added to the wells and incubated in dark at room temperature for

30 minutes. 50µl of stop solution was added to the wells after the

incubation and absorbance was recorded at 450nm. Standard

curve was plotted for the absorbance recorded for standard

provided in the kit and concentration of the samples was

determined from the curve. The negative controls included

untransfected cells and cells transfected with vector alone

(pJW4304) and mock positive (pJWSK3) control.

E. Western blot analysisThe transfected cell lysates were run on a denaturing SDS

PAGE and transferred onto nitrocellulose membrane by semidry

transfer method. The blot was blocked with 2.5% non-fat dry

milk in Tris buffered saline pH 7.4 for two hours at room

temperature (RT) and was washed thrice in TTBS (Tween-Tris

buffered saline). Immunoblotting was carried out by incubating

with HIV-1 positive human serum (at a dilution of 1:50) at RT

for 1hr. After washing thrice the blot was returned for incubation

with alkaline phosphatase conjugated goat anti-human IgG

antibody for an hour at RT. Thereafter, it was washed thrice and

the substrate (BCIP-NBT solution) was added. The reaction was

then stopped by washing in double distilled water.

G. Electron microscopy of transfected COS-7

cellsTransmission electron microscopy was performed with

transfected cells as described earlier (Gheysen et al, 1989) with

minor modifications. Briefly, transfected cells were scraped off,

washed in phosphate buffered saline (PBS pH 7.4) and then fixed

in 1% glutaraldehyde solution for two hours on ice. Thereafter,

the cells were washed with PBS thrice and postfixed with 1 %

osmium tetroxide in PBS for two hours. After washing with PBS

and then with distilled water, the fixed cells were stained with

1% uranyl acetate in 20% acetone for 30 min. The cells were

dehydrated by treatment with acetone and cleared with toluene.

Thereafter, infiltration was done with toluene araldite mixture

first at room temperature and then at 50oC temperature. The


329

sample was embedded in epoxy resin, sectioned and viewed

under TEM (transmission electron microscope).

*Footnote: The HIV-1 subytpe C strain 49587 used in this

study is from a hemophilic patient who got infected through

blood tranfusion in 1989 in India. (patient id# 49587). The

PBMC sample was collected in the year 1997 from the northern

part of India. The Genbank accession number isAF533140.

III. Results

A. Construction of pJWgagprotease49587In order to clone gag-protease genes of HIV 1

subtype C, a complete gag-pol clone was generated in

pGEM-Teasy by PCR based TA cloning (Figure 1A). A

4.3 Kb PCR product was generated by a nested set of

primers MSF12 and Pol RP06 and GagFP01 and

PolRPO01 (Figure 1B). This product was ligated to

pGEM-Teasy vector and the recombinant was screened on

the basis of blue white colony selection. The 4.3Kb gag-

pol insert was confirmed by EcoR1 digestion of the

plasmid that releases the complete gene fragment (Figure

1C). PCR products from different regions of the construct,

1.5-Kb gag and 3-Kb pol confirmed the presence of insert,

gag-pol, in the clone pGEMTgag-pol. (Figure 1D).

Figure 1A Cloning strategy for TA cloning of gagpol gene fragment. A 4.3Kb fragment generated by nested PCR was cloned into

pGEM-Teasy vector resulting in a recombinant molecule pGEM-Teasy gag-pol (7.3Kb). B Agarose gel picture showing, 4.3 Kb gag-pol

PCR product generated by nested set of PCR with ! Hind III Eco R1 DNA molecular weight marker in the adjacent lane. C Agarose gel

picture showing the release of 4.3 Kb gag-pol fragment from pGEMT-easy gag-pol upon EcoR1 digestion. D Complete gag (1.5 Kb) and

pol (3.1 Kb) PCR amplification products from the pGEMTeasy gag-pol.


330

Figure 2A Strategy for cloning gag-protease fragment into eukaryotic expression vector pJW4304. A double digestion of pGEMT-easy

gag-pol with restriction endonucleases Nhe1 and BamH1 releases a 2.3 Kb fragment containing the gag and protease genes. This

fragment was then ligated into pJW4304 by cohesive ends ligation. B Agarose gel picture showing 7.4 kb linearised plasmid

pJWgagprotease-49587 along with ! Hind III molecular weight marker. C Agarose gel picture showing PCR amplification products for

sub-genomic fragments of gag & complete protease genes. The amplification products for gag are 492 bp and 711bp respectively in

lanes 1 and 3. The protease gene fragment represented by 290bp PCR product is depicted in lane2.

From this clone the fragment containing gag-

protease gene was extracted by double digestion with

Nhe1 and BamH1, and ligated into the expression vector

pJW4304 (Figure 2A). The recombinant clone obtained

was confirmed for the presence of required gene fragment

by various digestions and PCR amplification products for

gag and protease genes (Figures 2B, C). The right

orientation of the insert in the clone was confirmed by

Pst1 digestion, which released a 750 bp product as it

should in case of correct orientation of the cloned gene.

Further confirmation of the cloned gag-protease gene that

it belonged to HIV-1 subtype C gag and protease regions,

was obtained with sequencing using primer walking

strategy. (GenBank Accession no: AF533140) (data not

shown).


331

B. p24 Antigen Capture ELISA

The amount of protein secreted in the medium by the

transfected COS-7 cells was assessed by p24 antigen

capture ELISA. p24 antigen was detectable at 24-hrs post-

transfection and showed a gradual increase in levels until

48 hrs and thereafter a decline was observed. Such an

observation is typical of protein expression in transiently

transfected cells. The negative controls included in the

study were untransfected cells and cells transfected with

vector pJW4304 (without any insert) and mock positive

control pJWSK3 (envelope plasmid). None of the control

supernates showed any reactivity in the assay. Up to 110-

pg/ml protein was detected in the supernates (Figure 3A).

C. Immunoblotting

The transfection cell lysates were run on SDS PAGE

and transferred onto nitro cellulose membrane for

immunoblotting using HIV positive sera as a source of

polyclonal antibodies to HIV proteins. The 24-kilodalton

band representing gag p24 was detected in the 24 and 48

hrs cell lysates indicating that the 55kilodalton-Gag

precursor was being cloven into respective products. The

negative controls and mock positive cell lysates did not

show any such band (Figure 3B).

Figure 3A p24 estimation in transfection supernatants during a time course experiment by p24 antigen capture ELISA plotted for the

various dilutions of reference standard p24, provided in the kit (Innogenetics Belgium). Maximum amount of p24 was detected at 48 hrs

post-transfection, thereafter the amount of p24 in the medium declined. B Immunoblotting was done with pJWgagprotease-49587

(denoted as gag in the figure) and pJW4304 (denoted as Mock in the figure) transfected cell lysates. SDS PAGE was run and proteins

were transferred onto nitrocellulose membrane by semi dry transfer method. The blot was probed with HIV positive human sera (ID no:

757) as a source of polyclonal antibodies to various HIV proteins. In the figure, immunoblot shows 24Kd band representing Gag protein

(p24) in the 24 hrs and 48hrs transfected cell lysates. The untransfected cell lysates did not show the presence of any HIV-1 specific

band.


332

Figure 4A, B. Transmission electron micrographs of COS-7 cells

transfected with pJWgagprotease-49587. TEM was done with

cells harvested at 24 and 48 hr post-transfection. Budding

protrusions from the cell membrane are seen representing VLPs.

Average particle size was determined to be in the range of 140 to

160 nm. (magnification (a) 23,000 X and (b) 18,000X) C

Transmission electron micrograph of pJW4304 transfected COS-

7 cells as control. No virus like particles are visible either on the

surface or outside the cell membrane. (magnification 14,000 X)

D. Electron microscopy of transfected

cells

In transmission electron micrographs numerous virus

like particles (VLPs) were seen budding out of the cell

membrane and lying outside the membrane in the

intercellular spaces. The morphology of these particles

corresponded to that of a pr55 VLP. These VLPs were

observed in pJWGagprotease-49587 transfected COS-7

cells at 24 and 48 hr post transfection. The average size of

the particle was determined to be 140 nm-160 nm (Fig 4. a

& b). Such particles were not seen in normal untransfected

cells and cells transfected with vector alone (pJW4304)

and untransfected cells (Figure 4C).

IV. DiscussionBoth structural (env, gag, pol) and nonstructural

genes (rev, nef) have been targeted as candidate

immunogens for elicitation of effective immune response

to HIV-1. The surface envelope glycoprotein gp 120 has

been extensively studied as a potential target for HIV-1

vaccine development. The variable nature of envelope,

particularly V3 loop, has proven to be a major hurdle in

elicitation of cross-clade responses. The importance of

targeting envelope gp120 remains, as it is the first HIV-1

protein that is encountered by the immune system in the

natural history of pathogenesis. In our laboratory we have

developed an envelope based DNA vaccine construct and

tested in mice model for immunogenecity (Arora et al,

2001). However in view of the importance of cross-clade

broad immune response we sought to develop a gag based

immunogen. Cross clade CTL responses have been

demonstrated within the gag region in studies with

infected individuals (McAdams et al, 1998). The

importance of gag-based responses is also derived from

the studies showing the co-relation of Th responses to gag

p24 in patients with non-progressive state of HIV-1

infection (Rosenberg et al, 1997). It has also been shown

that an early HAART rescues helper responses to gag p24,

which enables the immune system to keep the virus under

control. The distribution of CTL and Th epitopes in HIV-1

gag reveals presence of 81 CTL and 27 Th epitopes in gag

p24, 35 CTL and 5 Th epitopes in p17 and 2 CTL and 6

Th respectively in the nucleocapsid (p15) regions. These

data from the HIV molecular immunology database clearly

show the relevance of targeting gag gene of HIV-1(Los

Alamos Immunology Database).

In challenge studies with chimeric virus SHIV 83.6

in primates, SIV gag constructs have been used to

immunize the animals. The tetramer binding assays

showed that the presence of large frequency of precursor

CTL against HIV-1 gag gene was coincident with the

clearance of challenge virus. These studies underline the

importance of targeting gag gene in a vaccine construct

Considering all these factors we set out to design an

effective immunogen based on Indian clade C HIV-1

viruses. Our objective was to develop a DNA vaccine

construct from local circulating subtype C virus strain,

which is the most predominant subtype prevalent in the

Indian population. In our strategy for construction of gag-

protease plasmid we have cloned the gene fragment in

conjunction with the t-PA leader signal sequence present

in the vector pJW4304. The use of t-PA leader sequence is


333

known to have positive effects on expression of Envelope

and Gag proteins as demonstrated in other studies. Use of

t-PA leader signal has shown better immune responses as

compared to cytoplasmic targeting of gag gene (Qui et al,

2000).

The viral protease gene was cloned along with gag

gene in order to provide the native protease for proper

processing of gag gene products from the precursor pr55

protein into p17, p24, p6, p7, and p2. This gene encodes

for an aspartyl protease enzyme that recognizes and

cleaves the gag precursor pr55 into respective gene

products, p17, p24, p15, p6 and p2. Protease gene is

expressed as -1 frameshift from the gag open reading

frame in the HIV-1 genome. This frameshift occurs once

in twenty times during translation of gag-pol open reading

frame. In our cloning strategy the frameshift site was

preserved hence allowing the synthesis of both the

proteins as in their native infection process of mammalian

cells. Another obstacle in over-expression of protease is

that it leads to complete processing of gag particles which

abolishes VLP formation in cells, hence we considered it

beneficial to keep the original frame shift site in the gag

protease construct pJWgagprotease-49587.

In in-vitro expression studies, we detected upto

110pg/ml of secreted antigen in transfected COS-7 cell

supernatants (Figure 3A). In addition, a 24-kilodalton

band representing p24 gag (Figure 3B) was observed on

immunoblotting. This shows that the viral protease

expressed from the construct has been successful in

processing the pr55 precursor gag protein into respective

products. We also observed formation of virus like-

particles (VLPs) at 24 and 48 hrs post transfection in COS

7 cells (Figures 4A, B). These VLPs were in the size

range of 120-160 nm. This is the first report of production

of virus like-particles from an HIV-1 subtype C based

construct. The production of VLPs from the vaccine

construct adds the advantage of particulate antigen to

priming with DNA based immunogen.

The earlier studies with gag gene examined the

particle formation in various expression systems and

evaluated the probable use as particulate antigen. Antigens

in particulate conformation have been shown to be highly

immunogenic in mammals. Expression of gag gene alone

has shown that self-assembly of p55 molecules triggers the

formation of pseudovirions or VLPs (Nermut et al, 1998).

Virus like particles have been described in studies with

baculovirus, vaccinia, yeast and mammalian expression

systems (Gheysen et al, 1989; Haffar et al, 1990; Wagner

et al, 1992). A study by Wagner and coworkers examined

particle formation by gag constructs in various expression

systems (Wagner et al, 1992). Budding of 100-160 nm

pr55 core particles resembling immature virions was

observed in eukaryotic systems. They proposed that empty

immature gag particles would represent a safe non-

infectious and attractive immunogen. Thereafter several

studies have been published demonstrating the

immunogenicity of the virus like particles. Long-lived

cellular immune responses have been elicited upon

administration of VLP formulations in murine and monkey

models (Paliard et al, 2000; Rovinski et al, 1995; Wagner

et al, 1998). The hybrid HIV-1 p17/p24:Ty-VLP vaccine

module that has gone into phase I trials has demonstrated

the ability of inducing both cellular and humoral immune

responses to p17 and p24 proteins. VLPs have also been

designed for inclusion of principal neutralizing domain of

gp120 and other regions of envelope proteins for

successful elicitation of both neutralizing humoral immune

response and cytotoxic T cell response (Brand et al, 1995;

Buonangaro et al, 2002).

In a recent study immunogenicity of virus like

particles consisting of gag, protease and envelope from

clade B HIV-1 in rhesus macaques was assessed. In this

study three different forms of antigens were delivered,

purified VLPs, recombinant DNA and canarypox vectors

engineered to express VLPs. It was found that nucleic acid

vaccination capable of producing VLPs was more efficient

in priming cell-mediated immune responses (Montefiori et

al, 2001). It is understood that in order to induce CD8+ T

cell memory, the antigen needs to be presented via the

MHC class I pathway. It has also been demonstrated that

cross presentation of HIV-1 virus like particles by

dendritic cells can lead to efficient priming of CTL

responses (Bachman et al, 1996). These studies have

implicated that recruiting dendritic cells for antigen

presentation of exogenous virus like particles in a DNA

vaccine module is an added advantage. In view of the

above discussion, it can be expected that the production of

virus like-particles from our DNA vaccine construct,

pJWgagprotease-49587, would have a combined effect of

DNA vaccine and particulate antigen in one module.

Acknowledgments

This work has been supported through a generous

financial grant from the Department of Biotechnology,

Ministry of Science and Technology, Government of India

under the Prime minister’s Jai Vigyan Mission

Programme. Our special thanks are also due to the

University Grants commission for providing fellowship

support to Ms. Priti Chugh. Our thanks are also due to the

Electron Microscopy Department at AIIMS New Delhi for

their help in processing the samples.

ReferencesArora A, Fahey JL, Seth P. (2001) DNA vaccine for the

induction of immune responses against HIV-1 subtype C

envelope gene in mice. Gene Ther Mol Biol. 6, 79-89

Bachmann MF, Lutz MB, Layton GT, Harris SJ, Fehr T,

Rescigno M, Ricciardi-Castagnoli P. (1996) Dendritic cells

process exogenous viral proteins and virus-like particles for

class I presentation to CD8+ cytotoxic T lymphocytes. Eur J

Immunol. 26, 2595-600

Barouch DH, Santra S, Kuroda MJ, Schmitz JE, Plishka R,

BucklerWhite A, Gaitan AE, Zin R, NamJH, Wyatt LS,

Lifton MA, Nickerson CE, Moss B, Montefiori DC, Hirsch

VM, Letvin NL.(2001) Reduction of simian-human

immunodeficiencyvirus 89.6P viremia in rhesus monkeys by

recombinant modified vaccinia virus Ankara vaccination. J.

Virol. 75, 5151– 58

Brand D, Mallet F, Truong C, Roingeard P, Goudeau A, Barin F.

(1995) A simple procedure to generate chimeric Pr55gag

virus-like particles expressing the principal neutralization


334

domain of human immunodeficiency virus type 1. J Virol.

Methods. 51, 153-68

Buonaguro L, Racioppi L, Tornesello ML, Arra C, Visciano ML,

Biryahwaho B, Sempala SD, Giraldo G, Buonaguro FM.

(2002) Induction of neutralizing antibodies and cytotoxic T

lymphocytes in Balb/c mice immunized with virus-like

particles presenting a gp120 molecule from a HIV-1 isolate

of clade A. Antiviral Res. 54, 189-201

Chapman BS, Thayer RM, Vincent KA, Haigwood NL. (1991)

Effect of intron A from human cytomegalovirus (Towne)

immediate-early gene on heterologous expression in

mammalian cells. Nucleic Acids Res. 19, 3979-86

Dayton JM, Merson MH. (2000) Global dimensions of the AIDS

epidemic, implications for prevention and care. Infect Dis

Clin North Am. 14, 791-808.

Deml L, Bojak A, Steck S, Graf M, Wild J, Schirmbeck R, Wolf

H, Wagner R. (2001) Multiple effects of codon usage

optimization on expression and immunogenicity of DNA

candidate vaccines encoding the human immunodeficiency

virus type 1 Gag protein. J Virol. 75, 10991-1001

Gheysen D, Jacobs E, de Foresta F, Thiriart C, Francotte M,

Thines D, De Wilde M. (1989) Assembly and release of

HIV-1 precursor Pr55gag virus-like particles from

recombinant baculovirus-infected insect cells. Cell. 59, 103-

12

Gotch FM, Nixon DF, Alp N, McMichael AJ, Borysiewicz LK.

(1990) High frequency of memory and effector gag specific

cytotoxic T lymphocytes in HIV seropositive individuals. Int

Immunol. 2, 707-12

Haffar O, Garrigues J, Travis B, et al. (1990) Human

immunodeficiency virus-like, nonreplicating, gag-env

particles assemble in a recombinant vaccinia virus expression

system. J Virol. 64, 2653-9.

Huang Y, Kong WP, Nabel GJ. (2001) Human

immunodeficiency virus type 1-specific immunity after

genetic immunization is enhanced by modification of Gag

and Pol expression. J Virol. , 75, 4947-51

Johnson RP, Trocha A, Yang L, Mazzara GP, Panicali DL,

Buchanan TM, Walker BD. (1991) HIV-1 gag-specific

cytotoxic T lymphocytes recognize multiple highly

conserved epitopes. Fine specificity of the gag-specific

response defined by using unstimulated peripheral blood

mononuclear cells and cloned effector cells. J Immunol.

147, 3560-7

Kalams SA, Buchbinder SP, Rosenberg ES, Billingsley JM,

Colbert DS, Jones NG, Shea AK, Trocha AK, Walker BD.

(1999) Association between virus-specific cytotoxic T-

lymphocyte and helper responses in human

immunodeficiency virus type 1 infection. Leukemia. 13

Suppl 1, S42-7

Los Alamos HIV Molecular Immunology Database. (2002)

http://hiv-web.lanl.gov/content/immunology/

McAdam S, Kaleebu P, Krausa P, Goulder P, French N, Collin

B, Blanchard T, Whitworth J, McMichael A, Gotch F. (1998)

Cross-clade recognition of p55 by cytotoxic T lymphocytes

in HIV-1 infection. Proc Natl Acad Sci USA. 95, 10112-6

Montefiori DC, Safrit JT, Lydy SL, Barry AP, Bilska M, Vo HT,

Klein M, Tartaglia J, Robinson HL, Rovinski B. (2001)

Induction of neutralizing antibodies and gag-specific cellular

immune responses to an R5 primary isolate of human

immunodeficiency virus type 1 in rhesus macaques. J Virol

75, 5879-90

Nermut MV, Hockley DJ, Bron P, Thomas D, Zhang WH, Jones

IM. (1998) Further evidence for hexagonal organization of

HIV gag protein in prebudding assemblies and immature

virus-like particles. J Struct Biol. 123, 143-9

Paliard X, Liu Y, Wagner R, Wolf H, Baenziger J, Walker CM.

(2000) Priming of strong, broad, and long-lived HIV type 1

p55gag-specific CD8+ cytotoxic T cells after administration

of a virus-like particle vaccine in rhesus macaques. AIDS

Res. Hum Retroviruses 16, 273-82

Qiu JT, Liu B, Tian C, Pavlakis GN, Yu XF. (2000)

Enhancement of primary and secondary cellular immune

responses against human immunodeficiency virus type 1 gag

by using DNA expression vectors that target Gag antigen to

the secretory pathway. J Virol. 74, 5997-6005.

Rosenberg ES, Billingsley JM, Caliendo AM, Boswell SL, Sax

PE, Kalams SA, Walker BD. (1997) Vigorous HIV-

1–specific CD4 T cell responses associated with control of

viremia. Science. 278, 1447–50

Rovinski B, Rodrigues L, Cao SX, Yao FL, McGuinness U, Sia

C, Cates G, ZollaPazner S, Karwowska S, Matthews TJ.

(1995) Induction of HIV type 1 neutralizing and env-CD4

blocking antibodies by immunization with genetically

engineered HIV type 1-like particles containing unprocessed

gp160 glycoproteins. AIDS Res Hum Retroviruses. 11,

1187-95.

Seth A, Ourmanov I, Schmitz JE, Kuroda MJ, Lifton MA,

Nickerson CE, Wyatt L, Carroll M, Moss B, Venzon D,

Letvin NL, Hirsch VM. (2000) Immunization with a

modified vaccinia virus expressing simian immunodeficiency

virus (SIV) Gag-Pol primes for an anamnestic Gag-specific

cy-totoxic T-lymphocyte response and is asso-ciated with

reduction of viremia after SIV challenge. J. Virol. 74,

2502–7

Tatt ID, Barlow KL, Nicoll A, Clewley JP. (2001) The public

health significance of HIV-1 subtypes. AIDS. 15 Suppl 5,

S59-71

Wagner R, Fliessbach H, Wanner G, Motz M, Niedrig M, Deby

G, von Brunn A, Wolf H. (1992) Studies on processing,

particle formation, and immunogenicity of the HIV-1 gag

gene product, a possible component of a HIV vaccine. Arch

Virol. 127(1-4) 117-37

Wagner R, Teeuwsen VJ, Deml L. (1998) Cytotoxic T cells and

neutralizing antibodies induced in rhesus monkeys by virus-

like particle HIV vaccines in the absence of protection from

SHIV infection. Virology. 245, 65-74


335


Targeting retroviral vector entry by host range

extensionReview Article

Katja Sliva and Barbara S.Schnierle*Institute for Biomedical Research, Georg-Speyer Haus, Paul-Ehrlich-Str. 42-44, 60596 Frankfurt/Main, Germany

__________________________________________________________________________________

*Correspondence: Barbara S.Schnierle, Institute for Biomedical Research, Georg-Speyer Haus, Paul-Ehrlich-Str. 42-44, 60596

Frankfurt/Main, Germany; Tel. +49-69-63395-218; Fax. +49-69-63395-297; E-mail: [email protected]

Key words: murine leukemia virus, targeting, vector, envelope, virus entry, host range

Abbreviations: endoplasmatic reticulum, (ER); envelope glycoproteins, (Env); epidermal growth factor, (EGF); feline leukemia virus,

(FeLV); fusion peptide, (FP); gastrin-releasing protein, (GRP); green fluorescent protein, (GFP); haemagglutinin, (HA); murine

leukemia virus, (MLV); proline-rich region, (PRR); receptor-binding domain, (RBD); receptor-binding domain, (RBD); signal peptide,

(SP); soluble receptor-binding domains, (sRBD); translocation domain, (TLD)

Received: 12 July 2004; Accepted: 27 July 2004; electronically published: July 2004

Summary

The dream of vectorologists is a vector with magic bullet properties. This conceptual breakthrough in gene therapy

would be a gene transfer vector that could be systemically applied, allowing targeted gene transfer into a

predetermined cell type. The host range of a retroviral vector is determined by the interaction between the viral

envelope glycoprotein and the retrovirus receptor on the surface of the host cell. Here are summarized current

efforts to engineer the envelope glycoprotein of ecotropic murine leukemia virus, which does not infect human cells,

in order to extend its host range and accomplish gene delivery in a highly specific manner.

I. IntroductionTargeting retroviral entry is a central theme in the

development of vectors for gene therapy. The selective

delivery of a therapeutic gene would immensely reduce

unfavorable side effects and ease the clinical application

of gene therapy. Here one aspect of generating targeted

retroviral vectors will be discussed: the extension of the

host range of a non human pathogenic virus. Other

approaches are summarized in other current reviews

(Haynes et al, 2003; Sandrin et al, 2003; Verhoeyen and

Cosset, 2004).

The ability of viruses to introduce foreign DNA

sequences into target cells is being exploited for treating

genetic diseases, including cancer (Cavazzana-Calvo et al,

2000; Aiuti et al, 2002). Retroviral vectors are the best

understood and the most widely used vectors for gene

therapy. They integrate their genomes stably into host cell

DNA allowing long-term expression of inserted

therapeutic genes. Retroviral entry and genome integration

do not require viral protein synthesis, and, therefore, all

viral genes in the vector genome can be replaced with

foreign sequences. There is no production of viral proteins

after transduction, which could lead to immune responses

against the vector particle, and no subsequent spread of the

vector. Vector particles are produced by packaging cell

lines that provided the viral proteins in trans. These cell

lines release vector genomes packaged into infectious

particles that are free from contaminating helper virus and

replication-competent recombinant virus.

Retroviruses and vectors derived thereof acquire cell-

derived lipid bilayer in which the envelope glycoproteins

(Env) are inserted, by budding from the host cell

membrane. The Env protein mediates attachment and

fusion between the host cell membrane and the viral

membrane, which results in the release of the viral capsid

particle containing the genetic material into the cytoplasm.

Viral entry is initiated by the binding of the envelope

protein to an appropriate cellular receptor at the host cell

surface. After binding, the Env protein undergoes

conformational changes allowing induction of membrane

fusion. This is triggered either at the cell surface by the

interaction with the receptor (pH-independent entry), or by

exposure to low pH following receptor-mediated

endocytosis (pH-dependent entry). Induction of fusion

under low pH conditions is believed to occur in the

absence of receptor binding, suggesting that the binding of

pH-dependent envelope proteins serves only as a means of

targeting the virus to endosomes.

Sliva and Schnierle: Host range extension

336

II. The murine leukemia virus (MLV)

envelope glycoproteinThe host range of a retroviral vector is dependent

upon its Env, which binds to a specific cell surface

receptor protein. The MLV Env protein, like all retroviral

Envs, is a type I membrane protein and is synthesized as a

precursor protein, which is directed into the lumen of the

endoplasmatic reticulum (ER) by its N-terminal signal

peptide (SP) (Figure 1A). In the ER, the signal peptide is

cleaved off, the protein is N-linked glycosylated and

correctly folded proteins assemble into trimers. After

transport to the Golgi apparatus, further glycosylation and

trimming of the carbohydrates take place and the precursor

protein is cleaved by furin or related proteases into the

surface SU, and transmembrane TM, subunits. SU and TM

are linked in the case of MLV Env by labile disulfide

bonds. The cleavage is necessary for Env to gain the

active, fusion competent conformation, required for viral

entry. From the Golgi apparatus the mature Env is

transported to the plasma membrane where it is

incorporated into the budding viral particles. Recently, it

has been indicated that recruitment of Env by MLV core

proteins also occurs in intracellular compartments

(Sandrin et al, 2004). The MLV Env is further processed

in the viral particle by another cleavage event. A short

portion of the cytoplasmic tail (R) of TM is removed by

the viral protease. This cleavage is required to activate the

fusion potential of Env (Coffin et al, 1997).

Figure 1. A. Schematic structure of the Moloney-MLV envelope glycoprotein.SU: Env surface domain; TM: Env transmembrane

domain; SP: Signal peptide; VRA: variable region A; VRB: variable region B; RBD: receptor-binding region; PRR: proline-rich region;

FP: fusion peptide; HR: helical region; MS: membrane spanning region; R: R peptide. Arrows indicate protease cleavage sites. B.

Schematic three dimensional structure of Moloney-MLV envelope glycoprotein.


337

The receptor-binding domain (RBD) is located in the

SU subunit of Env (Figure 1A, B). Two hypervarible

regions (VRA and VRB) are believed to be the main

determinants of the receptor-binding specificity. The

structure of the receptor-binding region has been

determined (Fass et al, 1997) and the VRA and VRB

regions form parallel !-helices that shape the receptor-

binding site. The receptor-binding site is followed by the

proline-rich region (PRR), which is thought to have a

hinge function. The PRR has a role in stabilizing the

overall structure of the protein, affects the SU-TM

interactions and functions as a signal which induces the

envelope conformational changes leading to fusion

(Weimin Wu et al, 1998; Lavillette et al, 1998). The PRR

contains a highly conserved N-terminal sequence and a

hypervariable C-terminal sequence. The hypervariable

region of the PRR has been described to be not absolutely

required for envelope protein function (Weimin Wu et al,

1998). The C-terminal domain of SU is believed to

mediate the SU-TM interaction (Schulz et al, 1992)

(Figure 1B).

A conserved motif (SPHQV) at the N-terminus of

SU containing the histidine residue H8, has also been

shown to be required for membrane fusion. Deletion or

mutation of this histidine residue abrogates Env’s fusion

activity, but not receptor binding. Surprisingly, this fusion

defect can be restored by adding soluble fragments of SU,

containing the receptor-binding site, to viral particles

carrying Envs with a mutated histidine (Zavorotinskaya

and Albritton, 1999; Lavillette et al, 2000; Barnett and

Cunningham, 2001).

TM contains the hydrophobic fusion peptide (FP) at

its N-terminus. It is crucial for membrane fusion and

becomes exposed and inserted into the host cell membrane

after receptor binding and the resulting conformational

changes in Env. The fusion process also involves major

changes in the membrane proximal region of TM. A six-

helix bundle is formed, which pulls the cellular and viral

membrane closer together, driving membrane fusion by

permitting membrane merging and pore formation. This

finally leads to fusion of the viral and cellular membranes,

and eventual delivery of the viral core into the cell (Dutch

et al, 2000).

The mammalian type C retroviruses, like MLV, can

be divided into four different naturally occurring host-

range subtypes according to the distinct cell-surface

receptors they recognize among species as well as to the

viral interference patterns. MLV "s that recognize receptors

found on both rodent cells and cells of other species are

classified as amphotropic and dual- or polytropic viruses,

while the receptor for viruses with xenotropic host range is

present on cells of a variety of species but not on mouse

cells. Receptors for ecotropic MLVs are restricted to cells

of mouse or rat origin, which makes this envelope to a

good candidate for targeting approaches. However, all

receptors belong to the family of membrane transporter

molecules (Coffin et al, 1997). While this allows different

host ranges for the various retrovirus family members, it

also implies that the receptor’s function might have an

important task during viral entry.

The ecotropic MLV envelope protein does not

recognizes receptors on human cells. An obvious

challenge has been to extend the host range of vectors

carrying the ecotropic envelope glycoprotein to a

predetermined human cell type. This change in host range

requires the inclusion of a novel attachment site and the

induction of fusion via a novel receptor interaction.

III. Extension of the ecotropic Env

host rangeA. The search for insertion sites in EnvThe extension of the host range of ecotropic MLV

vectors to specific human cell types was begun with the

insertion of new receptor-binding ligands into Env, to

redirect binding of viral particles to a predetermined cell

type. The insertion of additional sequences into Env very

often interferes with its cleavage into the SU and TM

subunits and/or incorporation into virions (Schnierle and

Groner, 1996; Benedict et al, 1999). Rational

determination of the appropriate insertion site in Env has

been difficult, since its structure is complex and only

limited information is available. Several studies have

investigated locations within the ecotropic Env protein

which can tolerate the insertion of ligands and the

following sites have been mainly determined empirically:

1. The N-terminus of SUInitially ligands were fused to the N-terminus of Env

behind aa 7 of the mature Env protein (Russell et al, 1993;

Cosset et al, 1995; Schnierle et al, 1996; Hall et al, 1997;

Yajima et al, 1998; Benedict et al, 1999). However it was

found that sequences between +1 and +7 also influence the

fusion activity of the chimeric Env, and N-terminal

extension of Env (position +1) is now believed to be

superior over the insertion of additional sequences at

position +7 (Ager et al, 1996; Valsesia-Wittmann et al,

1996).

2. The proline-rich region (PRR)The hypervariable region of the PRR has been

described to be dispensable for Env function and to

tolerate insertion of foreign sequences (Weimin Wu et al,

1998). Even large insertions have been introduced

(Kayman et al, 1999; Erlwein et al, 2003). We recently

generated a fully replication competent Moloney-MLV

that bears the green fluorescent protein (GFP) in its PRR

and still replicates to the same titers as the parental

construct (Erlwein et al, 2003).

3. The receptor-binding domain (RBD)Three studies have reported the stable insertion of

sequences into a small disulfide-bonded loop (between

Cys 73 and Cys 81) near the native receptor-binding site,

which is predicted by the crystal structure exposed to the

surface (Lorimer and Lavictoire, 2000; Wu et al, 2000;

Katane et al, 2002).

4. Replacement of the RBD with a new ligandIn addition to adding new ligands, the insertion of

new ligands into Env by the replacement of the entire


338

receptor binding region of Env has been described

(Kasahara et al, 1994; Han et al, 1995; Masood et al, 2001;

Nakamura et al, 2001). These targeting approaches

however do require the co-expression of wt Env in order

to achieve efficient uptake of the chimeric Env and

probably also to enhance the fusion process.

B. Host range expansionInsertion of ligands into Env is possible and insertion

sites are well established, but not all inserted ligands are

tolerated by the ecotropic Env. Unfortunately, it is not yet

possible to predict which ligands will allow proper

incorporation of Env into vector particles. In the last

decade, however, attempts to expand the host range of

MLV vectors by redirecting binding to specific human cell

types through the attachment of additional cell-binding

ligands to the ecotropic MLV Env have met with little

success. While binding of Env to the new receptor could

be demonstrated frequently, this was not sufficient to

catalyze efficient infections (Cosset and Russell, 1996,

1999; Schnierle and Groner, 1996; Benedict et al, 1999;

Lavillette et al, 2001b). Recently, a few exceptions have

been reported. These include targeting via the human

CXCR-4 receptor by incorporation of SDF-1 into the VRA

region of the RBD (Katane et al, 2002, 2004) and two

approaches using N-terminal extensions of Env to target

either the human epidermal growth factor (EGF) receptor

family using their ligand heregulin or gastrin-releasing

protein (GRP) using short peptide ligands (Gollan and

Green, 2002a, 2002b). But the maximum titers reached on

human cells were only 104 IU/ml and these vectors are,

therefore, not yet useful for gene therapy applications.

Why is host range expansion so difficult? The

targeted binding of a new receptor presumably fails to

induce the conformational changes in Env required for the

activation of membrane fusion (Cosset et al, 1995; Zhao et

al, 1999; Karavanas et al, 2002). As mentioned above,

mammalian type C retroviral receptors belong to the

multi-transmembrane domain-containing transporter

family. As retroviruses have evolved to use this type of

proteins as receptors, it is possible that only this type of

surface molecule is able to trigger cellular processes

required for retroviral entry. This would only affect pH-

independent entry processes, because in this case receptor

binding induces the fusion process. Since ecotropic MLV

has been described to use the pH-dependent entry route

(Nussbaum et al, 1993) it was thought that targeting it to

receptors that are internalized after ligand binding should

facilitate infection, because the virus is transported to the

low pH compartment required for fusion activation. This

assumption proved, however, to be too simple. Viral

particles containing a chimeric EGF-Env bind to the EGF-

receptor but are rapidly trafficked to endosomes and

become degraded (sequestration). This effect is dominant

over the normal entry pathway, because a strong decrease

in infectivity of EGF-Env vectors in mouse cells

expressing the EGF-receptor has been observed (Cosset et

al, 1995; Yajima et al, 1998; Benedict et al, 1999;

Chadwick et al, 1999; Zhao et al, 1999) (Figure 2).

Figure 2. Proposed mechanism of cell entry with targeted

vectors using fusion helpers.

IV. Overcoming the fusion defectA. Retroviral librariesThe search for an Env integration site and ligands

that allow both binding and the induction of the fusion

process is continuing. The most promising results come

from evolutionary approaches, such as using retroviral

libraries with random modifications in the receptor-

binding site to select viruses with a desired host range. The

selection process takes attachment and induction of fusion

into account. Successful examples have already been

described for feline leukemia virus (FeLV) subtype A

where Env molecules conferring an altered host range

have been successfully selected from a retroviral library

(Bupp and Roth, 2002, 2003).

B. Adding pH-dependent endosome

escape functionThe post-binding entry process differs among the

MLV Envs. Amphotropic MLV fuses with cells at neutral

pH, whereas ecotropic MLV entry seems to be acid pH

dependent (Coffin et al, 1997). However, following

targeting of the ecotropic MLV to the EGF-receptor, the

subsequent internalization does not support infection

(Cosset et al, 1995), but rather leads to an inactivation of

the viral particles. This observation opened the field to

new targeting strategies that include insertion of an

endosome escape function (fusion helper) into the viral

particles (Figure 2).

We generated chimeric ecotropic Env proteins

containing EGF-receptor ligands and the translocation

domain (TLD) of Exotoxin A of Pseudomonas aeruginosa

which gives the toxin the ability to translocate from


339

endosomes to the cytoplasm. These chimeric proteins were

successfully produced, chimeric vector particles could

bind to the EGF-receptor, but transduction of human cells

expressing EGF-receptor was not observed (Erlwein et al,

2002). Since the titers of vectors containing Envs with the

TLD were significantly decreased, it is still not clear

whether the endosome escape is inefficient or if infectivity

of the vectors is below a detectable level.

PH-dependent viruses enter cells through receptor-

mediated endocytosis and the subsequent acidification in

the endosome produces the conformational changes in the

viral envelope protein(s) which lead to membrane fusion.

It seems likely that targeting such proteins to a receptor

that undergoes endocytosis could result in efficient fusion.

These proteins are attractive molecules for co-packaging

with ecotropic targeted Envs, and the best studied

envelope protein of this type is the haemagglutinin (HA)

of influenza A (Skehel and Wiley, 2000). Analogous to

retroviral Envs, the mature protein consists of 2 subunits,

HA1 and HA2. The major part of HA1 forms the globular

head region, containing the receptor-binding domain

which binds to the ubiquitously present sialic acid. HA2

contains the fusion peptide and transmembrane domain.

For targeting approaches, however, HA has to be modified

to eliminate its tropism towards human cells. Point

mutations within the receptor-binding pocket have been

reported that greatly reduce binding (Martin et al, 1998;

Lin and Cannon, 2002). The co-expression of these HA

mutants has been reported by Lin et al, (2001). MLV

vectors bearing both, the HA mutant and a chimeric,

ecotropic MLV Env targeted to the murine Flt-3 receptor

show a 10-fold increase in titer on human cells expressing

this receptor compared to the parental cells. Although

there is still a low residual titer of this HA protein, this

study shows that the production of infectious retroviral

vectors bearing a targeted binding protein complemented

with a fusion active HA is possible.

C. Targeting by using soluble RBDsTheoretically targeting might be possible using

soluble receptor-binding domains (sRBD), which are able

to activate fusion-defective Envs. This may allow the local

activation of fusion at the cell type of choice might be

possible (Lavillette et al, 2000; 2001a, 2002; Barnett and

Cunningham, 2001). However, the clinical application of

this strategy is questionable, since two proteinous

components have to be applied systemically to accomplish

their task at a locally restricted area.

V. ConclusionsWe know now that the initial assumption, that

changing the host range of retroviruses is possible by

simply modifying the cell-binding specificity, was too

simple. However, some of the key problems in

engineering Envs to target retroviral vectors have been

answered. It is possible to modify ecotropic Env and

change its binding specificity, but the efficient triggering

of membrane fusion is still missing. As more data about

viral assembly and Env structure are becoming available,

new strategies might arise, which may substantiate the

doubts of some scientists in the field that host range

expansion will not be possible, or which will finally

facilitate the generation of targeted retroviral vectors.

ReferencesAger S, Nilson BH, Morling FJ, Peng KW, Cosset FL and

Russell SJ (1996) Retroviral display of antibody fragments;

interdomain spacing strongly influences vector infectivity.

Hum Gene Ther 7, 2157-2164.

Aiuti A, Slavin S, Aker M, Ficara F, Deola S, Mortellaro A,

Morecki S andolfi G, Tabucchi A, Carlucci F, et al (2002)

Correction of ADA-SCID by stem cell gene therapy

combined with nonmyeloablative conditioning. Science 296,

2410-2413.

Barnett AL and Cunningham JM (2001) Receptor binding

transforms the surface subunit of the mammalian C-type

retrovirus envelope protein from an inhibitor to an activator

of fusion. J Virol 75, 9096-9105.

Benedict CA, Tun RY, Rubinstein DB, Guillaume T, Cannon

PM and Anderson WF (1999) Targeting retroviral vectors to

CD34-expressing cells: binding to CD34 does not catalyze

virus-cell fusion. Hum Gene Ther 10, 545-557.

Bupp K and Roth MJ (2002) Altering retroviral tropism using a

random-display envelope library. Mol Ther 5, 329-335.

Bupp K and Roth MJ (2003) Targeting a retroviral vector in the

absence of a known cell-targeting ligand. Hum Gene Ther

14, 1557-1564.

Cavazzana-Calvo M, Hacein-Bey S, de Saint Basile G, Gross F,

Yvon E, Nusbaum P, Selz F, Hue C, Certain S, Casanova JL,

et al (2000) Gene therapy of human severe combined

immunodeficiency (SCID)-X1 disease. Science 288, 669-

672.

Chadwick MP, Morling FJ, Cosset FL and Russell SJ (1999)

Modification of retroviral tropism by display of IGF-I. J Mol

Biol 285, 485-494.

Coffin JM, Hughes SH and Varmus HE (1997) Retroviruses, Vol

2, Cold Spring Harbor Press.

Cosset FL and Russell SJ (1996) Targeting retrovirus entry.

Gene Ther 3, 946-956.

Cosset FL, Morling FJ, Takeuchi Y, Weiss RA, Collins MK and

Russell SJ (1995) Retroviral retargeting by envelopes

expressing an N-terminal binding domain. J Virol 69, 6314-

6322.

Dutch RE, Jardetzky TS and Lamb RA (2000) Virus membrane

fusion proteins: biological machines that undergo a

metamorphosis. Biosci Rep 20, 597-612.

Erlwein O, Buchholz CJ and Schnierle BS (2003) The proline-

rich region of the ecotropic Moloney murine leukaemia virus

envelope protein tolerates the insertion of the green

fluorescent protein and allows the generation of replication-

competent virus. J Gen Virol 84, 369-373.

Erlwein O, Wels W and Schnierle BS (2002) Chimeric ecotropic

MLV envelope proteins that carry EGF receptor-specific

ligands and the Pseudomonas exotoxin A translocation

domain to target gene transfer to human cancer cells.

Virology 302, 333-341.

Fass D, Davey RA, Hamson CA, Kim PS, Cunningham JM and

Berger JM (1997) Structure of a murine leukemia virus

receptor-binding glycoprotein at 2.0 angstrom resolution.

Science 277, 1662-1666.

Gollan TJ and Green MR (2002a) Redirecting retroviral tropism

by insertion of short, nondisruptive peptide ligands into

envelope. J Virol 76, 3558-3563.


340

Gollan TJ and Green MR (2002b) Selective targeting and

inducible destruction of human cancer cells by retroviruses

with envelope proteins bearing short peptide ligands. J Virol

76, 3564-3569.

Hall FL, Gordon EM, Wu L, Zhu NL, Skotzko MJ, Starnes VA

and Anderson WF (1997) Targeting retroviral vectors to

vascular lesions by genetic engineering of the MoMLV gp70

envelope protein. Hum Gene Ther 8, 2183-2192.

Han X, Kasahara N and Kan YW (1995) Ligand-directed

retroviral targeting of human breast cancer cells. Proc Natl

Acad Sci U S A 92, 9747-9751.

Haynes C, Erlwein O and Schnierle BS (2003) Modified

envelope glycoproteins to retarget retroviral vectors. Curr

Gene Ther 3, 405-410.

Karavanas G, Marin M, Bachrach E, Papavassiliou AG and

Piechaczyk M (2002) The insertion of an anti-MHC I ScFv

into the N-terminus of an ecotropic MLV glycoprotein does

not alter its fusiogenic potential on murine cells. Virus Res

83, 57-69.

Kasahara N, Dozy AM and Kan YW (1994) Tissue-specific

targeting of retroviral vectors through ligand-receptor

interactions. Science 266, 1373-1376.

Katane M, Fujita R, Takao E, Kubo Y, Aoki Y and Amanuma H

(2004) An essential role for the His-8 residue of the SDF-

1alpha-chimeric, tropism-redirected Env protein of the

Moloney murine leukemia virus in regulating postbinding

fusion events. J Gene Med 6, 260-267.

Katane M, Takao E, Kubo Y, Fujita R and Amanuma H (2002)

Factors affecting the direct targeting of murine leukemia

virus vectors containing peptide ligands in the envelope

protein. EMBO Rep 3, 899-904.

Kayman SC, Park H, Saxon M and Pinter A (1999) The

hypervariable domain of the murine leukemia virus surface

protein tolerates large insertions and deletions, enabling

development of a retroviral particle display system. J Virol

73, 1802-1808.

Lavillette D, Boson B, Russell SJ and Cosset FL (2001a)

Activation of membrane fusion by murine leukemia viruses

is controlled in cis or in trans by interactions between the

receptor-binding domain and a conserved disulfide loop of

the carboxy terminus of the surface glycoprotein. J Virol 75,

3685-3695.

Lavillette D, Maurice M, Roche C, Russell SJ, Sitbon M and

Cosset FL (1998) A proline-rich motif downstream of the

receptor binding domain modulates conformation and

fusogenicity of murine retroviral envelopes. J Virol 72,

9955-9965.

Lavillette D, Ruggieri A, Boson B, Maurice M and Cosset FL

(2002) Relationship between SU subdomains that regulate

the receptor-mediated transition from the native (fusion-

inhibited) to the fusion-active conformation of the murine

leukemia virus glycoprotein. J Virol 76, 9673-9685.

Lavillette D, Ruggieri A, Russell SJ and Cosset FL (2000)

Activation of a cell entry pathway common to type C

mammalian retroviruses by soluble envelope fragments. J

Virol 74, 295-304.

Lavillette D, Russell SJ and Cosset FL (2001b) Retargeting gene

delivery using surface-engineered retroviral vector particles.

Curr Opin Biotechnol 12, 461-466.

Lin AH and Cannon PM (2002) Use of pseudotyped retroviral

vectors to analyze the receptor-binding pocket of

hemagglutinin from a pathogenic avian influenza A virus

(H7 subtype) Virus Res 83, 43-56.

Lorimer IA and Lavictoire SJ (2000) Targeting retrovirus to

cancer cells expressing a mutant EGF receptor by insertion

of a single chain antibody variable domain in the envelope

glycoprotein receptor binding lobe. J Immunol Methods

237, 147-157.

Martin J, Wharton SA, Lin YP, Takemoto DK, Skehel JJ, Wiley

DC and Steinhauer DA (1998) Studies of the binding

properties of influenza hemagglutinin receptor-site mutants.

Virology 241, 101-111.

Masood R, Gordon EM, Whitley MD, Wu BW, Cannon P, Evans

L anderson WF, Gill P and Hall FL (2001) Retroviral vectors

bearing IgG-binding motifs for antibody-mediated targeting

of vascular endothelial growth factor receptors. Int J Mol

Med 8, 335-343.

Nakamura H, Takeda A and Matano T (2001) Postbinding fusion

function contributed by a chimeric murine leukemia virus

envelope protein. Arch Virol 146, 953-961.

Nussbaum O, Roop A and Anderson WF (1993) Sequences

determining the pH dependence of viral entry are distinct

from the host range-determining region of the murine

ecotropic and amphotropic retrovirus envelope proteins. J

Virol 67, 7402-7405.

Russell SJ and Cosset FL (1999) Modifying the host range

properties of retroviral vectors. J Gene Med 1, 300-311.

Russell SJ, Hawkins RE and Winter G (1993) Retroviral vectors

displaying functional antibody fragments. Nucleic Acids Res

21, 1081-1085.

Sandrin V, Muriaux D, Darlix JL and Cosset FL (2004)

Intracellular trafficking of gag and env proteins and their

interactions modulate pseudotyping of retroviruses. J Virol

78, 7153-7164.

Sandrin V, Russell SJ and Cosset FL (2003) Targeting retroviral

and lentiviral vectors. Curr Top Microbiol Immunol 281,

137-178.

Schnierle BS and Groner B (1996) Retroviral targeted delivery.

Gene Ther 3, 1069-1073.

Schnierle BS, Moritz D, Jeschke M and Groner B (1996)

Expression of chimeric envelope proteins in helper cell lines

and integration into Moloney murine leukemia virus

particles. Gene Ther 3, 334-342.

Schulz TF, Jameson BA, Lopalco L, Siccardi AG, Weiss RA and

Moore JP (1992) Conserved structural features in the

interaction between retroviral surface and transmembrane

glycoproteins? AIDS Res Hum Retroviruses 8, 1571-1580.

Skehel JJ and Wiley DC (2000) Receptor binding and membrane

fusion in virus entry: the influenza hemagglutinin. Annu Rev

Biochem 69, 531-569.

Valsesia-Wittmann S, Morling FJ, Nilson BH, Takeuchi Y,

Russell SJ and Cosset FL (1996) Improvement of retroviral

retargeting by using amino acid spacers between an

additional binding domain and the N terminus of Moloney

murine leukemia virus SU. J Virol 70, 2059-2064.

Verhoeyen E and Cosset FL (2004) Surface-engineering of

lentiviral vectors. J Gene Med 6 Suppl 1, S83-94.

Weimin Wu B, Cannon PM, Gordon EM, Hall FL and Anderson

WF (1998) Characterization of the proline-rich region of

murine leukemia virus envelope protein. J Virol 72, 5383-

5391.

Wu BW, Lu J, Gallaher TK anderson WF and Cannon PM

(2000) Identification of regions in the Moloney murine

leukemia virus SU protein that tolerate the insertion of an

integrin-binding peptide. Virology 269, 7-17.

Yajima T, Kanda T, Yoshiike K and Kitamura Y (1998)

Retroviral vector targeting human cells via c-Kit-stem cell

factor interaction. Hum Gene Ther 9, 779-787.

Zavorotinskaya T and Albritton LM (1999) Suppression of a

fusion defect by second site mutations in the ecotropic


341

murine leukemia virus surface protein. J Virol 73, 5034-

5042.

Zhao Y, Zhu L, Lee S, Li L, Chang E, Soong NW, Douer D and

Anderson WF (1999) Identification of the block in targeted

retroviral-mediated gene transfer. Proc Natl Acad Sci U S A

96, 4005-4010.


342


343


Role of the Brn-3a and Brn-3b POU family

transcription factors in cancerReview Article

David S. Latchman*Institute of Child Health, 30 Guilford Street, London WC1N 1EH & Birkbeck, University of London Malet Street, London

WC1E 7HX

__________________________________________________________________________________*Correspondence: David S. Latchman, Institute of Child Health, 30 Guilford Street, London WC1N 1EH and Birkbeck, University of

London, Malet Street, London WC1E 7HX, UK; Tel (+44) 20 7905 2611; Fax (+44) 20 7905 2301; E-mail: [email protected]

Key words: Brn-3a, Brn-3b, POU family transcription factors, neuroblastoma, Ewing's sarcoma, breast cancer, cervical cancer

Abbreviations: cervical intra-epithelial neoplasia Type 3, (CIN3)

Received: 03 August 2004; Accepted: 04 August 2004; electronically published: August 2004

Contributed by Prof. David Latchman

Summary

Brn-3a and Brn-3b are closely-related POU family transcription factors both of which play an important role in the

nervous system. However, both these factors were originally isolated from a neuroblastoma cell line and their

expression has been shown to be altered in several different human cancers. Interestingly, functional studies have

shown that Brn-3b has a growth-stimulating effect in neurobastomas, whereas Brn-3a has a growth-inhibiting

effect. Similarly, Brn-3b is over-expressed in human breast cancers and stimulates their growth. However, Brn-3a is

strongly over-expressed in human cervical cancer and stimulates cervical tumour growth by activating expression

of the human papilloma virus E6 and E7 oncogenes which are essential for development of this tumour. Hence,

these closely-related factors play critical but distinct roles in different human cancers.

I. IntroductionThe POU family of transcription factors was

originally defined on the basis of a common DNA binding

domain identified in the mammalian transcription factors

Pit, Oct-1 and Oct-2 and the nematode regulatory protein

Unc-86 (Herr et al, 1988). Subsequently, a large number

of other POU family members have been identified in a

range of different invertebrates and vertebrates and have

been shown to play critical roles in development,

particularly in the nervous system (Verrijzer and van der

Vliet 1993; Ryan and Rosenfeld 1997; Latchman 1999).

For example, He et al, (1989) used degenerate

oligonucleotides corresponding to conserved regions of

the POU domain to isolate several novel POU factors

expressed specifically in the brain. One of these, which

they named Brn-3 was highly expressed in sensory

neurones of the peripheral nervous system and was

particularly closely related to the nematode Unc-86 gene

product, indicating the evolutionary conservation of POU

proteins.

Subsequently however, using a similar approach in a

rodent neuroblastoma cell line we isolated two very

closely-related POU factors (Lillycrop et al, 1992). One of

these was identical to the Brn-3 factor reported by He et

al, (1989), whilst the other showed seven amino acid

differences in the POU domain from the original factor.

Subsequent studies indicated that these two factors which

we named respectively Brn-3a and Brn-3b, were encoded

by different genes and, whilst having highly homologous

POU domains, were much less homologous outside the

POU domain (Lillycrop et al, 1992: Ring and Latchman,

1993). Subsequently, a third closely-related factor Brn-3c

was also isolated from the nervous system (Ninkina et al,

1993).

All these three factors play essential roles in

development of particular aspects of the nervous system.

Thus, inactivation of Brn-3a (also known as Brn-3.0) in

knock out mice results in extensive death of sensory

neurones and is incompatible with survival (McEvilly et

al, 1996; Xiang et al, 1996). Although inactivation of Brn-

3b (also known as Brn-3.2) and Brn-3c (also known as

Brn-3.1) is not incompatible with survival of the animal,

such inactivation leads respectively to defects in the visual

and auditory systems (Erkman et al, 1996; Xiang et al,

1997). Hence, the POU factors Brn-3a, Brn-3b and Brn-3c

constitute a closely-related group of factors which are

classified together in the POU IV subfamily and are the

most closely-related mammalian factors to Unc-86 and

like this factor play an essential role in the proper

development of the nervous system.

However, in terms of cancer it is of particular interest

that both Brn-3a and Brn-3b were isolated from a rodent

Latchman: Role of the Brn-3a and Brn-3b POU family transcription factors in cancer

344

neuroblastoma cell line and were shown to be regulated

during its differentiation (Lillycrop et al, 1992). Similarly,

Brn-3a was also isolated independently (and named RDC-

1) as a factor which is expressed by Ewing's sarcomas

(Collum et al, 1992) and was subsequently shown to be

expressed in a number of aggressive neuroendocrine

tumours (Leblond-Francillard et al, 1997). Similarly, Brn-

3b was shown to be expressed by teratocarcinoma cell

lines and to be regulated during their differentiation

(Turner et al, 1994). These early expression studies led to

the suggestion that these factors may play a particularly

critical role in specific cancers (Chiarugi et al, 2002). In

this review, I will discuss detailed studies on a few tumour

cell types which indicate that this is indeed the case and

which demonstrate critical but contrasting roles for Brn-3a

and Brn-3b in different types of cancer.

II. Brn-3a and Brn-3b in

neuroblastomaAs indicated above, Brn-3a and Brn-3b were

originally isolated from a rodent neuroblastoma cell line

(Lillycrop et al, 1992). When these cells are induced to

differentiate from a dividing cell type to a non-dividing

cell bearing numerous neurite processes, the level of Brn-

3a was shown to increase dramatically, whilst the level of

Brn-3b decreased (Lillycrop et al, 1992; Budhram-

Mahadeo et al, 1994, 1995). A similar increase in Brn-3a

and decrease in Brn-3b was also noted when several

different human neuroblastoma cell lines were induced to

differentiate in culture (Smith and Latchman, 1996).

These expression studies were of particular interest

since Brn-3a and Brn-3b were shown to have antagonistic

effects on their target promoters. Thus, Brn-3a was able to

activate the promoters of genes encoding neuronal

differentiation markers such as SNAP-25 and the

neurofilaments, whereas Brn-3b repressed these promoters

and antagonised their activation by Brn-3a (Lakin et al,

1995; Smith et al, 1997c). This led to the idea that Brn-3a

may act to promote neuroblastoma differentiation by

inducing the activity of neuronal differentiation genes,

whilst Brn-3b opposes such an effect and promotes the

maintenance of the non-differentiated proliferative

phenotype.

This idea was directly proven by over-expressing

Brn-3a in neuroblastoma cells in the absence of a

differentiation stimulus. This resulted in the cells

activating neuronal specific genes and undergoing

differentiation to a process-bearing cell type (Smith et al,

1997b). Conversely, over-expression of Brn-3b in these

cells prevented neuronal differentiation even in response

to stimuli which would normally induce it (Smith et al,

1997a). Hence, Brn-3a can indeed promote the

differentiation of neuroblastoma cells whereas Brn-3b

opposes this effect and promotes their continued

proliferation.

Interestingly, the ability of full length Brn-3a to

activate neuronal-specific genes and induce differentiation

can be produced by the isolated POU domain, whereas

such effects are not observed with the POU domain of

Brn-3b which differs by only seven amino acids (Smith et

al, 1997b). The critical difference between Brn-3a and

Brn-3b resides at position 22 in the POU-homeodomain

(which is one of the two subdomains of the POU domain).

Thus, altering the valine found at this position in Brn-3a to

the isoleucine found in Brn-3b abolishes its ability to

activate neuronal-specific gene expression and induce

differentiation, whereas the converse change introducing a

valine into Brn-3b allows it to activate neuronal-specific

gene expression and induce differentiation, even though

only a single amino acid has been changed (Dawson et al,

1996; Smith et al, 1997b).

These studies indicate that a small difference

between Brn-3a and Brn-3b allows Brn-3a to act as an

inducer of differentiation in neuroblastoma cells, whereas

Brn-3b opposes this effect.

Although these findings were based on in vitro

studies of a rodent cell line, they have recently been

extended to a human neuroblastoma cell line using both in

vitro and in vivo techniques. Thus, overexpression of Brn-

3b in a human neuroblastoma cell line results in its

enhanced proliferation, whereas inhibition of Brn-3b

expression correspondingly leads to reduced proliferation.

Interestingly, overexpression of Brn-3b also results in the

increased ability of these human neuroblastoma cells to

show anchorage-independent growth in culture, as well as

demonstrating increased invasiveness based on their

ability to migrate through an artificial matrigel basement

membrane (Irshad et al, 2004). Most importantly, these

studies were also extended to the in vivo situation by

showing that the human neuroblastoma cells with

enhanced Brn-3b showed an increased ability to form

tumours when introduced into nude mice compared to

control cells, whereas the cells with reduced Brn-3b

showed a decreased ability to form tumours (Irshad et al,

2004). These results therefore, extend the initial findings

and indicate that Brn-3b appears to be a potent enhancer of

tumour growth and invasiveness

III. Brn-3a and Ewing's sarcomaAs noted above, Collum et al, (1992), observed

expression of Brn-3a (which they referred to as RDC-1) in

Ewing's sarcoma/primitive neuroectodermal tumour cells,

which like neuroblastomas are tumours derived from the

neuroendocrine lineage of neural crest cells (Kovar 1998;

da Alva and Gerald, 2000). These tumours are

characterised by rearrangement of the gene encoding the

EWS regulatory protein to form a fusion protein with a

member of the Ets family of transcription factors with the

resulting fusion protein acting as a strong transcriptional

regulator, which unlike either parental factor can produce

cellular transformation. In 85% of cases, the gene

rearrangement involves the production of a fusion protein

containing the N-terminal part of EWS linked to the C-

terminal portion of the Ets family transcription factor Fli-1

(Arvand and Denny, 2001; Ladanyi, 2002).

In view of the expression of Brn-3a in these tumours,

it is of particular interest that in a yeast two hybrid screen

for proteins which interact with Brn-3a, we isolated the

EWS protein and subsequently showed that Brn-3a can


345

interact with both EWS and its oncogenic derivative EWS-

Fli1 (Thomas and Latchman, 2002).

Most interestingly however, the interaction between

Brn-3a and EWS or EWS-Fli1 has different functional

effects. Thus, interaction of Brn-3a with EWS-Fli1

prevents Brn-3a from activating markers of neuronal

differentiation and inducing neurite outgrowth and also

inhibits its ability to activate the promoter of the p21 cell

cycle arrest gene and to induce cell cycle arrest (Gascoyne

et al, 2004) (Figure 1).

Figure 1 . Effect of EWS or EWS/Fli1 on the ability of Brn-3a to induce the SNAP-25 promoter (panel a), the endogenous SNAP-25

gene (panel b) and neurite outgrowth (panel c). Note the manner in which EWS/Fli1 but not EWS blocks the effect of Brn-3a. In panels

a and c, Brn-3a was introduced by transfection, in panel b endogenous Brn-3a expression was induced with differentiation medium.


346

In contrast, interaction with EWS does not inhibit these

effects of Brn-3a. Hence, the rearrangement which results

in the production of EWS-Fli1 produces a protein which is

able to inhibit the growth arrest and differentiation-

inducing properties of Brn-3a, thereby promoting tumour

cell growth.

Interestingly, Brn-3a in addition to its effect on

differentiation can also activate genes encoding anti-

apoptotic proteins such as Bcl-2 and Bcl-x and

correspondingly protect neuronal cells from apoptosis

(Smith et al, 1998b; Ensor et al, 2001). These effects,

unlike the effects on neuronal differentiation require an

additional N-terminal domain of Brn-3a (Smith et al,

1998a; 2001). Clearly, this anti-apoptotic effect of Brn-3a

has the potential to promote tumour cell survival and may

therefore be antagonistic to the effect inducing tumour cell

differentiation. Indeed, in an early study, Thiel et al,

(1993), reported that Brn-3a could co-operate with the Ras

oncogene to induce oncogenic transformation and that this

effect was dependent upon the presence of the N-terminal

domain.

In this regard, it is therefore of particular interest that

the interaction of Brn-3a with EWS and EWS-Fli1 appears

to affect the anti-apoptotic activity of Brn-3a differently

compared to its differentiation/growth arrest effect. Thus,

EWS but not EWS-Fli1 can prevent the activation of the

Bcl-2 and Bcl-x promoters by Brn-3a and inhibit its anti-

apoptotic effect (Thomas and Latchman, 2002; Gascoyne

et al, 2004).

Hence, the oncogenic rearrangement of EWS to

produce EWS-Fli1 releases the EWS-mediated block on

the anti-apoptotic effect of Brn-3a, thereby promoting

tumour cell survival, whilst simultaneously inhibiting its

growth arrest/differentiation-inducing effect, thereby

promoting tumour growth.

IV. Brn-3b in breast cancerAlthough Brn-3b can also interact with EWS and

EWS-Fli1, this interaction is much weaker than that with

Brn-3a and its functional significance in Ewing's sarcoma

is at present unclear (Gascoyne et al, 2004). Interestingly

however, a role for Brn-3b in breast cancer has been

defined and appears to be similar to that described above

for neuroblastoma.

Thus, human MCF-7 breast cancer cells which have

been engineered to overexpress Brn-3b, exhibit enhanced

proliferation and anchorage-independent growth, whereas

cells engineered to have reduced Brn-3b levels show

reduced growth and anchorage independence (Dennis et

al, 2001). Moreover, overexpression of Brn-3b in MCF-7

cells enhances their responsiveness to oestrogen which is

correspondingly reduced in the cells showing reduced Brn-

3b levels. This is in agreement with previous molecular

analysis which showed that Brn-3b can interact directly

with the oestrogen receptor via a protein-protein

interaction, which results in enhanced transcriptional

activity of the receptor (Budhram-Mahadeo et al, 1998).

These effects on a human breast cancer cell line in

culture are of particular interest since Brn-3b has also been

shown to be overexpressed in human mammary tumour

biopsies compared to its level in normal human mammary

gland tissue (Budhram-Mahadeo et al, 1999). In contrast,

no overexpression of Brn-3a was observed. Moreover,

expression of Brn-3b in the human breast cancer biopsies

correlates inversely with the expression of the BRCA-1

anti-oncogene. This suggests that Brn-3b may repress

expression of the BRCA-1 anti-oncogene in sporadic

cancers, producing the same effect as the mutation of this

anti-oncogene which occurs in inherited breast cancer. In

agreement with this idea, Brn-3b can repress the BRCA-1

promoter in co-transfection experiments (Dennis et al,

2001).

To further probe the way in which Brn-3b can alter

breast cancer cell growth, we also carried out a

transcriptomic/gene chip screen to identify novel genes

whose expression was altered in Brn-3b overexpressing

breast cancer cells compared to cells with reduced

expression. This resulted in the identification of a number

of different genes whose expression is either increased or

decreased in breast cancer cells, when Brn-3b expression

is altered (Samady et al, 2004) (Table 1). Most

interestingly, one of these encodes the cyclin-dependent

kinase 4 (CDK4) which plays a critical role in stimulating

cellular growth. Following the initial identification of

CDK4 as a putative target gene for Brn-3b, we were able

to demonstrate that expression of CDK4 correlates

positively with Brn-3b expression in breast cancer biopsy

material and that Brn-3b can activate the CDK4 promoter

(Samady et al, 2004)

As well as demonstrating that Brn-3b is likely to play

a stimulatory role in breast cancer as well as in

neuroblastoma, these experiments demonstrate the variety

of mechanisms by which Brn-3b may act to achieve this

effect. Thus, it appears that Brn-3b can repress the

expression of the anti-oncogenic protein BRCA-1, whilst

stimulating the transcription of the gene encoding the

growth-promoting CDK4 protein and interacting with the

oestrogen receptor to stimulate its transcriptional

activating ability.

V. Brn-3a in cervical cancerThe studies described so far, have indicated a strong

stimulatory role for Brn-3b in both breast cancer and

neuroblastoma. Conversely, Brn-3a expression is

unchanged in breast cancer and appears to have a

predominantly anti-oncogenic role in both neuroblastoma

and Ewing's sarcoma.

At first sight therefore, it is perhaps surprising that human

cervical biopsies demonstrate a 300-fold elevation in Brn-

3a expression in cervical intra-epithelial neoplasia Type 3

(CIN3) compared to normal biopsies from women with a

normal cervix (Ndisang et al, 1998). In contrast, no

difference is observed between Brn-3b levels in CIN3 and

normal cervix. This paradox is explained by the fact that

Brn-3a but not Brn-3b can activate the upstream

regulatory region of human papilloma viruses Types 16

and 18 (HPV-16 and HPV-18), which controls the

production of the oncogenic E6 and E7 proteins (Morris et

al, 1994).

In agreement with the idea that Brn-3a acts in

cervical cells via stimulating HPV oncogene expression,

overexpression of Brn-3a in cervical cell lines containing


347

HPV enhances their expression of HPV E6 protein,

stimulates their cellular growth and their ability to grow in

an anchorage-independent manner, whereas none of these

effects are observed when Brn-3a is over-expressed in

cervical cell lines which do not contain HPV

genomes(Ndisang et al, 1999). Most importantly, cervical

cells engineered to have reduced levels of Brn-3a not only

exhibit reduced E6 expression and cellular growth in

culture, but also show a decreased ability to form tumours

in nude mice, demonstrating that Brn-3a is important for

tumour growth in vivo (Ndisang et al, 2001).

Table 1. Genes showing altered expression in MCF-7 cells over expressing Brn-3b compared to those with reduced levels

of Brn-3b

Ratio

Up Down Gene

8.3

2.1

1.7

2.3

1.7

2.4

2.0

1.8

3.5

c-jun proto-oncogene; transcription factor AP-1

Interferon-inducible protein 9-27

c-myc oncogene

c-myc binding protein MM-1

cell division protein kinase 4; cyclin-dependent kinase 4 (CDK4);

PSK-J3

cyclin-dependent kinase inhibitor 1 (CDKN1A); melanoma

differentiation-associated protein 6 (MDA6); CDK-interacting protein

1 (CIP1); WAF1

cyclin-dependent kinase regulatory subunit 1 (CKS1)

cdc2-related protein kinase PISSLRE

G1 to S phase transition protein 1 homologue; GTP-binding protein

GST1-HS

1.9

1.7

1.7

1.7

2.1

13.7

4.5

ADP/ATP carrier protein

protein phosphatase 2C gamma

rhoC (H9); small GTPase (rhoC)

B-cell receptor-associated protein (hBAP)

zyxin + zyxin-2

c-jun N-terminal kinase 2 (JNK2); JNK55

junction plakoglobin (JUP); desmoplakin III (DP3)

1.9

2.4

8.0

5.6

8.3

2.0

DNA ligase 1; polydeoxyribonucleotide synthase (ATP) (DNL1)

(LIG1)

tumour necrosis factor type 1 receptor associated protein (TRAP1)

TIS11B protein, EGF response factor (ERF1)

early growth response protein 1 (hEGR1); transcription factor

ETR103; KROX24; zinc finger protein 225; AT225

fuse-binding protein 2 (FBP2)

transcription factor erf-1; AP2 gamma transcription factor

2.0

1.9

2.1

3.4

2.3

integrin beta 4 (ITG84); CD104 antigen

high mobility group protein HMG2

paxillin

alpha 1 catenin (CTNNA1); cadherin-associated protein; alpha E-

catenin

glutathione-S-transferase (GST) homologue

1.8

5.5

2.0

2.0

78-kDa glucose regulated protein precursor (GRP 78);

immunoglobulin heavy chain binding protein (BIP)

cathepsin D precursor (CTSD)

interleukin-1 beta precursor (IL-1; IL1B); catabolin

macrophage migration inhibitory factor (MIF); glycosylation-inhibiting

factor (GIF)

2.6

1.8

2.1

3.9

1.7

1.8

3.5

60S ribosomal protein L5

ornithine decarboxylase

PM5 protein

suppressor for yeast mutant

type 11 cycloskeletal 2 epidermal keratin (KRT2E);cytokeratin 2E

(K2E;CK2E)

glycyl tRNA synthetase

aminoacylase 1 (ACY1)


348

Table 2. Brn-3a and E-6 levels in Pap smears from patients categorised on the basis of the histological diagnosis

Category Count (No =) Percentage Brn-3a

mean value

E-6

mean value

Negative

LGSIL

(HPV-CIN1)

HGSIL

(CIN2-CIN3)

Cancer

74

83

79

2

31%

35%

33%

1%

0.201

0.259

0.438

0.575

0125

0.231

0.358

0.475

Total 238 100% - -

Hence, Brn-3a appears to be of importance as a

cellular factor which is required to stimulate HPV gene

expression and hence produce oncogenic transformation

following initial infection with HPV-16 or HPV-18.

Interestingly, Brn-3a levels are also elevated in biopsies

from women with CIN3 when the biopsy is taken from a

normal region of the cervix (Ndisang et al, 1998; 2000).

This suggests therefore, that Brn-3a is not specifically

elevated in the tumour cells. Rather, it may be elevated in

a subset of women for genetic or environmental reasons

and that such women are at enhanced risk of tumour

formation following initial infection with HPV. This is of

particular importance since the vast majority of women

clear HPV infections and do not progress to tumour

formation.

Although our initial studies on Brn-3a expression

were conducted on cervical biopsies, we have recently

been able to measure Brn-3a in routinely taken cervical

smear samples (Sindos et al, 2003b). As elevated levels of

Brn-3a in the smear correlate with the presence of cervical

abnormality as determined by subsequent histological

analysis (Table 2), its measurement may represent an

additional test which could be used to confirm the results

of cytological examination and determine the need for

further action. Moreover, Brn-3a levels are elevated in

cervical smears from women with persistent minor smear

abnormalities who were subsequently found by

histological examination to have CIN2/3 compared to

those with CIN1 or no abnormality (Sindos et al, 2003a).

This suggests that Brn-3a could be used as a marker for

women who require detailed follow-up in this situation

since they would be predicted to be at enhanced risk of

disease-progression. Hence, as well as playing a critical

role in the development of cervical tumours, Brn-3a may

represent a novel prognostic and diagnostic marker of the

disease.

VI. ConclusionThe studies described above have characterised the

role of Brn-3a and Brn-3b in several different tumours.

They have indicated that Brn-3b plays a stimulatory role in

tumours such as neuroblastoma and breast cancer, whilst

Brn-3a may have an anti-oncogenic role in neuroblastoma

and Ewing's sarcoma but is involved in the development of

cervical cancer, via its ability to activate human papilloma

virus gene expression.

These findings suggest that it would be worthwhile to

investigate the role of Brn-3 factors in other types of

tumour. This is particularly so in view of recent findings

using gene chip analysis which have suggested that Brn-3a

is specifically overexpressed in leukaemias with the

t(8;21) translocation (Schoch et al, 2002; Debernardi et al,

2003). Similarly, it is of interest that the gene encoding

Brn-3b has recently been shown to be activated by the

Wilms' tumour suppressor protein WT-1 (Wagner et al,

2003), whilst Brn-3c has been shown to be overexpressed

in Merkel cell carcinoma (Lennard et al, 2002). The

characterisation of the role of Brn-3a, Brn-3b and Brn-3c

in different types of tumours is likely therefore to require

considerably more effort. It is already clear however, in

the case of Brn-3a and Brn-3b that both these factors play

a critical role in specific types of human cancer where

their expression is altered.

AcknowledgementsI thank the Association for International Cancer

Research, the BBSRC, Cancer Research U.K. and the

Medical Research Council for supporting the work of my

laboratory on Brn-3a and Brn-3b.

ReferencesArvand A, Denny CT (2001) Biology of EWS/ETS fusions in

Ewing's family tumors. Oncogene 20, 5747-54.

Budhram-Mahadeo V, Lillycrop KA, Latchman DS (1995) The

levels of the antagonistic POU family transcription factors

Brn-3a and Brn-3b in neuronal cells are regulated in opposite

directions by serum growth factors. Neurosci Lett 185, 48-

51

Budhram-Mahadeo VS, Ndisang D, Ward T, Weber BL and

Latchman DS (1999) The Brn-3b POU family transcription

factor represses expression of the BRCA-1 anti-oncogene in

breast cancer cells. Oncogene 18, 6684-6691.


349

Budhram-Mahadeo VS, Parker M and Latchman DS (1998) The

POU Domain factors Brn-3a and Brn-3b interact with the

estrogen receptor and differentially regulate transcriptional

activity via an ERE. Mol Cell Biol 18, 1029-1041.

Budhram-Mahadeo VS, Theil T, Morris PJ, Lillycrop KA,

Möröy T and Latchman DS (1994) The DNA target site for

the Brn-3 POU family transcription factors can confer

responsiveness to cyclic AMP and removal of serum in

neuronal cells. Nucleic Acids Res 22, 3092-3098.

Chiarugi V, Del Rosso M and Magnelli L (2002) Brn-3a, a

neuronal transcription factor of the POU gene family,

indications for its involvement in cancer and angiogenesis.

Mol Biotechnol 22, 123-127.

Collum RG, Fisher PE, Datta M, Mellis S, Thiele C, Huebner K,

Croce CM, Israel MA, Theil T, Möröy, T, DePinho R and

Alt FW (1992) A novel POU homeodomain gene specifically

expressed in cells of the developing nervous system. Nucleic

Acids Res 20, 4919-4925.

Dawson SJ, Morris PJ, Latchman DS (1996) A single amino acid

change converts an inhibitory transcription factor into an

activator. J Biol Chem 271, 11631-11633.

de Alava E, Gerald WL (2000) Molecular biology of the Ewing's

sarcoma/Primitive neuroectodermal tumor family. J Clin

Oncol 18, 204-213.

Debernardi S, Lillington DM, Chaplin T, Tomlinson S, Amess J,

Rohatiner A, Lister TA, Young BD (2003) Genome-wide

analysis of acute myeloid leukemia with normal karyotype

reveals a unique pattern of homeobox gene expression

distinct from those with translocation-mediated fusion

events. Genes Chromosomes Cancer 37, 149-158.

Dennis JH, Budhram-Mahadeo V, Latchman DS (2001) The Brn-

3b POU family transcription factor regulates the cellular

growth, proliferation and anchorage dependence of human

breast cancer cells. Oncogene 20, 4961-4971.

Ensor E, Smith MD, Latchman DS (2001) The Brn-3a

transcription factor protects sensory but not sympathetic

neurones from programmed cell death/apoptosis. J Biol

Chem 276, 5204-5212.

Erkman L, McEvilly RJ, Luo L, Ryan AK, Hooshmand F,

O'Connell SM, Keithley EM, Rapaport DH, Ryan AF,

Rosenfeld MG (1996) Role of transcription factors Brn-3.1

and Brn-3.2 in auditory and visual system development.

Nature 381, 603-606..

Gascoyne DM, Thomas GR, Latchman DS (2004) The effects of

Brn-3a on neuronal differentiation and apoptosis are

differentially modulated by EWS and its oncogenic

derivative EWS/Fli-1. Oncogene 23, 3830-3840.

He X, Treacy MN, Simmons DM, Ingraham HA, Swanson LW,

Rosenfeld MG (1989) Expression of a large family of POU-

domain regulatory genes in mammalian brain development.

Nature 340, 35-42.

Herr W, Sturm RA, Clerc RG, Corcoran LM, Baltimore D, Sharp

PA, Ingraham HA, Rosenfeld MG, Finney M, Ruvkun G, et

al (1988) The POU domain, a large conserved region in the

mammalian pit-1 Oct-1 Oct-2 and Caenorhabditis elegans

Unc-86 gene products. Genes Dev 2, 1513-1516.

Irshad S, Pedley RB, Anderson J, Latchman DS, Budhram-

Mahadeo V (2004) The Brn-3b transcription factor regulates

the growth, behaviour and invasiveness of human

neuroblastoma cells in vitro and in vivo . J Biol Chem 279,

21617-21627.

Kovar H (1998) Ewing's sarcoma and peripheral primitive

neuroectodermal tumours after their genetic union. Curr

Opin Oncol 10, 334-342.

Ladanyi M (2002) EWS-FLI1 and Ewing's sarcoma. Cancer

Biol Ther 1, 330-336.

Lakin ND, Morris PJ, Theil T, Sato TN, Moroy T, Wilson MC,

Latchman DS (1995) Regulation of neurite outgrowth and

SNAP-25 gene expression by the Brn-3a transcription factor.

J Biol Chem 270, 15858-15863.

Latchman DS (1999) POU Family transcription factors in the

nervous system. J Cell Physiol 179, 126-133.

Leblond-Francillard M, Picon A, Bertagna X, de Keyzer Y

(1997) High Expression of the POU Factor Brn3a in

Aggressive Neuroendocrine Tumors. J Clin Endocrinol

Metab 82, 89-94.

Leonard JH, Cook AL, Van Gele M, Boyle GM, Inglis KJ,

Speleman F, Sturm RA (2002) Proneural and

proneuroendocrine transcription factor expression in

cutaneous mechanoreceptor (Merkel) cells and Merkel cell

carcinoma. Int J Cancer 101, 103-110.

Lillycrop KA, Budrahan VS, Lakin ND, Terrenghi G, Wood JN,

Polak JM, Latchman DS (1992) A novel POU family

transcription factor is closely related to Brn-3 but has a

distinct expression pattern in neuronal cells. Nucleic Acids

Res 20, 5093-5096.

McEvilly RJ, Erkman L, Luo L, Sawchenko PE, Ryan AF,

Rosenfeld MG (1996) Requirement for Brn-3.0 in

differentiation and survival of sensory and motor neurons.

Nature 384, 574-577.

Morris PJ, Theil T, Ring CJ, Lillycrop KA, Möröy T, Latchman

DS (1994) The opposite and antagonistic effects of the

closely related POU family transcription factors on the

activity of a target promoter are dependent upon differences

in the POU domain. Mol Cell Biol 14, 6907-6914.

Ndisang D, Budhram-Mahadeo V, Latchman DS (1999) The

Brn-3a transcription factor plays a critical role in regulating

HPV gene expression and determining the growth

characteristics of cervical cancer cells. J Biol Chem 274,

28521-28527.

Ndisang D, Budhram-Mahadeo V, Singer A, Latchman DS

(2000) Widespread elevated expression of the HPV-

activating cellular transcription factor Brn-3a in the cervix of

women with CIN3. Clin Sci (Lond) 98, 601-602.

Ndisang D, Budhram-Mahadeo V, Pedley B, Latchman DS

(2001) The Brn-3a transcription factor plays a key role in

regulating the growth of cervical cancer cells in vivo.

Oncogene 20, 4899-4903.

Ndisdang D, Morris PJ, Chapman C, Ho L, Singer A, Latchman

DS (1998) The HPV-activating cellular transcription factor

Brn-3a is overexpressed in CIN3 cervical lesions. J Clin

Invest 101, 1687-1692.

Ninkina NN, Stevens GE, Wood JN, Richardson WD (1993) A

novel Brn3-like POU transcription factor expressed in

subsets of rat sensory and spinal cord neurons. Nucleic Acids

Res 21, 3175-3182.

Ring CJ, Latchman DS (1993) The human Brn-3b POU

transcription factor shows only limited homology to the Brn-

3a/RDC-1 factor outside the conserved POU domain.

Nucleic Acids Res 21, 2946.

Ryan AK and Rosenfeld MG (1997) POU domain family

values,- flexibility, partnerships and developmental codes.

Genes and Development 11, 1207-1225.

Samady L, Dennis J, Budhram-Mahadeo V, Latchman DS (2004)

Activation of CDK4 gene expression in human breast cancer

cells by the Brn-3b POU family transcription factor. Cancer

Biol Ther 3, 317-323.

Schoch C, Kohlmann A, Schnittger S, Brors B, Dugas M,

Mergenthaler S, Kern W, Hiddemann W, Eils R, Haferlach T

(2002) Acute myeloid leukemias with reciprocal

rearrangements can be distinguished by specific gene

expression profiles. Proc Natl Acad Sci U S A. 99, 10008-

10013.

Sindos M, Ndisang D, Pisal N, Chow C, Deery A, Singer A,

Latchman D (2003a) Detection of cervical neoplasia using


350

measurement of Brn-3a in cervical smears with persistent

minor abnormalities. Int J Gynecol Cancer.13, 515-517.

Sindos M, Ndisang D, Pisal N, Chow C, Singer A, Latchman DS

(2003b) Measurement of Brn-3a levels in Pap smears

provides a novel diagnostic marker for the detection of

cervical neoplasia. Gynecol Oncol 90, 366-371.

Smith MD, Latchman DS (1996) The functionally antagonistic

POU family transcription factors Brn-3a and Brn-3b show

opposite changes in expression during the growth arrest and

differentiation of human neuroblastoma cells. Int J Cancer

67, 653-660.

Smith MD, Dawson SJ, Latchman DS (1997a) Inhibition of

neuronal process outgrowth and neuronal specific gene

activation by the Brn-3b transcription factor. J Biol Chem

272, 1382-1388.

Smith MD, Dawson SJ, Latchman DS (1997b) The Brn-3a

transcription factor induces neuronal process outgrowth and

the co-ordinate expression of genes encoding synaptic

proteins. Mol Cell Biol 17, 345-354.

Smith MD, Dawson SJ, Boxer LM, Latchman DS (1998a) The

N-terminal domain unique to the long form of the Brn-3a

transcription factor is essential to protect neuronal cells from

apoptosis and for the activation of Bcl-2 gene expression.

Nucleic Acids Res 26, 4100-4107.

Smith MD, Ensor EA, Coffin RS, Boxer LM, Latchman DS

(1998b) Bcl-2 transcription from the proximal P2 promoter is

activated in neuronal cells by the Brn-3a POU transcription

factor. J Biol Chem 273, 16715-16722.

Smith MD, Melton LA, Ensor EA, Packham G, Anderson P,

Kinloch RA, Latchman DS (2001) Brn-3a activates the

expression of Bcl-X L and promotes neuronal survival in vivo

as well as in vitro. Mol Cell Neurosci. 17, 460-470.

Smith MD, Morris PJ, Dawson SJ, Schwartz ML, Schlaepfer

WW, Latchman DS (1997c) Co-ordinate induction of the

three neurofilament genes by the Brn-3a transcription factor.

J Biol Chem 272, 21325-21333.

Theil T, McLean-Hunter S, Zornig M and Möröy, T (1993)

Mouse Brn-3 family of POU transcription factors, a new

amino terminal domain is crucial for the oncogenic activity

of Brn-3A. Nucleic Acids Res 21, 5921-5929.

Thomas GR, Latchman DS (2002) The pro-oncoprotein EWS

(Ewing's sarcoma protein) interacts with the Brn-3a

transcription factor and inhibits its ability to activate

transcription. Cancer Biol Ther. 1, 428-432.

Verrijzer CP and Van der Vliet PC (1993) POU domain

transcription factors. Biochimica et Biophysica Acta 1173, 1-

21.

Wagner KD, Wagner N, Schley G, Theres H, Scholz H (2003)

The Wilms' tumour suppressor Wt1 encodes a transcriptional

activator of the class IV POU-domain factor Pou4f2 (Brn-

3b). Gene 305, 217-223.

Xiang M, Gan L, Li D, Chen ZY, Zhou L, O'Malley BW Jr,

Klein W, Nathans J (1997) Essential role of POU domain

factor Brn-3c in auditory and vestibular hair cell

development. Proc Natl Acad Sci U S A 94, 9445-9450.

Xiang M, Gan L, Zhou L, Klein WH, Nathans J (1996) Targeted

deletion of the mouse POU domain gene Brn-3a causes a

selective loss of neurons in the brainstem and trigeminal

ganglion, uncoordinated limb movement and impaired

suckling. Proc Natl Acad Sci U S A 93, 11950-11955.

Prof. David S. Latchman


351


Angiogenic gene therapy in the treatment of

ischemic cardiovascular diseasesReview Article

Tamer A. Malik, Cesario Bianchi, Frank W. SellkeBeth Israel Deaconess Medical Center, Boston, MA 02215, USA

__________________________________________________________________________________

*Correspondence: Tamer A. Malik, Beth Israel Deaconess Medical Center, Boston, MA 02215, 330 Brookline Ave, East Campus,

Dana Building, Room 881; Tel: 617-667-1853/617-632-8385; Fax 617-975-5562; Email: [email protected],

[email protected]

Key words: VEGF, FGF, HGF, Retrovirus, Adenovirus, Adeno-associated virus, Plasmids, Liposomes, MRI, AGENT trials, VEGF

trials

Abbreviations: basic fibroblast growth factor, (!-FGF); complementary DNA, (cDNA); coronary artery bypass grafting, (CABG);

coronary artery disease, (CAD); cytomegalovirus, (CMV); electromechanical mapping, (EMM); extracellular matrix, (ECM); fibroblast

growth factor-4, (FGF-4); hepatocyte growth factor, (HGF), herpes simplex virus, (HSV); interventional MRI, (iMRI); kilobases, (kb);

left ventricular, (LV); magnetic resonance imaging, (MRI); percutaneous transmural coronary angioplasty, (PTCA); peripheral vascular

disease, (PAD); human immunodeficiency virus, (HIV); tumor necrosis factor alpha, (TNF-").

Received: 11 June 2004; Accepted: 30 July 2004; electronically published: July 2004

Summary

Encouraging preliminary data suggest that gene therapy may soon be an option for the treatment of patients with

advanced coronary artery disease that is not amenable to conventional treatment. A critical consideration in

developing cardiovascular gene transfer as a therapy is the ability to deliver the vector, viral or plasmid, to the

desired tissue in a safe fashion. Attempts at developing non-viral direct DNA therapy delivered through the

intravenous route are currently underway and with the use of advanced technology the possibility of making gene

therapy a simple outpatient procedure does not seem out of the realm of possibility. Several clinical trials are

currently underway that should help characterize the risk–benefit profile of various products, the optimal dose that

should be administered, and the patient population likely to derive greatest benefit.

I. IntroductionGene therapy is most often defined as the transfer of

nucleic materials to the somatic cells of an individual to

elicit a beneficial therapeutic effect. A transferred gene

can be targeted to specific tissues, organs or to the entire

body. The potential advantage of gene therapy over drug

administration is the single administration with long

lasting beneficial results and minimal systemic toxicity.

There are a couple of techniques that need to be developed

for the success of gene therapy namely; the isolation and

cloning of the desired therapeutic genes, the vectors which

are the vehicle for these genes and finally delivery of gene

to target tissues. The proposed mechanisms of action of

gene therapy are replacement of non-functional genes with

functional counterparts, correction of a defective gene,

enhancement of normal gene expression and restriction of

the expression of certain genes (Clowes et al, 1997).

The two types of gene delivery for therapy are the ex

vivo where the cells to be transfected by the gene are

cultured outside the body under a controlled environment

and then re-introduced back into the body and the in vivo

where the genetic material is directly delivered into the

body affecting the desired the cells. Gene therapy is

evolving as a new therapeutic alternative for the treatment

of patients with advanced coronary artery disease (CAD)

not amenable to bypass surgery or catheter based

interventions.

II. Development of vectorsThe transfer of plain DNA known as “naked” DNA

directly into the body has yielded less than satisfactory

results owing to the fact that only a small fraction of

transferred DNA enters the cell and once inside is

subjected to destruction by the cytoplasmic enzymes.

Therefore, mechanisms of facilitating DNA entry into

cells were developed, namely through the use of vectors,

which are vehicles carrying the genetic material to the

target tissues or cells. The ideal vector would be the one

that delivers genetic material efficiently to target tissue

producing the desired level of gene expression with

minimal systemic and local adverse effects and for the

specified duration of time. To fit all these characteristics in

one vector is challenging and has not been completely

successful. The vectors used in cardiovascular gene

Malik et al: Angiogenic gene therapy for ischemic cardiovascular diseases

352

therapy, as well as gene therapies directed at other

diseases, include viral vectors, such as retroviruses,

adenoviruses and adeno-associated viruses, and nonviral

vectors, such as polymers, cationic liposomes, and

liposome-viral conjugates. In order to develop clinical

gene therapy strategies, a clear understanding of the

advantages and shortcomings of current vector systems is

mandatory (Zuckerbraun et al, 2002) (Figure 1).

A. Viral vectors

For delivery of the genetic load into cells, viral

vectors first must attach to the cell membrane through

binding proteins, then fuse with the cell membrane

injecting their genetic material into the cytoplasm. The

viruses’ capability to replicate in the host cell is annulled

by removing certain genes and replacing them with the

desired genes to be incorporated into the host’s genome.

1. Retrovirus

This is a class of viruses that have a lipid envelope

containing a single stranded RNA genome. Once the virus

transfects a cell and enters the cytoplasm, the viral genome

is reverse transcribed into double stranded DNA, which

integrates into the host genome [called complementary

DNA (cDNA)] and is further expressed as proteins

(Figure 2, 3).

Figure 1. The vector gets internalized into the cell and releases its nucleic acids (containing transgene). The nucleic acids are

translocated into the nucleus, where they may remain distinct or become incorporated into the host DNA. Vector (transgene) messenger

RNA (mRNA) is transcribed in the nucleus then translated by ribosomal complexes in the cytoplasm to yield the final transgene protein

product. It is the over expression of this protein that is intended to be of therapeutic value. Reproduced from Zuckerbraun and Tzeng,

2002 with kind permission from Archives of Surgery.

Figure 2. From The Online Biology

Book hosted by Estrella Mountain

Community College Website, in

Sunny Avondale, Arizona: Biological

Diversity: Viruses (revised 6/18/01).


353

The viral genome is approximately 10 kilobases (kb),

containing mainly these three genes: gag (coding for core

proteins), pol (coding for reverse transcriptase) and env

(coding for the viral envelope protein), which are replaced

with the transgene of interest (Figure 3) (Nabel, 1989,

1990). Retroviruses have the advantage of longer periods

of gene expression with relatively minimal stimulation of

the immune system and no local inflammatory reactions.

But they attack only proliferating cells with a large

variety of cells as a target, which explains why they can’t

be used in in-vivo gene therapy. If the viruses are

delivered directly into the body they will be neutralized

immediately by the complement system and also the

desired target cells are not necessarily in the proliferation

phase. The cells desired to undergo the genetic

modification are removed from the body and are cultured

under controlled conditions then re-transplanted into the

body after being transfected by the virus. The retrovirus

genome is easily manipulated and replication-deficient

retroviruses can hold large transgenes, measuring up to 8

kb (Figure 3). Retroviruses theoretically can cause genetic

mutations due to the incorporation of an unfamiliar genetic

material in the cell’s genome. Major limitations to the use

of retroviruses are their low titers (number of virus

particles proportional to the gene transfer efficiency) but

the development of new retroviruses increased the virus

titers with more efficient gene transfer (Weiss et al, 1984;

Flugelman et al, 1992). Transfecting endothelial cells with

retroviruses to be implanted into vascular stents, grafts or

injured arteries for a desired therapeutic effect have been

studied.

Lentiviruses are a class of retrovirus but unlike

retroviruses they can infect non-proliferating, terminally

differentiated cells. These advantages of stable gene

expression in non-dividing cells with minimal

immunogenicity could be promising for gene therapy in

the cardiovascular system. The human immunodeficiency

virus (HIV) is a member of this family and, as may be

expected, there are some concerns about the possible

mutation of these recombinant viruses back to a

pathogenic phenotype. The use of lentiviruses for gene

therapy is on the horizon, and they may be the preferred

vectors of the future.

2. AdenovirusesAdenoviruses are non-enveloped viruses with

double-stranded DNA genomes that cause respiratory,

intestinal, and eye infections in humans. The virus that

causes the common cold is an adenovirus. The virion is

spherical and about 70 to 90 nm in size. The genome

encodes about thirty proteins and both strands of the DNA

encode genes. Some regions of the DNA have to be

removed in order to render the virus non-proliferative

(Figure 4).

Adenoviruses do not incorporate in the host’s

genome thereby do not cause mutations. This also explains

its short duration of action which is usually for 1 or 2

weeks added to the fact that most people in their lifetime

have had a natural adenovirus infection thereby evoking

an immune response, both at the cellular and humoral

levels, against future encounters with the virus. This short

duration of action could be seen as a shortcoming in the

treatment of chronic diseases and an advantage in the

treatment of diseases where a temporary action is required.

Figure 3. From the Department of Microbiology & Immunology, University of Leicester, UK. MBChB Special Study Module Project

Report about Virus Vectors & Gene Therapy Problems, Promises & Prospects by David Peel 1998


359

Mack CA, Patel SR, Schwarz EA, et al. (1998) Biologic bypass

with the use of adenovirus-mediated gene transfer of the

complementary deoxyribonucleic acid for vascular

endothelial growth factor 121 improves myocardial perfusion

and function in the ischemic porcine heart. J Thorac

Cardiovasc Surg 115, 168-176.

Morishita R, Gibbons GH, Ellison KE, et al. (1994) Intimal

hyperplasia after vascular injury is inhibited by antisense

CDK 2 kinase oligonucleotides. J Clin Invest. 93, 1458-

1464.

Nabel EG, Nabel GJ. (1999) Genetic therapies for cardiovascular

disease. In, Topol EJ, ed. Textbook of Interventional

Cardiology. 3rd ed. Philadelphia, Pa, WB Saunders Co.

Nabel EG, Plautz G, Boyce FM, Stanley JC, Nabel GJ. (1989)

Recombinant gene expression in vivo within endothelial cells

of the arterial wall. Science 244, 1342-1344.

Nabel EG, Plautz G, Nabel GJ. (1990) Site-specific gene

expression in vivo by direct gene transfer into the arterial

wall. Science. 249, 1285-1288.

Rosengart TK, Lee LY, Patel SR, et al. (1999a) Angiogenesis

gene therapy, phase I assessment of direct intramyocardial

administration of an adenovirus vector expressing VEGF121

cDNA to individuals with clinically significant severe

coronary artery disease. Circulation 100, 468-474.

Rosengart TK, Lee LY, Patel SR, et al. (1999b) Six-month

assessment of a phase I trial of angiogenic gene therapy for

the treatment of coronary artery disease using direct

intramyocardial administration of an adenovirus vector

expressing the VEGF121 cDNA. Ann Surg 230, 466-470.

Ruel M, Sellke FW. (2003) Angiogenic protein therapy. Semin

Thorac Cardiovasc Surg Jul 15, 222-35.

Schiedner G, Morral N, Parks RJ, et al. (1998) Genomic DNA

transfer with a high-capacity adenovirus vector results in

improved in vivo gene expression and decreased toxicity.

Nat Genet 18, 180-183.

Sellke FW, Ruel M, (2003) Vascular growth factors and

angiogenesis in cardiac surgery. Ann Thorac Surg 75,

S685-90.

Sleight P (2003) Current options in the management of coronary

artery disease. Am J Cardiol 92, 4N-8N.

Summerford C, Samulski RJ. (1998) Membrane-associated

heparan sulfate proteoglycan is a receptor for adeno-

associated virus type 2 virions. J Virol 72, 1438-1445.

Taniyama Y, Morishita R, Aoki M et al. (2002) Angiogenic and

antifibrotic action of hepatocyte growth factor in

cardiomyopathy. Hypertension 40, 47-53.

Ueda H, Sawa Y, Matsumoto K, et al. (1999) Gene transfection

of hepatocyte growth factor attenuates reperfusion injury in

the heart. Ann Thorac Surg 67, 1726-1731.

Vale PR, Losordo DW, Milliken CE, et al. (2000) Left

ventricular electromechanical mapping to assess efficacy of

phVEGF165 gene transfer for therapeutic angiogenesis in

chronic myocardial ischemia. Circulation 102, 965-974.

Von der Leyen HE, Gibbons GH, Morishita R, et al. (1995) Gene

therapy inhibiting neointimal vascular lesion, in vivo transfer

of endothelial cell nitric oxide synthase gene. Proc Natl

Acad Sci U S A. 92, 1137-1141.

Weiss RA, Teich NM, Varmus HE, Coffin JM, eds. RNA Tumor

Viruses. Cold Spring Harbor, NY, Cold Spring Harbor

Laboratory Press 1984. Cold Spring Harbor Monograph

Series 10C, pt 1.

Wolf C, Cai WJ, Vosschulte R, Koltai S, Mousavipour D, Scholz

D, Afsah-Hedjri A, Schaper W, Schaper J. (1998) Vascular

remodeling and altered protein expression during growth of

coronary collateral arteries. J Mol Cell Cardiol 30, 2291-

2305


360


354

Figure 4. Adenoviruses are non-enveloped icosahedral particles.

The capsid is built up from 252 capsomers of which 240 are

hexavalent and 12 (situated at the apices) are pentavalent. From

the Department of Medical Microbiology Website, University of

Cape Town, written by Linda M Stannard, 1995. Virus Ultra

Structure

Unlike retroviruses, adenoviruses can be used in in

vivo, infecting replicating and non-replicating cells

equally. They also have high transduction efficiencies with

high levels of gene expression (Horwitz, 1990; Clemens et

al, 1996). Adenoviruses induce a local inflammatory

response and have a large complex genome making it

difficult to manipulate (Kochanek et al, 1996; Schiedner et

al, 1998).

So several strategies have been developed to improve

the use of adenoviruses, and researchers are creating what

is called a “gutless” adenovirus that is devoid of all its

native genetic material. It has been shown that this new

virus causes less stimulation of the immune system with a

longer duration of action and the ability to use larger

transgenes (Kibbe et al, 2000; Fisher et al, 2001).

3. Adeno-associated viruses (AAVs)These are small DNA viruses that integrate

successfully in one spot of the host’s genome (on

chromosome 19 in humans). They can’t replicate by

themselves and therefore require a helper virus, either

adenovirus or herpes virus. Also they are non-pathogenic

in humans, do not cause mutations and once integrated are

stable leading to long term genetic expression which

makes AAV an attractive tool for the management of

chronic diseases from single gene mutation as well as

acquired disorders, such as atherosclerosis (Summerford

and Samulski, 1998). Other advantages of AAVs are that

proliferating cells are not a requirement for transfection, it

is relatively non-immunogenic, and the genome is small

and easy to manipulate. A disadvantage of the small AAV

genome is that the transferred genetic material is limited in

size to a maximum of 4.9kb. It is challenging to produce

this vector in large amounts without delivering an equally

large amount of the contaminating helper virus. These

problems with AAV production will soon be overcome,

and it is becoming a very attractive vector for human gene

therapy (Cheung et al, 1980; Jolly, 1994) (Figure 5).

4. OthersSeveral others viruses have been used experimentally

for gene transfer namely; Herpes Simplex Virus (HSV),

Pertussis Virus, Cytomegalovirus (CMV).

B. Non viral vectorsA plasmid is an autonomous, circular, self-replicating

and an extra-chromosomal DNA molecule that carries

only a few genes and has a single origin of replication.

Some plasmids can be inserted into a bacterial

chromosome, where they become a permanent part of the

bacterial genome. The number of plasmids in a cell

generally remains constant from generation to generation.

It is here that they provide great functionality in molecular

science.

Plasmids are easy to manipulate and isolate using

bacteria. They can be integrated into mammalian genomes,

thereby conferring to mammalian cells whatever genetic

functionality they carry. Thus, we can have the ability to

introduce genes into a given organism by using bacteria to

amplify the hybrid genes that are created in vitro. This tiny

but mighty plasmid molecule is the basis of recombinant

DNA technology.

They were originally discovered by their ability to

transfer antibiotic-resistance genes between bacteria, so to

make plasmids useful these regions of antibiotic resistance

had to be removed and replaced with recombinant genes

(Feldman and Steg, 1997). Methods to deliver gene-

carrying plasmids to mammalian cells for gene therapy

include direct microinjection, liposomes, calcium

phosphate, electroporation, or DNA-coated particle

bombardment.

Liposomes are microscopic artificial vesicles,

spherical in shape that can be produced from natural

nontoxic phospholipids and cholesterol. When mixed in

water under low shear conditions, the phospholipids

arrange themselves in sheets, the molecules aligning side

by side in like orientation, "heads" up and "tails" down

(Figure 6). These sheets then join tails-to-tails to form a

bilayer membrane enclosing some of the water in that

phospholipid sphere. The vesicles can be loaded with a

great variety of molecules, such as small drug molecules,

proteins, nucleotides and even plasmids.

The simplicity of the liposome preparation and lack

of disease transmission associated with viral vectors

combined with the ease of plasmid construction make

liposomes the most common form of non-viral gene

transfer. The genetic material transferred by the liposome

will enter the nucleus but will not incorporate into the

cell’s genome except for a very small amount. However

some of its shortcomings are its use only in in vitro due to

the instability of this complex (liposome-plasmid DNA) in

the circulation, gene expression is for a short duration and

the efficiency of gene transfer is low (Morishita et al,

1994). Transfection efficiencies vary with DNA/liposome

ratio, cell type, and the proliferation status of cells. (Dzau

et al, 1996; Armeanu et al, 2000). The non-selectivity of

these liposomes has been partially overcome by the

insertion of surface markers that attach to specific cell

surface receptors (Von der Leyen et al, 1995).


355

Figure 5. From the Avigen Company Website. 2001. DNA should be single stranded.

Figure 6 . A liposome with showing the lipid bilayer with water

inside. From the Collaborative Laboratories Website. Liposomes,

controlled delivery systems. Updated April 22nd 2004.

III. New techniques for administering

gene-based therapy and assessment of

heart functionOne of the important considerations in developing

cardiovascular gene transfer as a therapy is the ability to

deliver the vector, viral or plasmid, to the desired tissue in

a safe fashion. This is not a problem in peripheral vessels

but proves to be quite a challenge in the coronary arteries

(Nabel EG and Nabel GJ, 1999). In the peripheral vessels,

adequate exposure at the time of surgery makes gene

transfer feasible and also these vessels tolerate long

periods of ischemia without serious consequences. In

contrast, in the coronary bed, we must be able to access

the lesion and occlude the vessel for an adequate amount

of time to allow vector attachment and uptake without

significantly compromising myocardial perfusion (Bailey,

1996) (Figure 7).

In angiogenesis direct intramuscular injection of the

desired vector into ischemic tissues, such as skeletal

muscle or myocardium, allows local angiogenic factor

expression to stimulate collateral blood vessel

development (Baumgartner et al, 1998; Mack et al, 1998;

Rosengart et al, 1999a). Researchers have modified this by

injecting microspheres coupled to plasmids or growth

factors that in turn can allow for slow release of the

recombinant material into the surrounding tissue. (Arras et

al, 1998).

Figure 7. From the Arizona Heart Institute Research Website.

2000-2001


356

A. Magnetic resonance imaging (MRI)MRI has evolved as a new non-invasive tool of

accurately measuring and quantifying myocardial function

and perfusion. The distinct advantages of MRI over

current conventional nuclear-based cardiac imaging

techniques, such as PET or myocardial scintigraphy,

include its spatial resolution and lack of exposure of the

patient to ionizing radiation. Also, quantification of

cardiac morphology and function by MRI is more accurate

and image quality is more reproducible than

echocardiography, independent of the operator’s skills and

experience or each patient’s individual anatomy

(Lederman et al, 2002).

The new interventional MRI (iMRI) provides a real-

time guidance for gene and cell delivery into the heart in

addition to being a reliable tool in assessing the ventricular

remodeling after myocardial infarction (Barbash et al,

2004).

B. Electro-mechanical mappingLeft ventricular (LV) electromechanical mapping

(EMM) can be used to distinguish among infarcted,

ischemic, and normal myocardium. This system uses

electromagnetic field sensors to combine and integrate

real-time information from percutaneous intracardiac

electrograms acquired at multiple endocardial locations.

The resulting interrogations can be used to distinguish

between infarcted and normal myocardium (Gepstein et al,

1998) and thus permit online assessment of myocardial

function and viability (Kornowski et al, 1998). This could

be used as a tool for assessing the effects of gene delivery

in restoring the myocardial function after an infarct.

IV. Angiogenesis and gene therapyFor gene therapy to be successful in angiogenesis, the

gene selected should code for a protein with a proven

angiogenic activity, the vector used should provide high

gene-transfer efficiency, the delivery technique should

target the desired ischemic tissues and the procedure

should be safe both in the long term and short term.

A. Process of new blood vessel formationA couple of trials have been done using gene therapy

in angiogenesis with some promising results. Three

different processes (vasculogenesis, arteriogenesis and

angiogenesis) contribute to the growth of blood vessels.

Vasculogenesis is the primary process responsible for

growth of new vasculature during embryonic development

and it is characterized by the differentiation of pluripotent

endothelial cell precursors into endothelial cells that

subsequently form primitive blood vessels (Bussolino et

al, 1997). Arteriogenesis is the growth of collateral arteries

that possess a fully developed tunica media or the

enlargement of existing blood vessels that is seen in adult

vessels. Recruited monocytes transform into macrophages,

which produce numerous cytokines and growth factors

(including tumor necrosis factor alpha (TNF-"), and basic

fibroblast growth factor (b-FGF) involved in

arteriogenesis (Wolf et al, 1998). These proteins stimulate

remodeling and dilatation of arterioles leading to the

development of functional collaterals. Angiogenesis is a

process that also occurs in adult tissues whereby new

capillaries develop from preexisting vasculature. It is a

dynamic, multi-step process and requires interaction of a

variety of cells which involves retraction of pericytes from

the surface of the capillary, release of proteases from the

activated endothelial cells by VEGF family proteins,

degradation of the extracellular matrix (ECM) surrounding

the pre-existing vessels, endothelial migration towards an

angiogenic stimulus and their proliferation, formation of

tube-like structures, fusion of the formed vessels and

initiation of blood flow. Matrix degradation and

endothelial and smooth muscle cell/pericyte migration are

modulated by interplay of numerous factors, including

plasminogen activators, matrix metalloproteinases and

their inhibitors. There are multiple additional regulators of

endothelial and smooth muscle cell proliferation that are

also important components of the angiogenic process

(Ruel and Sellke, 2003). Initial trials with gene therapy

using adenovirus have used a replication-deficient virus,

serotype 5 (Ad5) in which the E1A and E1B genes have

been removed and replaced with fibroblast growth factor-4

(FGF-4) may be promising.

B. Regulation of angiogenesisAngiogenesis is held delicately in a balance, well

orchestrated by the interplay of many cells and controlled

by both positive and negative regulators. In the body,

angiogenesis is controlled through a series of "on" and

"off" switches. The "on" switches are angiogenesis-

stimulating factors, and the "off" switches are

angiogenesis-inhibiting factors. There are more than 20

known angiogenic growth factors, and 30 known

angiogenic inhibitors. Under normal physiological

conditions, angiogenesis is "turned off" because there is

more production of inhibitors than stimulators. But, this

balance is a double-edged sword. Improper regulation of

stimulators and inhibitors contributes to more than 70

pathological conditions such as tumor growth, rheumatoid

arthritis, psoriasis, and diabetes mellitus (Sellke and Ruel,

2003). VEGF is the most widely studied and used factor

for therapeutic angiogenesis. Several studies have been

done where VEGF was directly delivered to a patient’s leg

with known peripheral vascular disease (PAD) in the area

surrounding a diseased artery. Within a few days,

stimulation of the growth of new blood vessels around the

blockage in the ailing blood vessel was found and this

obviated the need for an amputation. Improved myocardial

perfusion and function after the administration of

angiogenic growth factors has been demonstrated in

animal models of chronic myocardial ischemia. A recent

clinical study reported beneficial long-term effects of

therapeutic angiogenesis using FGF-2 protein in terms of

freedom from angina and improved myocardial perfusion

on nuclear imaging (Ruel and Sellke, 2003). For

successful angiogenesis in ischemic heart disease and

PAD, a sustained but transient expression of growth

factors is required, which makes gene therapy a particular

attractive therapeutic option.


357

V. Gene therapy trialsA. FGF trialsInitial pre-clinical trials using animal models of

chronic myocardial ischemia have shown that adenovirus-

5 with a gene coding for fibroblast growth factor-4

(Ad5FGF-4) delivery into coronary vessel reverses

myocardial dysfunction and increases blood flow with a

sustained response of approximately 2-3 months. This

ultimately led to the initiation of the multi-center clinical

trials known as the AGENT trials.

1. AGENT and AGENT 2 trialsThis was the first multi-center US clinical,

randomized, double-blinded, placebo-controlled trial using

Ad5-FGF4 for the treatment through the stimulation of

angiogenesis of myocardial ischemia.

The main focus of this trial was safety of intra-

coronary route for gene delivery. Patients with chronic

stable angina were given incremental doses of ad5fgf-4 to

know the optimum dose for use in future trials. It was not

powered to evaluate the dose response or the efficacy.

Both the treatment and placebo groups were well matched

in terms of disease characteristics. Results showed that

administration of ad5fgf-4 by intra-coronary route is safe

and well tolerated and patients had a significant increase in

their exercise tolerance when compared to placebo

suggesting an improvement in myocardial dysfunction

(Grines et al, 2002).

AGENT 2 was designed to evaluate the potential of

Ad5FGF-4 in promoting new blood formation thus

reversing the ischemic insult and to reassess its safety

(Grines et al, 2003).

Seventy-nine were included in the first and 52

patients in the second trial. Patients who received

Ad5FGF-4 experienced complete resolution of symptoms

(30% vs. 13%) and less usage of medications to relieve

their angina (43% vs. 17%) when compared to patients

who received placebo. In addition, the incidence of

worsening/unstable angina and revascularization by

coronary artery bypass grafting or angioplasty was

considerably lower in the Ad5FGF-4 group (6% and 6%,

respectively) compared with those in the placebo group

(24% and 16%, respectively). But some of these results

did not reach a statistical significance (Data on file, Berlex

Laboratories, 1998 Report No. A02854, 2000 Report No.

A02856).

2. AGENT 3 and AGENT 4 trialsThe results from the first two AGENT trials have

provided preliminary encouraging data about the safety

and anti-ischemic effects of Ad5FGF-4. Larger, long-term

trials that could evaluate better the potential risks, benefits

and complications looking into the short- and long-term

safety and efficacy parameters were needed.

AGENT 3 and AGENT 4 are 2 ongoing double-blind,

placebo-controlled trials with AGENT 3 is being

conducted exclusively in the United States, whereas

AGENT 4 is a multinational study (Europe, Canada,

United States, and Latin America). Each trial will recruit

450 patients (150 patients each on low-dose Ad5FGF-4,

high-dose Ad5FGF-4, and placebo) from centers with

expertise in multiple vessel percutaneous revascularization

procedures (Data on file, Berlex Laboratories, 2000 Report

No. A02858) and patients will be followed clinically for

up to 5 years and tracked for a further 10 years (Grines et

al, 2003).

Other potential areas for investigation include the use

of Ad5FGF-4 as an adjunct to angioplasty, as well as the

value of repeated administration of Ad5FGF-4 (Grines et

al, 2003).

B. VEGF trialsIn one of the first human clinical trials, patients with

ischemic heart disease were injected with naked plasmid

encoding for VEGF directly into diseased myocardium

and results showed marked improvement in blood flow

and with reduction of symptoms related to ischemia

(Losordo et al, 1998; Vale et al, 2000).

In a more recent trial, patients (n=13) with

symptomatic disease in spite of being treated with

conventional modalities of therapy [medications,

percutaneous transmural coronary angioplasty (PTCA) and

/or coronary artery bypass grafting (CABG)] demonstrated

significant reduction in infarct size after direct myocardial

injection of phVEGF165 measured by serial single-photon

emission CT-sestamibi imaging (Lathi et al, 2001).

Also patients with advanced CAD (class 3 or 4

angina) receiving naked DNA-encoding VEGF165

through direct myocardial injection reported to experience

reduced angina and sublingual nitroglycerin consumption

and this improvement was maintained throughout a whole

year of follow-up measured at different time points (Lathi

et al, 2001; Fortuin et al, 2003). Following this success, a

phase I study using intramuscular injection of adenoviral

vector of VEGF121 gene demonstrated clinical safety with

no evidence of systemic or cardiac related adverse effects

related to the vector (Rosengart et al, 1999a; Hedman et al,

2003).

Using the intra-coronary route for gene delivery

encoding for VEGF165 produced promising results with

significant increase in myocardial perfusion although no

differences in clinical restenosis rate or minimal lumen

diameter were present after the 6-month follow-up (Aoki

et al, 2000).

C. HGF trialsAnother angiogenic factor that looks promising is

hepatocyte growth factor (HGF), which was reported to

promote angiogenesis in animal models of myocardial

infarction (Ueda et al, 1999).

HGF has been found to inhibit collagen synthesis and

through different mechanisms stimulate its degradation

and this interesting function can be used as a tool in the

treatment of post myocardial infarction fibrotic

cardiomyopathy (Taniyama et al, 2002).

VI. ConclusionEncouraging preliminary data suggest the possible

use of gene therapy in the treatment of advanced coronary


358

artery disease that is not amenable to conventional

treatment options (Dzau et al, 2003; Sleight, 2003).

Indeed, larger-scale, clinical trials are currently

underway at centers throughout the world. These trials will

characterize further the risk–benefit profile of various

products, the optimal dose that should be administered,

and the patient population likely to derive greatest benefit

(Dzau, 2003).

Attempts at developing non-viral direct DNA therapy

delivered through the intravenous route are currently

underway and with the use of advanced technology the

possibility of making gene therapy a simple outpatient

procedure does not seem remote.

ReferencesAoki M, Morishita R, Taniyama Y, et al. (2000) Angiogenesis

induced by hepatocyte growth factor in non-infarcted

myocardium and infarcted myocardium, up-regulation of

essential transcription factor for angiogenesis, ets. Gene

Ther 7, 417-427.

Armeanu S, Pelisek J, Krausz E, et al. (2000) Optimization of

nonviral gene transfer of vascular smooth muscle cells in

vitro and in vivo. Mol Ther 1, 366-375.

Arras M, Mollnau H, Strasser R, et al. (1998) The delivery of

angiogenic factors to the heart by microsphere therapy. Nat

Biotechnol 16, 159-162.

Bailey SR. (1996) Mechanisms of delivery and local drug

delivery technologies. Semin Interv Cardiol 1, 17-23.

Barbash IM, Leor J, Feinberg MS, et al. (2004) Interventional

magnetic resonance imaging for guiding gene and cell

transfer in the heart. Heart 90, 87-91.

Baumgartner I, Pieczek A, Manor O, et al. (1998) Constitutive

expression of phVEGF165 after intramuscular gene transfer

promotes collateral vessel development in patients with

critical limb ischemia. Circulation 97, 1114-1123.

Bussolino F, Mantovani A, Persico G. (1997) Molecular

mechanisms of blood vessel formation. trends Biochem Sci

22, 251-256

Cheung AK, Hoggan MD, Hauswirth WW, Berns KI. (1980)

Integration of the adeno-associated virus genome into

cellular DNA in latently infected human Detroit 6 cells. J

Virol 33, 739-748.

Clemens PR, Kochanek S, Sunada Y, et al. (1996) In vivo muscle

gene transfer of full-length dystrophin with an adenoviral

vector that lacks all viral genes. Gene Ther 3, 965-972.

Clowes WA (1997) Vascular Gene Therapy in the 21st Century.

Thromb Haemost 78, 605-610

Data on file, Berlex Laboratories, (1998) Report No. A02854

(Ad5FGF-4 dose-response study in ameroid pig)


(Chronic efficacy study following single administration of

Ad5FGF-4.)


(Effect of high anti-Ad5 antibody titer on the efficacy

ofAd5FGF-4 in an ameroid model of myocardial ischemia)


(Systemic toxicology, distribution and expression following

intracoronary or left ventricular administration of Ad5FGF-4

in swine)

Dzau VJ, Beatt K, Pompilio G, Smith K. (2003) Current

perceptions of cardiovascular gene therapy. Am J Cardiol

92, 18N-23N

Dzau VJ, Mann MJ, Morishita R, Kaneda Y. (1996) Fusigenic

viral liposome for gene therapy in cardiovascular diseases.

Proc Natl Acad Sci U S A. 93, 11421-11425.

Dzau VJ. (2003) Predicting the future of human gene therapy for

cardiovascular diseases, what will the management of

coronary artery disease be like in 2005 and 2010? Am J

Cardiol 92, 32n-35n.

Feldman LJ, Steg G. (1997) Optimal techniques for arterial gene

transfer. Cardiovasc Res. 35, 391-404.

Fisher KD, Stallwood Y, Green NK, Ulbrich K, Mautner V,

Seymour LW. (2001) Polymer-coated adenovirus permits

efficient retargeting and evades neutralising antibodies. Gene

Ther. 8, 341-348.

Flugelman MY, Jaklitsch MT, Newman KD, Casscells W,

Bratthauer GL, Dichek DA. (1992) Low level in vivo gene

transfer into the arterial wall through a perforated balloon

catheter. Circulation. 85, 1110-1117.

Fortuin FD, Vale P, Losordo DW, et al. (2003) One-year follow-

up of direct myocardial gene transfer of vascular endothelial

growth factor-2 using naked plasmid deoxyribonucleic acid

by way of thoracotomy in no-option patients. Am J Cardiol

92, 436-439.

Gepstein L, Goldin A, Lessick J, et al. (1998) Electromechanical

characterization of chronic myocardial infarction in the

canine coronary occlusion model. Circulation 98, 2055-

2064.

Grines C, Watkins M, Mahmarian J, Iskandrian A, Rade J,

Marrott P, Pratt C, Kleiman N. (2003) A randomized double

blind placebo-controlled trial of Ad5FGF-4 gene therapy and

its effect on myocardial perfusion in patients with stable

angina. J Am Coll Cardiol 42, 1339-1347.

Grines CL, Watkins MW, Helmer G, Penny W, Brinker J,

Marmur JD, West A, Rade JJ, Marrott P, Hammond HK,

Engler RL. (2002) Angiogenic Gene Therapy (AGENT) trial

in patients with stable angina pectoris. Circulation 105,

1291-1297.

Hedman M, Hartikainen J, Syvanne M, et al. (2003) Safety and

feasibility of catheter-based local intracoronary vascular

endothelial growth factor gene transfer in the prevention of

postangioplasty and in-stent restenosis and in the treatment

of chronic myocardial ischemia, phase II results of the

Kuopio Angiogenesis Trial (KAT). Circulation 107, 2677-

2683.

Horwitz M. (1990) The adenoviruses. In, Fields BN, Knipe DM,

eds. Virology. New York, NY, Raven Press, 1723.

Jolly D. (1994) Viral vector systems for gene therapy. Cancer

Gene Ther. 1, 51-64.

Kibbe MR, Murdock A, Wickham T, et al. (2000) Optimizing

cardiovascular gene therapy, increased vascular gene transfer

with modified adenoviral vectors. Arch Surg 135, 191-197.

Kochanek S, Clemens PR, Mitani K, Chen HH, Chan S, Caskey

CT (1996) A new adenoviral vector, replacement of all viral

coding sequences with 28 kb of DNA independently

expressing both full-length dystrophin and beta-

galactosidase. Proc Natl Acad Sci U S A 93, 5731-5736.

Kornowski R, Hong MK, Leon MB. (1998) Comparison between

left ventricular electromechanical mapping and radionuclide

perfusion imaging for detection of myocardial viability.

Circulation 98, 1837-1841.

Lathi KG, Vale PR, Losordo DW, et al. (2001) Gene therapy

with vascular endothelial growth factor for inoperable

coronary artery disease, anesthetic management and results.

Anesth Analg 92, 19-25.

Lederman RJ, Guttman MA, Peters DC, et al. (2002) Catheter-

based endomyocardial injection with real-time magnetic

resonance imaging. Circulation 105, 1282-4.

Losordo DW, Vale PR, Symes JF, et al. (1998) Gene therapy for

myocardial angiogenesis, initial clinical results with direct

myocardial injection of phVEGF165 as sole therapy for

myocardial ischemia. Circulation 98, 2800-2804.


361


Targeting Myc function in cancer therapyReview Article

William L. Walker, Sandra Fernandez and Peter J. Hurlin*Shriners Hospitals for Children and Department of Cell and Developmental Biology, Oregon Health Sciences University,

3101 Sam Jackson Park Road, Portland, Oregon 97201 USA

__________________________________________________________________________________*Correspondence: Peter J. Hurlin, Shriners Hospitals for Children and Department of Cell and Developmental Biology, Oregon Health

Sciences University, 3101 Sam Jackson Park Road, Portland, Oregon 97201 USA; Tel: +1 503 221 3438; Fax: +1 503 221 3451; e-mail:

[email protected]

Key words: Myc, Max, Mnt, apoptosis

Received: 23 July 2004; Accepted: 23 August 2004; electronically published: August 2004

Summary

The development of novel therapeutic strategies to improve the survival rate of patients with cancer requires a

better understanding of the critical events that underlie the origins and progression of tumors. The Myc family of

transcription factors play important normal roles in regulating cell proliferation and their deregulated or elevated

expression is one of the most common features of cancer cells. Here, we review mechanisms thought to underlie

Myc-dependent tumor formation and discuss possible strategies for disrupting the oncogenic activity of Myc family

proteins.

I. IntroductionDeregulated expression of members of the Myc

family of genes is a common feature of diverse

malignancies. Myc gene amplification and gene

translocation are often responsible, but abnormally high

Myc levels are also observed in numerous tumors that

show no such defects. Although it is not possible to

discriminate between cause and effect when evaluating the

role of Myc in human tumors, a large collection of

experimental results from cell culture and animal models

clearly demonstrate that deregulated Myc expression can

function as a root cause of cancer.

How do Myc proteins contribute to the tumor

phenotype? The use of transgenic mice containing

inducible Myc genes or activatable forms of Myc, together

with more traditional types of transgenic models, have led

to, or confirmed, the identification of several Myc

activities that can be a factor in tumor formation. These

activities include stimulating cell proliferation, promoting

vasculogenesis and, paradoxically, promoting or

sensitizing cells to apoptosis. Although Myc driven

apoptosis can be regarded as a safeguard or tumor

suppressor mechanism (Huebner and Evan, 1998;

Pelengaris et al, 2002a), when combined with its affects on

cell proliferation and vasculogenesis, this activity has the

potential to ultimately have the reverse effect. Because

Myc deregulation/overexpression can stimulate both

proliferation and apoptosis, it has the capability of

applying strong selection pressure for the development of

cells that escape cell death. This type of scenario was

shown to play out in cultured primary cells exposed to

high c-Myc levels (Zindy et al, 1998). Typically, cells that

escaped Myc-driven apoptosis in culture, harbored defects

in the p53 tumor suppressor pathway (Zindy et al, 1998),

which serves as an important mediator apoptosis in

general and of Myc-driven apoptosis specifically (Sherr,

2001). Mutations in the p53 pathway, in theory, help clear

the path for Myc-driven tumorigenesis by not only

preventing apoptosis (Figure 1), but by also disabling

important checkpoints governed by p53 that prevent

excessive cell proliferation (Sherr, 2001). Proof of this

principal has been obtained in the results of crosses

between transgenic mice that overexpress c-Myc and ones

that have abrogated p53 pathway function. In this

environment, tumorigenesis is typically accelerated, often

dramatically (Nilsson and Cleveland, 2003). Taken

together, these results demonstrate that Myc deregulation

has the potential to function as an early, initiating event in

the evolution of tumor cells and, at least theoretically, may

be partially responsible for the high proportion of human

tumors that exhibit mutations in genes encoding p53 or its

positive regulator p19ARF.

In addition to mutations that disrupt the p53 pathway,

Myc-dependent apoptosis can be disarmed through a

variety of other mechanisms (Nilsson and Cleveland,

2003). Most notably, this can be accomplished by

overexpression of anti-apoptotic proteins such as Bcl2 and

BclXL (Strasser et al, 1990; Pelengaris et al, 2002b) and

Walker et al: Targeting Myc function in cancer therapy

362

loss of proapoptotic proteins such as Bax (Eischen et al,

1991). Thus, events that cripple Myc-dependent apoptosis,

but leave its other proliferation-promoting activities intact,

cooperate to drive tumor formation (Figure 1).

Based on the model presented above, tumors that

exhibit excessively high and/or deregulated Myc

expression, must either have lost their apoptotic response

to Myc or are not programmed to respond in this manner.

The latter situation appears to exist in certain cell types,

such as skin keratinocytes (Gandarillas and Watt, 1997;

Pelengaris et al, 1999;Waikel et al; 1999, 2001). When c-

Myc expression was induced in suprabasal mouse

keratinocytes, cells committed to terminal differentiation,

they reinitiated cell proliferation and formed highly

Figure 1. Model outlining activities and events associated with Myc-dependent tumor formation. When normal cells (gray) are subjected

to Myc deregulation (blue), they become hyperproliferative. In the absence of sufficient growth/survival factors and nutrients to support

hyperproliferation, cells are stressed to the point that they undergo apoptosis (purple). Myc overexpressing cells that sustain secondary

events allowing escape from an apoptotic fate, such as mutational disruption of p53 pathway function or upregulation of anti-apoptotic

proteins such as Bcl2 and BclXL, continue to proliferate (green), In addition to promoting cell proliferation, Myc stimulates

vasculogenesis and angiogenesis, activities that ultimately drive tumor formation.


363

vascularized papillomas (Pelengaris et al, 1999). Although

apoptosis appears to be minimal in this setting, the

formation of tumors was limited due to the retention and

advance of the keratinocyte terminal differentiation

program. In other words, Myc seemed to cause suprabasal

keratinocytes to revert to a basal-like phenotype that

ultimately produced differentiated “squames” that slough

off the skin surface (Pelengaris et al, 1999; Waikel et al,

2001). This is a surprising result since Myc has the

demonstrated activity of suppressing the differentiation

programs of many other cell types while promoting their

proliferation (Grandori et al, 2000). Moreover, in terms of

the response to deregulated/elevated Myc expression, the

lack of increased apoptosis in keratinocytes appears to be

the exception rather than the rule.

A potential explanation for these results is that skin

keratinocytes have a higher threshold for induction of

apoptosis. Because of their location at the body surface

and therefore frequent exposure to stresses capable of

inducing apoptosis (e.g. UV light), a higher apoptosis

threshold may have evolved specifically in keratinocytes

to help insure the integrity of our skin. For example,

keratinocytes may have naturally high levels of certain

anti-apoptotic proteins or low levels of proapoptotic

proteins compared to other cell types. Clearly, there is still

much to be learned about the conditions that determine the

response primary cells in vivo have to deregulated and/or

overexpressed Myc and mechanisms that ultimately lead

to tumorigenesis. Moreover, understanding the detailed

molecular mechanisms that underlie Myc-dependent

tumorigenesis in different cancers will ultimately provide

specific, efficatious targets for the development of

therapeutic drugs.

II. Potential therapeutic strategies that

target Myc expression and activityA. Turning Myc offThe most obvious way to prevent Myc-dependent

tumorigenesis is to target its downregulation or

inactivation in tumors. Transgenic mice expressing Myc

under the control of an inducible promoter or expressing

an activatible form of Myc (Myc-estrogen receptor

fusions), have clearly demonstrated that tumors induced

by ectopic Myc expression typically remain dependent on

the artificially deregulated and typically elevated Myc

levels (Felsher and Bishop, 1999; Pelengaris et al, 1999,

2002b; D’Cruz et al, 2001). Thus, “turning off” Myc

subsequent to tumor formation has been found to lead to

rapid tumor regression. Although in some settings a

subpopulation of cells ultimately become resistant to Myc

downregulation, these results clearly indicate that

therapies targeting inactivation of Myc in tumors would at

least temporarily slow tumor growth. Indeed, this would

most likely be true whether or not a tumor exhibited Myc

deregulation/overexpression, as targeted deletion of c-Myc

in both primary and “immortal” cells has been

demonstrated to cause a dramatic reduction in their ability

to proliferate (Mateyak et al, 1997; Trumpp et al, 2001; de

Alboran et al, 2001).

These latter results and the finding that homozygous

deletion of c-Myc and N-myc cause mid-gestation

lethality, also illustrate the seemingly obvious point that,

even if Myc genes could be targeted for downregulation in

vivo, this would probably have to be largely confined to

the tumor cell population. However, the great majority of

tumors occur in adults, which of course contain a much

smaller pool of proliferating cells than a fetus or

prepubescent individual. Thus, assuming that the only

effect of targeting Myc downregulation is decreased

proliferation, this strategy may actually be less destructive

to normal proliferating cell populations than many

standard chemotherapeutic agents that may also negatively

impact non-proliferating cells. Moreover, because of the

overlapping tissue expression patterns of the three well-

characterized Myc family genes, c-Myc, L-Myc and N-

Myc, systemic downregulation of any one of the Myc

genes – in an attempt to target its overexpression (or

normal expression) in a specific tumor – may have a quite

limited deleterious effect overall. This would probably be

most true for L-Myc and N-Myc, which exhibit a more

limited expression range than c-Myc (Mugrauer et al,

1988; Downs et al, 1989; Hatton et al, 1995). Thus, for

example, targeting L-Myc downregulation to treat small

cell lung carcinoma, which frequently exhibit L-Myc

amplification, by systemic application of L-Myc anti-sense

oligos, morpholinos, or siRNA, may have a minimal

organism-wide deleterious effect. Further, unlike the

lethality caused by N-Myc and c-Myc deletion in mice,

mice lacking L-Myc appear normal, supporting the

hypothesis that there would be minimal impact outside of

a L-Myc-dependent tumor.

It has been demonstrated that antisense

oligonucleotides targeting c-Myc, L-Myc and N-Myc can

be effective at slowing the proliferation of particular tumor

cell types in culture and in partially ameliorating tumor-

associated phenotypes (Wickstrom et al, 1988; Schmidt et

al, 1994; Dosaka-Akita et al, 1995; Smith et al, 1998;

Waelti and Gluck, 1998; Iversen et al, 2003; Pastorino et

al, 2003). Further, it has been observed that systemic

introduction of Myc antisense agents can lead to

significant tumor regression in mouse tumor xenografts

(Schmidt et al, 1994; Iversen et al, 2003; Pastorino et al,

2003). However, these studies have been largely

preliminary in nature and, to date, there has been no

follow-up evidence supporting the notion that this type of

approach works on human tumors. It seems that the

greatest limitation to this approach is instability of

antisense agents and consequently an inability for them to

effectively reach and enter enough tumor cells to have a

significant impact. Perhaps the development of next

generation antisense Myc agents that may have a longer

half-life in vivo (Iversen et al, 2003) or adjuvant vehicles

to better deliver the agents to tumors will aid their

effectiveness.

B. Restoring Myc-dependent apoptosis in

tumorsAs discussed above, transgenic models of Myc-

driven tumor formation using inducible and/or activatible

systems have demonstrated that most tumors regress


364

following “inactivation” of Myc. In this setting, a basic

assumption had been that reactivating or turning Myc back

on would reinitiate tumorigenesis. Surprisingly, this was

found not to be the case in osteosarcomas produced in

transgenic mice using an inducible c-Myc expression

system (Jain et al, 2002). Termination of ectopic c-Myc

expression caused restoration of osteocyte differentation

and tumor regression and subsequent restoration of ectopic

c-Myc expression led to apoptosis and a failure to promote

tumor formation (Jain et al, 2002). Mechanisms

underlying this unexpected phenomenon have yet to be

defined and it is not known whether this is a general

response of cells to temporary downregulation of

oncogenic levels of Myc. Although many questions

remain, reactivation of Myc-driven apoptosis has obvious

implications for tumor therapy (Felsher and Bradon,

2003). For example, some tumors might be especially

vulnerable to transient downregulation of Myc protein

levels using existing antisense and siRNA technologies as

discussed above. Such a protocol would ameliorate the

potential side effects of sustained systemic delivery of

such agents. Further, there transient use, combined with

chemotherapeutic drugs known to exacerbate Myc-driven

apoptosis, might offer even more promise.

Because defective apoptosis appears to be a common

mechanism underlying Myc-dependent progression to

tumor formation, as well as tumor progression in general,

restoring apoptosis in tumors offers great promise as a

cancer therapy. The prevalence of p53 pathway defects in

tumor cells, has made restoring p53 pathway function the

primary focus in this area. Indeed, considerable progress

has been made in this effort and drugs with the potential of

restoring wildtype p53 function to mutated and defective

p53 proteins have been identified and are currently being

tested in clinical trials (Wang and El-Diery, 2004).

The anti-apoptotic BCL-2 family proteins are also

attractive targets for drug design, as they are known to

cooperate with ectopic Myc expression in tumorigenesis

and are expressed at elevated levels in a wide variety of

tumor types (Nilsson and Cleveland, 2003). BCL2-specific

antisense oligonucleotides have been developed that show

broad anti-cancer activities in pre-clinical models and are

currently being tested in several late-stage clinical trials

(Hu and Kavanagh, 2003; Manion and Hokenbery, 2004).

While drugs that target restoration of apoptotic pathways

appear to have general anti-tumor activity, tumors that

exhibit deregulation and/or overexpressed of Myc family

proteins may be particularly vulnerable to this type of

therapy.

C. Targeting disruption of functional

Myc complexesThe biological function of Myc family proteins is

highly dependent on the integrity of its basic-helix-loop-

helix leucine zipper motif (bHLHZip – Grandori et al,

2000). The HLHZip motif mediates interaction with

another bHLHZip protein, Max, which facilitates binding

of the basic regions of the Myc:Max heterodimer to the

DNA sequence CACGTG and related “E-box” sites . The

Myc:Max heterodimer can activate transcription in

reporter assays, an activity mediated primarily through a

conserved tripartite activation domain in the N-terminal

half of Myc family proteins (Grandori et al, 2000). Many

different proteins have been found that interact within this

region and mediate or modulate Myc-dependent

transcription. As if this were not complicated enough, Myc

proteins can also repress transcription, an activity that

involves protein-protein interactions in regions that

sometimes overlap with their activation domains

(Grandori et al, 2000).

Because of the obligate role Max plays in Myc

function, interaction between Myc and Max and between

Myc:Max heterodimers and DNA offer attractive targets

for drug design. The same is true for protein – protein

interactions that mediate the transcriptional properties of

Myc. Drugs that interfere with either the Myc:Max

interaction or with Myc:Max DNA binding would be

expected to abolish Myc activity, whereas drugs that

interfere with interactions between Myc and coactivator or

corepressor proteins may have a more limited or selective

affect on Myc function. Because Max interacts with a

number of other proteins that contain Myc-like HLHZip

regions (Grandori et al, 2000), there is the real problem of

specificity in targeting the Myc:Max interaction, as drugs

that interfere with Myc:Max interactions may also

interfere with other Max - HLHZip interactions, with

unknown consequences for the cell. Nonetheless, small

molecules have been identified that disrupt Myc:Max

heterodimerization using a yeast two-hybrid approach, and

they seem to have specific effects in suppressing Myc

activities (Yin et al, 2003). Potential problems of

specificity may also arise in drugs that target Myc:Max

DNA binding, as they may affect DNA binding by

members of a large number of additional proteins that

contain a “basic” region DNA binding motif.

Finally, because the molecular mechanisms that

mediate the transcriptional activities of Myc family

proteins are still confusing, it is not clear whether targeting

any of the many interactions thought to control Myc

transcription would cripple its functions in tumorigenesis.

However, one potential target is the interaction between

Myc and the coactivator TRRAP (McMahon et al, 1998

–Figure 2). Interaction with TRRAP was found to be

required for Myc-dependent transformation (McMahon et

al, 1998; Park et al, 2001) and regions within these

proteins that mediate the interaction have been mapped.

Thus small molecules that disrupt this interaction might be

effective in blocking tumor-promoting activities of Myc.

A second potential target is the interaction between

Myc and Miz1 (Wanzel et al, 2003). Miz1 is a

transcriptional activator whose activities are repressed by

interaction with Myc which causes displacement of the

Miz1 coactivator protein CBP (Staller et al, 2001, Herold

et al, 2002). Through this mechanism, Myc was found to

disrupt Miz1-dependent transcriptional activation of the

genes encoding cyclin-dependent kinase inhibitors

p15INK4D and p21CIP1 (Herold et al, 2002; Seoane et al,

2002). The p21CIP1 gene is a key transcriptional target of

p53, and by suppressing its transcription, Myc appears to

suppress the cell cycle arrest functions of p53, but not its

pro-apoptotic function. Therefore, in cells that have an

intact p53 pathway, the development of drugs that disrupt.


365

Figure 2. Speculative Myc-Mnt antagonism model. Myc (c-Myc, N-Myc and L-Myc) and Mnt compete for interaction with their

obligate heterodimerization partner Max and for binding and regulation of shared transcriptional target genes. Myc:Max complexes

activate transcription through recruitment of coactivator proteins such as TRRAP and TRRAP-associated GCN5, a histone

acetyltransferase. Of note, TRRAP is one of many proteins found to interact with Myc and affect its ability to activate transcription. In

contrast to Myc, Mnt represses transcription through its interaction with Sin3 corepressor proteins, which tethers histone deacetylating

(HDAC) enzymes. Ubiquitous Mnt:Max complexes are postulated to create a threshold of transcriptional repression at shared Myc/Mnt

target genes that is overcome, and proliferation promoted, when Myc levels are expressed at sufficiently high levels.

intact p53 pathway, the development of drugs that disrupt

interaction between Myc and Miz1 would theoretically

cause increased susceptibility to Myc-dependent

apoptosis.

D. Interfering with downstream

pathways regulated by MycBecause Myc family proteins are transcriptional

regulators, it would seem that disrupting the function of

proteins encoded by its transcriptional target genes would

offer an effective way at disarming Myc function.

However, the identification of bona fide Myc target genes

has been at best difficult and at worse, misleading

(Eisenman, 2001). Moreover, recent findings support the

view that Myc functions are not mediated by it’s

regulation of a small number of key transcriptional targets,

but instead through it’s binding and regulation of perhaps

thousands of different genes (see http//www.myc-cancer-

gene.org for an updated list). Although it is not clear how

many different genes Myc actually regulates, it is clear

that it broadly affects the gene expression profile of cells.

This is also reflected at the protein level, where changes,

up and down, of broad categories of proteins have been

observed following ectopic Myc expression (Ishii, et al,

2002). Therefore, instead of - or in addition to - trying to

zero in on specific Myc transcriptional targets as candidate

drug targets, it may be fruitful to focus on disrupting more

downstream events that ultimately contribute to the

oncogenic activity of Myc. In many, and perhaps most

cases, such events are probably not unique to Myc-driven

oncogenesis, but represent general attributes of tumor cells

that Myc can provoke or enhance.

One example of this is vasculogenesis - the

production of new blood vessel networks, and

angiogenesis - the remodeling and expansion of this blood

vessel networks. Vasculogenesis and angiogenesis

provides for the increased blood supply required to

support the ever-growing nutritional needs of neoplastic

tissues during tumorigenesis. Ectopic

expression/activation of Myc in transgenic mice has been

found to stimulate angiogenesis and vasculogenesis

(Pelengaris et al, 1999, 2002b). Further, the vasculature

network formed in neoplastic tissues was dependent on

continued ectopic Myc expression. In addition, it was

recently revealed that angiogenesis and vasculogenesis is

defective in c-Myc null embryos and this deficiency was

linked to the inability of c-Myc null embryonic stem cells

to form tumors in Skid mice (Baudino et al, 2003). These

studies, together with data indicating that Myc can

regulate, either directly or indirectly, the expression of a

number of important factors involved in angiogenesis and


366

vasculogenesis (Baudino et al, 2003 and references

therein), support the idea that drugs that disrupt

neovascularization will be effective in disrupting Myc-

dependent tumorigenesis. Because neovascularization is a

common and necessary feature of tumor growth in general,

the development and testing of such drugs has been the

focus of intense study for several years. However, the

drugs that have been developed have, so far, yet to prove

effective against human tumors (Siemann et al, 2004).

Thus, perhaps models of Myc-driven tumorigenesis may

provide a useful setting to more precisely define the

critical mechanisms responsible for neo-vasculogenesis

and a useful system to test novel drugs designed to disrupt

new blood vessel formation.

Another pathway modulated by Myc family proteins

that is likely generally important in tumorigenesis is cell

growth. Cell growth refers to the increased cell size

associated with progression through specific phases of the

cell cycle. Before cells divide, they increase their cell mass

and volume in order to maintain a consistent size of

daughter cells (Saucedo et al, 2002). It is hypothesized

that Myc regulates cell size by stimulating the expression,

directly or indirectly, of genes encoding proteins required

for protein synthesis (Jones et al, 1996; Greasly et al,

2000) and by assisting RNA polymerase III in the

transcription activation of transfer and ribosomal (5S)

RNAs (Gomez-Roman et al, 2003). Although these Myc

activities might be considered potential targets for

therapeutic intervention in tumors, disrupting fundamental

components of the protein synthesis machinery, that are

not necessarily coupled to cell proliferation, might be

expected to have strong adverse effects on non-tumor

tissues as well. However, the activity of mTOR, a central

regulator of cell growth, survival and protein translational

control is a key target of the drug rapamycin and related

compounds that show promise as anticancer agents

(Bjornsti and Houghton, 2004). Indeed, rapamycin has

been shown to be effective at reversing chemotherapeutic

resistance of Myc-dependent mouse lymphomas that

express Akt, an important regulator of mTOR activity and

cell survival (Wendel et al. 2004). In addition, inhibition

of mTOR activity by rapamycin can lead to c-Myc

downregulation in some cell types, (Gera et al, 2004), and

has been shown to inhibit transcription of the telomerase

catalytic subunit hTERT gene (Zhou et al, 2003), a direct

target of c-Myc transcriptional activation (Grandori et al,

2000) and putative oncogene. Thus, inhibitors of mTOR

activity may ultimately prove efficacious on human tumor

subsets that can be defined as exhibiting Myc

deregulation, particularly ones showing activation of

Akt/mTOR signalling.

III. Stimulating endogenous Myc

antagonistsBesides Myc family proteins, Max interacts with

another set of bHLHZip proteins that include the four Mad

family proteins (Mad1, Mxi1-Mad2, Mad3 and Mad4),

Mnt and Mga (Grandori et al, 2000). Like Myc:Max, these

alternative Max complexes bind to E-box sequences, but

appear to function as dedicated repressors. Furthermore,

each of these proteins can suppress the ability of Myc

family proteins to transform normal cells in culture to

tumor-like cells (Grandori et al, 2000). From these results

it has been speculated that this group of proteins normally

function as Myc antagonists in cells and would therefore

act as tumor suppressors in vivo. Although there is no

definitive evidence for a role as tumor suppressors in

human cancers for any of these proteins, disruption of

mouse Mxi1 (a.k.a. Mad2) and Mnt genes was shown to

predispose certain cell types to tumorigenesis (Schreiber-

Agus et al, 1998; Hurlin et al, 2003). In the case of Mnt,

conditional deletion in mammary epithelium led to the

formation of breast tumors. A conditional deletion

approach was required in these experiments because

homozygous germline deletion of Mnt is early postnatal

lethal (Hurlin et al, 2003; Toyo-oka et al, 2004) and

studies are underway by our group to test whether loss of

Mnt leads to tumors in other tissues.

Further support for the idea that Mnt functions as a

Myc antagonist comes from cell culture experiments.

MEFs lacking Mnt were found to exhibit several of the

hallmark attributes of cells caused by ectopic Myc

expression, including being sensitized to apoptosis, having

cell cycle entry defects and showing an enhanced rate of

senescence escape (Hurlin et al, 2003). Suppression of

Mnt by siRNA also caused increased apoptosis, even in an

immortal cell line lacking c-Myc (Nilsson et al, 2004).

Although these data generally support the notion that Mnt

is a Myc antagonist, because of the complicated

transcriptional activities of Myc family proteins, this is

somewhat difficult to unequivocally prove and requires

much more work. Nonetheless, these data, particularly the

finding of increasing sensitivity to apoptosis by Mnt

deficiency, raise the possibility that Mnt and possibly

other Max-interacting repressor proteins may serve as

future cancer therapeutic targets.

IV. ConclusionMyc family proteins serve as essential regulators of

cell proliferation and events that uncouple Myc

transcriptional gene expression from growth factor

signaling, push cells into a proliferative mode and makes

them prone to malignant conversion. If the local

growth/survival factor and nutrient environment is

sufficient, cell proliferation will occur, but when the

environment is, or becomes unfavorable to cell

proliferation, apoptotic cell death typically ensues. Thus,

sustained Myc-driven proliferation, and ultimately tumor

formation, is thought to require cooperation with

secondary events that either provide a favorable growth

factor/nutritional environment or that suppress apoptosis

(or both). This understanding of Myc-dependent

tumorigenesis has led to efforts to directly suppress Myc

expression in tumors and initiatives to restore defective

pro-apoptotic pathways in tumors. While these approaches

may ultimately be successful, the identification and

development of new therapeutic strategies and eventually

drugs targeting Myc functions in tumorigenesis will

require a more precise understanding of the complicated

molecular mechanisms underlying the normal and

oncogenic activities of Myc family proteins.


367

AcknowledgementsPJH is funded by grants from the NIH and Shriners

Hospitals for Children.

ReferencesBaudino TA, Maclean KH, Brennan J, Parganas E, Yang C,

Aslanian A, Lees JA, Sherr CJ, Roussel MF and Cleveland

JL (2003) Myc-mediated proliferation and lymphomagenesis,

but not apoptosis, are compromised by E2f1 loss. Mol Cell

11, 905-914.

Bjornsti MA and Houghton PJ (2004) The TOR pathway: a

target for cancer therapy. Nat Rev Cancer 4, 335-348.

D'Cruz CM, Gunther EJ, Boxer RB, Hartman JL, Sintasath L,

Moody SE, Cox JD, Ha SI, Belka GK, Golant A, Cardiff RD

and Chodosh LA (2001) c-MYC induces mammary

tumorigenesis by means of a preferred pathway involving

spontaneous Kras2 mutations. Nat Med 7,235-239.

de Alboran IM, O'Hagan RC, Gartner F, Malynn B, Davidson L,

Rickert R, Rajewsky K, DePinho RA and Alt FW (2001)

Analysis of C-MYC function in normal cells via conditional

gene-targeted mutation. Immunity 14, 45-55.

Dosaka-Akita H, Akie K, Hiroumi H, Kinoshita I, Kawakami Y

and Murakami A (1995) Inhibition of proliferation by L-myc

antisense DNA for the translational initiation site in human

small cell lung cancer. Cancer Res 55, 1559-1564.

Downs KM, Martin GR and Bishop JM (1989) Contrasting

patterns of myc and N-myc expression during gastrulation of

the mouse embryo. Genes Dev 3, 860-869.

Eischen CM, Roussel MF, Korsmeyer SJ and Cleveland JL

(2001) Bax loss impairs Myc-induced apoptosis and

circumvents the selection of p53 mutations during Myc-

mediated lymphomagenesis. Mol Cell Biol 21, 7653-7662.

Eisenman, RN (2001) Deconstructing myc. Genes Dev 15, 2023-

2030.

Felsher DW and Bradon N (2003) Pharmacological inactivation

of MYC for the treatment of cancer. Drug News Perspect

16,370-374.

Felsher DW, Bishop JM (1999) Reversible tumorigenesis by

MYC in hematopoietic lineages. Mol Cell 4, 199-207

Gandarillas A and Watt FM (1997) c-Myc promotes

differentiation of human epidermal stem cells. Genes Dev

11,2869-2882.

Gera JF, Mellinghoff IK, Shi Y, Rettig MB, Tran C, Hsu JH,

Sawyers CL and Lichtenstein AK (2004) AKT activity

determines sensitivity to mammalian target of rapamycin

(mTOR) inhibitors by regulating cyclin D1 and c-myc

expression. J Biol Chem 279, 2737-46.

Gomez-Roman N, Grandori C, Eisenman RN and White RJ

(2003) Direct activation of RNA polymerase III transcription

by c-Myc. Nature 421, 290-294.

Grandori C, Cowley SM, James LP and Eisenman RN (2000)

The Myc/Max/Mad network and the transcriptional control

of cell behavior. Annu Rev Cell Dev Biol 16, 653-699.

Greasley PJ, Bonnard C and Amati B (2000) Myc induces the

nucleolin and BN51 genes: possible implications in ribosome

biogenesis. Nucleic Acids Res 28, 446-453.

Hatton KS, Mahon K, Chin L, Chiu FC, Lee H W, Peng D,

Morgenbesser SD, Horner J and DePinho RA (1996)

Expression and activity of L-Myc in normal mouse

development. Mol Cell Biol 16, 1794-1804.

Herold S, Wanzel M, Beuger V, Frohme C, Beul D, Hillukkala

T, Syvaoja J, Saluz HP, Haenel F and Eilers M (2002)

Negative regulation of the mammalian UV response by Myc

through association with Miz-1. Mol Cell 10, 509-521.

Hu W and Kavanagh JJ (2003) Anticancer therapy targeting the

apoptotic pathway. Lancet Oncol 4, 721-729.

Hueber AO and Evan GI (1998) Traps to catch unwary

oncogenes. Trends Genet 14, 364-367.

Hurlin PJ, Zhou ZQ, Toyo-oka K, Ota S, Walker WL, Hirotsune

S, Wynshaw-Boris A (2003) Deletion of Mnt leads to

disrupted cell cycle control and tumorigenesis. Embo J 22,

4584-4596.

Iversen PL, Arora V, Acker AJ, Mason DH and Devi GR (2003)

Efficacy of antisense morpholino oligomer targeted to c-myc

in prostate cancer xenograft murine model and a Phase I

safety study in humans. Clin Cancer Res 9, 2510-2519.

Jain M, Arvanitis C, Chu K, Dewey W, Leonhardt E, Trinh M,

Sundberg CD, Bishop JM and Felsher DW (2002) Sustained

loss of a neoplastic phenotype by brief inactivation of MYC.

Science 297, 102-104.

Jones RM, Branda J, Johnston KA, Polymenis M, Gadd M,

Rustgi A, Callanan L, Schmidt EV (1996) An essential E box

in the promoter of the gene encoding the mRNA cap-binding

protein (eukaryotic initiation factor 4E) is a target for

activation by c-myc. Mol Cell Biol 16, 4754-4764.

Manion MK and Hockenbery DM (2003) Targeting BCL-2-

related proteins in cancer therapy. Cancer Biol Ther 2,

S105-114.

Mateyak MK, Obaya AJ, Adachi S and Sedivy JM (1997)

Phenotypes of c-Myc-deficient rat fibroblasts isolated by

targeted homologous recombination. Cell Growth Differ 8,

1039-1048.

McMahon SB, Van Buskirk HA, Dugan KA, Copeland TD and

Cole MD (1998) The novel ATM-related protein TRRAP is

an essential cofactor for the c-Myc and E2F oncoproteins.

Cell 94, 363-374.

Mugrauer G, Alt FW and Ekblom P (1988) N-myc proto-

oncogene expression during organogenesis in the developing

mouse as revealed by in situ hybridization. J Cell Biol 107,

1325-1335.

Nilsson, JA and Cleveland, JL (2003) Myc pathways provoking

cell suicide and cancer. Oncogene 22, 9007-9021.

Nilsson, JA, Maclean, KH, Keller, UB, Pendeville, H, Baudino,

TA and Cleveland, JL (2004) Mnt loss triggers Myc

transcription targets, proliferation, apoptosis, and

transformation. Mol Cell Biol 24, 1560-1569.

Park J, Kunjibettu S, McMahon SB, Cole MD (2001) The ATM-

related domain of TRRAP is required for histone

acetyltransferase recruitment and Myc-dependent

oncogenesis. Genes Dev 15, 1619-1624.

Pastorino F, Brignole C, Marimpietri D, Pagnan G, Morando A,

Ribatti D, Semple SC, Gambini C, Allen TM and Ponzoni M

(2003) Targeted liposomal c-myc antisense

oligodeoxynucleotides induce apoptosis and inhibit tumor

growth and metastases in human melanoma models. Clin

Cancer Res 9, 4595-4605.

Pelengaris S, Khan M and Evan G (2002a) c-MYC: more than

just a matter of life and death. Nat Rev Cancer 2, 764-776.

Pelengaris S, Khan M and Evan G (2002b) Suppression of Myc-

induced apoptosis in beta cells exposes multiple oncogenic

properties of Myc and triggers carcinogenic progression. Cell

109, 321-334.

Pelengaris, S, Littlewood, T, Khan, M, Elia, G and Evan, G

(1999) Reversible activation of c-Myc in skin: induction of a

complex neoplastic phenotype by a single oncogenic lesion.

Mol Cell 3, 565-577.

Saucedo LJ and Edgar BA (2002) Why size matters: altering cell

size. Curr Opin Genet Dev 12, 565-571

Schmidt ML, Salwen HR, Manohar CF, Ikegaki N and Cohn SL

1994 The biological effects of antisense N-myc expression in

human neuroblastoma. Cell Growth Differ 5, 171-178.

Schreiber-Agus, N, Meng, Y, Hoang, T, Hou, H, Jr, Chen, K,

Greenberg, R, Cordon-Cardo, C, Lee, HW and DePinho, RA

(1998) Role of Mxi1 in ageing organ systems and the


368

regulation of normal and neoplastic growth. Nature 393,

483-487.

Seoane J, Le HV and Massague J (2002) Myc suppression of the

p21(Cip1) Cdk inhibitor influences the outcome of the p53

response to DNA damage. Nature 419, 729-734.

Sherr, CJ (2001) The INK4a/ARF network in tumour

suppression. Nat Rev Mol Cell Biol 2, 731-737.

Shiio Y, Donohoe S, Yi EC, Goodlett DR, Aebersold R,

Eisenman RN (2002) Quantitative proteomic analysis of Myc

oncoprotein function. EMBO J 21, 5088-5096

Siemann DW, Chaplin DJ and Horsman MR (2004) Vascular-

targeting therapies for treatment of malignant disease.

Cancer 100, 2491-2499

Smith JB and Wickstrom E. (1998) Antisense c-myc and

immunostimulatory oligonucleotide inhibition of

tumorigenesis in a murine B-cell lymphoma transplant

model. J Natl Cancer Inst 90, 1146-1154.

Staller P, Peukert K, Kiermaier A, Seoane J, Lukas J, Karsunky

H, Moroy T, Bartek J, Massague J, Hanel F, Eilers M. (2001)

Repression of p15INK4b expression by Myc through

association with Miz-1. Nat Cell Biol 3, 392-9.

Toyo-oka K, Hirotsune S, Gambello MJ, Zhou ZQ, Olson L,

Rosenfeld MG, Eisenman R, Hurlin P and Wynshaw-Boris A

(2004) Loss of the Max-interacting protein Mnt in mice

results in decreased viability, defective embryonic growth

and craniofacial defects: relevance to Miller-Dieker

syndrome. Hum Mol Genet 13, 1057-1067.

Trumpp A, Refaeli Y, Oskarsson T, Gasser S, Murphy M, Martin

GR and Bishop JM (2001) c-Myc regulates mammalian body

size by controlling cell number but not cell size. Nature 414,

768-773.

Waelti ER and Gluck R (1998) Delivery to cancer cells of

antisense L-myc oligonucleotides incorporated in fusogenic,

cationic-lipid-reconstituted influenza-virus envelopes

(cationic virosomes). Int J Cancer 77, 728-733.

Waikel RL, Kawachi Y, Waikel PA, Wang XJ and Roop DR

(2001) Deregulated expression of c-Myc depletes epidermal

stem cells. Nat Genet 28, 165-168.

Waikel RL, Wang XJ, and Roop DR (1999) Targeted expression

of c-Myc in the epidermis alters normal proliferation,

differentiation and UV-B induced apoptosis. Oncogene 18,

4870-4878.

Wang S and El-Deiry WS (2004) The p53 pathway: targets for

the development of novel cancer therapeutics. Cancer Treat

Res 119, 175-187.

Wanzel, M, Herold, S and Eilers, M (2003) Transcriptional

repression by Myc. Trends Cell Biol 13, 146-150.

Wendel HG, De Stanchina E, Fridman JS, Malina A, Ray S,

Kogan S, Cordon-Cardo C, Pelletier J, Lowe SW (2004)

Survival signalling by Akt and eIF4E in oncogenesis and

cancer therapy. Nature 428, 332-337.

Wickstrom E L, Bacon T A, Gonzalez A, Freeman D L, Lyman

G H and Wickstrom E 1988 Human promyelocytic leukemia

HL-60 cell proliferation and c-myc protein expression are

inhibited by an antisense pentadecadeoxynucleotide targeted

against c-myc mRNA. Proc Natl Acad Sci USA 85, 1028-

1032.

Yin X, Giap C, Lazo JS and Prochownik EV (2003) Low

molecular weight inhibitors of Myc-Max interaction and

function. Oncogene 22, 6151-6159.

Zhou C, Gehrig PA, Whang YE and Boggess JF (2003)

Rapamycin inhibits telomerase activity by decreasing the

hTERT mRNA level in endometrial cancer cells. Mol

Cancer Ther 2, 789-795.

Zindy F, Eischen CM, Randle DH, Kamijo T, Cleveland JL,

Sherr CJ, Roussel MF (1998) Myc signaling via the ARF

tumor suppressor regulates p53-dependent apoptosis and

immortalization. Genes Dev 12. 2424-2433.

Dr. Peter J. Hurlin


369


Transfection pathways of nonspecific and targetedPEI-polyplexesReview Article

Vicent M. Guillem1 and Salvador F. Aliño2

1Servei d’ Hematologia i Oncologia. Hospital Clínic Universitari. Facultat de Medicina. Universitat de València. Avda.

Blasco Ibañez 17, 46010 – València (Spain)2Grup de Teràpia Gènica. Departament de Farmacologia. Facultat de Medicina. Universitat de València. Avda. Blasco

Ibañez 15, 46010 – València (Spain)

__________________________________________________________________________________*Correspondence: Salvador F. Aliño, Departament de Farmacologia. Facultat de Medicina, Universitat de València, Blasco Ibañez 15,

46010 – Valencia (Spain); Phone: (+34) 96 386 46 21; Fax: (+34) 96 386 49 72; E-mail: [email protected]

Key words: PEI-polyplexes, transfection, DNase degradation, Interactions, cell surface, cell culture medium, specificity, efficacy, cell

internalization, Endosome trafficking, proton-sponge effect, Cytoplasm transport, nuclear accession, dissociation

Abbreviations: Polyethyleneimine, (PEI); polylysine, (PLL); polyamidoamine dendrimers, (PAMAM dendrimers); epithelial growth

factor, (EGF); basic fibroblast growth factor, (bFGF); 2-(dimethylamino)ethylmethacrylate, (pDMAEMA); transferrin-polylysine

polyplexes, (Tf-pLL); poly-[N-(2-hydroxypropyl)methacrylamide], (pHPMA)

Received: 30 April 2004; Accepted: 24 June 2004; electronically published: September 2004

Summary

Polyethyleneimine (PEI) based vectors have become in an important vehicle for nonviral gene transfer. However,despite their extensive use and efficacy in the transfection of several cellular models both in vitro and in vivo , themechanism by which they transfect cells has not been fully elucidated, and controversy remains over theinterpretation of some apparently contradictory findings. A review is made of the studies on PEI polyplexes,

focusing on PEI polyplex transfection properties (as physico-chemical characteristics important for transfection)and the mechanistic findings of PEI polyplex transfection comprising cell membrane binding with nonspecific andtargeted–PEI polyplexes, the putative internalization pathways (such as the proton sponge hypothesis), the nuclearbioavailability of the transported nucleic acid, and other relevant issues such as the influence of polyplex size in vitro

upon transfection activity.

I. IntroductionSpecific and efficient delivery of nucleic acid into

targeted cells is a priority objective of gene therapy. To

achieve successful modification of the gene expression

pattern, the exogenous nucleic acid must overcome a

series of obstacles to gain access first to the cell and

posteriorly to the intracellular compartments, where the

nucleic acid exerts its function. Since nucleic acid uptake

by cells is an inefficient process, it has been necessary to

develop several strategies to increase nucleic acid

delivery. One of the approaches is based on the use of

nonviral vehicles such as liposomes (Wong et al, 1980;

Alino et al, 1993), lipoplexes or nucleic acid-cationic lipid

complexes (Felgner et al, 1997), and polyplexes (Gebhart

and Kabanov 2001) - complexes of nucleic acids and

cationic polymers such as polyethyleneimine (PEI)

(Boussif et al, 1995). Due to its intrinsic transfection

properties, PEI has been used to conform the backbone of

a great number of vector formulations. Despite their

widespread use and demonstrated efficacy in the

transfection of several cellular models both in vitro and in

vivo, the mechanism by which they transfect cells has not

been fully elucidated, and controversy remains over the

interpretation of some apparently contradictory findings.

The present review discusses the hypothetical transfection

pathways of PEI-polyplexes - from vector binding to the

cell membrane to nucleic acid arrival in the nucleus, the

influence of physico-chemical properties of PEI in

transfection activity and other relevant issues such as the

influence of polyplex size and cell type upon transfection

activity, and the most relevant differences or similarities

between PEI and other polymers used in transfection

(fundamentally polylysine polyplexes).

II. Characteristics of PEI-polyplexes

A. PEI physico-chemical properties ofimportance for transfection

PEI is a synthetic polymer with a nitrogen-carbon

base (32.5% nitrogen). Ethanolamine, the monomeric unit

of PEI (CH2-CH2-NH-), confers great PEI solubility in

Guillem and Aliño: Transfection pathways of nonspecific and targeted PEI-polyplexes

370

water and most polar solvents. The most prominent

characteristic of PEI is its high positive charge density

(20-25 mEq/g), which facilitates ionic interaction with

negatively charged molecules such as nucleic acids, via

the protonation of amine groups taken from the

surrounding medium. This implies the existence of a

correlation between PEI positive charge density and the

pH of the medium, which (as we will see) largely accounts

for the transfection properties of PEI. Two types of

polyethyleneimine are used in transfection: branched PEI

(mainly of molecular weights 25 and 800 KDa) (Boussif et

al, 1995) and linear PEI (22 kDa) (Ferrari et al, 1997).

Branched PEI has three kinds of amine groups – primary,

secondary and tertiary - with an amine ratio of 1:2:1,

respectively, while linear PEI amines are exclusively

secondary. Thus, while linear PEI acquires its positive

charge density through the protonation of secondary

groups, branched PEI possesses additional primary amine

groups for protonation. Based on the existing protonation

profile, only every 5 or 6 amino groups are protonated a

physiological pH (Suh et al, 1994). In addition to being

most basic and also most reactive, the primary amine

groups are amenable to chemical modification and have

been used to covalently attach different types of molecules

with the aim of conferring additional properties to the

vector. Nucleic acid-PEI binding slightly changes the PEI

protonation profile, one-half to one-third of the amine

groups being protonated at physiological pH. Therefore, in

contrast to other polymers such as polylysine (PLL), PEI

possesses a great buffering capacity over a very wide pH

range (Tang and Szoka 1997).

B. PEI-polyplex physico-chemical

properties of importance for transfectionAs has been commented, polyplex formation occurs

as a result of ionic interaction between negative DNA

charges provided by phosphate groups, and the positive

charge of the cationic polymer (Kabanov and Kabanov

1995) - provided in the case of PEI by protonated amine

groups. The size and shape of the resulting polyplex

particles depends on the conditions under which they are

prepared.

An important part of polyplex transfection activity

depends on the polyplex physico-chemical characteristics.

Therefore, characterization of the physico-chemical

properties and knowledge of the parameters that can

modify them could be very useful for predicting and

defining the conditions of preparation capable of ensuring

optimal transfection performance. The physico-chemical

characteristics of polyplexes (structure, size, charge,

capability of interaction with biomolecules) are largely

dependent on factors inherent to the nature of the

polycation (structure, molecular weight, charge density,

etc.), but also on properties common to all polymers, such

as the charge or mass ratio between polymer and DNA,

and also on the characteristics of the solvent used for the

electrostatic reaction – such as the ionic force (De Smedt

et al, 2000). Of all physico-chemical parameters, the size

of the complexes seems to be directly associated to

transfection activity (Ogris et al, 1998), while the rest of

parameters are relevant to transfection in the degree in

which they affect polyplex size. The latter can vary from a

few nanometers to several micrometers (Tang and Szoka

1997) - complexes of larger size being aggregates of

particles of smaller size. Polyplex size depends on several

parameters, such as the cation/anion ratio, DNA and

polycation concentration, solution volume, and mixing

speed. Moreover, size is greatly influenced by the

presence of other electrolytes in the dissolution. Each of

these factors will be analyzed separately below.

1. Influence of charge ratioOn examining the variation of size with respect to

charge ratio, it is seen that under conditions of non-

aggregation (preparation in water), low +/- charge ratios

yield small particles. Size progressively increases until the

neutralization charge is reached, and decreases again as

the net positive charge increases – this being thought to

favor solubility of the polyplex particles (Kabanov and

Kabanov 1995; Tang and Szoka 1997; Pouton et al, 1998).

In the case of PEI-polyplexes, complete condensation

takes place from a N/P ratio of 2 or 3 (where N is the

number of polymer nitrogen atoms and P the number of

DNA phosphorus atoms), with the formation of neutral

charge particles (Erbacher et al, 1999a). At these ratios, a

tendency towards particle aggregation is observed. The

compact particles of smaller size are generally obtained at

higher N/P ratios, yielding polyplexes of positive net

charge (Erbacher et al, 1999a). At N/P ratios generally

used to obtain complete condensation (N/P >4), PEI/DNA

complexes present a zeta potential of around + 30-35 mV

(Kircheis et al, 1999; Ogris et al, 1999). With respect to

shape, small polyplexes have revealed toroidal structures

measuring between 40-80 nm, according to electron

microscopic estimations (Tang and Szoka 1997) and

dynamic light scattering studies (Ogris et al, 1998), as well

as globular structures of up to 20-40 nm according to

estimations of atomic force microscopy (Dunlap et al,

1997). In comparison, large-size polyplexes are generally

spherical or aggregates of micrometric size.

2. Influence of preparation conditionsThe preparation conditions greatly influence

polyplex size and structure, mostly at aggregation level.

The most relevant factors are salt concentration and the

concentration of DNA and PEI before and after

preparation. In general, polyplexes formed in saline

solutions are larger than those formed in water (low ionic

force) (Tang and Szoka 1997; Ogris et al, 1998; Kwoh et

al, 1999), and size can moreover change over time (Ogris

et al, 1998). In addition, even when polyplexes are formed

under conditions of low ionic force, and despite the

presence of the strong positive polyplex charge, many

polyplexes (such as those composed of PLL) effectively

aggregate when added to saline solutions of physiological

concentration (Pouton et al, 1998). This aggregation

tendency is probably related to a decrease in the real zeta

potential due to the presence of saline electrolytes (Tang

and Szoka 1997). According to these authors, this

behavior is partially dependent on the type of cationic


371

polymer involved. For example, PLL polyplexes and

polyamidoamine dendrimers (PAMAM dendrimers) tend

to form aggregates, whereas PEI polyplexes and fractured

dendrimers (starburst dendrimers) are more resistant to

aggregation (Tang and Szoka 1997).

Other authors have demonstrated the importance of

DNA and polymer concentration. For example, PLL

polyplexes aggregate when the DNA solution is highly

concentrated (400 µg/ml), and do not aggregate when the

DNA concentration is lower (Duguid et al, 1998). This

tendency to aggregate at certain concentrations is frequent

in almost all polymers. When equal volumes of prediluted

polymer and DNA are used, differences in transfection

effectiveness associated to the sequence of the addition of

the reagents are scantly relevant (Kircheis et al, 2001c;

Wightman et al, 2001), though when the concentrations

are high, the mixing order becomes relevant. Thus,

transfection activity in vitro was found to be 10-fold

greater when the polymer (PEI) was added to the plasmid

DNA (drop by drop) than when the inverse approach was

adopted, i.e., adding the DNA to the polymer (Boussif et

al, 1995, 1996). Such differences were in fact associated to

differences in the size of the polyplexes prepared in one or

other way (larger polyplexes being the most efficacious)

(Ogris et al, 1998).

3. Influence of PEI typeWhile there do not seem to be important differences

in zeta potential between polyplexes formed with the

different types from PEI (i.e., linear versus branched and

high versus low molecular weight)(Kircheis et al, 2001b),

the influence of PEI type upon particle size is remarkable

under certain preparation conditions. For example, while

at low ionic force the sizes of polyplexes prepared with

different types of PEI (linear and branched, with different

molecular weights) seem to be quite invariable, the

behavior of branched and linear PEI polyplexes clearly

diverges when the complexes are formed at physiological

ionic force. While complexes formed with branched PEI

(25 or 800 kDa, indistinctly) are small (50-80 nm) or

medium-sized (100 to some hundreds of nm), depending

on the DNA concentration, complexes formed with linear

PEI of molecular weight 22 kDa conform large aggregates

– the size increasing with incubation time (Kircheis et al,

2001b). The same behavior is observed when linear 22-

kDa polyplexes initially prepared in a medium without

salts are later added to a saline medium (Goula et al,

1998b; Kircheis et al, 2001b; Wightman et al, 2001). As

can be expected, these differences in size between linear

and branched PEI polyplexes exert a great influence upon

transfection activity. In some cell types, the transfection

activity of linear PEI of molecular weight 22 kDa is

similar to that of branched PEI (Demeneix et al, 1998)

(Poulain et al, 2000), whereas in others it is remarkably

greater (Poulain et al, 2000; Wightman et al, 2001) – this

phenomenon being attributed to the greater size of linear

PEI polyplexes when prepared in saline medium. This

advantage disappears when the complexes are prepared in

nonsaline medium that avoids aggregation (HBG, 5,

glucose). In this medium, both linear and branched PEI-

polyplexes are small and of similar size (Poulain et al,

2000; Wightman et al, 2001).

4. Influence of PEI molecular weight

The first studies of the influence of molecular weight

in transfection, involving both linear and branched

polyplexes, pointed to the existence of an optimum

molecular weight (around 20-25 kDa) at which PEI

polyplexes show improved transfection performance

(Demeneix et al, 1998; Fischer et al, 1999; Godbey et al,

1999b; Jeong et al, 2001). At higher and lower molecular

weights transfection efficacy decreases. Some authors

have tried to explain this molecular weight dependency. It

has been postulated that low molecular weight constructs

show poorer transfection either because they are more

unstable and more easily dissociable in saline medium

(Papisov and Litmanovich 1988) than high weight

constructs, or because their endosomal release capacity is

less (Boussif et al, 1996; Kircheis et al, 2001c). The slight

decreasing tendency in transfection efficacy for molecular

weights larger than 20 kDa is attributed to increased

polyplex toxicity (Bieber and Elsasser 2001).

Nevertheless, the optimum molecular weight range seems

to differ from one cell line to another. Such differences are

attributed to an increase in toxicity with growing

molecular weight, and to variable cell sensitivity to PEI.

C. Protection against DNase degradation

One of the consequences derived from polyplex

formation is nucleic acid protection from degradation by

nucleases. Practically all cationic polymers are able to

afford variable DNA protection against DNase

degradation once the polyplex has been formed (De Smedt

et al, 2000) - PEI being one of the most protective

polymers (Kircheis et al, 2001c; Moret et al, 2001;

Guillem et al, 2002b). This property is of vital importance

for transfection activity in vitro and in vivo, since it allows

protection of the nucleic acid from intracellular

(endolysosomal digestion) as well as extracellular

degradation (through serum nuclease action).

D. In vitro transfection properties of PEI-polyplexes

The in vitro transfection activity of polyplexes is

influenced not only by the intrinsic properties of the latter

(as described above), but also by other inherent factors

associated to the transfection process, such as polyplex

concentration, incubation time, polyplex interaction with

the culture medium, and the type of cells used (Boussif et

al, 1996). It is difficult to establish systematic comparisons

between the transfection activities of different polyplexes,

since there is a great variety of cationic polymers, and the

optimum transfection conditions vary from one polyplex

system to another, as well as from one cell line to another.

Perhaps two of the most exhaustive studies comparing the

transfection activity of nonspecific polyplexes are those

carried out in the 3T3 (Demeneix et al, 1998) and Cos-7

cell lines (Gebhart and Kabanov 2001), employing several


372

polyplexes - including PEI. According to these studies,

PEI and PAMAM polyplexes present the best transfection

activities, compared with other polymers, at least in these

cell lines. In reference to PEI, the transfection activity in

vitro has been established in a broad variety of cells. The

first form of PEI used for gene transfer was the branched

form with a molecular weight of 800 kDa, applied to

different cell lines and tissues, as well as in local

administration to the brain (Boussif et al, 1995).

Posteriorly, these authors described PEI (branched 800

kDa type) mediated transfection in 25 different cell types,

including 18 human cell lines as well as primary rat and

pig cells (Boussif et al, 1996; Demeneix et al, 1998).

Branched PEI of low molecular weight (25 kDa) was

introduced soon afterwards (Abdallah et al, 1996),

affording superior transfection efficacy and toxicity versus

the high molecular weight form. In fact, this form of

branched PEI has allowed the transfer and expression of

genes incorporated to large gene constructs, as is the case

of the artificial 2300-kb chromosomes (Marschall et al,

1999). Such results had not been obtained up until that

time with any other type of vector. These two branched

forms of PEI have been used with significant efficacy in

terms of cell transfection, and have been the standard

forms of PEI employed for nucleic acid transference

(Godbey et al, 1999a). The linear PEI form was developed

soon afterwards (Ferrari et al, 1997). As has been

mentioned above, it displays some significant differences

in transfection profile (not only in vitro but also in vivo)

that can be interesting for certain applications. However,

despite the well demonstrated transfection activity of PEI

polyplexes and their widespread use as a regular tool for

transfection in different laboratories, our understanding of

the PEI transfection process remains incomplete. In the

following section we review the mechanistic findings of

transfection with PEI polyplexes.

III. Mechanisms of the in vitro

transfection process with PEI polyplexes

This section describes the pathway of PEI polyplexes

in the transfection process, from polyplex addition to the

cell culture to arrival of the nucleic acid in the nucleus. To

make understanding easier, the section has been divided

into different sections referring to the most relevant stages

of the polyplex pathway, including interaction with the

cell culture medium and the subsequent cellular barriers

(cell membrane, endosome-lysosome, cytoplasm and

nuclear envelope), and other important issues (influence of

particle size, targeting, etc.) in the context of each phase.

A. Interaction with cell culture medium

Once the polyplex has been prepared, the next step

consists of polyplex incubation with cells. Polyplex

interaction with elements of the cell culture medium (ions,

anionic proteins from serum) can originate structural

changes in size and surface charge that in turn can affect

transfection activity. Although polyplexes generally seem

to be less sensitive to serum than lipoplexes (Gebhart and

Kabanov, 2001), the presence of serum can reduce or even

increase the transfection activity of some polyplexes-

concretely when serum absence or presence produces

changes in polyplex size. Some authors (Guo and Lee,

2001) have suggested that the inhibiting role of serum on

transfection is associated to the stabilization of small PEI

polyplexes (of smaller transfection efficacy), in a way

similar to what happens with lipoplexes (Turek et al,

2000). According to this hypothesis, initially large

complexes or initially small complexes that increase in

size on coming into contact with the culture medium,

would be resistant to serum inhibition. The influence of

polyplex size upon transfection activity is discussed in

greater detail in the following sections.

B. Interactions between polyplexes and

the cell surface

It can be considered that in vitro transfection begins

with polyplex interaction with the cell membrane.

Different forms of membrane interaction can be defined:

nonspecific interactions with receptors or other

components of the cell membrane (such as proteoglycans),

and specific interactions with membrane receptors

(Godbey and Mikos, 2001). The type of interaction

depends on whether the polyplex is targeted or not, and on

the cell type involved in transfection.

1. Nonspecific cell interaction of untargeted

polyplexesIt is generally accepted that the interaction of an

untargeted polyplex with the cell essentially consists of an

ionic interaction between the positive polyplex charges

and the negative charges of the cell membrane (Kabanov

and Kabanov, 1995). Specifically, it is thought that

polyplex interaction with the cell surface takes place

fundamentally with sulfated proteoglycans, which are

negatively charged proteins present in the membrane

(Kjellen and Lindahl 1991). Evidence to this effect is

provided by the fact that cell treatment with heparinase

and chondroitinase (enzymes that degrade proteoglycans)

or the use of mutant cell lines deficient in proteoglycan

production dramatically inhibits transfection with PLL

polyplexes (Mislick and Baldeschwieler). A similar

mechanism is postulated for other polymers including as

PEI polyplexes. Recent studies indicate that such

interactions with the membrane proteoglycans are decisive

not only in the interaction process, but also in subsequent

polyplex internalization (Kircheis et al, 2001a). These

studies suggest that the transfection differences observed

between different cell types are associated to the levels of

proteoglycan expression (Mislick and Baldeschwieler

1996; Labat-Moleur et al, 1996; Godbey and Mikos 2001;

Wiethoff et al, 2001). If this were the case, and since

several cell types are characterized by low or nil

proteoglycan expression (e.g., hematopoietic cells), the

latter can be considered difficult to transfect with

nonspecific polyplexes (Ogris et al, 2000), and

transfection in these cell types would thus require the

incorporation of additional elements to the polyplex

construct in order to promote cell interaction.


373

2. Specific cell interaction of targeted

polyplexes. Influence of targeting upon vector

properties: specificity, efficacy, cell internalizationConsidering the need to improve polyplex specificity

and efficacy, effort has centered on combining and even

exchanging nonspecific interaction between polyplexes

and the cell surface via a specific cellular internalization

mechanism, by incorporating ligands attached to the

vectors. The development of targeted polyplexes has as

main aim their application to in vivo therapy, where

selectivity in gene delivery is particularly important.

Nevertheless, in vitro targeting, in addition to testing the

selectivity of a possible ligand for subsequent in vivo use,

is especially interesting when transference through

nonspecific interaction is very low. This is the case of cells

that grow in suspension, such as lymphocyte derived cell

lines, whose proteoglycan expression is very low and

nonspecific polyplex transfection fails (Ogris et al, 2000).

In the case of PEI-polyplexes, it has been demonstrated

that the incorporation of targeting elements not only

contributes to improve the specificity of delivery but also

increases the activity of transfection in different cell lines

(Erbacher et al, 1999b).

In general, targeted polyplexes have been based on

the covalent attachment of a targeting element to the

polymer, PLL and PEI being the most commonly used

elements. This strategy began with the experiments of Wu

et al, (1987), which targeted complexes of

asialoorosomucoid-PLL/DNA to the asialoglycoprotein

receptors of hepatic cells. Other ligands frequently used

for selective nucleic acid delivery are: a) transferrin

(Wagner and al.), whose receptor is abundant in tumor

cells (Wagner et al, 1990; Cotten et al, 1993); b)

galactosylated ligands (Plank et al, 1992) or asialofetuin

(Dasi et al,) for hepatocyte targeting; c) epithelial growth

factor (EGF) (Chen et al, 1994, Cristiano and Roth 1996)

and basic fibroblast growth factor (bFGF) (Sosnowski et

al, 1996) for targeting lung cancer cells; and d) antibodies

that recognize specific membrane elements, such as anti-

PECAM (platelet endothelial cell adhesion molecule), for

selective transference to endothelial cells (Li et al, 2000).

In this last group, one of the best developed models is

based on specific gene transfer to T cells using antibodies

against membrane antigens that are expressed

fundamentally in these cells, such as JL1 (Suh et al, 2001),

CD3 (Erbacher et al, 1999a; O'Neill et al, 2001) and CD4

(Puls and Minchin, 1999).

Although in some models these targeted polyplexes

have produced interesting results, the need for specific

synthesis of the vector for each target cell greatly limits

their use and increases the economic cost - especially

when a monoclonal antibody is used as targeting element.

A more versatile targeting method is based on the use of

the streptavidin-biotin system, which had been previously

used to prepare targeted immunoliposomes (Alino et al,

1999). In this case, targeted gene delivery was based on

the attachment of biotinylated antibodies (against

membrane antigens) on the cell surface, with the

subsequent addition of polyethylenimine-avidin-DNA

complexes to interact with cell-attached antibodies (Wojda

and Miller, 2000) through the specific avidin-biotin

interaction. The in vitro transfection results in terms of

effectiveness obtained with this procedure are limited,

though the main disadvantage is that for further in vivo

development, complete vector assembly must be made

before administration.

Taking these previous studies as reference, we

attempted to construct a targeted polyplex (which we have

called immunopolyplex), the salient characteristic of

which is the possibility of easily replacing the targeting

element, leaving the polyplex backbone intact.

Streptavidin protein was thought to be attached covalently

to PEI, acting as a bridge molecule for direct binding of

biotinylated proteins (targeting elements) to the vector.

The streptavidin-biotin system is considered to allow

targeting element replacement without complicated

protocol modifications, avoiding the need for specific

synthesis of the vector for each case, and moreover

allowing considerable savings in time and money. Since a

great amount of biotin-labeled antibodies against

membrane antigens are commercially available, they can

easily be used to determine the most suitable targeting

element for many targeted nucleic acid strategies. Due to

the therapeutic interest and difficulty of hematopoietic cell

gene transfer, our work with immunopolyplexes has

focused on the transference of genes and oligonucleotides

to cell lines of hematological origin, which proved hard to

transfect through nonspecific pathways. Thus, we selected

as targeting elements several biotinylated antibodies that

specifically recognize some membrane antigens of

hematopoietic cells. Initially we started with a set of

commercial biotin labeled antibodies against the following

antigens: CD4 and CD3 for T lymphocyte targeting,

CD19, CD20, CD21, CD22 for B lymphocyte targeting

and CD45 and CD71 for panlymphocytic targeting. The

best results were obtained with immunopolyplexes

carrying CD3 antibody for T cell transfection (Guillem et

al, 2002a, 2002b) and CD19 antibody for B cell

transfection (Guillem et al, 2002b) (Figure 1). We found

that immunopolyplex activity was fundamentally specific

and mediated mainly through specific antigen-antibody

interaction, and that anti-CD3 immunopolyplex is more

efficacious in T cells than anti-CD19 in B cells (4- or 5-

fold in terms of the percentage of positive cells, and 6- to

12-fold in terms of fluorescence intensity per cell). In this

case, abundance of antigen could be a parameter for partly

explaining observed differences in transfection activities:

we found CD3 in T cell line (Jurkat) to be about 3-fold

more abundant than CD19 in B cell line (Granta 519).

However, this is not the only parameter to be taken into

account for explaining or predicting transfection activities

in general. As some authors have suggested (O'Neill et al,

2001), the efficiency of transgene expression could be

affected by signaling events following antibody-antigen

interaction. For example, we observed that although CD45

is 4-fold more abundant than CD3 in Jurkat cells,

transfection with anti-CD45 immunopolyplexes displayed

poor results (data not shown). The lack of transfection is

probably related to the notion that CD45 does not

internalize upon antibody binding, as previously reported

(van der Jagt et al, 1992). In this case, although anti-CD45

immunopolyplex does bind to CD45 membrane antigen,


374

Figure 1: Fluorescence imaging of EGFP transfection with immunopolyplexes. Granta 519 B cell line (CD3-/CD19+, up) and

Jurkat T cell line (CD3+/CD19-, down) were transfected with p3CEGFP (5 mg/ml), employing anti-CD3(left,up and down) and anti-

CD19 (right, up and down) immunopolyplexes as vehicles . The imaging shows cells seen under fluorescence microscopy 24 h after

transfection.

its internalization might not be promoted. In the case of

CD3, the fact that CD3 antibody binding stimulates cell

proliferation can be taken to constitute a collateral effect

favoring transfection efficacy, since it eliminates the

nuclear membrane in the transfection period. Conversely,

antibodies that after antigen binding stimulate cell

apoptosis, such as CD20 (Cardarelli et al, 2002), would

dramatically impair the transfection process by eliminating

targeted cells. All these facts should be taken into account

when designing a targeting model, though when the

antigen-antibody profile is not known, antibody screening

could easily be performed with immunopolyplex until the

most suitable targeting option is identified.

C. Polyplex internalization: size doesmatter

Although endocytosis is accepted to be the general

mechanism responsible for cellular internalization of

polyplexes (Kircheis et al, 1997; Godbey et al, 1999c), the

term comprises very different forms of internalization,

including fluid phase endocytosis (Remy-Kristensen et al,

2001), nonspecific absorptive endocytosis (Labat-Moleur

et al, 1996; Mislick and Baldeschwieler 1996),

phagocytosis, macropinocytosis (Remy-Kristensen et al,

2001), and receptor mediated endocytosis (Boussif et al,

1996; Ogris et al, 1998). The first studies of polyplex

internalization mechanisms were performed with

transferrin-polylysine polyplexes (Tf-pLL)(Cotten et al,

1990; Zenke et al, 1990; Wagner et al, 1991). These

authors reported important in vitro transfection with small

particles (diameter !100 nm), and suggested that clathrin-

coated pits were implicated in receptor mediated

endocytosis (Wagner et al, 1990). Without further

evidence, it was quickly assumed that this mechanism

could be the preferential internalization route for other

polyplexes and, at the same time, that it should restrict the

internalization of complexes greater than 100 nm. This

correspondence seemed to be satisfied by PLL (Wagner et

al, 1991) and pDMAEMA (2-(dimethylamino)ethyl

methacrylate) polyplexes (van de Wetering et al, 1998),

since complexes of a few hundreds of nanometers

transfected better than those of micrometric size.

Subsequent research with PEI-polyplexes (Ogris et al,

1998) demonstrated that polyplexes of great size can also

benefit from specific internalization mediated by receptor,

resulting in even greater transfection levels than with

small constructs (Ogris et al, 1998; Wightman et al, 2001).

In an attempt to account for these apparently

contradictory findings, some authors have suggested

hypotheses to explain the relation between transfection

efficacy and construct size. One hypothesis suggests that

larger (and therefore heavier) polyplexes settle upon the

cells, creating a greater local polyplex concentration which

would force interaction with the cells. In contrast, small


375

polyplexes remain in suspension and their contact with the

cells would be more limited (Boussif et al, 1996; Ogris et

al, 1998). This hypothesis is sustained by the fact that on

promoting sedimentation of small polyplexes over cells by

centrifugation, transfection efficacy increases (Boussif et

al, 1996). This hypothesis assumes that there are no

significant internalization differences between large and

small PEI-polyplexes, since if the internalization of large

polyplexes were greatly impaired, the effect of the higher

local concentration could be neutralized. This explanation

by itself, which could help account for the differences with

PEI-polyplexes, fails to explain the behaviour of

polyplexes in general - since it does not account for PLL

polyplexes behaving in exactly the opposite way, i.e.,

large polyplexes transfect worse than small constructs. It

could be argued that the assumption that PEI and PLL

polyplexes follow the same internalization pathway has

not been demonstrated, since some authors have proposed

different internalization pathways for PEI and PLL

polyplexes (Godbey et al, 2000), and these could be

influenced differently by polyplex size. Moreover, the

influence of size upon transfection seems to be strongly

dependent on the type of cell involved, though the PEI and

PLL polyplex experiments mentioned above were

performed in the same cell line model (K562 cells).

Another proposed explanation suggests that the

reduced transfection efficacy of small PEI-polyplexes is

due to their lesser capacity to destabilize the endosomes

compared with larger PEI-polyplexes. Since PEI is though

to behave as a proton sponge that destabilizes the

endosome (Behr 1996)(see the following section), these

authors assume that a critical minimum amount of PEI

must reach the endosome to cause its rupture, and suggest

that small PEI-polyplexes do not contain sufficient

polymer to promote endosome disruption as effectively as

the larger constructs. This hypothesis is supported by the

observation that the transfection efficacy of small particles

increases in the presence of lysosomotropic agents

(chloroquine or endosomolytic peptides), whereas the

efficacy of large particles is not substantially modified

(Ogris et al, 1998).

In the case of polylysine, and since the latter does not

exert an intrinsic destabilizing effect upon the endosome,

large particles would not have an advantage over small

ones in relation to endosomal release, and transfection

efficacy would fundamentally depend on internalization

effectiveness - where small polyplexes supposedly would

be favored by the possibility of using the clathrin coated

pit internalization route. In support of this explanation,

some studies of the kinetics of internalization of

fluorescent labeled transferrin PEI-polyplexes show that

while small polyplexes are rapidly and fully internalized,

those of great size remain attached to the membrane and

are internalized more slowly (Ogris et al, 2001b). Still,

total fluorescence and membrane binding fluorescence are

greater in the case of the large polyplexes that for the

small particles–thus supporting the hypothesis postulating

a greater local concentration of large polyplexes. On the

other hand, although relative internalization is less

efficient in the case of large polyplexes, the associated

transgene expression is eleven times greater than in the

case of the smaller constructs. This supports the

hypothesis of an increased endosomal release for large PEI

polyplexes.

In our studies of PEI polyplex characterization, we

have observed that when PEI-polyplexes of different sizes

are treated with DNase I, the large complexes (N/P ratios

close to charge neutrality) totally protect plasmid DNA

from degradation, while the smaller ones (high N/P ratios)

experience discrete cuts in the DNA sequence (Guillem et

al, 2002b). This would occur because a small particle

would have more DNA exposed at the polyplex surface

per unit mass than a larger particle – thereby increasing

the probability of exposure of some DNA regions at the

polyplex surface, with increased accessibility to nucleases.

We hypothesize that this same process may occur at

intralysosomal level, and can partly explain the

transfection advantage of large polyplexes versus small

constructs.

Probably the influence upon transfection efficacy of

all these processes would be the sum of the contribution of

each individual effect, favoring transfection in one of the

stages (internalization, endosomal release, access to the

nucleus), while impairing it in others.

Regarding the upper polyplex size limit for

penetrating the cell, there are at least two alternative

possibilities. One option is to accept that penetration

occurs via the internalization of polyplex particles in large

vesicles. This hypothesis receives growing support from

many studies that show that polyplexes (targeted or not)

with a size of hundreds of nanometers and of micrometric

size (Pouton et al, 1998), or even aggregates or

precipitates (such as DNA complexes with calcium

phosphate or DEAE-dextran), are able to transfect cultured

cells (De Smedt et al, 2000). Some authors have even

detected the endocytosis of large polyplex particles using

electron microscopy (Bieber et al, 2002). Retaining the

hypothesis of small particle endocytosis as preferential

internalization mechanism, the other possibility would be

to admit that large polyplexes might not be internalized

entirely, but could remain attached to the external cell

membrane surface - as suggested for transfection with

large fluorescent labeled transferring PEI polyplexes

(Ogris et al, 2001b) - and would then be internalized as

smaller fragments detached from the large ones. Both

processes could coexist, and the variable predominance of

either could depend not only on particle size, but also on

polyplex type, and the cell type involved (Kircheis et al,

2001c). In fact, some authors (Remy-Kristensen et al,

2001) have observed that in certain cells (EAhy 926 cells),

small PEI-polyplexes, initially homogeneously attached to

cell membrane, migrate to particular areas of the cell

surface, yielding large aggregates that are further taken up

in vesicles several micrometers in size (macropinocytosis).

In contrast, in other cells (L929 fibroblasts), the same

polyplexes are quickly and homogeneously internalized by

submicrometric endosomes (fluid phase endocytosis).

D. Endosome trafficking. The proton-sponge effect: influence on the transfectionefficacy of PEI-polyplexes

It is believed that after internalization, the particles


376

are directed towards the lysosomal route to be degraded

(Klemm et al, 1998; Lecocq et al, 2000). For most

polycations such as polylysine, accumulation and

degradation in the endosomal compartment is an important

obstacle in the transfection process (Mislick et al, 1995),

and explains the relatively low levels of transfection

obtained. Different strategies have been developed to

overcome this obstacle, such as the addition of

lysosomotropic agents (e.g., chloroquine) (Erbacher et al,

1996) to the culture medium, or the use of membrane

destabilizing peptides (Plank et al, 1994) or inactivated

viral particles possessing endosomolytic activity (Curiel et

al, 1991) and which can be added to the medium or bound

to the vector.

Nevertheless, some polycations such as PEI and

PAMAM fractured dendrimers (starburst dendrimers) do

not require lysosomotropic agents to exhibit substantial

transfection in vitro (Haensler and Szoka 1993;

Kukowska-Latallo et al, 1996; Tang et al, 1996; Tang and

Szoka 1997). In these cases, the addition of chloroquine

has little or no effect. Attempts have been made to explain

this behavior through the proton sponge hypothesis, which

assumes that PEI and fractured dendrimers are able to

buffer the endolysosomal pH and cause endosome

disruption via osmotic swelling (Berh 1996). The key to

the proton sponge effect would be the degree of

protonation of the polycation amine groups. Whereas at

physiological pH the amine groups of PLL are fully

protonated (pKa between 9 and 10), the amine groups of

PEI and the starburst dendrimers are only partially

protonated. Consequently, after endocytosis of such

polyplexes (PEI or PAMAM), the amine groups are able

to uptake protons from the acidic endosomal interior,

which is thought to buffer endosomal pH and induce

proton accumulation within the endosome–this in turn

being coupled to a simultaneous flow of chloride anions

towards the interior. The above authors on one hand

hypothesize that the net increase in ion concentration

would lead to a massive water input, with swelling and

ultimately rupture of the endosome, while on the other

hand it is postulated that increasing PEI protonation could

contribute to its separation from DNA via the repulsion of

internal positive charges - thereby contributing to polyplex

dissociation (Berh). However, the authors did not take into

consideration that the presence of negative DNA charges

can compensate the increase in the PEI protonation, and

therefore the internal cationic repulsion effect. Besides,

other investigators report that the differences in

transfection efficacy between PEI and PLL cannot be

sustained on the buffering effect of PEI upon lysosomal

pH, because according to their measurements the

intralysosomal pH of cells transfected with PEI-polyplexes

remains unaltered (Godbey et al, 2000; Forrest and Pack

2002). In any case, the different authors interpret their

respective findings in different ways. Thus, according to

Godbey el al., the increased effectiveness of PEI with

respect to PLL is explained by the capacity of PEI to avoid

the lysosomal degradation route followed by PLL

polyplexes. These authors accordingly proposed different

intracellular processing mechanisms for each type of

polyplex (Godbey et al, 1999a; Godbey et al, 2000). On

the other hand, Forest et al, maintain that it is necessary

for PEI-polyplexes to be exposed to an acidic environment

(endosome-lysosome fusion) in order to achieve endosome

DNA release. Moreover, they observe no trafficking of

PLL-polyplexes towards lysosomes in some cell lines.

Again, different routes for PEI and PLL polyplexes are

postulated, though in this case the situation is opposite that

proposed above. Uncertainty therefore remains about the

intracellular fate of polyplexes and their endolysosomal

processing.

Apart from such discrepancies regarding the particle

processing mechanisms, there seems to be general

agreement that knowledge of the relation between PEI-

polyplexes and intralysosomal pH is critical for

understanding PEI polyplex transfection activity. We

therefore decided to further investigate the influence of pH

upon the interaction between DNA and PEI. To this effect,

we added PEI polyplexes to solutions at different pH

(from 3.5 to 12) and studied the intensity of the resulting

interaction between DNA and PEI based on a fluorescence

decay assay (Guillem et al, 2002b). Our results indicate

that the intensity of interaction between DNA and PEI

decreases at basic pH and is enforced at acid pH values.

Considering the physico-chemical properties of PEI, this

seems logical, since at acid pH values PEI positive charge

increases and its capacity to interact with negatively

charged DNA should also increase. In contrast, as pH

becomes less acidic, the PEI positive charge decreases,

and DNA-PEI ionic interaction can be expected to

decrease gradually, releasing DNA. These data suggest

that, at intracellular level, an acidic environment, far from

stimulating the dissociation of PEI-DNA complexes

(which, if lysosomal pH is not modified by PEI

polyplexes, would threaten DNA integrity in the

lysosome), seems to actually strength PEI-DNA

interaction - and this could contribute to protect DNA

from lysosomal degradation.

Another point still far from being clarified is how

polyplexes leave the endosomes. While some authors have

used electron microscopy to detect endolysosomal

microrupture (Bieber et al, 2002), other investigators have

failed to detect any endolysosome vesicle alterations

(Remy-Kristensen et al, 2001) - even when transgene

expression is subsequently achieved. Again, the results

obtained seem to depend on the cell type involved. In any

case, if endosome disruption effectively occurs, it appears

to be on a non-massive scale, since the phenomenon has

been only scarcely detected. Nevertheless, the fact that

peptides such as melittin, which has endosomolytic

properties (thus contributing to nucleic acid release into

the cytoplasm), increase the transfection efficacy of PEI

polyplexes (Ogris et al, 2001a) speaks in favor of the

convenience of promoting endosomal release.

E. Cytoplasm transport and nuclearaccession

In reference to cytoplasmic transport, some authors

who have studied the dependence of inert particle

cytoplasmic diffusion upon size, concluded that particle

mobility is effectively dependent upon particle size – those

measuring more than 54 nm presenting impaired diffusion


377

(Luby-Phelps et al, 1987). Nevertheless, it has been found

that large particles can migrate through the cytoplasm not

only by diffusion, but also via other mechanisms in which

cytoskeletal components such as the microtubuli or actin

filaments are involved, thereby facilitating polyplex

transport (Meyer et al, 1997). Accordingly, if finally PEI

polyplexes are released into the cytoplasm following

endosomal disruption, they theoretically could be

transported to the nucleus – especially those particles

measuring less than 54 nm in size. With respect to the

nuclear envelope, one aspect that suggests the latter to be

an important barrier for nucleic acid transference to the

nucleus is the fact that when cells are allowed to undergo

mitosis after adding polylysine (Brunner et al, 2000) or

PEI polyplexes (Brunner et al, 2000; Remy-Kristensen et

al, 2001), these are transfected much more efficiently than

when the cell cycle has been arrested. Thus, it can be

concluded that mitosis (and consequently nuclear

dismantling) facilitates transfection – this being the reason

why superior transfection efficacy is generally obtained

with rapidly proliferating cells than in cells that either do

not divide or do so only slowly. Nevertheless, since some

cells that do not divide can be transfected, there must be

mechanisms for penetrating the nucleus in the presence of

the nuclear envelope.

Some authors have proposed that polyplex entry to

the nucleus could involve polyplex fusion with the nuclear

membranes, mediated by polyplex interaction with the

negatively charged membrane phospholipids (Godbey et

al, 1999c). According to these authors, at a certain

moment during polyplex trafficking, the particles could

establish contact with phospholipids - those synthesized

continuously for membrane regeneration or those from the

endosomal membrane. In any case, polyplexes could

become coated with a lipid envelope and perhaps on

interacting with the phospholipids of the nuclear envelope,

the coated polyplexes could finally fuse with the nuclear

membranes and thus access the interior of the nucleus.

Another potential route for polyplex access to the

nucleus that would not imply nuclear envelope

modification or rupture is based on the existence of the

nuclear pores. In this context, while pore diameter is 80

nm, pore structure leaves free only a central water channel

of 9 nm - though particles up to 28 nm in diameter can be

transported to the nucleus via the activation of transport

mechanisms that imply energy consumption (Nigg, 1997).

It is therefore theoretically possible for small polyplex

particles (less than 28 nm in size) to access the nucleus

through the nuclear pores. The nuclear importation of

molecules larger than 40,000 Da (generally proteins) is

known to be highly selective and depends on the presence

of a short amino acid sequence called a nuclear location

signal (NLS)(Newmeyer 1993). For this reason, with the

aim of facilitating nuclear delivery, and this improving

transfection efficacy, many polyplex formulations also

incorporate nuclear location sequences (Branden et al,

1999; Zanta et al, 1999) or peptides such as melittin (Ogris

et al, 2001a) which in addition to possessing

endosomolytic activity also has nuclear targeting

properties. Improvements in transfection efficacy

associated to the use of NLS suggest that polyplexes can at

least partially benefit from transport mechanisms through

nuclear pores.

F. PEI polyplex dissociation within the

nucleus: nuclear availabilityIn order for vehiculized nucleic acid to modify gene

expression (by means of a transgene or oligonucleotides),

it is assumed that the non-nucleic component in general, or

the cationic polymer in the case of polyplexes, must

separate from the nucleic acid at some point. In the case of

lipoplexes, the use of fluorescent labeled DNA and lipids

has shown that whereas labeled DNA appears in the

nucleus, the cationic lipids do not. This suggests that

lipoplex disassembly takes place before the DNA reaches

the nucleus (Marcusson et al, 1998). However, in the case

of polyplexes, the evidence suggests that the polymer

(fundamentally PEI) not only accompanies the nucleic

acid to the nucleus but moreover targets it to the latter

(Boussif et al, 1995; Pollard et al, 1998; Godbey et al,

1999c; Wightman et al, 2001). Thus, in experiments

involving cytoplasmic injection, the DNA vehiculized in

polyplexes produced an increase in the portion of DNA

released into the nucleus (up to 10-fold in the case of PEI-

polyplexes) with respect to naked DNA (Pollard et al,

1998).

Internalization experiments in certain cell models

involving fluorescent PEI administered either alone or

forming part of polyplexes have revealed preferential

fluorescence location in the nucleus (Godbey et al, 1999c).

With respect to disassembly, the destination seems to

depend on the nucleic acid size. Thus, in the case of

oligonucleotides, some evidence indicates that the latter

separate from the polymer (PEI) once within the nucleus

(Dheur et al, 1999; Guillem et al, 2002a). In our

transfection experiments with immunopolyplexes or

untargeted PEI-polyplexes carrying FITC labeled

oligonucleotides in Jurkat (non-adherent cells) and B16

(adherent) cells, respectively, we observed that the initially

quenched fluorescence of oligo-FITC in the polyplexes (at

95% to N/P 10) is progressively recovered once polyplex

or immunopolyplex has been incorporated into the cell and

disassembled - a process which can be seen with

fluorescence microscopy (Figure 2). Fluorescence is

located mainly in the nucleus in both models (Figure 3),

thus indicating that targeting does not alter the

intracellular processing of polyplexes - though the kinetics

are different (immunopolyplex trafficking being faster).

In the case of PEI polyplexes carrying plasmid DNA,

it seems that although the former reach the nucleus, most

polyplexes remain undissociated. This at least is the

interpretation of the experiment conducted by Godbey and

coworkers (Godbey et al, 1999c). In effect, when PEI and

nucleic acid are labeled with green and red fluorescent

probes, respectively, and polyplex is subsequently formed,

the fluorescence observed is yellow–thus indicating that

the green and red probes are located sufficiently close to

allow fluorescence overlapping. When the intracellular

route of these labeled PEI-polyplexes is followed,

fluorescence labeling in the nucleus is seen to be mainly of

a yellow color (undissociated polyplexes) - though some

green and red dots (corresponding to dissociated


378

Figure 2. Imaging of B16 cells treated with PEI-polyplexes bearing FITC labeled oligonucleotides. Cells were visualized under

fluorescence microscopy at 0 (a) 6(b) and 24 hours(d) after PEI polyplex addition (c ,cells seen under transmitted light).

complexes) appear extranuclearly. However, as mentioned

in previous sections, there is evidence to suggest that

polyplex destination is strongly dependent upon the cell

type involved (Remy-Kristensen et al, 2001; Bieber et al,

2002). In many studies it has not been possible to detect

the presence of exogenous DNA in the nucleus (either

along or accompanied by PEI), though transgene

expression has been detected (Remy-Kristensen et al,

2001; Bieber et al, 2002). This on one hand indicates that

it is not possible to know whether in these cases the

expressed DNA has reached the nucleus in free form or

accompanied by the polymer. On the other hand, it

suggests that the presence of many DNA copies is not

needed to ensure transgene expression (this being the

reason why transgene expression observed in the Godbey

nuclear location experiment could be due to the small

proportion of DNA dissociated from the polymer). This

hypothesis is reinforced by the observations of direct DNA

injection experiments: only 10 copies per nucleus sufficed

to achieve transgene expression (Pollard et al, 1998).

Nevertheless, the fact that direct polyplex injection (PEI or

PLL polyplexes with a small number of transgene copies

in different cell types) into the nucleus affords transgene

expression, and that this does not happen with lipoplexes

(Pollard et al, 1998), indicates that polyplex can be

disassembled, at least partially, within the nucleus. This in

turn generates new questions, however: Is it possible for

exogenous gene expression to occur without polyplex

disassembly? Without discarding that exogenous gene

expression could originate from a small part of plasmid

molecules that can be released, the possibility exists that

the transcription machinery (as if PEI were the cationic

nuclear proteins associated to genomic DNA), could

temporarily separate DNA from polymer – this in turn

being sufficient to allow transgene transcription. To date,

the limited experimental evidence in this direction is

provided by the work of Bieber and coworkers (Bieber et

al, 2002). In order to verify whether PEI-DNA interaction

could be a critical stage for transfection, these

investigators conducted tests of in vitro transcription with

PEI polyplexes, observing that transcription is not altered

by the presence of the PEI. This speaks in favor of the

hypothesis of transcriptional disassembly.

IV. In vivo transfection of polyplexesAlthough it was not our aim to conduct an in-depth

review of the mechanisms of polyplex in vivo transfection,

a summarized account will be provided of some critical

aspects of PEI that could be important for understanding

the transfection profile of PEI-polyplexes in vivo,

compared with other polymers also used in vivo.

In vivo gene expression mediated by polyplexes was

first reported by Wu and coworkers (Wu et al, 1991) in a

murine model of gene transfer to the liver using

polyplexes based on galactosylated PLL. Despite the time

elapsed since these first results were published, only few

subsequent reports have appeared involving the use of


379

Figure 3: Nuclear localization of oligo-F transferred with PEI based vectors. Imaging of B16 cells (Up) transfected with PEI-oligo

polyplexes (24 after trnasfection) and Jurkat cells (down) transfected with anti CD3 immunopolyplexes (6 h after transfection)

(left,transmitted light; right , fluorescent light)

polyplexes in vivo, and with limited success (De Smedt et

al, 2000). Regarding PEI polyplexes, the more successful

systemic administration models refer to lung gene transfer

(Goula et al, 1998a), though in this case transfection

depends on the formation of aggregates that cause

pulmonary capillary obstruction secondary to

microthrombus formation (Chollet et al, 2002). One of the

important and specific obstacles of in vivo gene transfer is

systemic clearance, i.e., polyplex elimination from blood

before the particles are able to cross the vascular

endothelial fenestrations and interact with the target

tissues. The two main characteristics controlling the

systemic stability of nonviral vectors in general, and of

polyplexes in particular, are particle size and surface

charge. In order to overcome this important problem,

several works have been conducted with the aim of

obtaining small-size polyplexes. By varying the type of

polymer, the preparation conditions, the zeta potential, the

nucleic acid-cationic polymer ratio, and via the addition of

other molecules, it has been possible to reach sizes of

under 200 nm for almost all kinds of polyplexes (Erbacher

et al, 1998). Even with such small-size polyplexes,

interaction of the latter with serum proteins (Dash et al,

1999) and/or later activation of the complement system

(Plank et al, 1996), induces the formation of large particles

that are recognized by the macrophage elimination system.

In order to avoid charge mediated aggregation, covering of

the positively charged surface of the polyplexes has been

performed. Some of the more widely used covering

molecules are hydrophilic polymers, mainly

polyethyleneglycol (Lee et al, 2002; Lim et al, 2000; Ogris

et al, 2001b), and to a lesser extent poly-[N-(2-

hydroxypropyl)methacrylamide] (pHPMA) (Toncheva et

al, 1998), anionic lipids (Mastrobattista et al, 2001), and

even the targeting elements themselves - as is the case of

galactose, (Hashida et al, 1998), the asialoorosomucoids

(Kwoh et al, 1999) or transferrin (Ogris et al, 2001b). In

general, the coated polyplexes exhibit a neutral or negative

zeta potential (surface charge), in addition to much lesser

binding to anionic proteins and scant induction of serum

aggregation compared with uncovered polyplexes

(Kircheis et al, 1999; Ogris et al, 1999).

On the other hand, with the purpose of increasing in

vivo transfection efficacy and specificity, several targeting

elements have been incorporated to the polyplexes. One of

the best worked models is the targeting to the liver of PLL

polyplexes, with the use mainly of ligands that are

recognized and internalized by the hepatic receptors of

asialoglycoproteins, such as the asialoorosomucoids (Wu

et al, 1991; Chowdhury et al, 1993), natural glycosidic

residues like galactose (Perales et al, 1994; Nishikawa et

al, 1998; Wu and Wu 1988) or mannose (Nishikawa et al,

2000), and glycopeptides (Merwin et al, 1994).

Another of the in vivo systemic administration


380

models affording improved results involves gene transfer

to tumors with PLL or PEI polyplexes targeted with

transferrin and EGF (Frederiksen et al, 2000; Kircheis et

al, 2001b). Polyplex targeting with antibodies has been

applied for in vivo transfer to respiratory epithelium.

Different targeting elements, such as anti-PECAM, an

antibody against PECAM1 (platelet endothelial cell

adhesion molecule 1) (Li et al, 2000) attached to a PEI

backbone, or the Fab fragment of polyclonal antibodies

with specificity for the polymeric Ig receptor abundantly

expressed in cells of the pulmonary epithelium, attached to

PLL backbone (Ferkol et al, 1995) have been used.

Another approach has been the search of alternative routes

to systemic administration, including local administration

by direct addition of polyplexes over the targeted tissues

or organs. One type of polymer used in vivo via local

administration is represented by the fractured dendrimers.

The latter have been used for the transfer of a gene with

immunosuppressor activity, with the purpose of

prolonging graft survival in a murine model of heart

transplantation (Qin et al, 1998), obtaining good results.

Also chitosan has been used in pulmonary local

administration with a good toxicity profiles and good

transfection efficacy (Koping-Hoggard et al, 2001).

However, PEI is the polymer offering the greatest success

and efficacy in vivo via local administration. PEI-

polyplexes have been used for nucleic acid transfer to

different organs including the kidneys (Boletta et al,

1997), brain (Boussif et al, 1995; Lemkine et al, 1999),

lungs (Ferrari et al, 1997; Ferrari et al, 1999), and tumors

in diverse locations (Coll et al, 1999; Aoki et al, 2001).

However, few clinical tests have been conducted based on

nucleic acid transfer with polyplexes. This shows that the

field is still in its beginnings, and development will

depend on the improvement of polyplex formulations for

in vivo use.

V. ConclusionsAs we have seen, PEI based vectors have become

important nonviral gene transfer vehicles, mostly because

of the intrinsic properties of PEI. In effect, the latter is

positively charged, thus allowing it to interact

spontaneously with polyanionic nucleic acids and form

stable polyplex particles that can interact with cell

membrane; PEI protects DNA from degradation; and it

allows linker molecule binding (through its primary amine

groups), which in turn facilitates further covalent coupling

of several elements that can improve the transfection

profile of the vector in terms of efficacy and specificity,

such as targeting proteins, nuclear localization sequences,

etc. The transfection pathway of PEI polyplexes has not

been fully elucidated, but they seem to follow an

endocytic route in which PEI protects DNA from

lysosomal degradation and promotes accession of DNA to

the nucleus.

Further efforts are needed to achieve better results

with in vivo use, including improvements in the toxicity

profile and stability in blood circulation, as well as other

aspects involving in vivo nucleic acid transfer efficacy and

specificity.

ReferencesAbdallah B, Hassan A, Benoist C, Goula D, Behr JP and

Demeneix BA (1996). A powerful nonviral vector for in vivo

gene transfer into the adult mammalian brain:

polyethylenimine. Hum Gene Ther 7, 1947-54

Alino SF, Bobadilla M, Garcia-Sanz M, Lejarreta M, Unda F and

Hilario E (1993). In vivo delivery of human alpha 1-

antitrypsin gene to mouse hepatocytes by liposomes.

Biochem Biophys Res Commun 192, 174-81.

Alino SF, Crespo J, Blaya C, Tarrason G, Adán J, Escrig E,

Benet M, Crespo A and Piulats J (1999). Oligonucleotide-

entrapped immunoliposome delivered by mini-osmotic pump

improves the survival of SCID mice bearing human

leukemia. Tumor Targeting 4, 1-9.

Aoki K, Furuhata S, Hatanaka K, Maeda M, Remy JS, Behr JP,

Terada M and Yoshida T (2001). Polyethylenimine-mediated

gene transfer into pancreatic tumor dissemination in the

murine peritoneal cavity. Gene Ther 8, 508-14.

Behr JP (1996). [Gene transfer with amino lipids and amino

polymers]. C R Seances Soc Biol Fil 190, 33-8.

Berh J (1996). Lëponge à protons: un moyen d'entrer dans une

cellule auquel les virus n'ont pas pensé. Méd Sci 12, 56-59.

Bieber T and Elsasser HP (2001). Preparation of a low molecular

weight polyethylenimine for efficient cell transfection.

Biotechniques 30, 74-7, 80-1.

Bieber T, Meissner W, Kostin S, Niemann A and Elsasser H

(2002). Intracellular route and transcriptional competence of

polyethylenimine-DNA complexes. J Control Release 82,

441.

Boletta A, Benigni A, Lutz J, Remuzzi G, Soria MR and Monaco

L (1997). Nonviral gene delivery to the rat kidney with

polyethylenimine. Hum Gene Ther 8, 1243-51.

Boussif O, Lezoualc'h F, Zanta MA, Mergny MD, Scherman D,

Demeneix B and Behr JP (1995). A versatile vector for gene

and oligonucleotide transfer into cells in culture and in vivo:

polyethylenimine. Proc Natl Acad Sci U S A 92, 7297-301.

Boussif O, Zanta MA and Behr JP (1996). Optimized galenics

improve in vitro gene transfer with cationic molecules up to

1000-fold. Gene Ther 3, 1074-80.

Branden LJ, Mohamed AJ and Smith CI (1999). A peptide

nucleic acid-nuclear localization signal fusion that mediates

nuclear transport of DNA. Nat Biotechnol 17, 784-7.

Brunner S, Sauer T, Carotta S, Cotten M, Saltik M and Wagner E

(2000). Cell cycle dependence of gene transfer by lipoplex,

polyplex and recombinant adenovirus. Gene Ther 7, 401-7.

Cardarelli PM, Quinn M, Buckman D, Fang Y, Colcher D, King

DJ, Bebbington C and Yarranton G (2002). Binding to CD20

by anti-B1 antibody or F(ab')(2) is sufficient for induction of

apoptosis in B-cell lines. Cancer Immunol Immunother 51,

15-24.

Chollet P, Favrot MC, Hurbin A and Coll JL (2002). Side-effects

of a systemic injection of linear polyethylenimine-DNA

complexes. J Gene Med 4, 84-91.

Chowdhury NR, Wu CH, Wu GY, Yerneni PC, Bommineni VR

and Chowdhury JR (1993). Fate of DNA targeted to the liver

by asialoglycoprotein receptor-mediated endocytosis in vivo.

Prolonged persistence in cytoplasmic vesicles after partial

hepatectomy. J Biol Chem 268, 11265-71.

Coll JL, Chollet P, Brambilla E, Desplanques D, Behr JP and

Favrot M (1999). In vivo delivery to tumors of DNA

complexed with linear polyethylenimine. Hum Gene Ther10, 1659-66.

Cotten M, Langle-Rouault F, Kirlappos H, Wagner E, Mechtler

K, Zenke M, Beug H and Birnstiel ML (1990). Transferrin-

polycation-mediated introduction of DNA into human

leukemic cells: stimulation by agents that affect the survival

of transfected DNA or modulate transferrin receptor levels.

Proc Natl Acad Sci U S A 87, 4033-7.


381

Cotten M, Wagner E and Birnstiel ML (1993). Receptor-

mediated transport of DNA into eukaryotic cells. Methods

Enzymol 217, 618-44.

Curiel DT, Agarwal S, Wagner E and Cotten M (1991).

Adenovirus enhancement of transferrin-polylysine-mediated

gene delivery. Proc Natl Acad Sci U S A 88, 8850-4.

Dash PR, Read ML, Barrett LB, Wolfert MA and Seymour LW

(1999). Factors affecting blood clearance and in vivo

distribution of polyelectrolyte complexes for gene delivery.

Gene Ther 6, 643-50.

Dasi F, Benet M, Crespo J, Crespo A and Alino SF (2001).

Asialofetuin liposome-mediated human alpha1-antitrypsin

gene transfer in vivo results in stationary long-term gene

expression. J Mol Med 79, 205-12.

De Smedt SC, Demeester J and Hennink WE (2000). Cationic

polymer based gene delivery systems. Pharm Res 17, 113-

26.

Demeneix B, Behr J, Boussif O, Zanta MA, Abdallah B and

Remy J (1998). Gene transfer with lipospermines and

polyethylenimines. Adv Drug Deliv Rev 30, 85-95.

Dheur S, Dias N, van Aerschot A, Herdewijn P, Bettinger T,

Remy JS, Helene C and Saison-Behmoaras ET (1999).

Polyethylenimine but not cationic lipid improves antisense

activity of 3'-capped phosphodiester oligonucleotides.

Antisense Nucleic Acid Drug Dev 9, 515-25.

Duguid JG, Li C, Shi M, Logan MJ, Alila H, Rolland A,

Tomlinson E, Sparrow JT and Smith LC (1998). A

physicochemical approach for predicting the effectiveness of

peptide-based gene delivery systems for use in plasmid-

based gene therapy. Biophys J 74, 2802-14.

Dunlap DD, Maggi A, Soria MR and Monaco L (1997).

Nanoscopic structure of DNA condensed for gene delivery.


Erbacher P, Roche AC, Monsigny M and Midoux P (1996).

Putative role of chloroquine in gene transfer into a human

hepatoma cell line by DNA/lactosylated polylysine

complexes. Exp Cell Res 225, 186-94.

Erbacher P, Zou S, Bettinger T, Steffan AM and Remy JS

(1998). Chitosan-based vector/DNA complexes for gene

delivery: biophysical characteristics and transfection ability.

Pharm Res 15, 1332-9.

Erbacher P, Bettinger T, Belguise-Valladier P, Zou S, Coll JL,

Behr JP and Remy JS (1999a). Transfection and physical

properties of various saccharide, poly(ethylene glycol), and

antibody-derivatized polyethylenimines (PEI). J Gene Med

1, 210-22.

Erbacher P, Remy JS and Behr JP (1999b). Gene transfer with

synthetic virus-like particles via the integrin-mediated

endocytosis pathway. Gene Ther 6, 138-45.

Felgner PL, Barenholz Y, Behr JP, Cheng SH, Cullis P, Huang

L, Jessee JA, Seymour L, Szoka F, Thierry AR, Wagner E

and Wu G (1997). Nomenclature for synthetic gene delivery

systems. Hum Gene Ther 8, 511-2.

Ferkol T, Perales JC, Eckman E, Kaetzel CS, Hanson RW and

Davis PB (1995). Gene transfer into the airway epithelium of

animals by targeting the polymeric immunoglobulin receptor.

J Clin Invest 95, 493-502.

Ferrari S, Moro E, Pettenazzo A, Behr JP, Zacchello F and

Scarpa M (1997). ExGen 500 is an efficient vector for gene

delivery to lung epithelial cells in vitro and in vivo. GeneTher 4, 1100-6.

Ferrari S, Pettenazzo A, Garbati N, Zacchello F, Behr JP and

Scarpa M (1999). Polyethylenimine shows properties of

interest for cystic fibrosis gene therapy. Biochim BiophysActa 1447, 219-25.

Fischer D, Bieber T, Li Y, Elsasser HP and Kissel T (1999). A

novel non-viral vector for DNA delivery based on low

molecular weight, branched polyethylenimine: effect of

molecular weight on transfection efficiency and cytotoxicity.

Pharm Res 16, 1273-9.

Forrest ML and Pack DW (2002). On the kinetics of polyplex

endocytic trafficking: implications for gene delivery vector

design. Mol Ther 6, 57-66.

Frederiksen KS, Abrahamsen N, Cristiano RJ, Damstrup L and

Poulsen HS (2000). Gene delivery by an epidermal growth

factor/DNA polyplex to small cell lung cancer cell lines

expressing low levels of epidermal growth factor receptor.

Cancer Gene Ther 7, 262-8.

Gebhart CL and Kabanov AV (2001). Evaluation of polyplexes

as gene transfer agents. J Control Release 73, 401-16.

Godbey WT, Barry MA, Saggau P, Wu KK and Mikos AG

(2000). Poly(ethylenimine)-mediated transfection: a new

paradigm for gene delivery. J Biomed Mater Res 51, 321-8.

Godbey WT and Mikos AG (2001). Recent progress in gene

delivery using non-viral transfer complexes. J Control

Release 72, 115-25.

Godbey WT, Wu KK and Mikos AG (1999a).

Poly(ethylenimine) and its role in gene delivery. J ControlRelease 60, 149-60.

Godbey WT, Wu KK and Mikos AG (1999b). Size matters:

molecular weight affects the efficiency of poly(ethylenimine)

as a gene delivery vehicle. J Biomed Mater Res 45, 268-75.

Godbey WT, Wu KK and Mikos AG (1999c). Tracking the

intracellular path of poly(ethylenimine)/DNA complexes for


Goula D, Benoist C, Mantero S, Merlo G, Levi G and Demeneix

BA (1998a). Polyethylenimine-based intravenous delivery of

transgenes to mouse lung. Gene Ther 5, 1291-5.

Goula D, Remy JS, Erbacher P, Wasowicz M, Levi G, Abdallah

B and Demeneix BA (1998b). Size, diffusibility and

transfection performance of linear PEI/DNA complexes in

the mouse central nervous system. Gene Ther 5, 712-7.

Guillem VM, Tormo M, Moret I, Benet I, Garcia-Conde J,

Crespo A and Alino SF (2002a). Targeted oligonucleotide

delivery in human lymphoma cell lines using a

polyethyleneimine based immunopolyplex. J Control

Release 83, 133-46.

Guillem VM, Tormo M, Revert F, Benet I, Garcia-Conde J,

Crespo A and Alino SF (2002b). Polyethyleneimine-based

immunopolyplex for targeted gene transfer in human

lymphoma cell lines. J Gene Med 4, 170-82.

Guo W and Lee RJ (2001). Efficient gene delivery via non-

covalent complexes of folic acid and polyethylenimine. J

Control Release 77, 131-8.

Haensler J and Szoka FC, Jr. (1993). Polyamidoamine cascade

polymers mediate efficient transfection of cells in culture.

Bioconjug Chem 4, 372-9.

Hashida M, Takemura S, Nishikawa M and Takakura Y (1998).

Targeted delivery of plasmid DNA complexed with

galactosylated poly(L-lysine). J Control Release 53, 301-10.

Jeong JH, Song SH, Lim DW, Lee H and Park TG (2001). DNA

transfection using linear poly(ethylenimine) prepared by

controlled acid hydrolysis of poly(2-ethyl-2-oxazoline). JControl Release 73, 391-9.

Kabanov AV and Kabanov VA (1995). DNA complexes with

polycations for the delivery of genetic material into cells.


Kircheis R, Kichler A, Wallner G, Kursa M, Ogris M, Felzmann

T, Buchberger M and Wagner E (1997). Coupling of cell-

binding ligands to polyethylenimine for targeted gene

delivery. Gene Ther 4, 409-18.

Kircheis R, Schuller S, Brunner S, Ogris M, Heider KH, Zauner

W and Wagner E (1999). Polycation-based DNA complexes

for tumor-targeted gene delivery in vivo. J Gene Med 1,

111-20.


382

Kircheis R, Blessing T, Brunner S, Wightman L and Wagner E

(2001a). Tumor targeting with surface-shielded ligand--

polycation DNA complexes. J Control Release 72, 165-70.

Kircheis R, Wightman L, Schreiber A, Robitza B, Rossler V,

Kursa M and Wagner E (2001b). Polyethylenimine/DNA

complexes shielded by transferrin target gene expression to

tumors after systemic application. Gene Ther 8, 28-40.

Kircheis R, Wightman L and Wagner E (2001c). Design and

gene delivery activity of modified polyethylenimines. Adv

Drug Deliv Rev 53, 341-58.

Kjellen L and Lindahl U (1991). Proteoglycans: structures and

interactions. Annu Rev Biochem 60, 443-75.

Klemm AR, Young D and Lloyd JB (1998). Effects of

polyethyleneimine on endocytosis and lysosome stability.

Biochem Pharmacol 56, 41-6.

Koping-Hoggard M, Tubulekas I, Guan H, Edwards K, Nilsson

M, Varum KM and Artursson P (2001). Chitosan as a

nonviral gene delivery system. Structure-property

relationships and characteristics compared with

polyethylenimine in vitro and after lung administration in

vivo. Gene Ther 8, 1108-21.

Kukowska-Latallo JF, Bielinska AU, Johnson J, Spindler R,

Tomalia DA and Baker JR, Jr. (1996). Efficient transfer of

genetic material into mammalian cells using Starburst

polyamidoamine dendrimers. Proc Natl Acad Sci U S A 93,

4897-902.

Kwoh DY, Coffin CC, Lollo CP, Jovenal J, Banaszczyk MG,

Mullen P, Phillips A, Amini A, Fabrycki J, Bartholomew

RM, Brostoff SW and Carlo DJ (1999). Stabilization of poly-

L-lysine/DNA polyplexes for in vivo gene delivery to the

liver. Biochim Biophys Acta 1444, 171-90.

Labat-Moleur F, Steffan AM, Brisson C, Perron H, Feugeas O,

Furstenberger P, Oberling F, Brambilla E and Behr JP

(1996). An electron microscopy study into the mechanism of

gene transfer with lipopolyamines. Gene Ther 3, 1010-7.

Lecocq M, Wattiaux-De Coninck S, Laurent N, Wattiaux R and

Jadot M (2000). Uptake and intracellular fate of

polyethylenimine in vivo. Biochem Biophys Res Commun

278, 414-8.

Lee H, Jeong JH and Park TG (2002). PEG grafted polylysine

with fusogenic peptide for gene delivery: high transfection

efficiency with low cytotoxicity.. J Control Release 79,

283-91.

Lemkine GF, Goula D, Becker N, Paleari L, Levi G and

Demeneix BA (1999). Optimisation of polyethylenimine-

based gene delivery to mouse brain. J Drug Target 7, 305-

12.

Li S, Tan Y, Viroonchatapan E, Pitt BR and Huang L (2000).

Targeted gene delivery to pulmonary endothelium by anti-

PECAM antibody. Am J Physiol Lung Cell Mol Physiol278, L504-11.

Lim DW, Yeom YI and Park TG (2000). Poly(DMAEMA-

NVP)-b-PEG-galactose as gene delivery vector for

hepatocytes. Bioconjug Chem 11, 688-95.

Luby-Phelps K, Castle PE, Taylor DL and Lanni F (1987).

Hindered diffusion of inert tracer particles in the cytoplasm

of mouse 3T3 cells. Proc Natl Acad Sci U S A 84. 4910-3

Marcusson EG, Bhat B, Manoharan M, Bennett CF and Dean

NM (1998). Phosphorothioate oligodeoxyribonucleotides

dissociate from cationic lipids before entering the nucleus.


Marschall P, Malik N and Larin Z (1999). Transfer of YACs up

to 2.3 Mb intact into human cells with polyethylenimine.

Gene Ther 6, 1634-7.

Mastrobattista E, Kapel RH, Eggenhuisen MH, Roholl PJ,

Crommelin DJ, Hennink WE and Storm G (2001). Lipid-

coated polyplexes for targeted gene delivery to ovarian

carcinoma cells. Cancer Gene Ther 8, 405-13.

Merwin JR, Noell GS, Thomas WL, Chiou HC, DeRome ME,

McKee TD, Spitalny GL and Findeis MA (1994). Targeted

delivery of DNA using YEE(GalNAcAH)3, a synthetic

glycopeptide ligand for the asialoglycoprotein receptor.


Meyer B, Uyech L and Szoka F (1997). Manipulating the

intracellular trafficking of nucleic acids. Gene Therapy for

diseases of the Lung. Brigham. New York, Marcel Dekker:135-180.

Mislick KA, Baldeschwieler JD, Kayyem JF and Meade TJ

(1995). Transfection of folate-polylysine DNA complexes:

evidence for lysosomal delivery. Bioconjug Chem 6, 512-5.

Mislick KA and Baldeschwieler JD (1996). Evidence for the role

of proteoglycans in cation-mediated gene transfer. Proc Natl

Acad Sci U S A 93, 12349-54.

Moret I, Esteban Peris J, Guillem VM, Benet M, Revert F, Dasi

F, Crespo A and Alino SF (2001). Stability of PEI-DNA and

DOTAP-DNA complexes: effect of alkaline pH, heparin and

serum. J Control Release 76, 169-81.

Newmeyer DD (1993). The nuclear pore complex and

nucleocytoplasmic transport. Curr Opin Cell Biol 5, 395-

407.

Nigg EA (1997). Nucleocytoplasmic transport: signals,

mechanisms and regulation. Nature 386, 779-87.

Nishikawa M, Takemura S, Takakura Y and Hashida M (1998).

Targeted delivery of plasmid DNA to hepatocytes in vivo:

optimization of the pharmacokinetics of plasmid

DNA/galactosylated poly(L-lysine) complexes by controlling

their physicochemical properties. J Pharmacol Exp Ther287, 408-15

Nishikawa M, Takemura S, Yamashita F, Takakura Y, Meijer

DK, Hashida M and Swart PJ (2000). Pharmacokinetics and

in vivo gene transfer of plasmid DNA complexed with

mannosylated poly(L-lysine) in mice. J Drug Target 8, 29-

38.

Ogris M, Steinlein P, Kursa M, Mechtler K, Kircheis R and

Wagner E (1998). The size of DNA/transferrin-PEI

complexes is an important factor for gene expression in

cultured cells. Gene Ther 5, 1425-33.

Ogris M, Brunner S, Schuller S, Kircheis R and Wagner E

(1999). PEGylated DNA/transferrin-PEI complexes: reduced

interaction with blood components, extended circulation in

blood and potential for systemic gene delivery. Gene Ther 6,

595-605.

Ogris M, Wagner E and Steinlein P (2000). A versatile assay to

study cellular uptake of gene transfer complexes by flow

cytometry. Biochim Biophys Acta 1474, 237-43.

Ogris M, Carlisle RC, Bettinger T and Seymour LW (2001a).

Melittin enables efficient vesicular escape and enhanced

nuclear access of nonviral gene delivery vectors. J BiolChem 276, 47550-5.

Ogris M, Steinlein P, Carotta S, Brunner S and Wagner E

(2001b). DNA/polyethylenimine transfection particles:

influence of ligands, polymer size, and PEGylation on

internalization and gene expression. AAPS PharmSci 3,

E21.

O'Neill MM, Kennedy CA, Barton RW and Tatake RJ (2001).

Receptor-mediated gene delivery to human peripheral blood

mononuclear cells using anti-CD3 antibody coupled to

polyethylenimine. Gene Ther 8, 362-8.

Papisov IM and Litmanovich A (1988). Molecular "recognition"

in interpolymer interactions and matrix polymerization. Adv.Polym. Sci. 90, 139-179.

Perales JC, Ferkol T, Beegen H, Ratnoff OD and Hanson RW

(1994). Gene transfer in vivo: sustained expression and

regulation of genes introduced into the liver by receptor-

targeted uptake. Proc Natl Acad Sci U S A 91, 4086-90.


383

Plank C, Zatloukal K, Cotten M, Mechtler K and Wagner E

(1992). Gene transfer into hepatocytes using

asialoglycoprotein receptor mediated endocytosis of DNA

complexed with an artificial tetra-antennary galactose ligand.


Plank C, Oberhauser B, Mechtler K, Koch C and Wagner E

(1994). The influence of endosome-disruptive peptides on

gene transfer using synthetic virus-like gene transfer systems.

J Biol Chem 269, 12918-24.

Plank C, Mechtler K, Szoka FC, Jr. and Wagner E (1996).

Activation of the complement system by synthetic DNA

complexes: a potential barrier for intravenous gene delivery.


Pollard H, Remy JS, Loussouarn G, Demolombe S, Behr JP and

Escande D (1998). Polyethylenimine but not cationic lipids

promotes transgene delivery to the nucleus in mammalian

cells.. J Biol Chem 273, 7507-11.

Poulain L, Ziller C, Muller CD, Erbacher P, Bettinger T, Rodier

JF and Behr JP (2000). Ovarian carcinoma cells are

effectively transfected by polyethylenimine (PEI)

derivatives. Cancer Gene Ther 7, 644-52.

Pouton CW, Lucas P, Thomas BJ, Uduehi AN, Milroy DA and

Moss SH (1998). Polycation-DNA complexes for gene

delivery: a comparison of the biopharmaceutical properties

of cationic polypeptides and cationic lipids. J ControlRelease 53, 289-99.

Puls R and Minchin R (1999). Gene transfer and expression of a

non-viral polycation-based vector in CD4+ cells. Gene Ther

6, 1774-8.

Qin L, Pahud DR, Ding Y, Bielinska AU, Kukowska-Latallo JF,

Baker JR, Jr. and Bromberg JS (1998). Efficient transfer of

genes into murine cardiac grafts by Starburst

polyamidoamine dendrimers. Hum Gene Ther 9, 553-60.

Remy-Kristensen A, Clamme JP, Vuilleumier C, Kuhry JG and

Mely Y (2001). Role of endocytosis in the transfection of

L929 fibroblasts by polyethylenimine/DNA complexes.

Biochim Biophys Acta 1514, 21-32.

Sosnowski BA, Gonzalez AM, Chandler LA, Buechler YJ,

Pierce GF and Baird A (1996). Targeting DNA to cells with

basic fibroblast growth factor (FGF2). J Biol Chem 271,

33647-53.

Suh J, Paik H and Hwang B (1994). Ionization of

polyethylenimine and polyallylamine at various pHs. Bioorg.Chem 22, 318-327.

Suh W, Chung JK, Park SH and Kim SW (2001). Anti-JL1

antibody-conjugated poly (L-lysine) for targeted gene

delivery to leukemia T cells. J Control Release 72, 171-8.

Tang MX, Redemann CT and Szoka FC, Jr. (1996). In vitro gene

delivery by degraded polyamidoamine dendrimers.


Tang MX and Szoka FC (1997). The influence of polymer

structure on the interactions of cationic polymers with DNA

and morphology of the resulting complexes. Gene Ther 4,

823-32.

Toncheva V, Wolfert MA, Dash PR, Oupicky D, Ulbrich K,

Seymour LW and Schacht EH (1998). Novel vectors for gene

delivery formed by self-assembly of DNA with poly(L-

lysine) grafted with hydrophilic polymers. Biochim Biophys

Acta 1380, 354-68.

Turek J, Dubertret C, Jaslin G, Antonakis K, Scherman D and

Pitard B (2000). Formulations which increase the size of

lipoplexes prevent serum-associated inhibition of

transfection. J Gene Med 2, 32-40.

van de Wetering P, Cherng JY, Talsma H, Crommelin DJ and

Hennink WE (1998). 2-(Dimethylamino)ethyl methacrylate

based (co)polymers as gene transfer agents. J Control

Release 53, 145-53.

van der Jagt RH, Badger CC, Appelbaum FR, Press OW,

Matthews DC, Eary JF, Krohn KA and Bernstein ID (1992).

Localization of radiolabeled antimyeloid antibodies in a

human acute leukemia xenograft tumor model. Cancer Res

52, 89-94.

Wagner E, Zenke M, Cotten M, Beug H and Birnstiel ML

(1990). Transferrin-polycation conjugates as carriers for

DNA uptake into cells. Proc Natl Acad Sci U S A 87, 3410-

4.

Wagner E, Cotten M, Foisner R and Birnstiel ML (1991).

Transferrin-polycation-DNA complexes: the effect of

polycations on the structure of the complex and DNA

delivery to cells. Proc Natl Acad Sci U S A 88, 4255-9.

Wagner E et al, (1994). Delivery of drugs, proteins and genes

into cells using transferrin as a ligand for receptor-mediated

endocytosis. Adv. Drug. Deliv. Rev 14, 113-136.

Wiethoff CM, Smith JG, Koe GS and Middaugh CR (2001). The

potential role of proteoglycans in cationic lipid-mediated

gene delivery. Studies of the interaction of cationic lipid-

DNA complexes with model glycosaminoglycans. J BiolChem 276, 32806-13.

Wightman L, Kircheis R, Rossler V, Carotta S, Ruzicka R, Kursa

M and Wagner E (2001). Different behavior of branched and

linear polyethylenimine for gene delivery in vitro and in

vivo. J Gene Med 3, 362-72.

Wojda U and Miller JL (2000). Targeted transfer of

polyethylenimine-avidin-DNA bioconjugates to

hematopoietic cells using biotinylated monoclonal

antibodies. J Pharm Sci 89, 674-81.

Wong TK, Nicolau C and Hofschneider PH (1980). Appearance

of beta-lactamase activity in animal cells upon liposome-

mediated gene transfer. Gene 10, 87-94.

Wu GY, Wilson JM, Shalaby F, Grossman M, Shafritz DA and

Wu CH (1991). Receptor-mediated gene delivery in vivo.

Partial correction of genetic analbuminemia in Nagase

rats.PG - 14338-42. J Biol Chem 266.

Wu GY and Wu CH (1987). Receptor-mediated in vitro gene

transformation by a soluble DNA carrier system. J Biol

Chem 262, 4429-32.

Wu GY and Wu CH (1988). Receptor-mediated gene delivery

and expression in vivo. J Biol Chem 263, 14621-4.

Zanta MA, Belguise-Valladier P and Behr JP (1999). Gene

delivery: a single nuclear localization signal peptide is

sufficient to carry DNA to the cell nucleus. Proc Natl Acad

Sci U S A 96, 91-6.

Zenke M, Steinlein P, Wagner E, Cotten M, Beug H and

Birnstiel ML (1990). Receptor-mediated endocytosis of

transferrin-polycation conjugates: an efficient way to

introduce DNA into hematopoietic cells. Proc Natl Acad Sci

U S A 87, 3655-9.

Dr. Salvador F. Aliño and Dr.Vicent M. Guillem


384


385


c-myc: a double-headed Janus that regulates cell

survival and deathReview Article

Rosanna Supino1 and A. Ivana Scovassi2*1Istituto Nazionale per lo Studio e la Cura dei Tumori, Via Venezian 1, 20133 Milano, and 2Istituto di Genetica Molecolare

CNR, Via Abbiategrasso 207, 27100 Pavia, Italy

__________________________________________________________________________________

*Correspondence: A. Ivana Scovassi, Istituto di Genetica Molecolare CNR, Via Abbiategrasso 207, 27100 Pavia, Italy; Tel +39-0382-

546334; Fax +39-0382-422286; E-mail: [email protected]

Key words: Antisense, apoptosis, cancer, c-myc, phosphorylation, TFO

Abbreviations: antisense oligonucleotides, (AS-ODN); disialoganglioside, (GD2); Oligonucleotides, (ODNs); Ribonucleoprotein,

(RNP); triple helix-forming oligonucleotides, (TFOs)

Received: 05 August 2004; Accepted: 07 September 2004; electronically published: September 2004

Summary

A paradox for cancer biology is represented by the fact that some oncogenes, including c-myc, provide an advantage

to cancer cells by stimulating uncontrolled proliferation while, at the same time, they exert a pro-apoptotic activity.

The prominent roles of c-myc and the relevance of phosphorylation and subcellular compartmentalization of c-Myc

protein are described in this review, which focuses also the possible strategies to modulate (i.e. up- and down-

regulate) the c-myc level. The gene expression targeted approach of c-myc modulation as anticancer therapeutic

treatment is discussed.

I. IntroductionA. c-myc: a proto-oncogene with many

functionsIt is generally assumed that the efficacy of anticancer

drugs may be related to cell proliferation control and/or to

the activation of the apoptotic pathway(s). Among the

mediators of such processes, the c-myc proto-oncogene

controls the balance between proliferation and death, thus

playing a crucial role in different cell pathways leading to

opposite effects (Prendergast, 1999; Amati et al, 2001;

Eisenman, 2001; Nasi et al, 2001; Pelengaris et al, 2002;

Pelengaris and Khan, 2003). In this respect, c-myc could

be represented as Janus, the old Roman deity with two

faces who presides over everything by regulating cell

proliferation and cell death (Figure 1).

A simplified view of the activities of c-myc is shown

in Figure 2. In normal cells, c-myc expression is tightly

controlled by mitogenic stimuli and appears to be

necessary, and in some instances sufficient, to induce cells

to enter the S phase of cell cycle and to proliferate, and to

respond to differentiative stimuli (Hoffman and

Liebermann, 1994). Translocation and amplification of the

c-myc gene as well as increased half-life and

overexpression of the oncoprotein, which have been

observed in many tumors, promote tumorigenesis (Spencer

and Groudine, 1991; Marcu et al, 1992).

Deregulation of c-myc occurring in a broad range of

human cancers is often associated with poor prognosis

(Pelengaris et al, 2002). The molecular mechanisms for

the frequently observed deregulation of c-myc in human

cancers could depend on the fact that c-myc

overexpression may antagonize the pro-apoptotic function

of p53 (Ceballos et al, 2000). c-myc controls or affects

other processes relevant to tumorigenesis, e.g. it can

promote transformation by its ability to induce the

expression of telomerase, thus bypassing telomere erosion

and facilitating immortalization (Drissi et al, 2001).

Different factors may regulate in distinct ways c-

myc-promoted cell transformation (O’Hagan et al, 2000).

Among them, Bim acts as a suppressor of Myc-induced

lymphomagenesis (Egle et al, 2004); non-peptide

antagonists of Myc/Max dimerization inhibit c-myc-

induced transformation (Berg et al, 2002); the ATM-

related domain of TRRAP protein, which is involved in

transcriptional regulation and chromatin structure,

modulates c-myc-dependent oncogenesis (Park et al,

2001).

B. c-Myc-interacting proteinsc-Myc protein is a member of the helix-loop-helix

leucine zipper family of transcription factors that bind to a

DNA motif called “E-box”, which consists of the

consensus sequence CACGTG. Efficient binding of c-Myc

Supino and Scovassi: Strategies to modulate the different functions of c-myc

386

to an E-box requires the heterodimerization with its

partner Max, another member of this family. Myc function

is antagonized by the Mad protein, which can also

dimerize with Max and bind to E-boxes (Amati et al,

2001; Baudino and Cleveland, 2001; Zhou and Hurlin,

2001). Since the main activities of Myc strictly depend on

its dimerization with Max, the inhibition of such

interaction may affect different processes. Indeed, small

molecules acting as inhibitors of Myc/Max dimerization

were effective in counteracting the oncogenic activity of

Myc (Berg et al, 2002).

c-myc initiates a transcriptional program that controls

hundred of genes belonging to different functional

categories of myc targets. Some of them can be considered

as direct targets, others are indirectly regulated. The

investigation of the nature of the interaction among c-Myc

network members revealed that it could be modulated

through the formation of distinct sub-nuclear structures

localized in specific compartments (Yin et al, 2001).

Figure 1. Representation of the oncogene c-myc as the double-headed Janus deity. Looking in the direction of both cell proliferation and

death, c-myc controls the basic life processes.

Figure 2. Regulation of different processes by c-myc in normal cells. Effect of c-myc deregulation in promoting cancer.


387

To date, the search for c-myc targets did not provide

conclusive data. A still growing list of proteins regulated

by c-Myc is reported and discussed in many reviews

(Dang, 1999; Sakamuro and Prendergast, 1999; O’Hagan

et al, 2000; Eisenman 2001; Levens, 2002, 2003;

Fernandez et al, 2003; Nilsson and Cleveland, 2003, 2004;

Patel et al, 2004). A variety of molecular, biological and

genetic approaches were devised to identify the mRNAs

induced or repressed by c-myc. Recent advances in

proteomics and microarray technology allowed genome-

wide studies of mRNA transcripts responsive to c-Myc

(Schuhmacher et al, 2001; Shiio et al, 2002; Watson et al,

2002; Fernandez et al, 2003; Orian et al, 2003).

C. Regulation of apoptosis by c-mycThe observation that c-myc null fibroblasts are

resistant to apoptosis highlighted the essential pro-

apoptotic role of this oncogene (Chang et al, 2000). It is

generally assumed that c-myc promotes apoptosis by

sensitizing cells to a variety of insults rather than by acting

as a direct death effector. Yu et al (2002) carried out a

genome-wide survey for myc-mediated gene expression

under apoptotic conditions. Isogenic Rat-1 cell lines that

either overexpress or lack c-myc, were treated with

etoposide, which induced apoptosis at an extent that

depend upon the level of c-myc. The analysis provided the

identification of a cluster of genes that respond to

etoposide and are highly dependent on the cellular myc

status. Moreover, the results revealed also that the

existence of c-myc-independent genes involved in the

apoptotic pathway.

Although a detailed understanding of the signalling

pathways by which c-myc elicits apoptosis is still lacking,

different factors have been shown to modulate c-myc-

induced apoptosis. As first shown by Fanidi et al (1992)

and Bissonnette et al (1992), the ability of c-myc to

promote apoptosis can be suppressed by the

overexpression of bcl-2; the same effect was obtained by

the suppression of the pro-apoptotic factor Bax (Mitchell

et al, 2000). Ionizing radiation-induced apoptosis can be

increased by the activity of c-Myc in suppressing BclXL,

thus suggesting a strategy in desensitizing tumor cells to

DNA damage-induced apoptosis (Maclean et al, 2003).

The transcriptional repressor Mad1, which regulates

negatively cell proliferation, has an inhibitory effect on c-

myc-mediated apoptosis and proliferation (Gehring et al,

2000). Using RNA stable interference (siRNA), Nilsson

and Cleveland (2004) showed that Mnt, a myc antagonist

(Hurlin et al, 2004), triggers apoptosis via the myc target

ODC. A similar indirect effect was described for the

complex formed by the c-myc-negative regulator MBP-1

(c-myc promoter-binding protein 1), and MIP-2A (MBP-1-

interacting protein), which in turn regulates negatively the

MBP-1 activity and the induction of apoptosis (Ghosh et

al, 2001).

A synergy between c-myc and different death

receptors, leading to the release of cytochrome c from

mitochondria, was shown (Klefstrom et al, 2002).

Remarkably, it has been reported that the gene for

cytochrome c, which is required for apoptosis, is a direct

target of c-myc and that c-Myc binds to it (Morrish et al,

2003). The analysis of the apoptosis induced in melanoma

cells after c-myc down-regulation revealed that this

process occurs through the specific depletion of the levels

of glutathione (Biroccio et al, 2002).

In contrast to the pro-apoptotic function usually

ascribed to c-myc, it has been shown that c-myc could

contribute to block apoptosis under some conditions. In

lymphoid CEM cells, treatment with oxysterols reduces c-

Myc protein expression level before promoting apoptosis

(Ayala-Torres et al, 1999), thus suggesting that the

negative regulation of c-Myc does not inhibit the

activation of apoptosis by steroid compounds.

D. c-Myc proteinc-Myc is a highly unstable phosphoprotein with a

half-life of about 15-30 minutes. The phosphorylation sites

Thr58 and Ser62 exert opposite effects on the control of c-

Myc degradation through the ubiquitin-proteasome

pathway (Flinn et al, 1998; Sears et al, 2000; Amati, 2004;

Herbst et al, 2004; Welcker et al, 2004; Yeh et al, 2004).

Recent data indicate that the stability of c-Myc is regulated

by different sequence elements, i.e. the N-terminal

“degron” that signals Myc ubiquitination and degradation,

and the C-terminal “stabilon” that promotes its

sequestration and stabilization into a subnuclear

compartment (Herbst et al, 2004).

The N-terminal domain of c-Myc, which is essential

for transcriptional and transforming activity, binds to !-

tubulin (Alexandrova et al, 1995) and is released from it

during mitosis to facilitate microtubule disassembly. The

release of c-Myc from !-tubulin is regulated by c-Myc

phosphorylation state (Noguchi et al, 1999; Gregory and

Hann, 2000; Niklinski et al, 2000). c-Myc protein shows a

predominant localization in the cytoplasm of interphase

cells, while in proliferating cells its nuclear distribution is

similar to that of some ribonucleoprotein (RNP)-

containing structures (Spector et al, 1987), or is confined

to large amorphous nuclear globules (Henriksson et al,

1988; Koskinen et al, 1991). The existence of a dynamic

modification of c-Myc is suggested by the competition of

phosphorylation and glycosylation for the same site, i.e.

Thr58 (Kamemura et al, 2002).

The search for the precise intracellular localization of

c-Myc in tumor cells, where its degradation is deregulated

with a resulting abnormal stability of the protein in the

nucleus (Flinn et al, 1998; Salghetti et al, 1999; Gregory

and Hann, 2000; Niklinski et al, 2000; Herbst et al, 2004),

revealed that phosphorylated c-Myc accumulates in the

nucleus of tumor cells. Phosphorylated c-Myc is

distributed in the form of spots of different sizes

throughout the nucleus and in the nucleolus (Soldani et al,

2002), where c-myc transcripts were described (Bond and

Wold, 1993). As clearly demonstrated in HeLa cells

(Soldani et al, 2002), phosphorylated c-Myc does

accumulate in large amorphous globules (Henriksson et al,

1998) and its distribution pattern is not reminiscent of the

distribution of non-nucleolar RNP-containing structures,

as reported by Spector et al (1987). Remarkably, in tumor

cells treated with the antimitotic drug paclitaxel, the

immunolabeling for phosphorylated c-Myc changed, and

became more diffused throughout the nucleoplasm


388

(Bottone et al, 2003; Supino et al, unpublished

observations). A typical example of the nuclear

distribution of phosphorylated c-Myc in tumor cells is

shown in Figure 3.

II. Strategies to modulate the c-myc

levelA. OverexpressionThe most common alteration affecting c-myc in

human tumors is gene amplification (Nesbit et al, 1999),

which can range from a single gene duplication to

hundreds of copies. Many experiments based on the

enforced expression of an exogenously introduced c-myc

gene provided the evidence that c-myc amplification could

sensitize tumor cells to apoptosis. The pro-apoptotic role

for c-myc has been first shown in serum-starved primary

or immortalized fibroblasts (Evan et al, 1992; Fanidi et al,

1992) and in IL-3-dependent myeloid cells upon

withdrawal of the cytokine (Askew et al, 1991) and this

role was further confirmed (Alarcon et al, 1996; Dong et

al, 1977; Rupnow et al, 1998). Promising results have

been obtained by Peltenburg et al (2004), who

demonstrated that the stable transfection of IGR39D

melanoma cells with c-myc causes a sensitization of tumor

cells toward apoptosis.

Although it is well established that apoptosis can be

induced by the enforced expression of exogenously

introduced c-myc genes in several experimental systems, it

is interesting to investigate whether constitutive

overexpression of the resident c-myc gene in tumor cells is

sufficient to induce apoptosis. A positive correlation

between endogenous high level of c-myc and apoptosis

propensity was found in lymphoblastic leukemic CEM

cells, which harbor constitutive activation of c-myc and

undergo serum starvation-induced apoptosis (Tiberio et al,

2001).

We addressed this question by examining the effect

of different apoptogenic stimuli on tumorigenic and non-

tumorigenic clones isolated from the SW613-S human

Figure 3. Nuclear localization of phosphorylated c-Myc in HeLa

cells. Immunofluorescence experiments were carried out

according to Bottone et al (2003). Red fluorescence: !-tubulin;

green fluorescence: phosphorylated c-Myc.

colon carcinoma cell line. 12A1 cells (tumorigenic clone)

harbor an endogenous high level of amplification of the c-

myc gene, whereas B3 cells (non-tumorigenic clone) have

a small number of copies of this gene (Lavialle et al,

1988). We found that only cells with endogenous c-myc

overexpression activate the apoptotic machinery in

response to serum deprivation (Donzelli et al, 1999) and

after the treatment with etoposide, doxorubicin and

vitamin D3, which induce Fas-mediated apoptosis (Gorrini

et al, 2003). The low levels of c-myc expression present in

SW613-B3 cells were unable to activate Fas-mediated

apoptosis, thus suggesting that only a high c-myc

expression can bypass the lack of Fas receptor. Apoptosis

driven by DNA damage and long term-culture was

independent of c-myc expression (Gorrini et al, 2003). The

same experimental system was used to define the effect of

c-myc amplification on the response to the antimitotic drug

paclitaxel. A high c-myc amplification level potentiates

paclitaxel cytotoxicity, confers a multinucleated

phenotype and promotes apoptosis to a high extent, thus

suggesting that c-myc expression level is relevant in

modulating the cellular responses to paclitaxel (Bottone et

al, 2003).

In conclusion, the overexpression of c-myc could be a

strategy for therapeutic applications, possibly by

modulating myc levels, thus sensitising tumor cells to

therapy. As an example of the clinical potential of the

analysis of the c-myc expression level in tumors, recent

data obtained on patients with ovarian cancer suggest that

a high c-myc expression level could improve the

chemotherapy response (Iba et al, 2004).

B. Inhibition1. The gene expression targeted therapyThe identification of genes that are important for the

development and maintenance of malignant phenotype

opened new perspectives for eventually inducing a

reversion to normal phenotype. In this view, disease-

associated proteins can be targets of a selective therapy

that would lead to less toxic side effects than the

conventional, often cytotoxic, therapeutic treatment. In

fact, the main limitation to conventional cancer

chemotherapy derives from the lack of specificity of the

drugs, and from pharmacokinetic and manufacturing

problems, which can lead to systemic, and organ toxicity.

This impairs the use of high-dose intensity therapy, giving

rise to a high rate of tumor relapse. The identification of

fundamental genetic differences between malignant and

normal cells resulting, for example, from activated

oncogenes and inactivated tumor suppressor genes, has

made it possible to consider such genes as specific targets

for antitumor therapy. In this respect, many genes have

been selected for antisense therapy, including HER-2/neu,

PKA, TGF-!, EGFR, TGF-ß, IGFIR, P12, MDM2,

BRCA, Bcl-2, ER, VEGF, MDR, ferritin, transferrin

receptor, IRE, c-fos, HSP27, c-myc, c-raf and

metallothioneins. Similar effects can be obtained with

triple helix-forming oligonucleotides (TFOs) that are

synthesized as to bind with a high affinity and specificity

to double stranded DNA.


389

2. Rational for the use of a therapy targeted

against c-mycSeveral genes known to be of importance in the

regulation of apoptosis, cell growth, metastatization and

angiogenesis provide a tantalizing prospect for the

development of anticancer agents. Impaired apoptosis is a

crucial step in tumorigenesis but is also a significant

impediment to cytotoxic therapy (Hu and Kavanagh,

2003). Thus, agents targeted to interfere with appropriate

molecules which regulate the apoptotic response to cell

damage (spontaneous or induced by antitumor drugs)

appear as a more rational therapeutic approach. As above

reported, c-myc and bcl-2 are important regulators of

tumor progression and of apoptotic response to

chemotherapy. Conflicting results have been reported on

the role of c-myc expression in drug resistance (Leonetti et

al, 1999; Knapp et al, 2003; Grassilli et al, 2004).

Implication of c-myc in sensitizing cells to apoptosis in

p53-mutant small cell lung carcinoma (Supino et al, 2001)

and in prostate carcinoma cells (Cassinelli et al, 2004) has

been reported. Thus, in tumors where overexpression of c-

myc is related to drug resistance, a combined treatment

with antitumor drugs and antisense oligonucleotides (AS-

ODN) against c-myc could improve the therapeutic effects.

Additional approaches to modify c-myc expression

consist of peptides, PNA (peptide nucleic acids) and

siRNA (Cutrona et al, 2000; Hosono et al, 2004).

Remarkably, it has been shown that c-Myc expression can

be lowered by affecting the stabilization of a G-

quadruplex structure present in the c-myc promoter (Grand

et al, 2004).

3. Mechanism of action of antisense

oligonucleotides and triple helix forming

oligonucleotidesAS-ODN are able to inhibit specifically the synthesis

of a particular protein by binding to protein-encoding

RNA, thereby preventing RNA function and thus

inhibiting the action of the gene. Antisense therapy should

correct the mutations and abnormal expression of genes of

tumor cells by decreasing their expression, inducing RNA

degradation, and causing a premature termination of RNA

transcription (Head et al, 2002). Oligonucleotides (ODNs)

are short pieces of DNA; their size ranges generally from

18 to 21 nucleotides. They hybridize to a specific target

mRNA and their action can be mediated by the cleavage

of the target DNA or by blocking the translation of RNA.

In the first case, once the AS-ODN is bound to the specific

RNA target, cellular RNase H cleaves the RNA/ODN

complex, cleaving the RNA strand and releasing the ODN

which can bind another specific RNA strand.

Alternatively, ODNs ribozymes can be designed to

hybridize and cleave the target RNA, thus to sterically

bind RNA, with a resulting arrest of translation process.

TFOs are synthesized as to bind with a high affinity

and specificity to the purine strand in the major groove of

homopurine-homopyrimidine sequences in double

stranded DNA. They can bind to DNA by parallel or anti-

parallel orientation. TFOs directed against the purine-rich

tracts of gene promoter regions are able to selectively

reduce the transcription and the expression of target genes,

by blocking binding of transcriptional activators and/or

formation of initiation complexes. TFOs can be used to

mediate site-specific genome modification. Indeed, TFOs

are effective by binding as third strands with sequence

specificity and the resulting triple helices, or TFO-

mutagen complexes, are able to provoke repair and

recombination (Faruqi et al, 2000), leading to directed

mutagenesis, recombination, and, potentially, gene

correction. TFO against p53, c-myc, bcl-2, HER/neu

EGFR, etc have been successfully synthesized (Thomas et

al, 1995; Basye et al, 2001; Shen et al, 2003; Re et al,

2004).

4. Effectiveness of antisense approachi. Experimental validation

The effectiveness of AS-ODN in the reduction of

target gene expression has been differently reported in

preclinical and clinical studies. In vitro studies show that

ODNs are effective in the selective inhibition of gene

expression (Monia et al, 1996; Eberle et al, 2002; Heere-

Ress et al, 2002) and their application in clinical trials is

attractive (Crooke, 1993; Hu and Kavanagh, 2003;

Stephens and Rivers, 2003). Many experimental studies

have been performed with AS-ODNs against several genes

and successful chemosensitization and radiosensitization

was found in combination treatments both in vitro and in

vivo (Bcl-2/Bcl-xL and TRAIL, MDM2, HER-2, adhesion

molecules; Del Bufalo et al, 2003; Rait et al, 2003;

Zangemeister-Wittke, 2003; Wang et al, 2003; Tang et al,

2004). Recently, inhibition of c-myc and cyclin D1,

resulting in a decrease in cell growth, increase of apoptotic

index, inhibition of colony formation mediated by a

decrease of E2F1 mRNA and protein production has been

reported in hepatoma (Simile et al, 2004) and melanoma

cells (Eberle et al, 2002). In an androgen-independent

human prostate cancer xenograft murine model, an AS-

ODN showed inhibition of c-myc translation and tumor

growth and induction of apoptosis. In vivo studies on

distribution of c-myc AS-ODN locally delivered by

gelatin-coated platinum-iridium stents in rabbits indicated

an induction of apoptosis in vascular smooth muscle cells,

suggesting the efficacy of a local treatment (Zhang et al,

2004).

TFOs directed to regulatory sequences in the c-myc

gene have been shown to inhibit transcription factor

binding and transcription in vitro as well as promoter

activity and gene expression in HeLa and MCF-7 cells

(Postel et al, 1991; Thomas et al, 1995; Kim et al, 1998).

Moreover, GT-rich TFOs directed to a sequence near the

P2 promoter were particularly effective in inhibiting c-myc

expression in leukemic and cancer cells (Catapano et al,

2000; McGuffie et al, 2000); daunomycin-conjugated GT-

TFOs showed an increased stability of triple-helix and

thus a higher activity of the TFO in human prostate

(DU145) and breast cancer (MCF-7 and MDA-MB-231)

cells (Carbone et al, 2004).

ii. Clinical results

Although ODNs are under clinical investigation in

different diseases, the majority of them are exploited


390

against cancer for which this form of molecular

therapeutics seems particularly suitable (Biroccio et al,

2003). ODNs are systemically administered and their

toxicities, similar for all compounds, include

thrombocytopenia, hypotension, fever and fatigue. AS-

ODNs against c-myc are currently in phase I study in

humans. The lack of toxicity together with the results

obtained in a large amount of preclinical results (Iversen et

al, 2003; Bayes et al, 2004) support their temptative

therapeutic use.

It should be remembered that many other antisense

approaches, including for example antisenses against

BCL2, XIAP, PKA type I, EGFR, COX-2 inhibitors, gave,

alone or in combination with antitumor agents, preclinical

encouraging results in patients with advanced solid

malignancies (Mani et al, 2003). Indeed this treatment is

well tolerated and it is now in Phase III trials on chronic

lymphocytic leukaemia, non-small-cell lung cancer,

advanced malignant melanoma, multiple myeloma and

prostate carcinoma (Hu and Kavanagh, 2003; Kim et al,

2004). Moreover, the effectiveness also of the oral

administration of this kind of treatment makes this strategy

very promising in cancer therapy (Tortora and Ciardiello,

2003).

iii. Limits of the ODNs approach and attempts to

their overcoming

Low physiological stability, intracellular degradation,

in vivo instability, unfavorable pharmacokinetics (the lack

of transfer across cell membranes), low cellular uptake,

insufficient nuclear accumulation and accessibility to the

target, and the need to deliver AS-ODNs selectively to

diseased tissues to maximize their action and to minimize

their side effect, together with dissociation of DNA

binding, due to changes in DNA or chromatin dynamics,

limit therapeutic applications of AS-ODNs and TFOs

(Wagner, 1995) (Figure 4). For this reason, many delivery

systems such as viral vectors and liposomes to carry the

AS-ODN through the cell membrane and the cytoplasm

into the nucleus have been developed (Head et al, 2002).

The use of lipid-based delivery systems represents a

technological tool for increasing the stability of AS-ODNs

in vivo (Gutierrez-Puente et al, 1999; Leonetti et al, 2001).

The main advantage of liposomes entrapment of AS-ODN

is their large carrying capacity, allowing the delivery of a

large number of asODN molecules for each binding event.

A second advantage is the long circulation longevity of

liposome-entrapped drugs in different animal models

(Webb et al, 1995; Leonetti et al, 2001) mainly due to a

delay of antisense loss by extracellular nucleases.

c-myc-AS-ODN efficiency was increased by

delivering the ODN in sterically stabilized liposomes

targeted against the disialoganglioside (GD2) epitope

(highly expressed in melanoma cells). Encapsulation of

AS-ODNs in GD2-targeted liposomes can protect non-

targeted cells from potential deleterious effects of the AS-

ODNs, and simultaneously enhance the toxicity of the

molecule toward the target cell population. In these

conditions, the down-modulation of c-myc determined a

reduction of cell proliferation and tumorigenicity and an

increased apoptotic rate of human melanoma (Pastorino et

al, 2003). To increase the specificity, a selective delivery

of immunoliposomes has been obtained with cell surface-

directed antibodies grafted on their exteriors (Allen and

Moase, 1996) which, however, lose their advantage in the

treatment of advanced solid tumors (Allen and Moase,

1996; Lopez De Menezes et al, 1998), likely because the

"binding site barrier" restricts the penetration into the

tumor (Yuan et al, 1994). Another strategy to increase the

Figure 4. Factors that can limit the use of antisense oligonucleotides (AS-ODN) or triple helix forming oligonucleotides (TFO). Sites 1-

3 define where the factors reported in the respective boxes can interfere.


391

residence time of the oligonucleotides on the target and to

increase their stability was to modify ODNs and TFOs as

phosphorothioate oligonucleotides, which show a binding

affinity similar to that of the phosphodiester

oligonucleotide. A marked inhibition of c-myc

transcription in HeLa cells has been demonstrated (Kim et

al, 1998). Advantages in the affinity and the half-life of

the binding of TFO to DNA were taken by the

daunomycin-conjugated TFO; with this approach c-myc-

targeted TFO showed a high stability and biological

activity in mammary and prostate carcinoma cells

(Carbone et al, 2004).

III. DiscussionThe oncogene c-myc plays essential roles in

controlling cell cycle and proliferation, differentiation,

tumorigenesis and apoptosis. For its crucial involvement

in the development of cancer as well as in driving tumor

cells to apoptosis, c-myc is a good candidate for the

development of strategies aimed at modulating its activity

in tumor cells.

In this respect, it is generally assumed that an

increased level of c-myc could confer a propensity to

apoptosis to a tumor cell, which is effective in potentiating

the effects of clinical treatments. Even if this pro-apoptotic

effect could be cell- and drug-dependent, promising results

have been obtained in c-myc-overexpressing tumor cells

derived from therapy-resistant tumors, such as melanomas

and colon carcinomas.

An opposite strategy to face tumor development is

the inhibition of the activity of factors that control cell

proliferation and transformation, including c-myc. This

goal is mainly achievable by the use of AS-ODN or TFO.

The increasing amount of preclinical data on the effect of

AS-ODN to c-myc encourages their temptative therapeutic

use. However, potential limitation to gene-targeted

therapies may exist, e.g. the development of resistant

tumor cell populations that lose their sensitivity toward c-

myc inhibition over time. In addition, since c-myc is a

factor involved in determining the fate of normal cells and

tissues, the side effects of its inactivation have to be

considered.

In parallel with the antisense approach, the use of

PNA and siRNA could provide an alternative way of

down-regulating c-myc. The modulation of the functional

interaction of c-Myc with its partners as well as the

development of molecular tools to block the c-myc

promoter could contribute to improve the anticancer

therapy. Further in vitro experiments on different cancer

cell lines will help in developing clinical trials aimed at

obtaining a beneficial up- and down-regulation of c-myc in

human tumors.

AcknowledgmentsThe research at the laboratory of RS and AIS is

supported respectively by AIRC (Associazione Italiana

Ricerca sul Cancro) and MIUR (FIRB Project

RBNE0132MY).

ReferencesAlarcon RM, Rupnow BA, Graeber TG, Knox SJ, and Giaccia

AJ (1996) Modulation of c-Myc activity and apoptosis in

vivo. Cancer Res 56, 4315-4319.

Alexandrova N, Niklinski J, Bliskovsky V, Otterson GA, Blake

M, Kaye FJ, and Zajac-Kaye M (1995) The N-terminal

domain of c-Myc associates with "-tubulin and microtubules

in vivo and in vitro. Mol Cell Biol 15, 5188-5195.

Allen TM, and Moase EH (1996) Therapeutic opportunities for

targeted liposomal drug delivery. Adv Drug Del Rev 21,

117-133.

Amati B (2004) Myc degradation: dancing with ubiquitin ligases.

Proc Natl Acad Sci USA 101, 8843-8844.

Amati B, Frank SR, Donjerkovic D, and Taubert S (2001)

Function of the c-Myc oncoprotein in chromatin remodeling

and transcription. Biochim Biophys Acta 1471, M135-

M145.

Askew DS, Ashmun RA, Simmons BC, and Cleveland JL (1991)

Constitutive c-myc expression in an IL-3-dependent myeloid

cell line suppresses cell cycle arrest and accelerates

apoptosis. Oncogene 6, 1915-1922.

Ayala-Torres S, Zhou F, and Thompson EB (1999) Apoptosis

induced by oxysterol in CEM cells is associated with

negative regulation of c-Myc. Exp Cell Res 246, 193-202.

Basye J, Trent JO, Gao D, and Ebbinghaus SW (2001) Triplex

formation by morpholino oligodeoxyribonucleotides in the

HER-2/neu promoter requires the pyrimidine motif. Nucl

Acids Res 29, 4873-4880.

Baudino TA, and Cleveland JL (2001) The Max network gone

Mad. Mol Cell Biol 21, 691-702.

Bayes M, Rabasseda X, and Prous JR (2004) Gateways to

clinical trials. Methods Find Exp Clin Pharmacol 26, 211-

244.

Berg T, Cohen SB, Desharnais J, Sonderegger C, Maslyar DJ,

Goldberg J, Boger DL, and Vogt PK (2002) Small-molecule

antagonists of Myc/Max dimerization inhibit Myc-induced

transformation of chicken embryo fibroblasts. Proc Natl

Acad Sci USA 99, 3830-3835.

Biroccio A, Benassi B, Filomeni G, Amodei S, Marchini S,

Chiorino G, Rotilio G, Zupi G, and Ciriolo MR (2002)

Glutathione influences c-Myc-induced apoptosis in M14

human melanoma cells. J Biol Chem 277, 43763-43770.

Biroccio A, Leonetti C, and Zupi G (2003) The future of

antisense therapy: combination with anticancer treatments.

Oncogene 22, 6579-6588.

Bissonnette RP, Echeverri F, Mahboubi A, and Green DR (1992)

Apoptotic cell death induced by c-myc is inhibited by bcl-2.

Nature 359, 552-554.

Bond VC, and Wold B (1993). Nucleolar localization of myc

transcripts. Mol Cell Biol 13, 3221-3230.

Bottone MG, Soldani C, Tognon GL, Gorrini C, Lazzè MC,

Brison O, Ciomei M, Pellicciari C, and Scovassi AI (2003)

Multiple effects of paclitaxel are modulated by a high c-myc

amplification level. Exp Cell Res 290, 49-59.

Carbone GM, McGuffie E, Napoli S, Flanagan CE, Dembech C,

Negri U, Arcamone F, Capobianco ML, and Catapano CV

(2004) DNA binding and antigene activity of a daunomycin-

conjugated triplex-forming oligonucleotide targeting the P2

promoter of the human c-myc gene. Nucl Acids Res 32,

2396-2410.

Cassinelli G, Zuco V, Supino R, Lanzi C, Scovassi AI, Semple

SC, and Zunino F (2004) Role of c-myc protein in hormone

refractory prostate carcinoma: cellular response to paclitaxel.

Biochem Pharmacol 68, 923-931.

Catapano CV, McGuffie EM, Pacheco D, and Carbone GM

(2000) Inhibition of gene expression and cell proliferation by

triple helix-forming oligonucleotides directed to the c-myc

gene. Biochemistry 39, 5126-5138.


392

Ceballos E, Delgado MD, Gutierrez P, Richard C, Muller D,

Eilers M, Ehinger M, Gullberg U, and Leon J (2000) c-Myc

antagonizes the effect of p53 on apoptosis and p21WAF1

transactivation in K562 leukemia cells. Oncogene 19, 2194-

2204.

Chang DW, Claassen GF, Hann SR, and Cole MD (2000) The c-

Myc transactivation domain is a direct modulator of

apoptotic versus proliferative signals. Mol Cell Biol 20,

4309-4319.

Crooke ST (1993) Therapeutic applications of oligonucleotides.

Annu Rev Pharmacol Toxicol 32, 329-376.

Cutrona G, Carpaneto EM, Ulivi M, Roncella S, Landt O,

Ferrarini M, and Boffa LC (2000) Effects in live cells of a c-

myc anti-gene PNA linker to a nuclear localization signal.

Nat Biotechnol 18, 300-303.

Dang CV (1999) c-Myc target genes involved in cell growth,

apoptosis, and metabolism. Mol Cell Biol 19, 1-11.

Del Bufalo D, Trisciuoglio D, Scarsella M, Zangemeister-Wittke

U, and Zupi G (2003) Treatment of melanoma cells with a

bcl-2/bcl-xL antisense oligonucleotide induces

antiangiogenic activity. Oncogene 22, 8441-8447.

Dong J, Naito M, and Tsuruo T (1997) c-Myc plays a role in

cellular susceptibility to death receptor-mediated and

chemotherapy-induced apoptosis in human monocytic

leukemia U937 cells. Oncogene 15, 639-647.

Donzelli M, Bernardi R, Negri C, Prosperi E, Padovan L,

Lavialle C, Brison O, and Scovassi AI (1999) Apoptosis-

prone phenotype of human colon carcinoma cells with a high

level amplification of the c-myc gene. Oncogene 18, 439-

448.

Drissi R, Zindy F, Roussel MF, and Cleveland JL (2001) c-Myc-

mediated regulation of telomerase activity is disabled in

immortalized cells. J Biol Chem 276, 29994-30001.

Eberle J, Fecker LF, Brittner JU, Orfanos CE, and Geilen CC

(2002) Decreased proliferation of human melanoma cell lines

caused by antisense RNA against translation factor ELF-

4A1. Br J Cancer 86, 1957-1962.

Egle A, Harris AW, Bouillet P, and Cory S (2004) Bim is a

suppressor of Myc-induced mouse B cell leukemia. Proc

Natl Acad Sci USA 101, 6164-6169.

Eisenman RN (2001) Deconstructing Myc. Genes Dev 15, 2023-

2030.

Evan GI, Wyllie AH, Gilbert CS, Littlewood TD, Land H,

Brooks M, Waters CM, Penn LZ, and Hancock DC (1992)

Induction of apoptosis in fibroblasts by c-myc protein. Cell

69, 119-128.

Fanidi A, Harrington EA, and Evan GI (1992) Cooperative

interaction between c-myc and bcl-2 proto-oncogenes.

Nature 359, 554-556.

Faruqi AF, Datta HJ, Carroll D, Seidman MM, Glazer PM

(2000). Triple-helix formation induces recombination in

mammalian cells via a nucleotide excision repair-dependent

pathway. Mol Cell Biol 20, 990-1000.

Fernandez PC, Frank SR, Wang L, Schroeder M, Liu S, Greene

J, Cocito A, and Amati B (2003) Genomic targets of the

human c-Myc protein. Genes Dev 17, 1115-1129.

Flinn EM, Busch CMC, and Wright APH (1998) myc boxes,

which are conserved in myc family proteins, are signals for

protein degradation via the proteasome. Mol Cell Biol 18,

5961-5969.

Gehring S, Rottmann S, Menkel AR, Mertsching J, Krippner-

Heidenreich A, and Luscher B (2000) Inhibition of

proliferation and apoptosis by the transcriptional repressor

Mad1. Repression of Fas-induced caspase-8 activation. J

Biol Chem 275, 10413-10420.

Ghosh AK, Majumder M, Steele R, White RA, and Ray RB

(2001) A novel 16-kilodalton cellular protein physically

interacts with and antagonizes the functional activity of c-

myc promoter-binding protein 1. Mol Cell Biol 21, 655-662.

Gorrini G, Donzelli M, Torriglia A, Supino R, Brison O,

Bernardi R, Negri C, Denegri M, Counis M-F, Ranzani GN,

and Scovassi AI (2003). Effect of apoptogenic stimuli on

colon carcinoma cell lines with a different c-myc expression

level. Int J Mol Med 11, 737-742.

Grand CL, Powell TJ, Nagle RB, Bearss DJ, Tye D, Gleason-

Guzman M, and Hurley LH (2004) Mutations in the G-

quadruplex silencer element and their relationshipo to c-

MYC overexpression, NM23 repression, and therapeutic

rescue. Proc Natl Acad Sci USA 101, 6140-6145.

Grassilli E, Ballabeni A, Maellaro E, Del Bello B, and Helin K

(2004) Loss of Myc confers resistance to doxorubicin-

induced apoptosis by preventing the activation of multiple

serine protease- and caspase-mediated pathways. J Biol

Chem 279, 21318-21326.

Gregory MA, and Hann SR (2000) c-Myc proteolysis by the

ubiquitin-proteasome pathway, stabilization of c-Myc in

Burkitt's lymphoma cells. Mol Cell Biol 20, 2423-2435.

Gutierrez-Puente Y, Tari AM, Stephens C, Rosenblum M,

Guerra RT, and Lopez-Berestein G (1999) Safety,

pharmacokinetics, and tissue distribution of liposomal P-

ethoxy antisense oligonucletotides targeted to Bcl-2.

Pharmacol Exp Ther 291, 865-869.

Head JF, Elliott RL, and Yang DC (2002) Gene targets of

antisense therapies in breast cancer. Exp Opin Ther Targets

6, 375-385.

Heere-Ress E, Thallinger C, Lucas T, Schlagbauer-Wadl H,

Wacheck V, Monia BP, Wolff K, Pehamberger H, and

Jansen B (2002) Bcl-X(L) is a chemoresistance factor in

human melanoma cells that can be inhibited by antisense

therapy. Int J Cancer 99, 29-34.

Henriksson M, Classon M, Ingvarsson S, Koskinen P, Sumegi J,

Klein G, and Thyberg J (1988) Elevated expression of c-myc

and N-myc produces distinct changes in nuclear fine

structure and chromatin organization. Oncogene 3, 587-593.

Herbst A, Salghetti SE, Kim SY, and Tansey WP (2004)

Multiple cell-type-specific elements regulate Myc protein

stability. Oncogene 23, 3863-3871.

Hoffman B, and Liebermann DA (1994) Molecular controls of

apoptosis: differentiation/growth arrest primary response

genes, proto-oncogenes, and tumor suppressor genes as

positive and negative modulators. Oncogene 9, 1807-1812.

Hosono T, Mizuguchi H, Katayama K, Xu ZL, Sakurai F, Ishii-

Watabe A, Kawabata K, Yamaguchi T, Nakagawa S,

Mayumi T, and Hayakawa T (2004) Adenovirus vector-

mediated doxycycline-inducible RNA interference. Hum

Gene Ther 15, 813-819.

Hu W, and Kavanagh JJ (2003) Anticancer therapy targeting the

apoptotic pathway. Lancet Oncol 4, 721-729.

Hurlin PJ, Zhou ZQ, Toyo-Oka K, Ota S, Walker WL, Hirotsune

S, and Wynshaw-Boris A (2004) Evidence of mnt-myc

antagonism revealed by mnt gene deletion. Cell Cycle 3, 97-

99.

Iba T, Kigawa J, Kanamori Y, Itamochi H, Oishi T, Simada M,

Uegaki K, Naniwa J, and Terakawa N (2004) Expression of

the c-myc gene as a predictor of chemotherapy response and a

prognostic factor in patients with ovarian cancer. Cancer Sci

95, 418-423.

Iversen PL, Arora V, Acker AJ, Mason DH, and Devi GR (2003)

Efficacy of antisense morpholino oligomer targeted to c-myc

in prostate cancer xenograft murine model and a Phase I

safety study in humans. Clin Cancer Res 9, 2510-2519.

Kamemura K, Hayes BK, Comer FI, and Hart GW (2002)

Dynamic interplay between O-glycosylation and O-

phosphorylation of nucleocytoplasmic proteins: alternative

glycosylation/phosphorylation of THR-58, a known


393

mutational hot spot of c-Myc in lymphomas, is regulated by

mitogens. J Biol Chem 277, 19229-19235.

Kim HG, Reddoch JF, Mayfield C, Ebbinghaus S, Vigneswaran

N, Thomas S, Jones DE, and Miller DM (1998) Inhibition of

transcription of the human c-myc protooncogene by

intermolecular triplex. Biochemistry 37, 2299-2304.

Kim R, Tanabe K, Emi M, Uchida Y, and Toge T (2004)

Potential roles of antisense therapy in the molecular targeting

of genes involved in cancer. Int J Oncol 24, 5-17.

Klefstrom J, Verschuren EW, and Evan G (2002) c-Myc

augments the apoptotic activity of cytosolic death receptor

signaling proteins by engaging the mitochondrial apoptotic

pathway. J Biol Chem 277, 43224-43232.

Knapp DC, Mata JE, Reddy MT, Devi DR, and Iversen PL

(2003) Resistance to chemotherapeutic drugs overcome by c-

Myc inhibition in a Lewis lung carcinoma murine model.

Anticancer Drugs 14, 39-47.

Koskinen PJ, Sistonen L, Evan G, Morimoto R, and Alitalo K

(1991) Nuclear colocalization of cellular and viral myc

proteins with HSP70 in myc-overexpressing cells. J Virol

65, 842-851.

Lavialle C, Modjtahedi N, Cassingena R, and Brison O (1988)

High c-myc amplification level contributes to the

tumorigenic phenotype of the human breast carcinoma cell

line SW613-S. Oncogene 3, 335-339.

Leonetti C, Biroccio A, Benassi B, Stringaro A, Stoppacciaro A,

Semple SC and Zupi G (2001) Encapsulation of c-myc

antisense oligodeoxynucleotides in lipid particles improves

antitumoral efficacy in vivo in a human melanoma line.


Leonetti C, Biroccio A, Candiloro A, Citro G, Fornari C,

Mottolese M, Del Bufalo D, and Zupi G (1999) Increase of

cisplatin sensitivity by c-myc antisense

oligodeoxynucleotides in a human metastatic melanoma

inherently resistant to cisplatin. Clin Cancer Res 5, 2588-

2595.

Levens D (2002) Disentangling the MYC web. Proc Natl Acad

Sci USA 99, 5757-5759.

Levens DL (2003) Reconstructing MYC. Genes Dev 17, 1071-

1077.

Lopez De Menezes DE, Pilarski LM, and Allen TM (1998) In

vitro and in vivo targeting of immunoliposomal doxorubicin

to human B-cell lymphoma. Cancer Res 58, 3320-3330.

Maclean KH, Keller UB, Rodriguez-Galindo C, Nilsson JA, and

Cleveland JL. (2003) c-Myc augments gamma irradiation-

induced apoptosis by suppressing Bcl-XL. Mol Cell Biol 23,

7256-7270.

Mani S, Goel S, Nesterova M, Martin RM, Grindel JM,

Rothenberg ML, Zhang R, Tortora G, and Cho-Chung YS

(2003) Clinical studies in patients with solid tumors using a

second-generation antisense oligonucleotide (GEM 231)

targeted against protein kinase A type I. Ann N Y Acad Sci

1002, 252-262.

Marcu KB, Bossone SA, and Patel AJ (1992) Myc function and

regulation. Annu Rev Biochem 61, 809-860.

McGuffie EM, Pacheco D, Carbone GM, and Catapano CV

(2000) Antigene and antiproliferative effects of a c-myc-

targeting phosphorothioate triple helix-forming

oligonucleotide in human leukemia cells. Cancer Res 60,

3790-3799.

Mitchell KO, Ricci MS, Miyashita T, Dicker DT, Jin Z, Reed JC,

and El-Deiry WS (2000) Bax is a transcriptional target and

mediator of c-myc-induced apoptosis. Cancer Res 60, 6318-

6325.

Monia BP, Johnston FJ, Geiger T, Muller M, and Fabbro D

(1996) Antitumor activity of a phosphorotioate antisense

oligodeoxynucleotide targeted against C-raf kinase. Nat Med

2, 668-675.

Morrish F, Giedt C, and Hockenbery D (2003) c-MYC apoptotic

function is mediated by NRF-1 target genes. Genes Dev 17,

240-255.

Nasi S, Ciarapica R, Jucker R, Rosati J, and Soucek L (2001)

Making decision through Myc. FEBS Lett 490, 153-162.

Nesbit CE, Tersak JM, and Prochownik EV (1999) MYC

oncogenes and human neoplastic disease. Oncogene 18,

3004-3016.

Niklinski J, Claassen G, Meyers C, Gregory MA, Allegra CJ,

Kaye FJ, Hann SR, and Zajac-Kaye M (2000) Disruption of

Myc-tubulin interaction by hyperphosphorylation of c-Myc

during mitosis or by constitutive hyperphosphorylation of

mutant c-Myc in Burkitt's lymphoma. Mol Cell Biol 20,

5276-5284.

Nilsson JA, and Cleveland JL (2003) Myc pathways provoking

cell suicide and cancer. Oncogene 22, 9007-9021.

Nilsson JA, and Cleveland JL (2004) Mnt: master regulator of

the max network. Cell Cycle 3, 588-590.

Noguchi K, Kitanaka C, Yamana H, Kokubu A, Mochizuki T,

and Kuchino Y (1999) Regulation of c-Myc through

phosphorylation at Ser-62 and Ser-71 by c-Jun N-terminal

kinase. J Biol Chem 274, 32580-32587.

O'Hagan RC, Schreiber-Agus N, Chen K, David G, Engelman

JA, Schwab R, Alland L, Thomson C, Ronning DR,

Sacchettini JC, Meltzer P, and DePinho RA (2000) Gene-

target recognition among members of the myc superfamily

and implications for oncogenesis. Nat Genet 24, 113-119.

Orian A, van Steensel B, Delrow J, Bussemaker HJ, Li L,

Sawado T, Williams E, Loo LW, Cowley SM, Yost C, Pierce

S, Edgar BA, Parkhurst SM, and Eisenman RN (2003)

Genomic binding by the Drosophila Myc, Max, Mad/Mnt

transcription factor network. Genes Dev 17, 1101-1114.

Park J, Kunjibettu S, McMahon SB, and Cole MD (2001) The

ATM-related domain of TRRAP is required for histone

acetyltransferase recruitment and Myc-dependent

oncogenesis. Genes Dev 15, 1619-1624.

Pastorino F, Brignole C, Marimpietri D, Pagnan G, Morando A,

Ribatti D, Sample SC, Gambini C, Allen TM, and Ponzoni M

(2003) Targeted liposomal c-myc antisense

oligodeoxynucleotides induce apoptosis and inhibit tumor

growth and metastases in human melanoma models. Clin

Cancer Res 9, 4595-4605.

Patel JH, Loboda AP, Showe MK, Showe LC, and McMahon

SB. (2004) Analysis of genomic targets reveals complex

functions of MYC. Nat Rev Cancer 4, 562-568.

Pelengaris S, Khan M, and Evan G (2002) c-Myc, more than just

a matter of life and death. Nat Rev Cancer 2, 764-776.

Pelengaris S, and Khan M (2003) The many faces of c-Myc.

Arch Biochem Biophys 416, 129-136.

Peltenburg LTC, de Bruin EC, Meersma D, Wilting S,

Jurgensmeier JM and Schrier PI (2004) c-Myc is able to

sensitize human melanoma cells to diverse apoptotic triggers.

Melanoma Res 14, 3-12.

Postel EH, Flint SJ, Kessler DJ, and Hogan ME (1991) Evidence

that a triplex-forming oligodeoxyribonucleotide binds to the

c-myc promoter in HeLa cells, thereby reducing cmyc

mRNA levels. Proc Natl Acad Sci USA 88, 8227-8231.

Prendergast G (1999) Mechanisms of apoptosis by c-Myc.

Oncogene 18, 2967-2987.

Rait AS, Pirollo KF, Ulick D, Cullen K, and Chang EH (2003)

Her-2-targeted antisense oligonucleotide results in

sensitization of head and neck cancer cells to

chemotherapeutic agents. Ann N Y Acad Sci 1002, 79-89.

Re RN, Cook JL, and Giardina JF (2004) The inhibition of tumor

growth by triplex-forming oligonucleotides. Cancer Lett

209, 51-53.

Rupnow BA, Alarcon RM, Giaccia AJ, and Knox SJ (1998) p53

mediates apoptosis induced by c-Myc activation in hypoxic


394

or gamma irradiated fibroblasts. Cell Death Differ 5, 141-

147.

Sakamuro D, and Prendergast GC (1999) New Myc-interacting

proteins: a second Myc network emerges. Oncogene 18,

2942-2954.

Salghetti SE, Kim SY, and Tansey WP (1999). Destruction of

Myc by ubiquitin-mediated proteolysis, cancer-associated

and transforming mutations stabilize Myc. EMBO J 18, 717-

726.

Schuhmacher M, Kohlhuber F, Holzel M, Kaiser C, Burtscher H,

Jarsch M, Bornkamm GW, Laux G, Polack A, Hudle UH,

and Eick D (2001) The transcriptional program of a human B

cell line in response to Myc. Nucl Acids Res 29, 397-406.

Sears R, Nuckolls F, Haura E, Taya Y, Tamai K, and Nevins JR

(2000) Multiple Ras-dependent phosphorylation pathways

regulate Myc protein stability. Genes Dev 14, 2501-2514.

Shen C, Rattat D, Buck A, Mehrke G, Polat B, Ribbert H,

Schirrmeister H, Mahren B, Matuschek C, and Reske SN

(2003) Targeting bcl-2 by triplex-forming oligonucleotide-a

promising carrier for gene-radiotherapy. Cancer Biother

Radiopharm18, 17-26.

Shiio Y, Donohoe S, Yi EC, Goodlett DR, Aebersold R, and

Eisenman RN (2002) Quantitative proteomic analysis of Myc

oncoprotein function. EMBO J 21, 5088-5096.

Simile MM, De Miglio MR, Muroni MR, Frau M, Asara G, Serra

S, Muntoni MD, Seddaiu MA, Daino L, Feo F, and Pascale

RM (2004) Down-regulation of c-myc and Cyclin D1 genes

by antisense oligodeoxy nucleotides inhibits the expression

of E2F1 and in vitro growth of HepG2 and Morris 5123 liver

cancer cells. Carcinogenesis 25, 333-341.

Soldani C, Bottone MG, Biggiogera M, Alpini C, Scovassi AI,

Martin T, and Pellicciari C (2002) Nuclear localization of

phosphorylated c-Myc protein in human tumor cells. Eur J

Histochem 46, 377-380.

Spector DL, Watt RA, and Sullivan NF (1987) The v- and c-myc

oncogene proteins colocalize in situ with small nuclear

ribonucleoprotein particles. Oncogene 1, 5-12.

Spencer CA, and Groudine M (1991) Control of c-myc

regulation in normal and neoplastic cells. Adv Cancer Res

56, 1-48.

Stephens AC, and Rivers RP (2003) Antisense oligonucleotide

therapy in cancer. Curr Opin Mol Ther 5, 118-122.

Supino R, Perego P, Gatti L, Caserini C, Leonetti C, Colantuono

M, Zuco V, Carenini N, Zupi G, and Zunino F (2001) A role

for c-myc in DNA damage-induced apoptosis in a human

TP53-mutant small-cell lung cancer cell line. Eur J Cancer

37, 2247-2256.

Tang NH, Chen YL, Wang XQ, Li XJ, Yin FZ, and Wang XZ

(2004) Cooperative inhibitory effects of antisense

oligonucleotide of cell adhesion molecules and cimetidine on

cancer cell adhesion. World J Gastroenterol 10, 62-66.

Thomas TJ, Faaland CA, Gallo MA, and Thomas T (1995)

Suppression of c-myc oncogene expression by a polyamine-

complexed triplex forming oligonucleotide in MCF-7 breast

cancer cells. Nucl Acids Res 23, 3594-3599.

Tiberio L, Maier JAM, and Schiaffonati L (2001) Down-

modulation of c-myc expression by phorbol ester protects

CEM T leukaemia cells from starvation-induced apoptosis:

role of ornithine decarboxylase and polyamines. Cell Death

Differ 8, 967-976.

Tortora G, and Ciardiello F (2003) Antisense targeting protein

kinase A type I as a drug for integrated strategies of cancer

therapy. Ann N Y Acad Sci 1002, 236-243.

Wagner RW (1995) The state of the art in antisense research. Nat

Med 1, 1116-1118.

Wang H, Oliver P, Zhang Z, Agrawal S, and Zhang R (2003)

Chemosensitization and radiosensitization of human cancer

by antisense anti-MDM2 oligonucleotides: in vitro and in

vivo activities and mechanisms. Ann NY Acad Sci 1002,

217-235.

Watson JD, Oster SK, Shago M, Khosravi F, and Penn LZ

(2002) Identifying genes regulated in a Myc-dependent

manner. J Biol Chem 277, 36921-36930.

Webb MS, Harasym TO, Masin D, Bally MB, and Mayer LD

(1995) Sphingomyelin-cholesterol liposomes significantly

enhance the pharmacokinetic and therapeutic properties of

vincristine in murine and human tumor models. Br J Cancer

72, 896-904.

Welcker M, Orian A, Jin J, Grim JA, Harper JW, Eisenman RN,

and Clurman BE (2004) The Fbw7 tumor suppressor

regulates glycogen synthase kinase 3 phosphorylation-

dependent c-Myc protein degradation. Proc Natl Acad Sci

USA 101, 9085-9090.

Yeh E, Cunningham M, Arnold H, Chasse D, Monteith T, Ivaldi

G, Hahn WC, Stukenberg PT, Shenolikar S, Uchida T,

Counter CM, Nevins JR, Means AR, and Sears R (2004) A

signalling pathway controlling c-Myc degradation that

impacts oncogenic transformation of human cells. Nat Cell

Biol 6, 308-318.

Yin X, Landay MF, Han W, Levitan ES, Watkins SC, Levenson

RM, Farkas DL, and Prochownik EV (2001) Dynamic in

vivo interactions among Myc network members. Oncogene

20, 4650-4664.

Yu Q, He M, Lee NH, and Liu ET (2002) Identification of Myc-

mediated death response pathways by microarray analysis. J

Biol Chem 277, 13059-13066.

Yuan F, Leunig M, Huang SK, Berk DA, Papahadjopoulos D,

and Jain RK (1994) Microvascular permeability and

interstitial penetration of sterically stabilized (stealth)

liposomes in a human tumor xenograft. Cancer Res 54,

3352-3356.

Zangemeister-Wittke U (2003) Antisense to apoptosis inhibitors

facilitates chemotherapy and TRAIL-induced death

signalling. Ann NY Acad Sci 1002, 90-94.

Zhang XX, Cui CC, Xu XG, Hu XS, Fang WH, and Kuang BJ

(2004) In vivo distribution of c-myc antisense

oligodeoxynucleotides local delivered by gelatine-coated

platinum-iridium stents in rabbits and its effect on apoptosis.

Chin Med J 117, 258-263.

Zhou ZQ, and Hurlin PJ (2001) The interplay between Mad and

Myc in proliferation and differentiation. Trends Cell Biol

11, S10-14.

From left to right: Rosanna Supino and A. Ivana Scovassi


395


DNA-based vaccine for treatment of intracerebral

neoplasmsResearch Article

Terry Lichtor1,3*, Roberta P Glick1,3, InSug O-Sullivan2, Edward P Cohen2,4

1Department of Neurological Surgery, Rush University Medical Center and John H Stroger Hospital of Cook County2Department of Microbiology and Immunology, University of Illinois at Chicago; Chicago, Illinois

__________________________________________________________________________________

*Correspondence: Terry Lichtor, MD, PhD, Department of Neurosurgery, 1900 West Polk Street, Chicago, Illinois 60612; Telelphone:

312-864-5120; Fax: 312-864-9606; E-Mail: [email protected]

Key words: Gene Therapy, Breast Cancer, Brain Tumors, Tumor Vaccine

Abbreviations: cytotoxic T-lymphocyte, (CTL); intracerebrally, (i.c.); Mean survival time, (MST); phenazine methosulfate, (PMS);

spontaneous breast neoplasm, (SB-5b); tumor associated antigens, (TAA)

3Supported in part by a grant from CINN Foundation awarded to Drs. Lichtor and Glick4Supported in part by NIDCR grant number RO1DE013970-01A2 awarded to Dr. Cohen

Received: 8 July 2004; revised: 14 September 2004

Accepted: 20 September 2004; electronically published: September 2004

Summary

Antigenic differences between normal and malignant cells of the cancer patient form the rationale for clinical

immunotherapeutic strategies. Because the antigenic phenotype of neoplastic cells varies widely among different

cells within the same malignant cell-population, immunization with a vaccine that stimulates immunity to the broad

array of tumor antigens expressed by the cancer cells is likely to be more efficacious than immunization with a

vaccine for a single antigen. A vaccine prepared by transfer of DNA from the tumor into a highly immunogenic cell

line can encompass the array of tumor antigens that characterize the patient’s neoplasm. Poorly immunogenic

tumor antigens, characteristic of malignant cells, can become strongly antigenic if they are expressed by highly

immunogenic cells. A DNA-based vaccine was prepared by transfer of genomic DNA from a breast cancer that

arose spontaneously in a C3H/He mouse into a highly immunogenic mouse fibroblast cell line, where genes

specifying tumor-antigens were expressed. The fibroblasts were modified in advance of DNA-transfer to secrete an

immune augmenting cytokine and to express allogeneic MHC class I-determinants. In an animal model of breast

cancer metastatic to the brain, introduction of the vaccine directly into the tumor bed stimulated a systemic cellular

anti-tumor immune response and prolonged the lives of the tumor-bearing mice.

I. IntroductionAn emerging strategy in the treatment of cancer

involves stimulation of an immune response against the

unique antigens expressed by the neoplastic cells. The

expectation is that effectively stimulated, the immune

system can be called upon to destroy the malignant cells.

In most instances, proliferating tumors do not provoke

anti-tumor immune responses, which are capable of

controlling tumor growth. The neoplastic cells escape

recognition by the immune system in spite of the fact that

they form weakly immunogenic tumor associated antigens

(TAA). The successful induction of immunity to TAA

could result in tumor cell destruction and prolongation of

the survival of cancer patients. A number of different

techniques have been designed to increase the antigenic

properties of tumor cells. The immunogenic properties of

tumor cells were increased by modifying neoplastic cells

to secrete immune-augmenting cytokines, or by “feeding”

antigen presenting (dendritic) apoptotic bodies from tumor

cells or tumor cell lysates. Anti-tumor immune responses

followed immunization with such vaccines as well as

vaccine prepared by introducing tumor cell-derived RNA

into dendritic cells. Immunization with dendritic cells

“fed” derivates of tumor cells or transfected with tumor-

RNA can result in the induction of immune responses

against the broad array of tumor antigens expressed by the

population of malignant cells including tumors of

neuroectodermal origin. In one pre-clinical study,

intraperitoneal injection of bone marrow-derived dendritic

Lichtor et al: DNA-Based Vaccine for intracerebral neoplasms

396

cells pulsed with the RNA derived from the GL261 glioma

cells induced a T cell response against intracerebrally

implanted GL261 cells (O et al, 2002). The efficacy of the

vaccine was improved further by administration of

recombinant interleukin-12 into the vaccine regimen. In

patients, immunization with autologous dendritic cells

transfected with mRNA from malignant glioma elicited a

tumor specific CD8+ cytotoxic T-lymphocyte (CTL)

response against the patient’s malignant cells (Kobayashi

et al, 2003).

Immunotherapy can result in the selective destruction

of the neoplasm with minimal or non-existent toxic

effects. Selective tumor regression was observed in

experimental animals and patients receiving

immunotherapy alone, suggesting the potential

effectiveness of this type of treatment for patients with

malignant disease (Valmori et al, 2000).

Antigenic differences between normal and malignant

cells form the rationale for clinical immunotherapy

protocols. Because the antigenic phenotype varies widely

among different cells within the same tumor-cell

population, immunization with a vaccine that stimulates

immunity to multiple TAA expressed by the entire

population of malignant cells is likely to be more effective

than immunization with a vaccine for a single antigen.

Variants that fail to express the antigen chosen for therapy

can avoid destruction. Here, in a mouse model, we

describe the application of a novel immunotherapeutic

strategy to intracerebral breast cancer. The vaccine was

prepared by transfer of genomic DNA from breast cancer

cells into a highly immunogenic fibroblast cell line, where

genes specifying breast cancer antigens are expressed

(Cohen, 2001). The vaccine encompasses the array of

TAA that defines the patient’s neoplasm. Poorly

immunogenic TAA, characteristic of malignant cells,

become strongly antigenic if they are expressed by highly

immunogenic cells. In animal models of melanoma and

breast cancer, immunization with DNA-based vaccine was

sufficient to deter tumor growth and to prolong the lives of

tumor-bearing mice (Cohen, 2001; Whiteside et al, 2002).

Previous studies indicated that transfection of genomic

DNA from the malignant cells into the cell line resulted in

stable integration and expression of the transferred DNA

altering both the genotype and the phenotype of the cells

that took up the exogenous DNA. The genetically

engineered cells were effective stimulators of the anti-

tumor immune response. Immunization of tumor-bearing

mice with the DNA-based vaccine resulted in the

induction of cell mediated immunity directed toward the

type of cell from which the DNA was obtained, and

prolongation of survival. This was the case for mice with

melanoma, squamous cell carcinoma and in mice with

breast cancer (de Zoeten et al, 1999). Multiple undefined

genes specifying TAA that characterize the malignant cell

population were expressed by cells that took up DNA from

the tumor. Among other advantages, only microgram

quantities of DNA from small amounts of tumor tissue

were required to prepare the vaccine. As the transferred

DNA is integrated into the genome of the recipient cells,

and is replicated as the cells divide, the number of vaccine

cells can be expanded as required for multiple

immunizations. The recipient cells can also be modified

before DNA transfer to increase their immunogenic

properties, as for example, to secrete immune-augmenting

cytokines or to express allogeneic MHC-determinants. In

animal models, injection of cytokine-secreting allogeneic

fibroblasts into the tumor bed of intracerebral neoplasms

was also effective in the treatment of mice with

established brain tumors (Lichtor et al, 2002).

Although immunotherapy with a vaccine prepared by

transfer of tumor-DNA into a highly immunogenic cell

line has its advantages, there are potential concerns. Genes

that specify normal cellular constituents are also expressed

by the transfected cells. They may be recognized as

‘foreign’ by the immune system, provoking an

autoimmune disease. Autoimmune disease has not been

observed, however, following extensive immunization

with the tumor-DNA-transfected fibroblasts. The immune

system is normally tolerant to “self” antigens. Mice

immunized with DNA-based vaccines have not exhibited

adverse effects; they lived their anticipated life spans

without evidence of disease. Cellular infiltrates into

normal organs or tissues have not been detected. It is also

conceivable that the vaccine itself may grow in the

recipient, forming a tumor or provoking a neoplasm.

However in multiple studies, tumor growth at the

vaccination site or elsewhere in the body has not been

observed.

II. Materials and methods

A. Preparation of a vaccine for use in the

treatment of intracerebral breast cancer by

transfection of cytokine-secreting syngeneic

/allogeneic fibroblasts with DNA from a breast

carcinoma that arose spontaneously in a C3H/He

mouse (SB-5b cells)Cytokine-secreting syngeneic/allogeneic fibroblasts were

prepared as described previously (Lichtor et al, 2002). The cells

were further modified by transferring DNA from mouse SB-5b

breast cancer cells into the fibroblasts (Figure 1). Sheared,

unfractionated DNA isolated (Qiagen, Chatsworth, CA) from a

spontaneous mammary adenocarcinoma (SB-5b) that arose in a

C3H/He mouse taken directly from in vitro cultured cells, was

used to transfect mouse fibroblasts modified to express

allogeneic H-2Kb-determinants and to secrete IL-2 (LM-IL-2Kb

cells), IL-18 (LM-IL-18Kb cells) or GM-CSF (LM-GMCSFKb

cells) or to express H-2Kb-determinants alone (LMKb cells) using

the methods described in (Wigler et al, 1979) as modified.

Briefly, high molecular weight DNA from each cell type was

sheared by passage through the DNA isolation column. The

approximate size of the DNA at the time it was used in the

experiments was 25 kb. Afterward, 100 µg of sheared DNA was

mixed with 10 µg pCDNA6/V5-HisA, a plasmid which gives

resistance to the antibiotic Blasticidin, for use in selection. The

sheared DNA and plasmid (DNA : plasmid ratio = 10 : 1) were

then mixed with Lipofectamine 2000, according to the

manufacturer’s instructions (Life Technologies, Carlsbad, CA).

The DNA/Lipofectamine mixture was added to a population of 1

X 107 actively proliferating LM-IL-2Kb, LM-IL18Kb,

LMGMCSFKb cells, or non-cytokine secreting LMKb cells

divided into ten dishes containing an original inoculum of 1 X

106 cells. Eighteen hours afterward, the medium was replaced

with fresh growth medium. The fibroblasts were maintained for

14 days in growth medium containing 2-5 µg/ml Blasticidin HCl


397

Figure 1. Preparation of the DNA-based vaccine. DNA-based vaccines were prepared by transfection of the fibroblast cell line LM with

DNA from mouse breast carcinoma. Briefly, high-molecular weight DNA from SB-5b cells was sheared by passage through the DNA

isolation column. Next, 100 µg of the sheared DNA was mixed with 10 µg pCDNA6/V5-HisA, a plasmid that confers resistance to

Basticidin. The sheared DNA and the plasmid were then mixed with lipofectamine to facilitate DNA uptake. The DNA-lipofectamine

mixture was added to a population of 1 X 107 LM fibroblasts modified previously by retroviral transduction to secrete IL-2 and to

express H-2Kb-determinants (LM-IL-2Kb cells). The transfected fibroblasts were grown on a tissue culture plate, and Blasticidin was

added to the medium to select for cells that had taken up the foreign plasmid DNA.

(Invitrogen, Carlsbad, CA). One hundred percent of the cells

transfected with tumor-DNA alone maintained in the Basticidin

growth medium died within this period. The surviving colonies

in each of the plates (a total of at least 2.5 X 104) were pooled

and maintained as a cell line for use in the experiments.

B. Intracerebral injection of C3H/He mice

with SB-5b breast cancer cellsAs a model of intracerebral metastatic breast cancer in

patients, C3H/He mice were injected intracerebrally with a

mixture of SB-5b breast cancer cells and the DNA-transfected

modified fibroblasts. Anesthetized mice were placed into a

stereotactic frame. A 1 mm burr hole was introduced into the

right frontal lobe in the region of the coronal suture using a D#60

drill bit (Plastics One, Roanoke, VA). A Hamilton syringe

containing a 26 gauge needle with a small 2-3 mm piece of

solder placed 3-4 mm from the tip of the needle to maintain a

uniform depth of injection was used to introduce the breast

cancer cells and vaccine into the brain. The total injection

volume was 5-10 µl. After injection, the incision over the burr

hole was closed with a single 5-O Dexon absorbable suture.

C. T cell mediated cytotoxicity toward breast

cancer cellsA CellTiter 96 aqueous non-radioactive cell proliferation

assay kit (Promega, Madison WI) was used to measure T cell

mediated cytotoxicity toward the breast cancer cells in mice

injected intracerebrally with the transfected fibroblasts. T cells

from the spleens of mice injected with the transfected cells were

co-incubated for 18 hr with SB-5b cells. Afterward, the number

of remaining viable cells was measured by MTS, which is

bioreduced by cells into a formazan product that can be detected

at 490 nm. Effector T cells recovered from the spleens by

Histopaque (Sigma) density gradient (Kim and Cohen, 1994)

were co-cultured at 370 C for 18 hrs with mitomycin C-treated

(50 µg/ml for 45 min at 370 C) SB-5b target cells. The ratio of

spleen cells to SB-5b cells was 30:1. Afterward, the non-adherent

cells were removed, washed and viable SB-5b cells were added

at various E:T ratios for 4 hrs at 370C. Negative control wells

were treated with 2% Triton-100 to cause total lysis of the cells.

Positive control wells contained SB-5b cells alone. Next 20 µl of

MTS and 1 µl of phenazine methosulfate (PMS), an electron

coupling reagent, were mixed and added to each well, followed

by incubation at 37°C for 1-4 hrs in a 7% CO2/air atmosphere

after which the absorbance was read. The percent specific lysis

was calculated from the absorbance using the formula as follows:

100 X Control Negative– Control Positive

Control Negative– Group alExperiment

D. ELISPOT IFN-! Assay

Spleen cells from C3H/He mice injected i.c. with the

various cell constructs were analyzed in ELISPOT IFN-! assays.

This determines the proportion of T cells reactive with SB-5b

cells. T cells from the spleens were recovered by Histopaque

density gradient and co-incubated with SB-5b tumor cells (the

spleen cell: SB-5b cell ratio = 10:1) for 16 hours at 37°C in wells

precoated with a high-affinity monoclonal antibody for INF-!

according to the manufacturer’s instructions (BD Pharmingen,

San Diego, CA). The cells were washed before the addition of

biotinylated anti-IFN-! detection antibody and horse radish

peroxidase labeled streptavidin (Streptavidin-HRP). The spots

were counted using computer-assisted image analysis

(ImmunoSpot Series 2 analyzer: Cellular Technology Limited,

Cleveland, OH).


398

E. Statistical analysisStudent’s t test was used to determine the statistical

differences between the survival of mice in various experimental

and control groups. A P value less than 0.05 was considered

significant.

III. ResultsA. Treatment of mice bearing an

intracerebral breast cancer with DNA-

transfected syngeneic/allogeneic fibroblasts

modified to secrete immune augmenting

cytokinesThe immunotherapeutic properties of the modified

fibroblasts transfected with DNA from a breast cancer that

arose spontaneously in a C3H/He mouse were determined

in mice with intracerebral breast cancer. C3H/He mice

were injected intracerebrally (i.c.) with a mixture of 1.0 X

104 SB-5b breast carcinoma cells and 1.0 X 106 cytokine-

secreting syngeneic/allogeneic fibroblasts transfected with

DNA from the breast cancer cells. The results (Figure 2)

indicated that mice injected i.c. with a mixture of breast

cancer cells and transfected syngeneic/allogeneic

fibroblasts modified to secrete IL-2 survived significantly

longer than mice injected i.c. with a mixture of breast

cancer cells and non cytokine-secreting, transfected

fibroblasts (P < 0.005). Analogous results were obtained

for mice injected i.c. with a mixture of breast cancer cells

and transfected fibroblasts modified to secrete GM-CSF (P

< 0.05). The survival of mice injected i.c. with SB-5b cells

and transfected fibroblasts modified to secrete IL-18 was

not significantly different than that of mice injected with

SB-5b cells and non-secreting transfected cells. The

experiment was repeated twice with equivalent results.

Thus syngenic/allogeneic fibroblasts modified to

secrete IL-2 or GM-CSF that were transfected with DNA

from breast cancer cells were effective in prolonging the

survival of mice with intracerebral breast cancer.

Transfected fibroblasts modified to secrete IL-18 were not

effective.

B. T cell mediated toxicity toward breast

cancer in mice injected intracerebrally with

syngeneic/allogeneic transfected fibroblasts

modified to secrete IL-2, GM-CSF or IL-18An MTS cytotoxicity assay was used to detect the

presence of cytotoxic T lymphocytes towards breast

cancer in mice injected i.c. with the mixture of SB-5b

breast cancer cells and the modified DNA-transfected

fibroblasts. The T cells, obtained from the spleens of the

injected mice, were analyzed two weeks after the i.c.

injection of the cell mixture. The results (Figure 3)

indicated that, like the survival of mice with i.c. breast

cancer treated with the cytokine-secreting fibroblasts, the

cytotoxic response of greatest magnitude was in mice

injected i.c. with the mixture of SB-5b cells and

transfected fibroblasts modified to secrete IL-2 or GM-

CSF. Lesser cytotoxic effects were present in mice

injected i.c. with SB-5b cells and transfected fibroblasts

modified to secrete IL-18.

An Elispot-IFN-! assay was used to determine the

proportion of T cells in the spleen that were reactive with

Figure 2. Treatment of C3H/He mice with intracerebral SB-5b breast carcinoma with cytokine-secreting allogeneic fibroblasts

transfected with DNA from a spontaneous breast neoplasm (SB-5b). C3H/He mice (nine animals/group) were injected with a mixture of

1.0 X 104 SB-5b cells and 1.0 X 106 cytokine secreting fibroblasts transfected with tumor DNA or with an equivalent number of non-

secreting cells transfected with tumor DNA (LMKb/SB5b). Mean survival time (MST) in days: Media control, 23.0 ± 1.9; LMKb/SB5b,

27.3 ± 6.3; LMKbGMCSF/SB5b, 30.0 ± 9.5; LMKbIL-2/SB5b, 36.6 ± 7.0; LMKbIL-18/SB5b, 28.4 ± 4.8. Probability values were as

follows: LMKbIL-2/SB5b vs LMKb/SB5b or media control, P < 0.005; LMKbIL-2/SB5b vs LMKbIL-18/SB5b, P < 0.025; LMKbIL-

2/SB5b vs LMKbGMCSF/SB5b, P < 0.05; LMKbGMCSF/SB5b vs media control, P < 0.05.


399

Figure 3 . MTS proliferation assay from spleen cells taken from the animals two weeks following a single intracerebral injection of a

mixture of tumor and treatment cells. The target cells used in this study were SB-5b breast cancer cells, and the effector (spleen cell) to

target cell ratios (E/T) were 50:1 and 100:1. Mononuclear cells from the spleens of the immunized mice obtained through Histopaque

centrifugation were used for this assay. The error bars represent one standard deviation.

Figure 4. ELISPOT assay detecting INF-! secretion by spleen cells in the animals that have survived for six weeks following the initial

injection of SB-5b tumor cells and allogeneic fibroblasts transfected with tumor DNA. Mononuclear cells from the spleens of the

immunized mice obtained through Histopaque centrifugation were used in this assay. The assay was done in the presence (SB-5b

stimulated) and absence (unstimulated) of SB-5b tumor cells. The error bars represent one standard deviation.


400

SB-5b cells in mice immunized with transfected

fibroblasts modified to secrete IL-2 or GM-CSF. The

assay was performed six weeks after the i.c. injection of

the mixture of SB-5b cells and the transfected fibroblasts.

The results indicated that the highest proportion of T cells

reactive with SB-5b cells was in surviving mice injected

with fibroblasts modified to secrete IL-2 (Figure 4).

Lesser numbers of spots were found in T cells from mice

injected with SB-5b cells and non-secreting transfected

fibroblasts or SB-5b cells and transfected fibroblasts

modified to secrete GM-CSF. The analysis of cells from

mice injected i.c. with SB-5b cells and transfected

fibroblasts modified to secrete IL-18 was not performed

because there were no surviving mice.

IV. DiscussionThe prognosis for patients with breast cancer

metastatic to the brain is poor, with the survival ranging

from eight to thirteen months (Bendell et al, 2003; Ogura

et al, 2003). Breast cancer is the second leading cause of

cancer-related death in American women, and

conventional treatments such as surgery, radiation therapy

and chemotherapy have provided little benefit to affect

long-term survival. Given the poor prognosis associated

with metastatic tumors to the brain, there is urgent need

for the development of therapies that can impact on

clinical survival rates.

Here, we report the generation of cell mediated

immune responses toward breast cancer in mice

immunized i.c. with cytokine-secreting syngeneic

/allogeneic mouse fibroblasts transfected with DNA from

a breast neoplasm that arose spontaneously in a C3H/He

mouse (SB-5b cells). Mice injected i.c. with breast cancer

cells and the transfected fibroblasts survived significantly

longer than mice injected with the breast cancer cells

alone, pointing toward the potential of this form of therapy

in breast cancer patients whose neoplasm has metastasized

to the brain.

Further evidence for the efficacy of the transfected

fibroblasts to stimulate an anti-tumor immune response

was provided by the results of the in vitro studies. Spleen

cells from mice injected i.c. with the DNA-based vaccine

were responsive to SB-5b breast cancer cells both in

ELISPOT IFN-! and cytolytic T lymphocyte assays. Co-

incubation of breast cancer cells and T cells from the

spleens of the i.c. injected mice stimulated both CTL-

mediated lysis of the breast cancer cells as well as the

number of activated T cells as determined by ELISPOT

IFN-! assays. Prior studies by this laboratory have

indicated that the introduction of high m.w. genomic DNA

from one cell type, using the techniques described in this

manuscript, altered both the genotype and the phenotypic

characteristics of the cells that took up the exogenous

DNA (de Zoeten et al, 1999). No attempt has been made

to identify the tumor associated antigens expressed by the

transfected cells. The identification of tumor antigens is

technically challenging and may not be required in the

treatment of breast cancer patients.

Mouse fibroblasts were chosen as recipients of the

DNA from the breast cancer cells for several compelling

reasons. The cells, maintained as a cell line under

conventional laboratory conditions were readily

transfected with sheared, genomic DNA from the breast

cancer cells. Since the transferred DNA was integrated,

and replicated as the recipient cells divided (the

transfected fibroblasts were maintained through multiple

rounds of cell division before they were used in the

experiments), the number of transfected cells could be

expanded as necessary. In addition, the fibroblasts could

be modified in advance of DNA-transfer to augment their

immunogenic properties. In the experiments reported here,

the cells were modified to express allogeneic MHC class I-

determinants and to secrete IL-2, IL-18 or GM-CSF.

Allogeneic class I-determinants are strong immune

adjuvants. IL-2 and GM-CSF are growth and activation

factors for CTLs. IL-18 stimulates CTLs and augments

NK cell mediated cytotoxicity. The immune-augmenting

properties of IL-2 and GM-CSF exceeded that of IL-18 in

this unique model system. In addition, like dendritic cells,

fibroblasts are efficient antigen presenting cells. In

particular they express class I-determinants and co-

stimulatory molecules required for T cell activation

constitutively. The cells used as DNA-recipients expressed

H-2k-determinants and B7.1. Systemic class I restricted

cellular breast cancer immune responses were generated in

mice injected i.c. with the transfected cells.

Transfection of DNA from the breast cancer cells

into a highly immunogenic cell line has additional

important advantages. A tumor cell line derived from a

primary breast neoplasm does not have to be established if

the patient’s own tumor is genetically modified to prepare

a vaccine for immunization. Preparation of a cell line from

a primary neoplasm is technically challenging and,

especially in the case of breast cancer, cannot always be

accomplished.

Surprisingly, the proportion of the transfected cell

population that expressed the products of genes specifying

TAA was sufficient to induce the anti-breast cancer

immune response. Our observation that the anti-tumor

immune response that were sufficient to deter the growth

of intracerebral breast cancer, resulting in prolongation of

survival may be an indication that multiple and possible

large numbers of immunologically distinct TAA, the

products of multiple mutant/dysregulated genes were

present within the population of breast cancer cells.

The results presented in this study raise the

possibility that a human fibroblast cell line that shares

identity with the patient at one or more MHC class I

alleles may be readily modified to provide immunologic

specificity for TAA expressed by the patient’s neoplastic

cells. Transfection of a highly characteristic fibroblast cell

line with DNA prepared from the tumor may capture the

array of genes that characterize the neoplasm. It is

conceivable that the prolongation of survival noted in the

treated animals in this study may be largely due to the

expression of potent immunostimulatory cytokines in

close proximity to tumor cells and independent of the

expression of genomic breast cancer DNA. However in

the clinical situation where the treatment cells will be

injected into the tumor cavity following surgical resection,


401

the expression of tumor antigens by the vaccine cells will

be more critical.

One concern related to therapy with fibroblasts

transfected with DNA from the tumor is that multiple

genes specifying normal “self” antigens are likely to be

expressed by the transfected cells. There is a theoretical

danger that autoimmune disease might develop in breast

cancer patients. Vaccines derived from tumor cell-extracts,

peptide elutes of tumor cells, or mRNA fed to APCs

including dendritic cells are subject to the same concern.

However, toxic effects have not been observed. Tumor-

free mice injected i.c. with cell-based vaccines including

those prepared by transfection of fibroblasts with DNA

from the breast cancer cells failed to exhibit adverse

effects. They lived their anticipated life spans without

evidence of disease.

The ultimate goal of cancer therapy is the elimination

of every remaining tumor cell from the patient. It is

unlikely that a single form of therapy is capable of

achieving this goal. However immunotherapy in

combination with surgery, radiation therapy and

chemotherapy will likely find a place as a new and

important means of treatment for patients with brain

tumors.

AcknowledgmentsThis work was supported in part by a grant from the

CINN foundation awarded to Drs. Lichtor and Glick, and

by NIDCR grant number RO1DE013970-01A2 awarded

to Dr. Cohen.

ReferencesBendell JC, Domchek SM, Burstein HJ, Harris L, Younger J,

Kuter I, Bunnell C, Rue M, Gelman R, Winer E (2003)

Central nervous system metastases in women who receive

trastuzumab-based therapy for metastatic breast carcinoma.

Cancer 97, 2972-2977.

Cohen EP (2001) DNA-based vaccines for the treatment of

cancer_an experimental model. Trends Mol Med 7, 175-

179.

de Zoeten E, Carr-Brendel V, Markovic D, Taylor-Papadimitriou

J, Cohen EP (1999) Treatment of breast cancer with

fibroblasts transfected with DNA from breast cancer cells. J

Immunol 162, 6934-6941.

Kim TS and Cohen EP (1994) Interleukin-2-secreting mouse

fibroblasts transfected with genomic DNA from murine

melanoma cells prolong the survival of mice with melanoma.

Cancer Res 54(10), 2531-2535.

Kobayashi T, Yamanaka R, Homma J, Tsuchiya N, Yajima N,

Yoshida S, Tanaka R (2003) Tumor mRNA-loaded dendritic

cells elicit tumor-specific CD8+ cytotoxic T cells in patients

with malignant glioma. Cancer Immunol Immunother 52,

632-637.

Lichtor T, Glick RP, Tarlock K, Moffett S, Mouw E, Cohen EP

(2002) Application of interleukin-2-secreting

syngeneic/allogeneic fibroblasts in the treatment of primary

and metastatic brain tumors. Cancer Gene Ther 9, 464-469.

O I, Ku G, Ertl HCJ, Blaszczyk-Thurin M (2002) A dendritic cell

vaccine induces protective immunity to intracranial growth

of glioma Anticancer Res 22, 613-622.

Ogura M, Mitsumori M, Okumura S, Yamauchi C, Kawamura S,

Oya N, Nagata Y, Hiraoka M (2003) Radiation therapy for

brain metastases from breast cancer. Breast Cancer 10, 349-

355.

Valmori D, Levy F, Miconnet I, Zajac P, Spagnoli GC, Rimoldi

D, Lienard D, Cerundolo V, Cerottini JC, Romero P (2000)

Induction of potent antitumor CTL responses by recombinant

vaccinia encoding a melan-A peptide analogue. J Immunol

164, 1125-1131.

Whiteside TL, Gambotto A, Albers A, Stanson J, Cohen EP

(2002) Human tumor derived genomic DNA transduced into

a recipient cell induces tumor-specific immune responses ex

vivo. Proc Natl Acad Sci USA 99, 9415-9420.

Wigler M, Pellicer A, Silverstein S, Axel R, Urlaub G, Chasin L

(1979) DNA-mediated transfer of the adenine

phosphoribosyltransferase locus into mammalian cells. Proc

Natl Acad Sci USA 76, 1373-1376.

Terry Lichtor, MD, PhD.


402


403


The involvement of H19 non-coding RNA in stress:

Implications in cancer development and prognosisResearch Article

Suhail Ayesh1,2*, Iba Farrah1, Tamar Schneider1, Nathan de-Groot1 and Abraham

Hochberg1

1The Department of Biological Chemistry, the Silberman Institute of Life Sciences. The Hebrew University of Jerusalem,

Jerusalem, Israel2Molecular Genetics Lab, Makassed Islamic Charitable Hospital, Jerusalem, Israel

__________________________________________________________________________________

*Correspondence: Suhail Ayesh, Tel: +972-2-6585455; Fax:+ 972-2-6510250; E-mail: [email protected]

Key words: Human cDNA expression assay, Bladder carcinoma cell lines, serum deprivation, hypoxia, Angiogenesis

Abbreviations: active cyclin dependent kinase 2, (CDK2); angiopoietin 1 receptor precursor, (TIE-2); c-jun N-terminal kinase, (JNK);

dimethyl sulphoxide, (DMSO); extracellular signal-regulated protein kinase, (ERK); fas-activated serine, (FAS); fetal calf serum, (FCS);

fibroblast growth factor receptor 1 precursor, (FGFR1); Focal adhesion kinase, (FAK); Hanks' Balanced Salt Solution, (HBSS); lipid-

activated protein kinase 2, (PRK2); mitogen-activated protein kinase and extracellular signal-regulated protein kinase, (MEK2);

mitogen-activated protein, (MAP); NF-kB-inducing kinase, (NIK); nuclear factor !-B, (NF-!B); phytohemagglutinin M, (PHA);

placenta growth factor, (PIGF); placental plasminogen activator inhibitor 2, (PAI-2); polymerase chain reaction, (PCR); Protein kinase C

", (PKCA); protein kinase C-#, (PKC-#); receptor-associated kinase, (IRAK IL1); reverse transcriptase-polymerase chain reaction, (RT-

PCR); Tumor necrosis factor-", (TNF-"); Urokinase plasminogen activator receptor, (uPAR); vascular endothelial growth factor

receptor 1, (VEGFR1); vascular permeability factor/vascular endothelial growth factor, (VPF/VEGF)

Received: 18 September 2004; Accepted: 27 September 2004; electronically published: October 2004

Summary

The H19 gene is an imprinted gene expressed from the maternal allele. It is known to function as an RNA molecule,

cDNA microarray hybridization was used in an attempt to identify novel kinases participating in cellular response

to hypoxia and serum deprivation. The expression of H19 RNA was examined in embryonic cells (Human

amniocytes) that normally express H19 RNA basal level. At low serum (0.1% FCS) medium or hypoxia: 100µM

CoCl2; or both: without serum (0.1% FCS) and 100µM CoCl2 for 16hr the fold increase of H19 RNA expression

was: 1.9 ±0.11, 1.73 ± 0.2 and 2.0 ± 0.18 folds respectively. Significant increase in expression and induced (up)

expression of certain genes were observed in TA31 cell line that highly expresses H19 RNA. Using the human cDNA

atlas microarray, we detected differentially expressed genes modulated by the presence of H19 RNA in certain

conditions: serum deprivation, hypoxia and both serum deprivation and hypoxia which may resemble the stress

conditions in cancer. Some of the key genes that had increased or induced (up) expression mainly in serum

deprivation are: CDK2, FGFR1, IRAK, JNK1, uPAR and PRK2. In hypoxia the key genes are PKC-#, cot-proto

oncogene, PKC-", FAK and MEK2. In serum deprivation and hypoxia these genes are: Tie2, JNK2, ERK2 and

VEGFR1. Using Atlas Array and observing the genes that had increased or induced (up) expression, a good

indication for certain genes and pathways was found to be involved in tumor progression and angiogenesis. The

major angiogenesis genes include FGFR1, VEGF, TIE2, uPA, and PKC-#. Other signal molecules associated with

the invasive and migratory potential include JNK2, uPAR and FAK.

I. IntroductionH19 is the first imprinted gene with no protein

product described to have oncofetal properties (Ariel et al,

1997). Little is known about the function of this imprinted

gene, though it is expressed abundantly in the human

placenta and in several embryonic tissues. A gene lying in

exons with a very low mutation rate and having significant

expression levels in certain human cells and tissues, must

have a function, if not having several vital functions

(Hurst and Smith, 1999).

H19 expression increases in certain conditions and

tissues (Tycko and Morison, 2002). It increases in the

Ayesh et al: The role of H19 gene during cancer development

404

carotid artery after injury, suggesting its role during

wound healing. During embryogenesis H19 RNA level is

highly elevated. Previous studies showed that H19 fulfills

an important role in the process of tumorigenesis

(Looijenga and Verkerk, 1997).

H19 is expressed abundantly in many cancer types,

but is only marginally expressed in nearly all normal adult

tissues. In some cases of breast adenocarcinoma with poor

prognosis, H19 is over expressed in epithelial cells (Lottin

et al, 2002). Our observations that ectopic expression of

H19 RNA alters expression profiles of (certain) genes

involved in metastasis and blood vessel development,

support the notion of a role for this gene in tumor invasion

and angiogenesis. This role seems to be triggered by stress

conditions that accompany tumor growth (better to be in

Discussion not here. It is especially noteworthy that many

of the genes modulated by H19 RNA are also hypoxia

responsive (Ayesh et al, 2002) The realization that a lot of

us carry in situ tumors (microscopic tumors), but do not

develop the disease, suggests that these microscopic

tumors are mostly dormant and need additional signals to

grow and become lethal tumors (Folkman and Kalluri,

2004). H19 is considered a tumor marker that combines

prognostic and predictive value in patients with refractory

superficial cancer (Ariel et al, 2000). The search for key

genes which convert the non-lethal tumors into the

expanding mass of tumor cells that is potentially lethal to

an individual became a very important issue.

To investigate more about the function of H19, we

transfected cells from the bladder carcinoma cell line

T24P, which does not express H19, with an episomal

construct in which H19 expression is under the control of

the cytomegalovirus promoter in either a sense full-length

cDNA construct (TA31 cells), or an anti-sense construct

covering 800 bp that extended from the 3' end direction

(TA11 cells). We aimed to identify kinases and genes that

showed altered expression between the TA31 (H19+) and

TA11 (H19-) cell lines with the Atlas human cDNA

expression array, containing cDNA from 350 all kinases.

We also compared the effect of the presence of H19 RNA

on the proliferation capacity of cells, and plotted out key

genes that were noticeably up regulated or over expressed

both in normal and poor serum conditions.

Some of the differentially expressed kinases are

among those promoting invasion, migration, angiogenesis

and notably apoptosis. These findings and results support

the suggestion of H19 functioning in cancer progression

by overcoming stress conditions thereby enabling cells to

survive and proliferate.

II. Materials and methodsA. Cell cultureThe human bladder carcinoma cell line T24P was obtained

from the American Type Culture Collection (Manassas, VA).

Cells from the T24P cell line were stably transfected with an

episomal vector that has an H19 full-length cDNA placed in

either the sense direction, creating TA31, or the antisense

direction (800 bp from 3’ end), creating TA11. The cells were

grown as previously described (Kopf et al, 1998). For serum

deprivation and hypoxia, these cells were grown in low serum

conditions (0.1% fetal calf serum (FCS)) medium or hypoxia:

100µM CoCl2 (Wang et al, 2000); or both: in low serum

conditions (0.1% FCS) and 100µM CoCl 2 for 16hr before RNA

extraction.

1. Human amniocytesHuman amniocytes were cultured in sterile flasks grown to

confluence in RPMI medium supplement. It contained 10% FCS,

1% Penicillin/ Streptomycin, 1% L-glutamate, and 1.3%

phytohemagglutinin M(PHA). They were grown at 370C in a

humidified incubator (95% air, 5% CO2), according to

cytogenetics laboratory procedure manual (Genetics Division

LAC/USA medical center,1990). When the cells reached

confluence, they were washed with Hanks' Balanced Salt

Solution (HBSS). Then trypsinized with EDTA-trypsin, and

neutralized with Bio-amf media (biological industries, Israel).

The media with the cultured cells were collected and sub-

cultured in 4 different flasks according to the previous culture

conditions for 48h. Later on, the flasks were washed with HBSS

and incubated for 16h with four different types of media. These

media are: medium A: the same medium mentioned above;

medium B: low serum conditions (0.1% FCS); medium C:

100µM CoCl2; medium D: low serum conditions (0.1% FCS) and

100µM CoCl2.

B. RNA Extraction and RT-PCRConditional media were collected; the cells were lysed, and

neutralized. Then total RNA was extracted by RNA STAT-60$

(TEL-TEST INC, Friends wood, TX) according to manufacturer

instructions. For RT-PCR reaction, the synthesis of cDNA was

performed using p(dT)15 primer (Boehringer, Mannheim,

Germany) to initiate reverse transcription of 2 µg total RNA with

400U of M-MLV reverse transcriptase (GibcoBRL®

Gaithersburg, MD).

The cDNA was used as a template for PCR to amplify the

tested genes, H19 and Histone H3.3. The amplification was

performed in a final volume of 25 µl reaction mixture. It

contained 2µl of cDNA, 0.625 units of Taq DNA polymerase

(Takara, Otsu, Japan), its 1X buffer (50 mM KCI, 2 mM MgCl2,

10 mM Tris-HCl), 0.2 mM dNTP mix, and 0.15µg of each

primer. DMSO (4.5%) was also used in the amplification of H19

transcript. Thermal cycling parameters for H19 were:

denaturation at 98°C for 15sec, annealing at 58°C for 30sec, and

extension at 72°C. In all the PCR assays, the number of cycles

was calibrated to ensure that PCR amplification was in the linear

phase. Each PCR was repeated 3 times. The integrity of the

cDNA was assayed by PCR analysis with the ubiquitous cell

cycle independent histone variant H3.3, as described by Futscher

et al, (1993). Photographs of the PCR products were scanned

with a PowerLook II scanner and quantified with ImageGague

version 3.41 software (Fuji Photo Film Co., Tokyo, Japan).

C. The custom Atlas arrayThe custom Atlas kinase array (Clontech Labs Inc)

includes 359 human complementary DNAs of known kinases and

phosphotase genes, divided into categories. In addition, the array

includes 9 housekeeping genes for internal control of gene

expression; genomic DNA spots as orientation markers and

controls of labeling efficiency; and negative controls

immobilized in duplicate dots on a nylon membrane.

D. RNA labeling and hybridizationThe Atlas array kit contains all necessary ingredients for RNA

labeling, probe purification, and hybridization. Total DNA-free

RNA (5 µg) from each tissue sample were labeled by "32-P-

dATP. The complementary DNA probe was purified on a special

column provided in the kit. Equal amounts of labeled probe

(about 10 7 cpm) for each cell line were hybridized to the array.


405

After several washings the arrays were exposed to radiographs at

-80°C for 7, 10, and 16 hours.

The whole analysis was carried out twice. The difference

between pattern and degree of gene expression was calibrated

using household genes in the two independent experiments.

E. RNA identification and comparisonSignals of exposure were scanned and quantified with

software for digital image analysis (Atlas-image, v. 2; Clontech

Labs Inc). This program is designed to compare gene expression

profiles and generate a detailed report. Briefly, after alignment of

the 2 arrays to the grid template, the background calculation was

performed. The program generates intensity values (the average

of the total signal from the left and right spots in double-spotted

arrays) and the normalization coefficient is calculated first for

array 1 and then applied to the adjusted intensity of each of the

genes on array 2. The adjusted intensity for a gene is the intensity

value minus background value multiplied by the normalization

coefficient. The ratio and difference values were calculated.

Comprehensive information on the genes included in the

array is found at Clontech Labs Inc's Atlas info bioinformatics

database (atlasinfo.clontech.com).

III. ResultsA. H19 expression at different stress

conditionsH19 expression in human amniocytes: the level of

H19 RNA was examined in embryonic cells (Human

amniocytes) that normally express H19 at basal level. The

change in H19 RNA expression was measured by RT-PCR

after different stress conditions and the results are as

shown below. Figure 1 shows that there is an increase in

H19 RNA level in low serum (0.1% FCS) medium or

hypoxia: 100µM CoCl2; or both: low serum conditions

(0.1% FCS) and 100µM CoCl2 for 16h. The increase of

H19 RNA expression was: 1.9 ± 0.11, 1.73 ± 0.2 and 2.0 ±

0.18 folds respectively.

H19 expression in T24P, TA 11 and TA 31 cell lines

was examined at low serum (0.1% FCS) medium, or

hypoxia: 100µM CoCl2; or both: low serum conditions

(0.1% FCS) and 100µM CoCl2for 16h by northern blot. As

shown in Figure 2, the H19 level was slightly increased in

T24p cell line at hypoxia (100µM CoCl2), while no H19

induction in TA 11 cell line, which contains the plasmid

that expresses the anti-sense for H19.

Figure 1. H19 expression in human ammniocytes. H19 RNA expression in usual medium (10% FCS) lane 1, low serum (0.1% FCS)

medium lane 2, hypoxia: 100µM CoCl2 lane 3; or both: low serum conditions(0.1% FCS) and 100µM CoCl2 lane 4 for 16hand blank

lane 5. The increase of H19 RNA expression was: 1.9 ± 0.11, 1.73 ± 0.2 and 2.0 ± 0.18 folds respectively.

Figure 2. Northern blot analysis of H19 expression in T24P, TA11 and TA31 cell lines at normal and different stress conditions. The

H19 RNA expression in normal conditions lane1, in low serum (0.1% FCS) medium lane2, or hypoxia: 100µM CoCl2 lane3; or both:

low serum conditions (0.1% FCS) and 100µM CoCl2 for 16hr lane 4, examined by northern blot in the three cell line: T24p cell line, TA

11 cell line, TA 31 cell line.


406

1. Gene expression analysisThe results of microarray gene analysis after

different stress conditions were as follows: The genes

listed in these Tables (1, 2, 3) are those increased

significantly (more than 1.5 fold) or induced (up) in TA31

cell line compared to TA 11 and T24p cell lines. Table 1

contains the genes with increased and induced (up)

expression at low serum (0.1% FCS) medium. Table 2

contains the genes that increased or induced expression

(up) in hypoxia (100µM CoCl2); 3 contains the genes that

increased or induced (up) at double stress conditions (low

serum conditions (0.1% FCS) and 100µM CoCl2 for 16h.

Table 1. Genes that had increased or induced (up) expression with a ratio of more than 1.5 fold at low serum (0.1% FCS)

medium in TA 31 cell line compared to TA11 and T24p cell lines

B6e 2.31673 serine/threonine-protein kinase PCTAIRE 3 (PCTK3) X66362

B5a 2.346823 Ribose phosphophate pyrophosphokinase M57423

A7a 2.531401 fibroblast growth factor receptor1 precursor (FGFR1) X66945

C2d 2.64694 checkpoint kinase 1 (CHK1) AF016582

C1a 2.702954 hint protein; protein kinase C inhibitor 1 (PKCI1) U51004

B1a 3.088425 Diacylglycerol kinase " AF064771

B3k 3.276213 protein kinase A anchoring protein AF037439

D3e 3.287641 CDC28 protein kinase 2 AA010065

A2m 3.387337 DRAK2 AB011421

A6e 3.873097 neurotrophic tyrosine kinase receptor type 1 (NTRK1) X03541

A1f 5.618388 cyclin-dependent protein kinase 2 (CDK2) M68520

A7d 5.633224 protein kinase C " polypeptide (PKC-") M22199

A3f Up c-jun N-terminal kinase 1 (JNK1) L26318

A3n Up Protein-tyrosine kinase transmembrane M97639

A4d Up cyclin-dependent kinase 10 (CDK10) L33264

A4k Up mitogen-activated protein kinase kinase 6 (MAP kinase kinase 6) U39657

A5d Up urokinase-type plasminogen activator precursor (uPAR) M15476

A5m Up SHK1 kinase binding protein 1 AF015913

A6a Up angiopoietin 1 receptor precursor L06139

A7n Up Muscle specific tyrosine kinase receptor AF006464

B1b Up Selenide water dikinase 1 U34044

B1n Up Lipid-activated protein kinase 2 (PRK2) U33052

B3d Up cell division protein kinase 4 M14505

B4m Up ribosomal protein S6 kinase II "3 (S6KII-"3) U08316

B5l Up cAMP-dependent protein kinase %-catalytic subunit (PKA C-%) M34182

B5m Up serine/threonine-protein kinase (NEK2) U11050

B6h Up Bruton's tyrosine kinase (BTK) U10087

B7a Up A kinase anchor protein U17195

C2c Up serine/threonine-protein kinase (NEK3) Z29067

C3f Up adenylate kinase 3 (AK3) X60673

C5c Up phosphatidylinositol 3-kinase catalytic subunit delta isoform U86453

C5e Up protein tyrosine kinase U02680

C5j Up activin receptor type I precursor (ACTRI) L02911

C7b Up serine/threonine protein kinase (SAK) Y13115

D6f Up serine/threonine-specific protein kinase minibrain U58496

Table 2. Genes that that had increased or induced (up) expression with a ratio of more than 1.5 fold at hypoxia in TA 31

cell line compared to TA11 and T24p cell lines

Gene code Ratio Protein/gene

Gene bank

accession

B1i 1.505267 ephrin type-B receptor 1 precursor L40636

A7d 1.510266 Protein kinase C " polypeptide (PKC-") M22199

A1m 1.512111 ntak protein (neural and thymus derived activator for erbb kinases AB005060

B6k 1.52491 ribosomal protein S6 kinase II "1 (S6KII-"1) L07597

A6d 1.528496 Placental plasminogen activator inhibitor 2 (PAI-2) M18082

D3h 1.544107 mitogen-activated protein kinase 9 L31951

B6e 1.555473 serine/threonine-protein kinase PCTAIRE 3 (PCTK3) X66362


407

C2d 1.568302 checkpoint kinase 1 (CHK1) AF016582

D1d 1.596408 protein kinase C # (PKC-#) Z15108

C3k 1.600221 6-phosphofructokinase D25328

A4c 1.604381 focal adhesion kinase (FAK) L13616

B7f 1.623765 NIK serine/threonine protein kinase Y10256

A7c 1.635135 protein serine/threonine kinase (STK1) L20320

A2m 1.641395 DRAK2 AB011421

B2j 1.671949 nucleoside diphosphate kinase A (NDKA) X17620

D4a 1.689245 calmodulin (CALM) J04046

B2e 1.805216 cell division control protein 2 homolog (CDC2) X05360

C5k 1.833114 putative diacylglycerol kinase eta (DAG kinase eta) D73409

B3l 1.882828 cAMP-dependent protein kinase I " regulatory subunit (PRKAR1) M33336


C4l 1.940017

guanine nucleotide-binding protein & subunit 2-like protein 1

(GNB2L1) M24194

B3k 2.143857 protein kinase A anchoring protein AF037439

B1c 2.209804 tyrosine-protein kinase ctk L18974

A6e 2.553698 neurotrophic tyrosine kinase receptor type 1 (NTRK1) X03541

D1b 2.59454 Creatin kinase B chain L47647

B2k 2.730018 STE20-like kinase 3 (MST3) AF024636

B4k 2.73525 cot proto-oncogene D14497

C4i 2.925536 mevalonate kinase M88468

C7d 3.366751 serine/threonine protein kinase minibrain homolog (DYRK) D86550

A6a Up angiopoietin 1 receptor precursor (TIE-2) L06139

B1g Up mitogen-activated protein kinase kinase 2 (MAP kinase kinase 2) L11285

B3d Up cell division protein kinase 4; cyclin-dependent kinase 4 (CDK4) M14505

B5c Up tyrosine-protein kinase itk/tsk D13720

B5l Up cAMP-dependent protein kinase gamma-catalytic subunit M34182

B5m Up serine/threonine-protein kinase (NEK2) U11050

B6i Up serine/threonine-protein kinase PLK1 (STPK13) U01038

B6l Up c-ros-1 tyrosine-protein kinase proto-oncogene M34353

B6m Up STE20-like kinase (MST2) U26424

B7a Up A-kinase anchor protein U17195

C2n Up mitochondrial thymidine kinase 2 U77088

C3f Up adenylate kinase 3 (AK3) X60673

C3i Up phosphomevalonate kinase (PMKase) L77213

C5h Up dual-specificity protein phosphatase 9 Y08302

C5j Up activin receptor type I precursor (ACTRI) L02911

C5n Up 1D-myo-inositol-trisphosphate 3-kinase B X57206

C6e Up MAP kinase-activating death domain protein U77352

C6h Up myotonic dystrophy protein kinase-like protein Y12337

C7e Up serine kinase 9 (SRPK2) U88666

D1c Up calcium/calmodulin-dependent protein kinase type II U50359

Table 3. Genes that had increased or induced (up) expression with a ratio of more than 1.5 fold at low serum (0.1% FCS)

medium and hypoxia in TA 31 cell line compared to TA11 and T24p cell lines

Gene code Ratio Protein/gene

C4l 1.576539 guanine nucleotide-binding protein & subunit 2-like protein 1 (GNB2L1) M24194

C6j 1.590471 myotonin-protein kinase; myotonic distrophy protein kinase (MDPK) L19268

A1h 1.680315 DNA-dependent protein kinase (DNA-PK) U35835

B7c 1.715803 cell division protein kinase 8 (CDK8) X85753

D4a 1.73196 calmodulin (CALM) J04046

A7a 1.762276 fibroblast growth factor receptor1 precursor (FGFR1) X66945

B4k 1.7795 cot proto-oncogene D14497


408

C5k 1.864683 putative diacylglycerol kinase eta (DAG kinase eta) D73409

A2m 2.046678 DRAK2 AB011421

B5h 2.072661 ephrin type-A receptor 5 precursor (EHK1) X95425

D3h 2.303345 mitogen-activated protein kinase 9 L31951

A1j 2.307026 vascular endothelial growth factor receptor 3 precursor (VEGFR3); flt-4 X68203

C5i 2.396003 phosphatidylinositol 3 kinase catalytic subunit % isoform X83368

A1m 2.504037 ntak protein (neural and thymus derived activator for erbb kinases) AB005060


B2e 2.782374 cell division control protein 2 homolog (CDC2) X05360

A7d 2.892207 protein kinase C " polypeptide (PKC-") M22199

A1f 2.971199 cyclin-dependent protein kinase 2 (CDK2) M68520

C4i 4.024127 mevalonate kinase M88468

A1d Up serine/threonine-protein kinase (STK2) L20321

A2b Up related to receptor tyrosine kinase (RYK) S59184

A2f Up protein kinase C ' (PKC-') L07032

A2i Up fas-activated serine/threonine kinase (FAST) X86779

A3b Up vascular endothelial growth factor receptor 1 (VEGFR1); Flt-1 X51602

B3d Up cell division protein kinase 4; cyclin-dependent kinase 4 (CDK4) M14505

B5c Up tyrosine-protein kinase itk/tsk D13720

B5l Up cAMP-dependent protein kinase %-catalytic subunit (PKA C-%) M34182

B5m Up serine/threonine-protein kinase NEK2 U11050

B6b Up B-lymphocyte kinase (BLK) Z33998

B7l Up deoxycytidine kinase M60527

B7m Up 58-kDa inhibitor of the RNA-activated protein kinase U28424

C2c Up serine/threonine-protein kinase NEK3 Z29067

C4f Up phosphorylase B kinase % catalytic subunit skeletal muscle isoform X80590

D1h Up c-jun N-terminal kinase 1 (JNK1) L26318

D2e Up hematopoietic progenitor kinase (HPK1) U66464

D2f Up Adenylate kinase isoenzyme 2 U39945

IV. DiscussionH19 was described to have oncofetal properties; it is

expressed abundantly in the human placenta and in several

embryonic tissues (Ariel et al, 1997). We cultured human

amniocytes, which express H19 under normal conditions,

at different stress condition i.e. hypoxia and serum stress

(Figure 1). The increase in H19 expression (about 2 folds)

in both serum deprivation and hypoxia was a strong

indication that H19 is involved in the physiological

response to different stress conditions.

The H19 level was slightly increased in T24p cell

line at hypoxia (100µM CoCl2) as shown in Figure 2.

While no H19 induction was found in TA 11 cell line,

which contains the plasmid that expresses the anti-sense

for H19, was found. It seems very likely that H19 RNA is

involved in the induction of the expression of the kinases

which increased significantly (more than 1.5 fold) or

induced (up) in TA31 cell line compared to TA 11 and

T24p cell lines.

Significant increase in expression and induced (up)

expression of certain genes was observed in TA31 cell line

which is H19+ and after growing these cells with stress

conditions: which are serum deprivation, hypoxia and both

serum deprivation and hypoxia together.

While taking a closer look at all the genes that had an

increase or induced (up) expression in the hypoxia and

serum stress conditions, which may resemble the stress

conditions in cancer, certain important genes may be

playing important roles in cell survival and the mitogenic

activities of the tumor.

A. Serum deprivationElevated expression of active cyclin dependent

kinase 2 (CDK2) is critical for promoting cell cycle

progression and unrestrained proliferation of tumor cells.

CDK2 is retained in the cytoplasm of cells by serum

deprivation (Bresnahan et al, 1997).

Apoptosis of human endothelial cells after growth

factor deprivation and stress accompanied by cancer is

associated with rapid and dramatic induced (up)

expression of CDK2 activity. CDK2 activation, through

caspase-mediated cleavage of cdk inhibitors, may be

instrumental in the execution of apoptosis following

caspase activation (Levkau et al, 1998). One of the stress

kinases which we found to have induced (up) expression

in serum deprivation is fibroblast growth factor receptor 1

precursor (FGFR1). FGFR1 may be a specific target for

MMP2 on the cell surface, yielding a soluble FGF receptor

that may modulate the mitogenic and angiogenic activities


409

of FGF. MMP2 is a key gene in angiogenesis (Levi et al,

1996).

Binding of interleukin-1 (IL1) to its receptor and by

the association of IRAK (IL1 receptor-associated kinase),

triggers activation of nuclear factor !-B (NF-!B), a family

of related transcription factors that regulates the

expression of genes bearing cognate DNA binding sites

such as PCNA which we also found to have induced (up)

expression in pervious study (Ayesh et al, 2002). Another

gene that had induced (up) expression was JNK1 (c-jun N-

terminal kinase 1) which is involved in the initiation of the

apoptosis process (Ch et al, 1996; Yu et al, 1996). JNK1 is

activated by various stimuli, including UV light, Ha-Ras,

TNF-" (Tumor necrosis factor-"), IL-1 and CD28

costimulation (Derijard et al, 1994; Ch et al 1996). JNK1

phosphorylates Elk-1 on the same major sites recognized

by ERK1/2 (extracellular-regulated kinase), thus

potentiating its transcriptional activity (Cavigelli et al,

1995).

A critical gene involved in the mitogenic and

invasive pathways and up regulated under stress

conditions is uPA (Urokinase plasminogen activator). uPA

is secreted as an enzymatically inactive proenzyme (pro-

uPA). Urokinase plasminogen activator receptor (uPAR)

mediates the binding of the zymogen, pro-uPA, to the

plasma membrane where trace amounts of plasmin will

initiate a series of events referred to as reciprocal zymogen

activation where plasmin converts pro-uPA to the active

enzyme, uPA, which in turn converts plasma membrane-

associated plasminogen to plasmin (Dear et al, 1998,

Plesner et al, 1997). Urokinase-type plasminogen activator

receptor (uPAR) is known to play important roles in tumor

cell migration, invasion, and metastasis (Ayesh et al,

2002). High levels of u-PA, PAI-1 (placental plasminogen

activator inhibitor 2) and u-PAR in many tumor types

predict poor patient prognosis (Fazioli and Blasi, 1994;

Andreasen et al, 1997). PRK2 (lipid-activated protein

kinase 2) is necessary for apoptosis, during FAS-induced

apoptosis (Cryns et al, 1997) which can form a complex

with adaptor proteins made up of src domains (Braverman

and Quilliam, 1999).

B. Hypoxia stressMany key genes in the main pathway of

tumorgenesis were found to have increased or induced

(up) expression. The proliferation of new tumor cells

instead could take place. PKC-# (protein kinase C-#) is

important in NF-!B activation (Folgueira et al, 1996) and

takes a central position in TNF signal pathways acting as a

molecular switch between mitogenic and growth

inhibitory signals of TNF-". (Muller et al, 1995). The role

of TNF-" in angiogenesis is thought to be indirect through

its ability to induce angiogenic factors. TNF-· mediates its

action through NF-!B transcription factor (Ayesh et al,

2002). In serum-free media, NF-!B is activated promoting

survival of cells while inhibiting PKC-# results in cell

death (Wang et al, 1999). PKC-# was implicated in tumor

angiogenesis (Pal et al, 1998). It is highly over expressed

in tumors and is involved in apoptosis, angiogenesis, and

several signal transduction pathways regulating

differentiation, proliferation or apoptosis of mammalian

cells. Sp1 promotes the transcription of vascular

permeability factor/vascular endothelial growth factor

(VPF/VEGF), a potent angiogenic factor, by interacting

directly and specifically with protein kinase C # (PKC #)

isoform in renal cell carcinoma. PKC # binds and

phosphorylates the zinc finger region of Sp1 (Pal et al,

1998).

One of the genes that had increased expression was

cot-proto oncogene (c-cot/TPL-2) which encodes a

MAP3K related serine threonine kinase and plays a critical

role in TNF-" production. An increase in cot kinase

expression promotes TNF-" promoter-driven

transcription. Cot kinase is partially mediated by

MEK/ERK kinase pathway which includes many up

regulated genes in the stress conditions in order to survive.

Cot kinase increases at least the AP-1 and AP-2 response

elements (Ballester et al, 1998). It also plays a role in IL-2

production which is an important angiogenesis-associated

secreted protein (Ballester et al, 1997). TPL-2 is a

component of a signaling pathway that controls proteolysis

of NF-!B1 p105 generating, at the end, active nuclear NF-

!B. Furthermore, kinase-inactive TPL-2 blocks the

degradation of p105 induced by (TNF-") (Belich et al,

1999). Cot assembles physically with NF-!B-inducing

kinase (NIK) and phosphorylate it in vivo (Lin et al,

1999).

Protein kinase C- " is the major protein kinase C

isoenzyme of a signal transduction cascade regulating IL-2

receptor expression and which is over expressed in the

experiment (Szamel et al, 1997). Focal adhesion kinase

(FAK) is centrally implicated in the regulation of cell

motility and adhesion (Zachary, 1997) and is induced by

adhesion of cell surface integrins to extracellular matrix

and other factors (Guan 1997; Zachary 1997). Activated

FAK leads to its binding to a number of intracellular

signaling molecules including SCr, Grb2 and PI 3-kinse.

Integrin signaling through FAK causes increased cell

migration and potentially regulates cell prolifration and

survival (Guan 1997). FAK is involved in the progression

of cancer to invasion and metastasis and overexpression of

FAK in tumor cells leads to a high propensity toward

invasion and metastasis and increased cell survival under

anchorage-independent conditions (Kornberg 1998). Other

genes as MEK2 (MAPK and ERK kinase) contribute to

the activation of the oxidative burst and phagocytosis, and

participate in cytokine regulation of apoptosis in cells

under stress (Downey et al, 1998).

C. Serum deprivation and hypoxia

stressesTie2 had an increased expression in all stresses and is

known to play a role in tumor angiogenesis (Lin et al,

1998). Tie2 and its ligand angiopiotin-1 represent key

signal transduction systems involved in the regulation of

embryonic vascular development. The expression of these

molecules correlates with phases of blood vessel formation

needed in angiogenesis (Breier et al, 1997).

Three distinct groups of MAP kinases have been

identified in mammalian cells (ERK, JNK, and p38).


410

These MAP kinases are mediators of signal transduction

from the cell surface to the nucleus (Whitmarsh and Davis,

1996). Jun kinase (JNK1 and JNK2) is selectively

mediating signal transduction of the pro-inflammatory

cytokines IL-1 and TNF as well as of cellular stress

(Uciechowski et al, 1996). JNK2 was found to be over

expressed in both serum deprivations and hypoxia. IL-1,

TNF, UV light and osmotic stress, are able to stimulate jun

kinase activity (including JNK2) in humans (Uciechowski

et al, 1996). JNK2 (also called Elk-1 activation domain

kinase) phosphorylates the NH2-terminal activation

domain of the transcription factor c-Jun, and the activity of

JNK2 was approximately 10-fold greater than that of

JNK1 (Sluss et al, 1994). JNK2 phosphorylates Elk-1 in

extracts of UV-irradiated cells on the same major sites

recognized by ERK1/2 that potentiate its transcriptional

activity (Cavigelli et al, 1995).

The mitogen-activated protein (MAP) kinase also

known as (ERK2) is proline-directed serine/threonine

kinases that are activated in response to a variety of

extracellular signals, including growth factors, hormones

and, neurotransmitters. MAPK/ERK is a key molecule in

intracellular signal transducing pathways that transport

extracellular stimuli from cell surface to nuclei.

MAPK/ERK has been revealed to be involved in the

physiological proliferation of mammalian cells and also to

potentiate them to transform and thus increase in amounts

in tumor cells (Davis 1995). ERK2 is activated by many

oncogenes, such as RAS and RAF, and they induce cell

proliferation (Mishima et al, 1998).

Vascular endothelial growth factor receptor 1

(VEGFR1) also called FLT-1 gene encodes a

transmembrane tyrosine kinase that is involved in

angiogenesis and migration which is a high-affinity

receptor for VEGF and placenta growth factor (PIGF). Flt-

1 plays important roles in the angiogenesis required for

embryogenesis and in monocyte/macrophage migration

(Gerber et al, 1997). VEGF/PIGF functions via flt-1 in an

autocrine manner to perform a role in invasion and

differentiation (Shore et al, 1997). The Flt-1 receptor gene

had direct induced (up) expression by hypoxia via

hypoxia-inducible enhancer on the Flt-1 promoter (Gerber

et al, 1997), and has been implicated in the regulation of

blood vessel growth during angiogenesis (Breier et al,

1997; Cheung 1997). The VEGF signal transduction

system has been implicated in the regulation of

pathological blood vessel growth during certain

angiogenesis-dependent diseases that are often associated

with tissue ischemia, such as tumorgenesis (Shibuya et al,

1994; Breier 1997).

ReferencesAndreasen PA, Kjoller L, Christensen L, Duffy MJ (1997) The

urokinase-type plasminogen activator system in cancer

metastasis, a review. Int J Cancer 72, 1-22

Ariel I, Ayesh S, Perlman EJ et al (1997) The product of the

imprinted H19 gene is an oncofetal RNA. Mol Pathol 50,

34-44.

Ariel I, Sughayer M, Fellig Y, et al (2000) The imprinted H19

gene is a marker of early recurrence in human bladder

carcinoma. Mol Pathol 53, 320-323.

Ayesh S, Matouk I, Schneider T et al (2002) A. Possible

physiological role of H19 RNA. Mol Carcinog 35, 63-74.

Ballester A, Tobena R, Lisbona C, Calvo V, Alemany S (1997)

Cot kinase regulation of IL-2 production in Jurkat T cells. J

Immunol 159, 1613-8.

Ballester A, Velasco A, Tobena R, Alemany S (1998) Cot kinase

activates tumor necrosis factor-" gene expression in a

cyclosporin A-resistant manner. J Biol Chem 273, 14099-

106.

Belich MP, Salmeron A, Johnston LH, Ley SC (1999) TPL-2

kinase regulates the proteolysis of the NF-!B-inhibitory

protein NF-!B1 p105. Nature 397, 363-8.

Braverman LE, Quilliam LA (1999) Identification of Grb4/Nck&,

a src homology 2 and 3 domain-containing adapter protein

having similar binding and biological properties to Nck. J

Biol Chem 274, 5542-9.

Breier G, Damert A, Plate KH, Risau W (1997) Angiogenesis in

embryos and ischemic diseases. Thromb Haemost 78, 678-

83.

Bresnahan WA, Thompson EA, Albrecht T (1997) Human

cytomegalovirus infection results in altered Cdk2 subcellular

localization. J Gen Virol 78, 8.

Cavigelli M, Dolfi F, Claret FX, Karin M (1995) Induction of c-

fos expression through JNK-mediated TCF/Elk-1

phosphorylation. EMBO J 14, 5957-64.

Chen YR, Meyer CF, Tan TH (1996) Persistent activation of c-

Jun N-terminal kinase 1 (JNK1) in % radiation-induced

apoptosis. J Biol Chem 271, 631-4.

Cheung CY (1997) Vascular endothelial growth factor, possible

role in fetal development and placental function. J Soc

Gynecol Investig 4, 169-77

Cryns VL, Byun Y, Rana A et al (1997) Specific proteolysis of

the kinase protein kinase C-related kinase 2 by caspase-3

during apoptosis. Identification by a novel, small pool

expression cloning strategy. J Biol Chem 272, 29449-53.

Davis RJ (1995) Transcriptional regulation by MAP kinases.

Mol Reprod Dev 42, 459-67

Dear AE, Medcalf RL (1998) The urokinase-type-plasminogen-

activator receptor (CD87) is a pleiotropic molecule. Eur J

Biochem 252, 185-93.

Derijard B, Hibi M, Wu IH et al (1994) a protein kinase

stimulated by UV light and Ha-Ras that binds and

phosphorylates the c-Jun activation domain. Cell 76, 1025-

37.

Downey GP, Butler JR, Tapper H, Fialkow L, Saltiel AR, Rubin

BB, Grinstein S (1998) Importance of MEK in neutrophil

microbicidal responsiveness. J Immunol 160, 434-43.

Fazioli F, Blasi F (1994) Urokinase-type plasminogen activator

and its receptor, new, targets for anti-metastatic therapy.

Trends Pharmacol Sci 15, 25-9.

Folgueira L, McElhinny JA, Bren GD et al (1996) Protein kinase

C-# mediates NF-!B activation in human immunodeficiency

virus-infected monocytes. J Virol 70, 223-31.

Folkman J, Kalluri R (2004) Cancer without disease. Nature

427, 787

Futscher BW, Blake LL, Gerlach JH, Grogan TM, Dalton WS

(1993) Quantitative polymerase chain reaction analysis of

mdr1 mRNA in multiple myeloma cell lines and clinical

specimens. Anal Biochem 213, 414-421.

Gerber HP, Condorelli F, Park J, Ferrara N (1997) Differential

transcriptional regulation of the two vascular endothelial

growth factor receptor genes. Flt-1, but not Flk-1/KDR, is

up-regulated by hypoxia. J Biol Chem 272, 23659-67.

Guan JL (1997) Focal adhesion kinase in integrin signaling.

Matrix Biol 16, 195- 200.

Hurst LD, Smith NG (1999) Molecular evolutionary evidence

that H19 RNA is functional. Trends Genet 15, 134-135.


411

Kopf E, Bibi O, Ayesh S et al (1998) The effect of retinoic acid

on the activation of the human H19 promoter by a 3’

downstream region. FEBS Lett 432, 123-127. Kornberg LJ

(1998) Focal adhesion kinase and its potential involvement in

tumor invasion and metastasis. Head Neck 20, 745-52.

Levi E, Fridman R, Miao HQ et al (1996) Matrix

metalloproteinase 2 releases active soluble ectodomain of

fibroblast growth factor receptor 1. Proc Natl Acad Sci 93,

7069-74.

Levkau B, Koyama H, Raines EW et al (1998) Cleavage of

p21Cip1/Waf1 and p27Kip1 mediates apoptosis in

endothelial cells through activation of Cdk2, role of a

caspase cascade. Mol Cell 1, 553-63.

Lin P, Buxton JA, Acheson A et al (1998) Antiangiogenic gene

therapy targeting the endothelium-specific receptor tyrosine

kinase Tie2. Proc Natl Acad Sci 95, 8829-34.

Lin X, Cunningham ET Jr, Mu Y, Geleziunas R, Greene WC

(1999) The proto-oncogene Cot kinase participates in

CD3/CD28 induction of NF-!B acting through the NF-!B-

inducing kinase and I!B kinases. Immunity 10, 271-80.

Looijenga LH, Verkerk AJ, de-Groot N, Hochberg A, Oosterhuis

JW (1997) H19 in normal development and neoplasia. Mol

Reprod Dev 46, 419-439.

Lottin S, Adriaenssens E, Dupressoir T, Berteaux N, Montpellier

C, Coll J, Dugimont T, Curgy JJ (2002) Overexpression of

an ectopic H19 gene enhances the tumorigenic properties of

breast cancer cells. Carcinogenesis 23, 1885-95.

Mishima K, Yamada E, Masui K et al. Shimokawara T,

Takayama K, Sugimura M, Ichijima K (1998)

Overexpression of the ERK/MAP kinases in oral squamous

cell carcinoma. Mod Pathol 11, 886-91.

Muller G, Ayoub M, Storz P, Rennecke J, Fabbro D, Pfizenmaier

K (1995) PKC-# is a molecular switch in signal transduction

of TNF-", bifunctionally regulated by ceramide and

arachidonic acid. EMBO J 14, 1961-9.

Pal S, Claffey KP, Cohen HT, Mukhopadhyay D (1998)

Activation of Sp1-mediatedvascular permeability

factor/vascular endothelial growth factor transcription

requires specific interaction with protein kinase C-#. J Biol

Chem 273, 26277-80.

Plesner T, Behrendt N, Ploug M (1998) Structure, function and

expression on blood and bone marrow cells of the urokinase-

type plasminogen activator receptor, uPAR. Stem Cells 15(6,

398-408.

Shibuya M, Seetharam L, Ishii Y et al (1994) Possible

involvement of VEGF- FLT tyrosine kinase receptor system

in normal and tumor angiogenesis. Princess Takamatsu

Symp. 24, 162-70.

Shore VH, Wang TH, Wang CL, Torry RJ, Caudle MR, Torry

DS (1997) Vascular endothelial growth factor, placenta

growth factor and their receptors in isolated human

trophoblast. Placenta 18, 657-65.

Sluss HK, Barrett T, Derijard B, Davis RJ (1994) Signal

transduction by tumor necrosis factor mediated by JNK

protein kinases. Mol Cell Biol 14, 8376-84.

Szamel M, Ebel U, Uciechowski P, Kaever V, Resch K (1997) T

cell antigen receptor dependent signalling in human

lymphocytes, cholera toxin inhibits interleukin-2 receptor

expression but not interleukin-2 synthesis by preventing

activation of a protein kinase C isotype, PKC-". Biochim

Biophys Acta 1356, 237-48.

Tycko B, Morison IM (2002) Physiological functions of

imprinted genes. J Cell Physiol 192, 245-258.

Uciechowski P, Saklatvala J, von der Ohe J, Resch K, Szamel M,

Kracht M (1996) Interleukin 1 activates jun N-terminal

kinases JNK1 and JNK2 but not extracellular regulated MAP

kinase (ERK) in human glomerular mesangial cells. FEBS

Lett 394, 273-8.

Wang G, Hazra TK, Mitra S, Lee HM, Englander EW (2000)

Mitochondrial DNA damage and a hypoxic response are

induced by CoCl2 in rat neuronal PC12 cells. Nucleic Acids

Res 28, 2135-40.

Wang YM, Seibenhener ML, Vandenplas ML, Wooten MW

(1999) Atypical PKC-# is activated by ceramide, resulting in

coactivation of NF-!B/JNK kinase and cell survival. J

Neurosci Res 55, 293-302.

Whitmarsh AJ, Davis RJ (1996) Transcription factor AP-1

regulation by mitogen-activated protein kinase signal

transduction pathways. J Mol Med 74, 589-607.

Yu R, Shtil AA, Tan TH, Roninson IB, Kong AN (1996)

Adriamycin activates c-jun N-terminal kinase in human

leukemia cells, a relevance to apoptosis. Cancer Lett 107,

73-81

Zachary I (1997) Focal adhesion kinase. Int J Biochem Cell

Biol 29, 929-34.

Suhail Ayesh, Iba Farrah, Tamar Schneider, Nathan de-Groot Abraham Hochberg


412


413


PSA promoter-driven conditional replication-

competent adenovirus for prostate cancer gene

therapyResearch Article

Guimin Chang2 and Yi Lu1,2*Department of 1Medicine and 2Urology, University of Tennessee Health Science Center, Memphis, Tennessee, USA

__________________________________________________________________________________

*Correspondence: Yi Lu, Ph.D., Department of Medicine, University of Tennessee Health Science Center, 956 Court Avenue, H300,

Memphis, TN 38163, USA; Tel: (901) 448-5436; Fax: (901) 448-5496; E-mail: [email protected]

Key words: adenovirus, PSA, E1, replication-competent, prostate cancer

Abbreviations: !-galactosidase, (lacZ); adenovirus type 5, (Ad5); Dulbecco’s modified Eagle medium, (D-MEM); early region 1, (E1);

Fetal bovine serum, (FBS); prostate specific antigen, (PSA); Rous sarcoma virus, (RSV)

Received: 24 August 2004; revised: 22 September 2004

Accepted: 6 October 2004; electronically published: October 2004

Summary

A conditional, replication-competent adenovirus (AdPSAE1) carrying the adenoviral E1 region under the control of

a prostate specific antigen (PSA) promoter was generated in an effect to target the prostate for cancer gene therapy.

The anti-prostate tumor efficacy and specificity of AdPSAE1 were examined in vitro and in vivo in prostate and

nonprostate cancer models. In vitro at multiplicity of infection (moi) of 1, AdPSAE1 effectively killed the human

prostate cancer cell lines PPC-1 and LNCaP, but had no effect on nonprostate cancer cells including the human

bladder cancer cell line RT4, human breast cancer cell line MCF-7, and rat gliosarcoma cell line 9L. As a control,

an adenovirus expressing the ß-galactosidase transgene under the control of the same PSA promoter (AdPSAlacZ)

was used in parallel in all experiments. The in vivo tissue-specific expression driven by this PSA promoter was

examined in a xenograft tumor model. Intratumoral injection of AdPSAlacZ resulted in PSA promoter-driven

expression of lacZ in xenograft tumors in nude mice derived from human prostate cancer PPC-1 cells, but not in

tumors derived from human bladder cancer RT4 cells. Intratumoral injection of AdPSAE1 effectively inhibited in

vivo growth (61.8% reduction in tumor size) of xenograft PPC-1 prostate tumors compared to untreated or

AdPSAlacZ treated tumors. Conversely, intratumoral injection of AdPSAE1 had no effect on the growth of

xenograft RT4 bladder tumors when compared to untreated control group. These results indicate that prostate-

targeted conditional replication-competent adenoviruses may be useful in gene therapy of prostate cancer.

I. IntroductionProstate cancer is the most frequently diagnosed

cancer and the second leading cause of cancer deaths in

men today. It is estimated that there will be approximately

230,110 new cases and 29,900 deaths of prostate cancer in

American men in 2004 (Jemal et al, 2004). Unfortunately

for those patients diagnosed with advanced prostate

cancer, there is no effective current treatment modality and

their prognosis is poor. Although viral based gene therapy

is a promising new strategy to combat advanced prostate

cancer, its current effectiveness is limited by inefficient

cellular transduction in vivo.

The adenovirus early region 1 (E1) gene, which

comprises E1a and E1b, encodes the viral early proteins

that are necessary for adenoviral replication and the

consequent oncolysis of permissive host cells. E1-deleted

(including E1a-deleted) adenoviruses are replication-

defective and are commonly used as viral vectors to carry

therapeutic genes for gene therapy. The conventional way

of producing an E1-deleted adenovirus is to use cells that

are able to supply replication-enabling proteins. One such

example is HEK 293 cells which were transformed by

human adenovirus type 5 (Ad5) and express E1 protein

(Graham et al, 1977). E1-deleted viruses infect host cells

and express the transgene but they cannot replicate and

undergo lysis due to the lack of the E1 protein. Thus, E1-

deleted recombinant adenoviruses are a safe viral vehicle

for gene transfer. However, E1-deleted, replication-

defective adenoviruses have several common problems

with respect to in vivo transduction: a low transduction

rate, time-limited expression of the transgene, and host

immune responses to repeated viral administration.

Chang and Lu: Prostate-specific conditional oncolytic adenovirus

414

An alternative means of producing E1-deleted

adenoviruses is to provide the E1 protein in the targeted

cells. Codelivery of an E1-deleted adenovirus along with

an E1-expressing plasmid allows one round of viral

replication. This limited replication significantly increases

in vivo delivery efficiency of adenovirus to cancer cells

(Goldsmith et al, 1994; Han et al, 1998). This trans

complementation of a replication-defective adenovirus

with E1 protein in targeted cells may provide a means of

amplifying gene transduction in vivo. However, the

resultant adenovirus itself is not replication-competent and

only one round of viral replication is possible. Therefore,

transduction of tumor cells by this approach is still limited.

Replication-competent viruses, also known as

oncolytic viruses, replicate within transduced cells and

force these cells into a lytic cycle. Released virus is then

able to infect neighboring cells until all susceptible cells

are eliminated. Theoretically a large tumor burden could

be effectively eradicated using a small dose of an

oncolytic virus. Therefore, strategies to use conditional

oncolytic virus, or so-called attenuated replication-

competent viruses, to specifically target prostate tissue

have been developed (Rodriguez et al, 1997; Yu et al,

1999a, 1999b).

The idea behind this study is to place the Ad5 E1

region in cis complementation (i.e., use E1 as a transgene)

back into an E1-deleted, replication-defective adenovirus

under the control of a prostate-specific promoter. Thus, E1

protein expression will be confined strictly to prostate

tissues and render this a conditional oncolytic virus within

the prostate. Our previous study showed that a prostate-

specific adenovirus, AdPSAlacZ, which contains a ß-

galactosidase (lacZ) reporter gene under the control of the

PSA promoter, transduced a high level of lacZ transgene

expression in the prostate after intraprostatic injection in

an animal model. The virus did disseminate to tissues

beyond the prostate after injection, however, AdPSAlacZ

did not express the transgene in these nonprostate tissues

(Steiner et al, 1999). This result suggests that the PSA

promoter effectively and specifically drives lacZ transgene

expression in prostate cells transduced by AdPSAlacZ. In

this study we replaced the lacZ transgene in AdPSAlacZ

with the Ad5 E1 region to generate a prostate-specific

replication-competent adenovirus AdPSAE1, in which E1

expression is under the control of the PSA promoter. The

efficacy and specificity of AdPSAE1 as a potential

therapeutic vector for prostate cancer gene therapy were

analyzed.

II. Materials and methodsA. Cell culture and mediumDulbecco’s modified Eagle medium (D-MEM) was

purchased from Gibco BRL (Gaithersburg, MD). RPMI 1640

medium and McCoy’s 5" medium were purchased from Cellgro

(Herndon, VA). Fetal bovine serum (FBS) was from Hyclone

Laboratories (Logan, UT). All cell lines were purchased from

ATCC (Rockville, MD) and were grown in D-MEM with 10%

heat inactivated FBS. The human prostate cancer cell lines PPC-

1 and LNCaP, both secret PSA (Dr. J. Norris of MUSC, personal

communication), were grown in RPMI 1640 medium with 10%

FBS. The human breast carcinoma MCF-7 cells and human

bladder cancer RT4 cells were grown in McCoy’s 5" medium

with 10% FBS. Rat gliosarcoma 9L cells were grown in D-MEM

medium with 10% FBS. All cells were grown in medium

containing 100 units/ml penicillin, 100 µg/ml streptomycin at

37°C in a 5% CO2 atmosphere.

B. Construction of adenoviral vector

AdPSAlacZ and AdPSAE1The generation of AdPSAlacZ, an E1-deleted recombinant

adenovirus expressing the lacZ reporter gene under the control of

a 680-bp PSA promoter, has been described previously (Steiner

et al, 1999). AdPSAE1 was generated by replacing the lacZ

transgene in AdPSAlacZ with the wild-type Ad5 E1 gene.

Briefly, an approximately 3-kb E1 fragment was generated by

PCR using DNA extracted from the E1-containing adenovirus

Ad-dl327 (Genetic Therapy Inc., Gaithersburg, MD) as a

template, and primers specific to both the 5’ and 3’ region of the

Ad5 E1 gene. In addition, a restriction site was introduced in

each of the 5’ and 3’ primers to facilitate subsequent subcloning.

The resultant PCR product included 4 bp upstream of the E1a

gene start codon, the entire E1a and E1b regions, and 7 bp

downstream of E1b stop codon, as well as the introduced BamH I

and EcoR I site at 5’- and 3’- end, respectively. This PCR

product was digested with BamH I and EcoR I, and subcloned

into the corresponding sites in pBluescript (Stratagene, La Jolla,

CA) and the E1 fragment was re-released with Spe I and EcoR V

digestions. The prostate-specific adenoviral shuttle vector

pPSAlacZ (used to generate AdPSAlacZ, Steiner et al, 1999) was

digested with Xba I and Cel II to remove the lacZ gene, and was

then ligated with the above-mentioned modified E1 fragment to

generate the shuttle vector pPSAE1. This pPSAE1 shuttle vector

was cotransfected with pJM17, an adenoviral genome plasmid, in

293 cells as described previously (Steiner et al, 2000a) to

generate AdPSAE1. The resultant AdPSAE1 was genomically

similar to Ad-dl327 except that the E1 gene in AdPSAE1 is

under the control of a 680-bp PSA promoter rather the

endogenous E1 promoter in Ad-dl327. Positive recombinant

plaques were isolated by a direct plaque-screening PCR method

(Lu et al, 1998) using primers specific to the recombinant

construct, i.e., using one primer specific for the PSA promoter

and the other primer specific for the E1 gene. Amplification and

titration of adenoviruses were performed as described previously

(Graham and Prevec, 1991).

C. Analysis of potential oncolytic effects of

AdPSAE1 on various cell lines by crystal violet

stainingCells (5#104 per well) were plated in six-well plates, the

next day the cells were either untreated or transduced with

AdPSAlacZ or AdPSAE1 at moi of 1. After 6 days of

transduction, the media was removed and the plates were washed

twice with PBS. The wells were then completely covered with 2

ml of 1% crystal violet (Sigma, St. Louis, MO) and the plate was

allowed to sit 5 min with gentle rocking. After washing with

water, the plate was allowed to dry at room temperature

overnight before they were photographed.

D. In vitro growth inhibition assay by

AdPSAE1Cells (5#104 per well) were plated in six-well plates, the

next day the cells were divided into three groups: (a) control

uninfected, (b) control virus AdPSAlacZ infected, and (c)

AdPSAE1 infected. After viral infection at moi of 1, cell

numbers were counted daily through day 6 post viral infection.


415

E. X-gal staining of AdPSAlacZ transduced

xenograft tumorsThe recombinant adenovirus, AdRSVlacZ, which contains

a !-galactosidase reporter gene under the control of a Rous

sarcoma virus (RSV) promoter, was used as a positive control to

demonstrate in vivo transduction efficiency within tumors.

Xenograft tumors were established by injecting 5 x 106 various

cancer cells subcutaneously into the flank of male Balb/c nu/nu

athymic nude mice (Harlan Sprague Dawley, Inc., Indianapolis,

IN). When tumors reached about 50 mm3 volume, 5 x 109 pfu

AdRSVlacZ, or 1x1010 pfu AdPSAlacZ were injected directly

into the tumor site. The mice were sacrificed 3 days post

injection and the tumors were harvested and processed to

cryosections as described previously (Lu et al, 1999). For tumor

section staining, samples were fixed in 4% paraformaldehyde for

30 min, then in 30% sucrose in PBS at 4°C until the samples

sank to the bottom of the vial. The samples were then snap-

frozen in liquid nitrogen in O.C.T. medium (Tissue-Tek/Sakura,

Torrance, CA) and processed to cryosections using a Cryostat.

The cryosections were fixed in formalin for 30 sec then

processed for X-gal staining as a measure of lacZ expression as

described (Eastham et al, 1996).

F. In vivo tumor growth inhibition by

AdPSAE1PPC-1 cells (1#107 cells in 0.2 ml of PBS) or RT4 cells

(5.7#106 cells in 0.2 ml of PBS) were injected subcutaneously

into the flank of male Balb/c nu/nu athymic nude mice (Harlan

Sprague Dawley, Indianapolis, IN). For each tumor cell model,

three groups of mice were formed with 8 mice in each group.

Group I was used as an untreated control. Group II and group III

were for intratumoral viral injection of AdPSAE1 and control

virus AdPSAlacZ, respectively. When tumors reached about 200

mm3 volume, a single dose of 5#106 pfu AdPSAE1 or

AdPSAlacZ were injected directly into each tumor mass. Tumor

volume was measured every 3 days until the animals were

sacrificed. All of the animals were sacrificed at day 35 after viral

injection, when several mice of group III showed distress or had

tumor burdens > 15% of their total body weight.

III. ResultsA prostate-specific, conditional oncolytic adenovirus,

AdPSAE1, was generated by replacing the lacZ transgene

of AdPSAlacZ (Steiner et al, 1999) with the wild-type

Ad5 E1 region (Figure 1). This strategy allows the

expression of E1 protein under the control of a prostate

specific promoter (PSA), enabling the adenovirus to

replicate and enter the oncolytic cycle only in prostate

cells. To analyze the oncolytic cell-killing effects and

tissue specificity of AdPSAE1, various cancer cell lines

including prostate and nonprostate cells were used in both

in vitro and in vivo models.

A. AdPSAE1 effectively and specifically

inhibited prostate cancer cell growth in vitro

The potential oncolytic cell-killing effects of

AdPSAE1 were analyzed in various cancer cells. The

human prostate cancer lines PPC-1 and LNCaP and

nonprostate cancer cell lines RT4 (human bladder cancer),

MCF-7 (human breast cancer), and 9L (human glioma)

were infected with AdPSAE1 or control virus AdPSAlacZ

at moi of 1. Viable cells were stained with crystal violet 6

days after infection and were compared to untreated

control cells (Figure 2). As dead cells typically detach,

crystal violet stains only those viable cells that remain

attached to the culture dish. As shown in Figure 2A and

2B, AdPSAE1 (right well) almost completely wiped out

all PPC-1 and LNCaP cells, whereas AdPSAlacZ (middle

well) had no cell-killing effects as compared to the

untreated control (left well), respectively. On the other

hand, AdPSAE1 had no cell-killing effects on RT4

(Figure 2C), MCF-7 (Figure 2D) and 9 L (Figure 2E)

cells. These results clearly demonstrate that AdPSAE1

selectively replicates (thus goes through the oncolytic

cycle and kills the host cells) in cancer cells derived from

the prostate (PPC-1 and LNCaP), but not in nonprostate

cancer cells (RT4, MCF-7 and 9L).

To analyze the time-course of the growth inhibition

effects of AdPSAE1 on prostate cancer cells, PPC-1 and

LNCaP cells were either untreated or transduced with

AdPSAE1 or control virus AdPSAlacZ at moi of 1 in

vitro, and the cell numbers were monitored. As shown in

Figure 3, significant growth inhibition was observed

starting at day 4 post AdPSAE1 infection, with complete

growth inhibition at day 6 for both prostate cancer cell

Figure 1. Design of a prostate-specific conditional replication-competent adenovirus. The native Ad5 early region 1 (E1) gene that

is required for adenoviral replication, is replaced by an expression cassette which contains an Ad5 E1 gene under the control of a 860-bp

PSA promoter.


416

Figure 2. Conditional oncolytic effects of AdPSAE1 in prostate cancer cells. The human prostate cancer cell lines PPC-1 (A) and

LNCaP (B), human bladder cancer cell line RT4 (C), human breast cancer cell line MCF-7 (D), and human glioma cell line 9L (E) were

transduced with AdPSAE1 or AdPSAlacZ at moi of 1. Attached viable cells were stained with crystal violet 6 days after viral infection

and were compared to the untreated controls.


417

Figure 3. Time-course of the growth inhibition effects of AdPSAE1 on prostate cancer cells. Prostate cancer cells PPC-1 (A) and

LNCaP (B) were transduced with AdPSAE1 at moi of 1. Cell numbers were determined daily from day 1 to 6 after viral transduction.

Untreated and AdPSAlacZ transduced cells were used as controls. The data represent the results from two independent experiments each

performed in duplicate. Some error bars are too small to show.

lines PPC-1 and LNCaP. AdPSAlacZ transduction did not

cause significant growth inhibition in either of these cell

lines (Figure 3A and 3B).

The differential sensitivity of various cancer cells to

AdPSAE1-mediated oncolytic killing and growth

inhibition is presented in Figure 4. On day 6 after in vitro

viral transduction at moi of 1, AdPSAE1 transduction

significantly reduced numbers of PPC-1 and LNCaP cells

to 81.6% and 96.9% of untreated control values, whereas

the control virus AdPSAlacZ transduction resulted in

minor and insignificant growth inhibition (Figure 4). In

contrast, AdPSAE1 had no significant cell-killing or

growth inhibition effects towards the nonprostate cancer

cells RT4, MCF-7 and 9L when compared to the untreated

control and control virus AdPSAlacZ transduced groups

(Figure 4). These results suggest that, in vitro , AdPSAE1

effectively leads to prostate-specific oncolytic killing.

To ensure that selective viral replication accounted

for the cell-killing in AdPSAE1 transduced cells, RT-PCR

was performed using primers specific to Ad5 E1a gene

and followed by Southern blot hybridization (Steiner et al,

1999) to examine the E1a mRNA expression in

AdPSAE1-transduced cells. We found that only LNCaP

and PPC-1 cells had positive E1a RT-PCR product

whereas RT4, MCF-7 and 9L cells did not (not shown),

indicating that E1a was selectively expressed in prostate

cancer cells. We also performed RCA (replication

complement adenovirus) assay by sequential infection of

target cells (prostate and nonprostate cells) with AdPSAE1

and consequently collected supernatant of target cells to

infect 293 cells. We only found plaques in 293 cells

infected by supernatant from LNCaP and DU145 cells that

Figure 4. Differential growth inhibition of AdPSAE1 with

respect to prostate and nonprostate cancer cells. Prostate

cancer cells (PPC-1 and LNCaP) and nonprostate cancer cells

(RT4, MCF-7 and 9L) were transduced with AdPSAE1 or

AdPSAlacZ at moi of 1. Cell numbers were determined six days

later and compared to that of untreated control. The data

represent the results from two independent experiments each

performed in duplicate. Some error bars are too small to show.


418

had been initially infected by AdPSAE1, not by

supernatant from nonprostate cancer cells infected by

AdPSAE1 (not shown). These results indicate that only

AdPSAE1-transduced prostate cancer cells generate

progeny viruses.

Figure 5. Specific transgene expression driven by a PSA promoter in prostate cancer cells. Xenograft tumors were established by

subcutaneous injection of cancer cells into the flank of nude mice. When tumors reached about 50 mm3, each of the adenoviral

constructs (1x1010 pfu AdPSAlacZ or 5x109 pfu AdRSVlacZ) was injected directly into the tumor. The tumors were harvested 72 hr later

and processed to cryosections. Shown are X-gal staining of tumor sections derived from prostate cancer PPC-1 cells (A, C, E) and

bladder cancer RT4 cells (B, D, F). A and B are tumors transduced by AdPSAlacZ (1x1010 pfu). C and D are untreated control tumors to

serve as negative controls. E and F are tumors transduced by AdRSVlacZ (5x109 pfu) to serve as positive controls.


419

B. Specific expression of transgene driven

by the PSA promoter in the xenograft

prostate tumors in animal modelTo determine the in vivo specificity of a 680-bp PSA

promoter that was used tin the AdPSAE1 construct, a

parallel adenovirus, AdPSAlacZ, containing a lacZ

reporter gene under the control of the same 680-bp PSA

promoter was used to analyze specificity in xenograft

tumors grown in nude mice. A dose of 1x1010 pfu

AdPSAlacZ was injected into subcutaneous xenograft

tumors derived from human prostate cancer PPC-1 cells or

human bladder cancer RT4 cells. As a positive control,

AdRSVlacZ (Lu et al, 1999), an adenovirus containing the

lacZ gene under the control of a constitutively active RSV

promoter, was injected into xenograft tumors at a dose of

5x109 pfu. LacZ expression was determined through X-gal

staining of cryosections of the tumors 72 h following viral

injection. Untransduced control PPC-1 (Figure 5C) and

RT4 (Figure 5D) tumors did not express detectable

endogenous lacZ. AdPSAlacZ transduced PPC-1 tumors

contained X-gal positive (blue stained) cells (Figure 5A),

whereas AdPSAlacZ transduced RT4 tumors did not

(Figure 5B). In contrast, both PPC-1 (Figure 5E) and

RT4 (Figure 5F) tumors transduced by AdRSVlacZ

showed X-gal positive cells. These results demonstrate

that expression of the lacZ transgene driven by this PSA

promoter occurred only in xenograft prostate tumors, but

not in xenograft bladder tumors. However, the activity of

the PSA promoter is much lower than that of the

constitutively active RSV promoter (Compare Figure 5A

and 5E with the blue stained cells and the viral dose

injected, respectively).

C. dPSAE1 specifically inhibited prostate

tumor growth in vivo

To determine whether AdPSAE1 causes similar

tumor growth inhibition in vivo as was shown in vitro

(Figure 2, 3 and 4), human prostate cancer PPC-1 cells

and human bladder cancer RT4 cells were injected

subcutaneously into the flank of nude mice to establish the

xenograft tumors. When tumors developed to about 200

mm3, a single dose of AdPSAE1 was injected directly into

the tumor in both cancer cell models. As shown in Figure

6A for the PPC-1 tumor model, both untreated tumors and

tumors treated with control virus AdPSAlacZ grew rapidly

and at a similar rate. In contrast, the AdPSAE1-treated

group showed an effective suppression of this rapid

growth. By day 35 post viral injection, the group treated

with AdPSAE1 had a remarkable 61.8% reduction of

tumor size as compared to the untreated group (Figure

6A). On the other hand, the same single dose of AdPSAE1

injected into the RT4 xenograft tumors failed to result in

significant growth inhibition, as compared to the untreated

RT4 tumor group (Figure 6B). These results suggest that

AdPSAE1 is able to specifically inhibit prostate tumor

growth in vivo.

IV. DiscussionMost currently used gene therapy vectors are

engineered to prevent viral self-replication. These

replication deficient viruses represent a safer gene transfer

vehicle. They deliver therapeutic transgenes without

exposing host cells to the viral lytic cycle. The

transduction of replication-defective viral vectors in vivo

confines transgene expression to those cells along the

Figure 6. AdPSAE1 specifically inhibits prostate tumor growth in vivo. (A) The human prostate cancer line PPC-1 and (B) human

bladder cancer line RT4 were injected subcutaneously into the flank of nude mice. When tumors reached an average volume of 200

mm3, tumors were either untreated (control) or treated with intratumoral injection (day 0) with 5x106 pfu of AdPSAlacZ (control virus)

or 5x106 pfu AdPSAE1. The tumor sizes were periodically measured after viral injection. Each point represents the average tumor

volume from 8 mice. Some error bars are too small to show.


420

injection track due an inability to pass the transgene

to neighboring cells. Consequently, the effectiveness of a

viral vector is directly correlated to its transduction

efficiency. Although bystander effect of certain

therapeutic transgenes in the suicide gene therapy strategy

helps to increase some therapeutic index, its effect is

limited. Tumor cells cannot be 100% transduced with a

single treatment. Untransduced tumor cells survive, divide

and eventually offset the therapeutic effects posed by the

initial viral transduction. Therefore, repeated viral

injections aimed at infecting those tumor cells not infected

in the first round of viral transduction is required to

maximize the therapeutic effect in vivo. However,

adenoviral vectors cause strong immunogenic responses.

Consequently, second and subsequent rounds of

adenoviral administration possess significantly reduced

therapeutic effects in vivo (Berkner, 1988; Russell, 2000).

To overcome this obstacle, an alternative approach is

to employ conditional oncolytic viruses, also called

attenuated replication-competent viruses, for cancer gene

therapy. Conditional oncolytic viruses are altered such that

they specifically target a desired cell type or modified such

that the desired target cells are several orders of magnitude

more sensitive to oncolytic cell lysis than are nontargeted

cells. By taking advantage of prostate-specific promoter,

an Ad5 E1a gene, was reintroduced to E1a/E3-deleted

adenovirus under the control of PSA enhancer/promoter (-

5322 to –3729/-580 to +12) (PSE). The resultant

adenovirus, CN706, specifically replicates in, and thus

kills, PSA-producing cells such as LNCaP but not in non-

PSA-producing cells such as DU145 (Rodriguez et al,

1997). Likewise, CN764, an adenoviral vector containing

the Ad5 E1a gene driven by PSE and the Ad5 E1b gene

driven by a hK2 enhancer/promoter (-5155 to –3387/-324

to +33), has a high therapeutic index with a cell specificity

of 10,000:1 for prostate cancer LNCaP cells, compared to

ovarian cancer OVCAR-3, SK-OV-3 and PA-1 cells (Yu

et al, 1999a). A similar approach was used to generate

another prostate-specific replication-competent

adenovirus, CV787. CV787 contains the E1a transgene

driven by a prostate-specific probasin promoter, an E1b

gene driven by the PSE promoter and a wild-type E3

region that suppresses the host immune system. CV787

destroys PSA-producing cells 10,000 times more

efficiently than non-PSA-producing cells. A single tail

vein injection of CV787 has been shown to eliminate

distant LNCaP xenograft tumors (Yu et al, 1999b). This

indicates that CV787 could be a powerful therapeutic

vector to treat metastatic prostate cancer.

Unlike other groups as mentioned above in which

they used much longer PSA promoter region (above 1.6

kb), our current study shows that a 680-bp PSA promoter

is sufficient enough to drive a prostate-specific transgene

expression. This 680-bp PSA promoter drives expression

of the lacZ transgene specifically in xenograft tumors

derived from prostate but not in those derived from

nonprostate cancer cells (Figure 5A and 5B). This

demonstrates specific expression of transgene by the PSA

promoter only in prostate derived cells. Our previous

publication demonstrated that the same PSA promoter

drives expression of the reporter transgene in a prostate-

specific manner when AdPSAlacZ was directly injected

into the prostate (Steiner et al, 1999). The majority of

injected virus was retained within the prostate gland,

whereas a minor portion spread to distant tissues. Despite

nonprostate infection by the adenovirus as detected by

Southern blot of PCR using primers specific to the Ad5

adenovirus, the lacZ transgene was not expressed as

detected by Southern blot of RT-PCR using primers

specific to bacterial lacZ gene. Together, these data

strongly demonstrate that the 680-bp PSA promoter drives

transgene expression exclusively in the prostate in vivo.

In this study we used xenograft prostate tumors

derived from a primary prostate cancer cell line PPC-1

(Brothman et al, 1989), rather from a metastatic prostate

cancer line (such as LNCaP or DU145 as other groups

did), for analyzing the efficacy of AdPSAE1. We believe

that the intratumoral injection of viral vector into a

primary prostate tumor setting reflects much closer to the

real clinical situation for prostate cancer gene therapy.

Moreover, to our knowledge, we are the first group to use

a bladder xenograft tumor model (RT4) for analyzing the

specificity of PSA promoter-driven E1 expression (Figure

6B), it seems to make more sense to us to pay attention

whether AdPSAE1 would cause damage to the bladder,

which is anatomically close to the prostate during the

prostate cancer gene therapy application, rather than to the

ovarian and breast as used by other group (Yu et al,

1999a).

While the PSA promoter maintains faithful tissue-

specific expression, its promoter activity is relatively weak

compared to the constitutive active RSV promoter

(compare Figure 5A and 5E). This implies that as a trade-

off for the tissue specificity, the expression of a

therapeutic transgene driven by the PSA promoter will be

lower than that of a constitutively active promoter. This

may not seem to be a major issue because we are using a

conditional oncolytic strategy in which the therapeutic

transgene itself is the Ad5 E1 gene. Theoretically, only

low levels of E1 expression are required to initiate and

maintain the viral oncolytic cycle to eradicate all the

prostate cells. In this study, we have demonstrated that at

an moi of 1, AdPSAE1 was able to completely eradicate

all cancerous prostate cells in vitro (Figure 2, 3 and 4).

Similarly, in our in vivo study, at viral doses (i.e.,

intratumoral injection of 5x106 pfu AdPSAE1 per tumor of

200 mm3 size, Figure 6) much lower than that of the

typical E1-deleted adenoviral vectors we have routinely

used (i.e., intratumoral injection of 5x109 pfu E1-deleted

adenovirus containing a therapeutic gene per tumor of 100

mm3 size, Steiner et al, 2000b, 2000c), AdPSAE1

exhibited an equivalent inhibition ability for xenograft

prostate tumor growth as those by E1-deleted adenovirus

at a much higher dose. However, we were still unable to

completely eradicate tumors using AdPSAE1 treatment in

vivo (Figure 6A). This failure may be due to insufficient

production of the E1 protein in vivo by the relatively weak

prostate-specific promoter.

The limitation of this strategy by a PSA promoter

driven, prostate-specific gene expression is that it only

works effectively in PSA-producing prostate cells (such as

LNCaP and PPC-1 as shown in this report), but not in


421

PSA-negative prostate cells such as DU145 and PC3

(Rodriguez et al, 1997; Yu et al, 1999b). Therefore, other

prostate-specific promoters (such as probasin) should be

explored for their abilities to drive transgene expression in

PSA-negative prostate cancer cells. Our ongoing research

showed that a 456-bp probasin promoter is able to drive

transgene specifically expressed in both PSA-positive and

PSA-negative prostate cancer cells. It implies that this

456-bp 5’ region of the probasin gene might be a good

candidate to function as a prostate-specific promoter to

drive the E1 transgene expression in prostate cancer.

The idea of using conditional oncolytic viruses is an

attractive strategy that may hold the promise of 100%

eradication of primary tumor cells and of targeting tumor

metastases. However, significant effort should be

undertaken to evaluate the tissue specificity and ensure the

safety of each new viral construct. A study to evaluate the

biodistribution and toxicity of a replication-competent

adenovirus following intraprostatic injection showed that

although the virus persisted in the urogenital tract and

liver, most toxicity was minimal and self-limiting. Most

importantly, there was no germ-line transmission of viral

genes (Paielli et al, 2000). One way to control viral spread

is to design a conditional oncolytic virus containing a

prodrug enzyme gene, so the prodrug can be used as

desired to suppress viral replication effectively. A

replication-competent, E1b-attenuated adenovirus

containing a cytosine deaminase/herpes simplex virus type

1-thymidine kinase (CD/HSV-TK) fusion gene was

constructed (Freytag et al, 1998). Not only the suicide

gene system allows for the utilization of double-suicide

gene therapy, but also it provides a means to eliminate the

virus itself by destroying the host cells in situ and controls

viral spread whenever needed (Freytag et al, 1998).

Recent development in this field has brought the

hope closer to generate the ideal conditional replication-

competent adenovirus for prostate cancer gene therapy. It

appears that PSA prompter/enhancer has more activity and

specificity in helper-dependent adenoviral vector (almost

devoid of all adenoviral sequences) than in traditional E1-

deleted adenoviral vector (Shi et al, 2002). Moreover, this

promoter specificity can also be influenced by other

constitutively active promoter/enhancer in the vector

backbone (Shi et al, 2002). To overcome the obstacle that

PSA promoter is active only in PSA-producing prostate

cancer cells, a strategy of cotransduction of another

adenovirus expressing androgen receptor (AR) and

combination with dihydrotestosterone (DHT) treatment

should be worth exploration. Because PSA promoter-

driven transgene can be induced by DHT in PC-3 cells (a

non-PSA-producing prostate cancer cell line) transfected

with AR expression vector (Kizu et al, 2004). Moreover, a

novel TARP (T cell receptor gamma-chain alternate

reading frame protein) promoter with PSA enhancer has

shown a high prostate-specific activity in both hormone-

dependent and hormone-refractory prostate cancer cells

(Cheng et al, 2004). With significant ongoing efforts of

better understanding and improvement in these aspects, we

expect that ideal conditional replication-competent

adenoviruses will be generated and become an effective

means for the treatment of prostate cancer in the near

future.

AcknowledgmentsThis research was supported in part by NIH grant

DK65962 (Y.L.), in part by Elsa U. Pardee Foundation

(Y.L.), and in part by Cancer Research and Prevention

Foundation (Y.L.).

We thank Dr. Dan Baker of the Department of

Medicine, University of Tennessee Health Science Center

for his critical review of this manuscript.

ReferencesBerkner KL (1988) Development of adenovirus vectors for the

expression of heterologous genes. Biotechniques 6, 616-629.

Brothman AR, Lesho LJ, Somers KD, Wright GL Jr, and

Merchant DJ (1989) Phenotypic and cytogenetic

characterization of a cell line derived from primary prostatic

carcinoma. Int J Cancer 44, 898-903.

Cheng WS, Kraaij R, Nilsson B, van der Weel L, de Ridder CM,

Totterman TH, and Essand M (2004) A novel TARP-

promoter-based adenovirus against hormone-dependent and

hormone-refractory prostate cancer. Mol Ther 10, 355-364.

Eastham JA, Chen S-H, Sehgal I, Yang G, Timme TL, Hall SJ,

Woo SLC, and Thompson TC (1996) Prostate cancer gene

therapy, herpes simplex virus thymidine kinase gene

transduction followed by ganciclovir in mouse and human

prostate cancer models. Hum Gene Ther 7, 515-525.

Freytag SO, Rogulski KR, Paielli DL, Gilbert JD, and Kim JH

(1998) A novel three-pronged approach to kill cancer cells

selectively, concomitant viral, double suicide gene, and

radiotherapy. Hum Gene Ther 9, 1323-1333.

Goldsmith KT, Curiel DT, Engler JA, and Garver Jr, RI (1994)

Trans complementation of an E1a-deleted adenovirus with

codelivered E1A sequences to make recombinant adenoviral

producer cells. Hum Gene Ther 5, 1341-1348.

Graham FL, Smiley J, Russell WC, and Nairn R (1977)

Characteristics of a human cell line transformed by DNA

from human adenovirus type 5. J Gen Virol 36, 59-72.

Graham FL. and Prevec L (1991) Manipulation of adenovirus

vectors. In Methods in Molecular Biology. E.J. Murray, ed,

Vol. 7, Gene transfer and expression protocols. (The

Human Press Inc, Clifton) pp. 109-128.

Han JS, Qian D, Wicha MS, and Clarke MF (1998) A method of

limited replication for the efficient in vivo delivery of

adenovirus to cancer cells. Hum Gene Ther 9, 1209-1216.

Jemal A, Timari RC, Murray T, Ghafoor A, Samuels A, Ward E,

Feuer EJ, and Thun MJ, A (2004) Cancer Statistics, 2004.

CA Cancer J Clin 54, 8-29.

Kizu R, Otsuki N, Kishida Y, Toriba A, Mizokami A, Burnstein

KL, Klinge CM, and Hayakawai K (2004) A new luciferase

reporter gene assay for the detection of androgenic and

antiandrogenic effects based on a human prostate specific

antigen promoter and PC3/AR human prostate cancer cells.

Anal Sci 20, 55-59.

Lu Y, Carraher J, Zhang Y, Armstrong J, Lerner J, Roger W, and

Steiner MS (1999) Delivery of adenoviral vectors to the

prostate for gene therapy. Cancer Gene Ther 6, 64-72.

Lu Y, Zhang Y, and Steiner MS (1998) Efficient identification of

recombinant adenoviruses by direct plaque-screening. DNA

Cell Biol 17, 643-645.

Paielli DL, Wing MS, Rogulski KR, Gilbert JD, Kolozsvary A,

Kim JH, Hughes J, Schnell M, Thompson T, and Freytag SO

(2000) Evaluation of the biodistribution, persistence,

toxicity, and potential of germ-line transmission of a


422

replication-competent human adenovirus following

intraprostatic administration in the mouse. Mol Ther 1, 263-

274.

Rodriguez R, Schuur ER, Lim HY, Henderson GA, Simons JW,

and Henderson DR (1997) Prostate attenuated replication

competent adenovirus (ARCA) CN706, a selective cytotoxic

for prostate-specific antigen-positive prostate cancer cells.

Cancer Res 57, 2559-2563.

Russell WC (2000) Update on adenovirus and its vectors. J Gen

Virol 81, 2573-2604.

Shi CX, Hitt M, Ng P,and Graham FL (2002) Superior tissue-

specific expression from tyrosinase and prostate-specific

antigen promoters/enhancers in helper-dependent compared

with first-generation adenoviral vectors. Hum Gene Ther

13, 211-224.

Steiner MS, Zhang X, Wang Y, and Lu Y (2000b) Growth

inhibition of prostate cancer by adenovirus expressing a

novel tumor suppressor gene pHyde. Cancer Res 60, 4419-

4425.

Steiner MS, Zhang Y, and Lu Y (2000a) A fast way to generate

recombinant adenovirus, a high-frequency-recombination

system. J Industr Microbiol Biotechnol 24, 198-202.

Steiner MS, Zhang Y, Carraher J, and Lu Y (1999) In vivo

expression of prostate specific adenoviral vectors in a canine

model. Cancer Gene Ther 6, 456-464.

Steiner MS, Zhang Y, Farooq F, Lerner J, Wang Y, and Lu Y

(2000c) Adenoviral vector containing wild type p16

suppresses prostate cancer growth and prolongs survival by

inducing cell senescence. Cancer Gene Ther 7, 360-372.

Yu DC, Chen Y, Seng M, Dilley J, and Henderson DR (1999b)

The addition of adenovirus type 5 region E3 enables calydon

virus 787 to eliminate distant prostate tumor xenografts.

Cancer Res 59, 4200-4203.

Yu DC, Sakamoto GT, and Henderson DR (1999a) Identification

of the transcriptional regulatory sequences of human

kallikrein 2 and their use in the construction of calydon virus

764, an attenuated replication competent adenovirus for

prostate cancer therapy. Cancer Res 59, 1498-1504.

Dr. Yi Lu


423


A platform for constructing infectivity-enhanced

fiber-mosaic adenoviruses genetically modified to

express two fiber typesResearch Article

Marianne G. Rots1*, Willemijn M. Gommans1, Igor Dmitriev2, Dorenda

Oosterhuis1, Toshiro Seki2, David T. Curiel2, Hidde J. Haisma1

1Therapeutic Gene Modulation, Groningen University Institute for Drug Exploration, University of Groningen, A.

Deusinglaan 1, 9713 AV Groningen, the Netherlands2Division of Human Gene Therapy, Departments of Medicine, Pathology and Surgery, University of Alabama at

Birmingham, Birmingham, AL 35291, USA

__________________________________________________________________________________

*Correspondence: Marianne G. Rots, Department of Therapeutic Gene Modulation; Groningen University Institute for Drug

Exploration; A. Deusinglaan 1; 9713 AV Groningen; The Netherlands; Tel: +31-50-363 8514 7866; Fax: +31-50-363 3247; e-mail:

[email protected]

Key words: gene therapy, adenovirus, fiber, infectivity enhancement

Abbreviations: adenovirus type 3, (Ad3); coxsackie adenovirus receptor, (CAR); fetal bovine serum, (FBS); Green Fluorescent Protein,

(GFP); Head and neck squamous cell carcinoma, (HNSCC); plaque forming units, (pfu); relative light units, (RLU); viral particle, (vp)

Received: 27 September 2004; Accepted: 6 October 2004; electronically published: October 2004

Summary

Adenoviruses type 5 have been successfully exploited as gene transfer vectors and numerous vectorological

improvements have contributed to increasing efficiency and specificity of adenoviral gene therapy. Despite these

improvements, inefficient gene transfer still is an important limitation and is, at least in part, due to the low

expression of the primary receptor (CAR) on target cells. Combining two different fiber types (the fiber of Ad5 for

CAR-dependent uptake and the fiber of Ad3 for CAR-independent uptake) on an Ad5-based capsid would increase

the options for improvement of specificity and efficiency. In this study, we present an approach to engineer fiber-

mosaic adenoviruses by cloning the fiber of Ad3 into the Ad5 genome under the control of the Major Late Promoter

using native splicing signals. Such fiber-mosaic viruses were efficiently rescued using conventional 293 cells and

demonstrated good infection profiles. Pre-incubation with recombinant fiber knob (either derived from Ad5 or

Ad3) indicated different mechanisms of entry for the fiber-mosaic viruses. The introduction of an additional entry

pathway can be further exploited to overcome low infection efficiency due to low CAR expression. In addition, the

technology will be of value in increasing the specificity of adenoviral gene therapy since this approach allows the

incorporation of two different retargeting ligands per capsid. Such infectivity enhancement will also prove powerful

in the context of replicative agents.

I. IntroductionAdenoviruses are widely used as gene transfer

vehicles in gene therapy for several reasons including the

easy production to high titers and their efficient infection

of both dividing and non-dividing cells. Even though

adenoviruses are among the most efficient vectors in vivo

to date, accounting for 40% of all clinical gene therapy

trials (Marshall, 2001), adenoviral cancer gene therapy is

limited by the low efficiency of gene transfer. This low

gene transfer might at least partially be explained by

no/low expression or accessibility of the primary receptor

for adenoviruses (coxsackie adenovirus receptor (CAR))

(Douglas et al, 2001).

Redirecting viruses to specific receptors on target

cells will improve specificity and possibly also efficiency

(Glasgow and Curiel, 2004). Such transductional

retargeting has been exploited through complexing the

virus to targeting moieties (eg bispecific antibodies) (Rots

et al, 2003) or through genetic modification of the knob or

penton base (Nicklin and Baker, 2002). Alternatively,

several genetic strategies have been developed to stably

incorporate retargeting moieties directly into the viral

capsid. For fiber modifications, the HI-loop or C-terminal

Rots et al: Constructing fiber-mosaic adenoviruses

424

end have been exploited, and several polypeptides have

been successfully incorporated (Belousova et al, 2002).

Although successful in improving the characteristics of the

vector in vitro, the retargeting moiety generally is only

expressed by specific tumor types in vivo . In this respect,

we reasoned that both efficiency and specificity of

adenoviral gene transfer would be improved by allowing a

virus to infect cells via two ways of entry.

Adenoviruses belonging to subgroup C mainly bind

to the CAR receptor and will be internalized after binding

of the penton base to integrins. However, subgroup B

adenoviruses do not bind to CAR but to other receptor(s),

like CD46 (Gaggar et al, 2003), before internalization via

integrin-mediated endocytosis takes place (Cuzange et al,

1994). These subgroup B viruses display a different

infection profile as has been described in detail for

adenovirus type 3 (Ad3) (Stevenson et al, 1997; Kanerva

et al, 2002), Ad7 (Gall et al, 1996), Ad17 (Chillon et al,

1997) and Ad35 (Shayakhmetov et al, 2000). Based on the

improved infection of primary cancer cells described for

Ad3 versus Ad5 (Kanerva et al, 2002; Volk et al, 2003),

we choose to exploit the infection mechanism of Ad3. To

this end, the Ad3 fiber was cloned into the Ad5 genome

using the native fiber splicing signals thus creating a virus

expressing both fibers onto the capsid of Ad5 (fiber-

mosaic virus). We demonstrate that such fiber-mosaic

viruses (AdF3F5) can be rescued and that this virus infects

cells through two different mechanisms; one CAR

mediated entry which can be blocked by recombinant

knob 5 protein and one entry pathway which can be

blocked by preincubation with recombinant knob 3

protein.

This technology of introducing an additional fiber

type in adenoviral gene therapy vectors will contribute to

optimizing adenoviral gene therapy efficiency (Figure 1).

Specificity can subsequently be achieved by introducing

targeting ligands into the knob of Ad5 (Dmitriev et al,

1998) and/or the knob of Ad3 (Uil et al, 2003).

Alternatively, the use of tumor specific promoters will

restrict transgene expression or viral replication

specifically to target cells (Rots et al, 2003). Especially in

the context of replication competent adenoviruses, the

fiber-mosaic approach will be beneficial since secondary

infection efficiency is thought to be a major problem

hampering therapeutic outcome of replicative agents.

II. Materials and methodsA. CellsHuman cervical cancer cells (HeLa) and embryonic kidney

cells (293), both expressing high levels of CAR and integrins,

were purchased from the American Type Culture Collection

(ATCC, Rockville, MD). Head and neck squamous cell

carcinoma (HNSCC) cell lines (FaDu and SCC25), glioma lines

(U373 and U118) and ovarian cancer cell lines (SKOV) were

included for their differential expression of the receptor for Ad3

and Ad5. Cells were cultured at linear phase in recommended

media.

B. Construction of recombinant adenoviral

plasmid encoding the fiber-mosaic adenovirus

AdF3F5Since incorporation of the fiber monotrimer into the viral

capsid is dependent on the tail domain of the fiber, we

constructed a chimeric fiber by fusing the tail of Ad5 to the shaft

of Ad3. Oligos encoding the first 15 amino acids of the tail of the

fiber of Ad5 (based on Ad sequence nts 31042 to 31087

containing the KRAR nuclear localization signal) (Hong and

Engler, 1991) were constructed to contain a NdeI- 3’end. The

shaft and the knob region of Ad3 were obtained by PCR using

Pfu-polymerase (Stratagene) resulting in a NdeI-5’end

(underlined) using the following primers: 5’-

GTACCCATATGAAGATGAAAGCAGCTC-3’ (forward) and

5’-GGGAAGGGGGAGGCAAAATAACTAC-3’ (reverse). The

tail of Ad5 was then genetically fused to the gene coding for the

shaft and the knob of Ad3 and introduced upstream of the wild

type Ad5 fiber by cloning into the PacI site of pAd70-100dlE3

(kindly provided by Dr. Falck-Pederson, Cornell, New York)

(Gall et al, 1996). Digestion with NdeI results in a NdeI-NdeI

fragment containing the shaft and knob of Ad3 followed by

Figure 1. Schematic representation of

infectivity-enhancement by fiber

mosaic adenoviruses. Adenoviruses

expressing two different fiber types on

one capsid can make use of two different

mechanisms of entry. This approach will

circumvent the low expression of the

primary receptor, CAR, as described for

numerous primary cancer cell types. The

technology allows for introduction of

two targeting moieties in the same

virion.


425

upstream sequence of wild type Ad5 fiber and the starting

genetic sequence encoding the Ad5 tail. This fragment was

subcloned into the NdeI site of the adenoviral transfer plasmid

pNEBpkFSP (Krasnykh et al, 1996) to ensure optimal splicing

conditions for the second chimeric fiber. Cloning strategy and

resulting construct is shown in Figure 2. Enzymes used were

obtained from LifeTechnologies and New England Biolabs.

Homologous recombination with the adenoviral backbone

pVK50 (Krasnykh et al, 1996) containing genes encoding

luciferase and Green Fluorescent Protein (GFP) in the E1-region

(Seki et al, 2002) resulted in a plasmid encoding AdF3F5.

Subsequent virus production was performed according to

the pAdEasy protocol (He et al, 1998). Expression of the two

fibers was detected by western blot analysis of 1010 boiled viral

particles separated on a 10% SDS-PAGE gel using the anti-tail

antibody 2D4 (Hong and Engler, 1991) generated at the

University of Alabama at Birmingham Hybridoma Core Facility.

C. VirusesTo compare the infection efficiency of AdF3F5 with

unretargeted Ad5, AdTL was used containing luciferase and GFP

in the E1 region (wild type Ad5 fiber, AdF5) (Alemany and

Curiel, 2001). To investigate the infection efficiency relative to

knob 3 mediated infection, Ad5/3Luc1 was used expressing a

chimeric fiber containing the knob of Ad3 in a Ad5 backbone

(AdK3) (Krasnykh et al, 2001). AdK3 encodes luciferase from a

different expression cassette and can therefore not be directly

compared to AdF5 and AdF3F5. Adenovirus type 3 was obtained

from the American Type Culture Collection. All viruses were

CsCl purified and quantified for viral particle (vp) number and

plaque forming units (pfu) according to standard procedures. The

vp/pfu ratios were 3.1, 3.7 and 2.2 for AdF3F5, AdF5 and AdK3,

respectively.

D. Inhibition of viral mediated gene transfer

by recombinant fiber proteinsMonolayers were grown to 70% confluency in 24 wells

plates and incubated with recombinant Ad3 knob (10 µg/ml

PBS), Ad5 knob (2 or 10 µg/ml), a combination of both knobs or

with plain PBS for 10 minutes at room temperature.

Recombinant proteins were obtained as described previously

(Krasnykh et al, 1996). Viruses (100 vp/cell) were added in 100

µl cell growth medium containing 2% fetal bovine serum (FBS,

hospital pharmacy University Hospital Groningen) and cells

were incubated for 1 hour at 37°C. Then, 500 µl growth medium

containing 10% FBS was added and cells were incubated for 2

days. Cells were lysed using Cell Culture Lysis Buffer and

luciferase activity was measured using a luminometer (Packard,

Groningen, the Netherlands), according to manufacturers

conditions (Luciferase Assay System, Promega, Leiden, the

Netherlands). Data are expressed as relative light units (RLU).

E. Infectivity assaysTo compare infection efficiency of the fiber-mosaic

adenovirus AdF3F5 with Ad5 infection (AdF5) and with

infection of Ad3 (Ad5/3-Luc1), different cell lines were grown to

70% confluent monolayers in 24 wells plates. Viruses were

diluted in 100 µl medium containing 2% FBS and cells were

infected at 100 vp/cell. After 1 hour of incubation at 37°C,

medium containing 10% FBS was added. After 2 days, cells were

lysed and luciferase activity was determined. Data are

represented as means of triplicates of representative experiments.

Students t-Tests were performed to analyze the differences

between infection efficiencies of AdF5 and AdF3F5.

Figure 2. Cloning strategy for the transfer plasmid pNEBpkFSP.F3F5 for construction of fiber-mosaic adenoviruses AdF3F5.

The chimeric fiber F3 was made by ligating the 5’ part of the tail of Ad5 (T5) to the PCR product of the Shaft and the Knob of Ad3

(SK3). Subsequently, this fragment (5T3SK) was ligated into pAd70-100dlE3 containing wild type fiber (F5). Restriction with NdeI of

plasmid pAd70-100(5T3SK) results in a fragment containing: 1) 3SK, 2) the wild type splicing sequences (*) upstream of fiber 5 and 3)

the initial portion of the tail of wild type fiber 5. Subcloning of this NdeI-fragment into pNEBpkFSP resulted in a transfer vector for

introduction of an additional fiber-encoding gene into the adenoviral backbone. Both fibers are under the control of the Major Late

Promoter, with the tripartite leader marked as black boxes and the wild type splicing sites denoted as *.


426

III. ResultsA. Construction of recombinant

adenoviral plasmid encoding the fiber-mosaic

adenovirus AdF3F5To circumvent low infection efficiency which is

hampering gene therapy approaches in vivo, we

constructed an adenovirus with two different fiber types

allowing two different mechanisms of cellular entry. Since

adenovirus type 5 is the most commonly used vector for

adenoviral gene therapy, we developed an approach to

incorporate the additional fiber into the capsid of Ad5. To

retain the trimerisation properties of adenoviral fiber

molecules, we focused on subgroup B viruses which do

not use the CAR receptor for entry. Optimal incorporation

of the chimeric additional fiber protein into the capsid of

Ad5, is ensured by cloning the Shaft and the Knob of Ad3

(3SK fragment) downstream of the initial coding sequence

for the Tail of Ad5 (5T) (Figure 2).

To achieve equal expression levels of the chimer

fiber compared to the wild type fiber, the chimeric fiber

(5T3SK) was cloned under the control of the same

promoter as the wild type fiber (the native adenoviral

Major Late Promoter). To this end, however, the splicing

signals of the wild type fiber 5 sequence also needed to be

retained. This has been achieved through subcloning of the

Ad3ShaftKnob-Ad5Tail Nde-fragment into another fiber

shuttle plasmid (see Materials and Methods). The fiber-

mosaic AdF3F5 viruses could be rescued on 293 cells as

efficiently as other first generation adenoviruses (up to

1012 viral particles/ml). Western blot analysis subsequently

confirmed the presence of both fiber types onto the CsCl-

purified virus material. The protein levels, however, were

not equal and higher levels of Ad5 fiber were detected

compared to Ad3 fiber (Figure 3).

B. Infectivity assays1. Functional validation of AdF3F5.To identify the pathway of entry of AdF3F5,

different cell lines (HeLa cells (expressing high levels of

both CAR and the receptor for Ad3), FaDu and SCC25

cells (both expressing low levels of CAR and high levels

of Ad3 receptor)) were incubated with AdF3F5, AdF5 and

AdK3 after preincubation with recombinant knob 3 and/or

knob 5 protein as described in Material and Methods.

Presence of knob 3 did slightly inhibit infection of

AdF3F5 (expressing both Ad3 and Ad5 fibers) and of

AdK3 (expressing the knob of Ad3, displaying an Ad3

infection spectrum) on HeLa cells (14 and 10% inhibition,

respectively) (Figure 4). However, more pronounced

inhibition of knob 3 mediated infection was observed on

FaDu (AdF3F5: 31% and AdK3: 58% inhibition) and

SSC25 (27 and 77%, respectively). Preincubation with

recombinant knob 5 protein efficiently inhibited infection

of AdF3F5 and AdF5 (wild type Ad5 fiber) on all cell

lines, especially on HeLa cells (over 90%). Combination

of both recombinant knob proteins inhibited the infection

efficiency of AdF3F5 even further on FaDu and SCC25

cells. Preincubation with knob 3 occasionally increased

infection efficiency of AdF5, whereas knob 5 could

marginally inhibit infection of AdK3 (shown for FaDu in

Figure 4b).

2. Determination of infection efficiency of

AdF3F5 on cancer cells.Some cancer types are known to be less susceptible

to infection with Ad5 compared to others due to low CAR

levels. To test improved infectivity of the fiber-mosaic

AdF3F5 on different cancer cell types, cell lines were

infected with AdF3F5, AdF5 and AdK3 (Figure 5).

Infection with AdF3F5 was as efficient as AdF5 on HeLa

and FaDu, while an 2- to 3-fold increase in efficiency was

observed for AdF3F5 compared to AdF5 on U373, U118

Figure 3. Western blot detecting adenoviral fiber molecules. Boiled CsCl-purified viruses (1010 viral particles) were separated on

SDS-PAGE gel, transferred to PVDF membrane and stained with 2D4 anti-tail antibody. Ad3 virions showed a band for the fiber

molecule at 35 kDa, whereas the fiber of Ad5 was detected around 65 kDa. For the fiber-mosaic AdF3F5, two bands were detectable:

one strong band at the size of the fiber of Ad5, whereas a weaker band could be detected at the size of Ad3 fibers.


427

Figure 4. Functional validation of AdF3F5. a) HeLa, FaDu and SCC25 cells were infected with AdF5, AdF3F5 and AdK3 (100

vp/cell) after pre-incubation with recombinant knob 3 (10 µg/ml) and/or knob 5 (2µg/ml). After 2 days, luciferase readings were

performed. Data are expressed as percentage of relative light units, 100% being no knob block present. b) to investigate cross-inhibition

of the knobs, FaDu cells were infected with AdF5, AdF3F5 and AdK3 (100 vp/cell) after pre-incubation with recombinant knob 3 or

knob 5 (10µg/ml).


428

Figure 5. Absolute and relative infection efficiencies of fiber-mosaic Ad on Ad3 receptor positive cells. Different cell lines were

incubated with AdF5, AdF3F5 and AdK3 viruses (100 vp/cell) and after two days infectivity efficiency was measured by determining

luciferase activity. Data are represented as mean values of triplicates + SD. To directly compare the different viruses, infectivity on HeLa

cells has been set at 100% in Figure 5b.

and on SKOV cells (p!0.01). Since the receptor levels of

Ad3 and Ad5 receptors on HeLa cells is similar, the

infection of the three viruses on HeLa cells was set at

100% to determine the relative infection efficiency of

AdF3F5 compared to AdK3. Although AdF3F5 showed

improved infection efficiency over AdF5, infection

efficiency of AdF3F5 was not improved compared to

AdK3 for any of the cell lines tested.

IV. DiscussionLow infection efficiency is hampering cancer gene

therapy from showing its full potential and vectorological

improvements are warranted. Moreover, virotherapy (the

conditional viral replication resulting in oncolysis) would

greatly benefit from infectivity enhanced agents as shown

by incorporation of different targeting moieties in fibers of

replication competent viruses (Hemminki et al, 2001;

Bauerschmitz et al, 2002; Kawakami et al, 2003). These

studies, however, again are limited to the expression of

one receptor type on tumor cells. In this study, we describe

the feasibility to grow fiber-mosaic adenoviral agents

targeting two different receptors simultaneously. We

showed that infection with this fiber-mosaic virus shows

advantage over AdF5 infection. Although no increase in

efficiency was observed compared to infection with AdK3

for low CAR cell lines, the technology provides a flexible

platform allowing increase of specificity by introduction

of two different targeting ligands.

Tropism of adenoviruses is determined by the knob

of the fiber protein and the penton base. We hypothesized

that the introduction of an additional different fiber type

provides a way of introducing an additional mechanism of

cellular entry of virus, thereby increasing efficiency of

infection and/or broadening the infection spectrum. Since

Ad3 has been demonstrated to efficiently infect several

CAR deficient (primary) tumor types (Stevenson et al,

1995; Kanerva et al, 2002; Volk et al, 2003), we choose

the Ad3 fiber molecule to be incorporated into the capsid

of type 5 adenoviruses in addition to the wild type Ad5

fiber.

We demonstrated that two different fiber proteins can

be incorporated into one viral capsid and that such fiber-

mosaic viruses can be efficiently rescued using

conventional methods. Although the additional fiber was

cloned under the control of the same Major Late Promoter,

using the same upstream splicing sequences as the wild

type fiber, incorporation of the chimeric fibers onto the

capsid was less efficient then for the wild type fiber, as

detected by western blot. This might be explained by a

packaging bias of one fiber type over the other as

previously described for naturally occurring fiber-mosaic

adenoviruses (Schoggins et al, 2003). However, in our

approach the tail of both fiber types starts with the first

amino acids of the tail of wild type Ad5 to avoid

inefficient incorporation. The imbalanced incorporation

most likely is explained by the low protein expression of

fiber observed after infection by Ad3 (Albiges-Rizo et al,

1991). However, we continued with this fiber chimera

since the shorter size of the fiber of Ad3 allowed easy

biochemical discrimination with the wild type Ad5 fiber.

Blocking experiments demonstrated that these fiber-

mosaic viruses exploit two ways of entry. Importantly,

infection efficiency was not impaired by incorporation of

the additional fiber into the capsid. As both the knob of

Ad5 (Belousova et al, 2002) as well as the knob of Ad3

(Uil et al, 2003) can be exploited to introduce targeting

moieties, fiber-mosaic viruses represents a powerful

platform for constructing efficient, but specific gene

therapy agents. Improved gene transfer efficiency by

introducing two retargeting moieties onto the viral capsid

has previously been obtained by incorporation of both the

RGD and a polylysine motif into the fiber (Wu et al,

2002), supporting our hypothesis.

Previously, we obtained fiber-mosaic adenoviruses

expressing both the fiber of Ad5 and a chimeric fiber

consisting of the tail and the shaft of Ad5 fiber and the


429

knob of Ad3 by co-culture of Ad5 and AdK3. The

resulting viruses incorporated both fibers on the same

virion as has also been described for co-culture of other

serotypes in the early 70s (Norrby and Gollmar, 1971).

These AdF5:AdK3 fiber-mosaic viruses demonstrated an

expanded infection spectrum (Takayama et al, 2003).

Interestingly, the viruses also showed an improved

infection efficiency on various cell types tested compared

to Ad5, suggesting synergism between knob 5 and knob 3.

In this study, we did not observe such profound synergism,

probably since the knob of Ad3 is expressed on the short

shaft of Ad3; Binding to the receptor of Ad3 through the

short shaft might prevent simultaneous binding to the

CAR via the long shaft. Any receptor-cross talk resulting

in synergism will therefore be prevented.

Although co-infection results in fiber-mosaic viruses,

the production is laborious and most likely not very

reproducible. The approach to genetically construct a

fiber-mosaic virus expressing two different fibers is

therefore preferred. Naturally occurring human fiber-

mosaic adenoviruses have been identified and belong to

subgroup F enteric viruses. These viruses (serotype 40 and

41) contain two separate genes encoding a short fiber of

200A (41 kDa) and a long fiber of 340A (61 kDa) (Kidd et

al, 1993; Favier et al, 2002). These viruses therefore are

very similar to the one described here as the fiber of Ad3

is 160A and the fiber of Ad5 is 370A. The long fiber of

Ad40 and Ad41 binds to the CAR receptor whereas

binding of the short fiber is CAR-independent (Roelvink

et al, 1998). The concept of tandem fiber genes to

construct fiber-mosaic viruses had previously been shown

feasible (Schoggins et al, 2003; Pereboeva et al, 2004). In

an elegant approach, Perebouva et al, introduced the

option of binding targeting ligands to the second fiber type

through a biotin-acceptor peptide (Pereboeva et al, 2004).

Schoggins et al, reported on the construction of a fiber-

mosaic adenovirus type 5 co-expressing the fiber of Ad7

either with the fiber of Ad5 or with the short fiber of

Ad41. Like AdF3F5, the fiber-mosaic F7F5 virus showed

similar infection efficiencies compared to Ad5 (Schoggins

et al, 2003). The infectivity of the Ad5 based fiber-mosaic

adenovirus expressing the fiber of Ad7 and the short fiber

of Ad41 virus was dramatically impaired in vitro. Also in

vivo, a 2-log lower transduction of the liver was observed.

Similarly, a 10-fold reduction in liver transduction has

been reported for an Ad5 based adenovirus expressing the

shaft and the knob of Ad3 on its capsid (Vigne et al,

2003). In this respect, fiber-mosaic viruses based on Ad5

show promise as a platform for engineering efficient gene

therapy agents with a liver-off profile.

In conclusion, we demonstrated that viruses

expressing two different fiber types can be constructed and

efficiently rescued. Both fiber types are functional in

infecting cells, which opens the way for infecting a

broader spectrum of tumors. The next step is to increase

the specificity of this potent vector by introducing

targeting moieties and/or tumor specific promoters to

selectively express a trangene or to restrict viral

replication.

AcknowledgmentsWe want to thank Dr Falck-Pederson from the

Department of Microbiology, Weill Medical College of

Cornell University, New York, USA for providing us with

pAd70-100dlE3. The study was supported by NIH grant

#5 P50 CA89019 (Breast Cancer SPORE) and NIH grant

#1 R01 CA94084 (Pancreatic Cancer).

ReferencesAlemany R and Curiel DT (2001) CAR-binding ablation does

not change biodistribution and toxicity of adenoviral vectors.

Gene Ther 8, 1347-1353.

Bauerschmitz GJ, Lam JT, Kanerva A, Suzuki K, Nettelbeck

DM, Dmitriev I, Krasnykh V, Mikheeva GV, Barnes MN,

Alvarez RD, Dall P, Alemany R, Curiel DT and Hemminki

A (2002) Treatment of ovarian cancer with a tropism

modified oncolytic adenovirus. Cancer Res 62, 1266-1270.

Belousova N, Krendelchtchikova V, Curiel DT and Krasnykh V

(2002) Modulation of adenovirus vector tropism via

incorporation of polypeptide ligands into the fiber protein. J

Virol 76, 8621-8631.

Chillon M, Bosch A, Zabner J, Law L, Armentano D, Welsh MJ

and Davidson BL (1999) Group D adenoviruses infect

primary central nervous system cells more efficiently than

those from group C. J Virol 73, 2537-40.

Cuzange A, Chroboczek J and Jacrot B (1994) The penton base

of human adenovirus type 3 has the RGD motif. Gene 146,

257-259.

Dmitriev I, Krasnykh V, Miller CR, Wang W, Kashentseva E,

Mikheeva G, Belousova N and Curiel DT (1998) An

adenovirus vector with genetically modified fibers

demonstrates expanded tropism via utilization of a

coxsackievirus and adenovirus receptor-independent cell

entry mechanism. J Virol 72, 9706-9713.

Douglas JT, Kim M, Sumerel LA, Carey DE and Curiel DT

(2001) Efficient oncolysis by a replicating adenovirus (ad) in

vivo is critically dependent on tumor expression of primary

ad receptors. Cancer Res 61, 813-817.

Favier AL, Schoehn G, Jaquinod M, Harsi C and Chroboczek J

(2002) Structural studies of human enteric adenovirus type

41. Virology 293, 75-85.

Gaggar A, Shayakhmetov DM and Lieber A (2003) CD46 is a

cellular receptor for group B adenoviruses. Nat Med 9,

1408-1412.

Gall J, Kass-Eisler A, Leinwand L and Falck-Pedersen E (1996)

Adenovirus type 5 and 7 capsid chimera, fiber replacement

alters receptor tropism without affecting primary immune

neutralization epitopes. J Virol 70, 2116-2123.

Glasgow JN, Bauerschmitz GJ, Curiel DT, Hemminki A (2004)

Transductional and transcriptional targeting of adenovirus for

clinical applications Curr Gene Ther 4,1-14.

He TC, Zhou S, da Costa LT, Yu J, Kinzler KW and Vogelstein

B (1998) A simplified system for generating recombinant

adenoviruses. Proc Natl Acad Sci USA 95, 2509-2514.

Hemminki A, Dmitriev I, Liu B, Desmond RA, Alemany R and

Curiel DT (2001) Targeting oncolytic adenoviral agents to

the epidermal growth factor pathway with a secretory fusion

molecule. Cancer Res 61, 6377-6381.

Hong JS and Engler JA (1991) The amino terminus of the

adenovirus fiber protein encodes the nuclear localization

signal. Virology 185, 758-767.

Kanerva A, Mikheeva GV, Krasnykh V, Coolidge CJ, Lam JT,

Mahasreshti PJ, Barker SD, Straughn M, Barnes MN,

Alvarez RD, Hemminki A and Curiel DT (2002) Targeting

adenovirus to the serotype 3 receptor increases gene transfer


430

efficiency to ovarian cancer cells. Clin Cancer Res 8, 275-

280.

Kawakami Y, Li H, Lam JT, Krasnykh V, Curiel DT and

Blackwell JL (2003) Substitution of the adenovirus serotype

5 knob with a serotype 3 knob enhances multiple steps in

virus replication. Cancer Res 63, 1262-1269.

Kidd AH, Chroboczek J, Cusack S and Ruigrok RW (1993)

Adenovirus type 40 virions contain two distinct fibers.

Virology 192, 73-84.

Krasnykh VN, Mikheeva GV, Douglas JT and Curiel DT (1996)

Generation of recombinant adenovirus vectors with modified

fibers for altering viral tropism. J Virol 70, 6839-6846.

Krasnykh V, Belousova N, Korokhov N, Mikheeva G and Curiel

DT (2001) Genetic targeting of an adenovirus vector via

replacement of the fiber protein with the phage T4 fibritin. J

Virol 75, 4176-4183.

Marshall E (2001) Gene therapy. Viral vectors still pack

surprises. Science 294, 1640.

Nicklin SA and Baker AH (2002) Tropism-modified adenoviral

and adeno-associated viral vectors for gene therapy. Curr

Gene Ther 2, 273-293.

Norrby E and Gollmar Y (1971) Mosaics of Capsid Components

Produced by Cocultivation of Certain Human Adenoviruses

in Vitro. Virology 44, 383-395.

Pereboeva L, Komarova S, Mahasreshti PJ and Curiel DT (2004)

Fiber-Mosaic Adenovirus as a novel approach to design

genetically modified adenoviral vectors. Vir Res 105, 35-46.

Roelvink PW, Lizonova A, Lee JG, Li Y, Bergelson JM, Finberg

RW, Brough DE, Kovesdi I and Wickham TJ (1998) The

coxsackievirus-adenovirus receptor protein can function as a

cellular attachment protein for adenovirus serotypes from

subgroups A, C, D, E and F. J Virol 72, 7909-7915.

Rots MG, Curiel DT, Gerritsen WR and Haisma HJ (2003)

Targeted cancer gene therapy, the flexibility of adenoviral

gene therapy vectors. J Control Release 87, 159-165.

Schoggins JW, Gall JG and Falck-Pedersen E (2003) Subgroup B

and F fiber chimeras eliminate normal adenovirus type 5

vector transduction in vitro and in vivo. J Virol 77, 1039-

1048.

Seki T, Dmitriev I, Kashentseva E, Takayama K, Rots M, Suzuki

K and Curiel DT (2002) Artificial extension of the

adenovirus fiber shaft inhibits infectivity in coxsackievirus

and adenovirus receptor-positive cell lines. J Virol 76, 1100-

1108.

Shayakhmetov DM, Papayannopoulou T, Stamatoyannopoulos G

and Lieber A (2000) Efficient gene transfer into human

CD34(+) cells by a retargeted adenovirus vector. J Virol 74,

2567-2583.

Stevenson SC, Rollence M, White B, Weaver L and McClelland

A (1995) Human adenovirus serotypes 3 and 5 bind to two

different cellular receptors via the fiber head domain. J Virol

69, 2850-2857.

Stevenson SC, Rollence M, Marshall-Neff J and McClelland A

(1997) Selective targeting of human cells by a chimeric

adenovirus vector containing a modified fiber protein. J

Virol 71, 4782-4790.

Takayama K, Reynolds PN, Short JJ, Kawakami Y, Adachi Y,

Glasgow JN, Rots MG, Krasnykh V, Douglas JT and Curiel

DT (2003) A mosaic adenovirus possessing serotype Ad5

and serotype Ad3 knobs exhibits expanded tropism.

Virology 309, 282-293.

Uil TG, Seki T, Dmitriev I, Kashentseva E, Douglas JT, Rots

MG, Middeldorp JM and Curiel DT (2003) Generation of an

adenoviral vector containing an addition of a heterologous

ligand to the serotype 3 fiber knob. Cancer Gene Ther 10,

121-124.

Vigne E, Dedieu JF, Brie A, Gillardeaux A, Briot D, Benihoud

K, Latta-Mahieu M, Saulnier P, Perricaudet M, Yeh P (2003)

Genetic manipulations of adenovirus type 5 fiber resulting in

liver tropism attenuation. Gene Ther 10, 153-162.

Volk AL, Rivera AA, Kanerva A, Bauerschmitz G, Dmitriev I,

Nettelbeck DM and Curiel DT (2003) Enhanced adenovirus

infection of melanoma cells by fiber-modification,

incorporation of RGD peptide or Ad5/3 chimerism. Cancer

Biol Ther 2, 511-515.

Wu H, Dmitriev I, Kashentseva E, Seki T, Wang M and Curiel

DT (2002) Construction and characterization of adenovirus

serotype 5 packaged by serotype 3 hexon. J Virol 76, 12775-

12782.

Group picture of the Department of Therapeutic Gene Modulation. Dr. Marianne G. Rots is the third person shown in the

first row from right to left.


431


Internal ribosome entry sites in cancer gene therapyReview Article

Benedict J Yan1 and Caroline GL Lee1,2,*1Department of Biochemistry, National University of Singapore, Singapore2Division of Medical Sciences, National Cancer Center, Singapore

__________________________________________________________________________________

*Correspondence: Caroline G. Lee, Ph.D., Division of Medical Sciences, National Cancer Center, Level 6, Lab 5, 11 Hospital Drive,

Singapore 169610; Tel: 65-6436-8353; Fax: 65-6224-1778; Email: [email protected]

Key words: cancer gene therapy, Tumor-directed therapy, Host-directed therapy, Internal ribosome,

Abbreviations: 5’ untranslated region, (5’UTR); cationic amino acid transporter, (Cat-1); dihydrofolate reductase, (DHFR); hypoxia-

inducible factor-1!, (HIF-1!); internal ribosome entry site, (IRES); methylguanine methyltransferase, (MGMT); multidrug-resistance 1

gene, (MDR1); open reading frames, (ORF); vascular endothelial growth factor, (VEGF)

Received: 14 October 2004; Accepted: 21 October 2004; electronically published: October 2004

Summary

Cancer gene therapy is a promising treatment modality. Strategies in cancer gene therapy include tumor-directed

therapy (e.g. the delivery of suicide, immunomodulatory, anti-angiogenic, apoptotic genes or oncolytic viruses or

genes to reinstate tumor suppressor activity) and host-directed therapy (e.g. the delivery of genes encoding factors

that enhance the antigen presenting function of dendritic cells or protect the patient against myelosuppression). As

cancer, a complex disorder, often results from several defective genes, efficacy of cancer gene therapy can be

improved by a combination approach whereby several different genes are targeted simultaneously. Of several

methods to effect co-expression of multiple genes, the employment of internal ribosome entry sites (IRES)

represents a promising approach. This review examines the various preclinical and clinical studies employing

IRESs for cancer gene therapy, as well as properties of various IRESs that could be exploited for cancer gene

therapy.

I. IntroductionEfforts to combat cancer with gene therapy have

been underway for more than a decade (Gottesman, 2003),

with several clinical trials having been conducted with

varying success (Schuler et al, 2001; Buller et al, 2002;

Kuball et al, 2002; Pagliaro et al, 2003). Because cancer

pathogenesis stems in part from genetic mutations, gene

therapy is, in concept, a viable approach to cancer

treatment. Gene therapy is also of considerable utility on

several fronts not directly pertaining to tumor-specific

therapy, for example the delivery of drug resistance genes

to mitigate myelotoxicity of chemotherapeutic agents.

II. Strategies in cancer gene therapyA. Tumor-directed therapyFundamental tenets in cancer biology are that

deregulated growth is due to a combination of the

activation of oncogenes and inhibition of tumor suppressor

genes, both of which present as obvious targets for cancer

gene therapy. To date, most of the clinical trials have

centered on reinstating tumor suppressor activity, in

particular p53. However, the results concerning clinical

efficacy have not been impressive (Zeimet and Marth,

2003; McNeish et al, 2004). One conceivable reason could

be that modifying the expression of a single gene alone is

insufficient to prohibit cancer growth because of numerous

diverse pathways that still permit cancer progression. This,

in theory, could be countered by the delivery of multiple

genes that act on different pathways, such that a

complementary or synergistic effect is obtained.

Other major themes in tumor-directed therapy

include the delivery of suicide, immunomodulatory, anti-

angiogenic, apoptotic genes and oncolytic viruses. Suicide

genes encode enzymes that convert prodrugs to their

cytotoxic form, and the herpes simplex virus thymidine

kinase, which converts ganciclovir to ganciclovir

phosphate, falls under this category. The

immunomodulatory genes employed often code for

cytokines, an example being interleukin 2, and these serve

to mobilize the immune system to effect tumor cell killing.

Strategies involving suicide and immunomodulatory genes

are a popular combination in cancer gene therapy (Pizzato

et al, 1998; Soler et al, 1999; Wen et al, 2001; Barzon et

al, 2002).

Yan and Lee: Internal ribosome entry sites in cancer gene therapy

432

Tumor cells actively induce the formation of new

blood vessels, and a recent paradigm in oncology is the

use of agents to impede this process, with a number of

ongoing clinical trials evaluating the effectiveness of such

agents. Gene therapy has been proposed to have several

advantages over protein-based inhibitors, including the

sustained expression of antiangiogenic molecules and the

ability to deliver multiple transgenes (Kleinman and Liau,

2001).

The induction of apoptosis in cancer cells is another

strategy, and studies involving the delivery of genes

coding for pro-apoptotic factors, such as TRAIL, Bax and

Smac/Diablo, have been conducted (Waxman and

Schwartz, 2003). With an increasing recognition that most

anticancer treatment modalities such as chemotherapy or

radiotherapy trigger apoptosis of cancer cells, gene

therapy may also prove useful in sensitizing the cells to

the effects of conventional agents.

Oncolytic viruses selectively replicate in and kill

tumor cells, and this specificity has contributed to their

favorable safety profile. However, clinical trials have

demonstrated an over-attenuation of these agents to the

extent that efficacy has been compromised. Hence there

has been a move to arm them with therapeutic genes to

improve their tumor-killing capabilities (Hermiston and

Kuhn, 2002).

B. Host-directed therapyMyelosuppression is an extremely frequent

complication of treatment utilizing conventional

chemotherapeutic agents, and this at times may prove

fatal. Hence a leading paradigm in cancer gene therapy is

the delivery of genes to protect susceptible haemopoietic

cells from the effects of these cytotoxic agents. Commonly

employed drug-resistance genes include the multidrug-

resistance 1 gene (MDR1), dihydrofolate reductase

(DHFR) gene and methylguanine methyltransferase

(MGMT) gene (Sorrentino, 2002).

Figure 1. Strategies in Cancer Gene Therapy to date utilizing IRESs


433

Tumor vaccines are another promising modality

(Berzofsky et al, 2004), and there are a variety of methods

to induce tumor immunity. Naked DNA expression

plasmids encoding tumor antigens have been shown to

generate immune responses. Another approach is to

deliver genes coding factors that enhance the antigen

presenting function of dendritic cells.

III. Multiple gene delivery and

attendant problemsAs noted above, the ability to co-express multiple

genes would be of immense value in cancer gene therapy

because complementary or synergistic effects could lead to

improved efficacy. Viruses are popular vectors for gene

delivery because of their higher transduction efficiency,

but this advantage is offset by the constraints placed on the

vector size. Because most therapeutic genes are quite

large, a polycistronic vector must be designed in such

fashion that the system of effecting multigene delivery is

modest in scale.

There are several methods available to effect

multiple gene expression. One could be the incorporation

of multiple promoters such that different proteins are

produced from separate mRNAs. A major drawback of

this approach is the possibility of promoter suppression

(Emerman and Temin, 1984), a phenomenon whereby

expression of any gene may be attenuated for ill-defined

reasons.

Other methods including splicing, fusion proteins

and proteolytic processing have been reviewed by de

Felipe (2002).

IV. Internal ribosome entry sitesIn eukaryotes, initiation of translation of most

mRNAs begins by a cap-dependent mechanism whereby a

43S complex (comprising a 40S subunit, the initiator

methionine-tRNA and other initiation factors) is recruited

to the 5’ methylguanosine cap. Recognition of the 5’ end

is mediated through the cap-binding protein complex

eIF4F, which comprises three subunits eIF4E, eIF4A and

eIF4G subunits. The 43S complex then scans in a 5’ to 3’

direction until an initiation codon is encountered,

following which the initiation factors dissociate and a

larger 60S ribosomal subunit binds to form the 80S

ribosome. Protein synthesis then commences.

IRESs are RNA structures capable of initiating

ribosome binding and translation in the absence of a 5’

cap. Most commonly found in the 5’ untranslated region

(5’UTR) of mRNAs, they were first documented in

poliovirus and other viral RNA sequences (Pelletier and

Sonenberg, 1988), but were subsequently shown to exist in

cellular mRNAs as well. To date there have been more

than 50 reported viral and cellular IRESs in total, and the

list is steadily expanding. The subject of IRESs has been

extensively reviewed, both in the academic (Hellen and

Sarnow, 2001; Stoneley and Willis, 2004) and applied

(Ngoi et al, 2004) setting.

In utilizing this system for multiple gene co-

expression, an internal ribosome entry site (IRES) is

placed between two or more open reading frames (ORF),

such that a corresponding number of proteins are

generated from a single mRNA transcript.

V. Application of IRESs in cancer

gene therapyIRESs have been employed in a number of

preclinical and clinical studies with some success, and

selected ones, that span the gamut of cancer gene therapy,

are displayed in Table 1.

VI. Choice of IRES?Most of the studies detailed in Table 1 employ the

EMCV IRES, but a number of studies have reported that

other IRESs may possess greater activity than the EMCV

IRES, for example the eIF4G IRES (Wong et al, 2002).

IRESs display a huge variation in their activity in various

contexts, and given the burgeoning number of IRESs, it

might be possible to tailor an IRES for a particular

purpose, for example in the treatment of a certain type of

cancer. However, current data is too sparse to allow a

meaningful decision making process as to the best IRES

for a given tumor type. Some factors governing the choice

of IRES are discussed, and Table 2 displays known

properties of IRESs that might be useful in developing an

effective polycistronic vector.

A. Tissue/Cell type specificityIRESs have not been shown to display a narrow

tissue/cell type specificity, and therefore cannot be

employed in situations where this property is requisite for

expression of the 3’ cistron, in contrast to tumor-specific

promoters.

B. Tissue/Cell type activityUnfortunately not much is know about the tissue /

cell type specificity of the different IRESs. Most IRES

studies have investigated the activity of a particular IRES

in different cell types, but the most valuable information

pertaining to gene therapy application can only be gleaned

from studies that have compared the activity of different

IRESs in a particular tumor type. Nevertheless, known

properties of some IRESs are detailed in Table 2.

C. Milieu-dependent activityCertain stressful conditions are known to suppress

cap-dependent translation, for example hypoxia, starvation

or apoptosis, leading to a general decrease in protein

synthesis. In this regard, IRESs possess a theoretical

advantage over other modalities such as promoters,

because some IRESs continue to operate under such

conditions - conditions that are typically experienced by

tumor cells. For example, the vascular endothelial growth

factor (VEGF) IRES (Stein et al, 1998) and hypoxia-

inducible factor-1! (HIF-1!) IRES (Lang et al, 2002)

maintain activity during hypoxia; and the cationic amino

acid transporter (Cat-1) IRES (Fernandez et al, 2001)

exhibits increased activity during amino acid starvation.

Where an IRES, such as the BCL-2 IRES (Sherrill et al,

2004), displays increased activity following cytotoxic drug


434

Table 1. Preclinical and Clinical Studies to date utilizing IRESs

Preclinical Studies (Tumor-directed therapy)

Year

published

Strategy/Aim

of Study

IRES

employe

d

Therapeutic/market/re

porter genes encoded

Vector Cell Lines References

1. SW480 Colon cancer

2. HCT116 Colon cancerArming an

oncolytic virus

with a suicide

gene

EMCV yCD Human

adenovirus 5

3.HT29 Colon cancer

Human

(Fuerer and

Iggo, 2004)

1. A549 Lung cancer

2. EKVX Lung cancer

3. HT29 Colon cancer

4. IGROV1 Ovariancancer

5. MDA-

MB-231

Breast

cancer

6. MDA-

MB-435

Breast

cancer

7. NCI-

H226

Lung cancer

8. NCI-

H522

Lung cancer

9. PC-3 Prostate

cancer

10. RXF-

393

Renal cancer

11. T47-D Breast

cancer

12. U251 Glioblastoma

multiforme

Suicide gene

delivery

EMCV 1. P450

2. NADPH-cytochrome

P450 reductase

Replication-

defective

adenovirus

13. 786-0 Renal cancer

Human (Jounaidi

and

Waxman,

2004)

Fusion of

reporter gene to

variousoncolytic viral

genes

EMCV Luciferase reporter gene Conditionally

replicative

adenovirus

1. A549 Lung cancer Human (Rivera et al,

2004)

1. 293 Embryonic

kidney

2004

Antiangiogenes

is

EMCV 1. Angiostatin

2. Endostatin

3. GFP

Recombinant

adenovirus-

associated

virus

2.

SKOV3.ipl

Ovarian

cancer

Human (Ponnazhaga

n et al, 2004)

1. KB-3-1 Cervical

cancer

2. 293 Embryonic

kidney

3. HepG2 Liver cancer

Human (Wong et al,

2002)

Charecterizatio

n of activity of

different IRESs

in varying

contexts using

reporter assays

1.

EMCV

2. BIP

3. eIF4G

4. MYC

5. VEGF

1. CAT

2. GAL Plasmid

4. N2a Neuroblasto

ma

Mouse

1. WRO Thyroid

cancer

2. FTC-133 Thyroid

cancer

3. C8305 Thyroid

cancer

4. ARO Thyroidcancer

5. HeLa Cervical

cancer

6. AoU373 Astrocytoma

Suicide and

immunomodula

ting gene

delivery

EMCV 1. HSV-tk

2. IL-2

Retrovirus

7. HepG2 Liver cancer

Human (Barzon et

al, 2002)

1.

Cwr22Rv1

Prostate

cancer

2. Dul45 Prostate

cancer

3. DuPro Prostate

cancer

4. JCA-1 Prostate

cancer

5. LNCaP Prostate

cancer

2002

Induction of

apoptosis

EMCV 1. TRAIL

2. GFP

Adenovirus

6. PC-3 Prostate

cancer

Human

(Voelkel-

Johnson et

al, 2002)


435

7. PPC-1 Prostate

cancer

8. TsuPr1 Prostate

cancer

9. PrEC Primary

prostate

epithelial

cells

1. U266 Myeloma

2. OCI-

My5

Myeloma

3. ANBL-6 Myeloma

4. K562 Leukemia

2001 Immunotherapy 1.

EMCV

2.

FMDV

1. IL-12p40

2.IL-12p35

3. CD80

1. Retrovirus

2. Adenovirus

5. Namalwa Myeloma

Human (Wen et al,

2001)

1. HSV-tk

2. IL-4

3. Neomycin1999 Tumor cell

vaccine

EMCV

4. phosphotransferase

Retrovirus 1. 9L Gliosarcoma Rat (Okada et al,

1999)

1. IL-2 1. Al72 Glioblastoma Human1998 Suicide and

immunomodula

ting gene

delivery

EMCV

2. HSV-tk

Retrovirus

2. AoU373 Astrocytoma Human(Pizzato et

al, 1998)

Preclinical Studies (Host-directed therapy)

1. NIH3T3 Fibroblast Mouse2001 Myeloprotecti

on

EMCV 1. ALDH-1 Retrovirus

2. Primary CD34+ cells Human

(Takebe et

al, 2001)

1. K562 Leukemia1999 Myeloprotecti

on and cell-

surface

marking

EMCV 1. MDR1

2. "LNGFR

Retrovirus

2. Primary CD34+ cells

Human (Hildinger et

al, 1999)

Year

published

Strategy/Aim

of Study

IRES

employed

Therapeutic/market/re

porter genes encoded

Vector Tumor type References

1. IL-21999 Suicide and

immunomodul

ating gene

delivery

EMCV

2. HSV-tk

Retrovirus Glioblastoma mulriforme (Palu et al,

1999)

ALDH-1 (aldehyde dehydrogenase), CAT (chioramphenicol acetyltransferase), F/S DHFR (doubly mutated dihydrofolate reductase),

GAL (beta-galactosidase), GFP (green fluorescent protein), HSV-TK (herpes simplex virus thymidine kinase), IL2 (interleukin 2), IL 12

(interleukin 12), "LNGFR (truncated human low-affinity nerve growth factor receptor), yCD (yeast cytosine deaminase)

Table 2. Known properties of some IRESs

IRES Properties Cell lines References

BCL-2 Reported to exhibit 3.4-fold greater activityfollowing 8h treatment with 80µM etoposide

compared to untreated cells.

1. 293T Embryonic kidney Human (Sherrill et al, 2004)

Cat-1 Reported to exhibit 7-fold greater activity

following 12h amino acid starvation compared to

fed cells.

Activity compared to the EMCV TRES unknown

1. C6 Glioma Rat (Fernandez et al, 2001)

Connexin43 Reported to exhibit 18-fold greater activity than

the EMCV IRES.

1. HeLa Cervical cancer Human (Schiavi et al, 1999)

DAP5 Reported to exhibit at least 2-fold greater activity

than the EMCV IRES following 48h etoposide

treatment.

1. 293T Embryonic kidney Human (Nevins et al, 2003)

1. KB-3- 1 Cervical cancer HumaneIF4G Reported to exhibit at least 200-fold greater

activity than the EMCV IRES 2. HepG2 Liver cancer Human

(Wong et al, 2002)

Gtx 9-nucleotides in length. 10 linked copies reported

to exhibit 63-fold greater activity than the EMCV

IRES.

1. N2a Neuroblastoma Mouse (Chappell et al, 2000)

HIF- 1! Activity maintained during hypoxia. Activity

compared to the EMCV IRES unknown.

1. NIH3T3 Fibroblast Mouse (Lang et al, 2002)

1. NB2a Neuroblastoma MouseReported to exhibit 5-7 fold greater activity than

the c-myc IRES. 2. SH-SY5Y Neuroblastoma Human

N-myc

3-fold greater activity compared to the EMCV

IRES.

3. HeLa Cervical cancer Human

(Jopling and Willis, 2001)

VEGF Activity maintained during hypoxia. Activity

compared to the EMCV IRES during hypoxia

unknown.

1. C6 Glioma Rat (Stein et al, 1998)


436

administration, the design of therapeutic regimes to exploit

this property, for example to augment cytotoxicity, is

conceivable.

D. SizeMost IRESs tend to be relatively large, and this may

limit the number of transgenes that can be incorporated

into a polycistronic vector. A 9-nucleotide long IRES

residing in the 5’UTR of the Gtx homeodomain RNA has

been reported (Chappell et al, 2000), and appears to

function in a modular fashion, such that multiple linked

copies increase the expression of the downstream cistron.

Besides the advantages of its small size, it also allows for

regulated expression of the downstream cistron by varying

the number of intercistronic modules.

VII. Current problems with IRESs in

gene therapyA traditional problem concerning the use of IRESs is

that expression levels of the gene downstream of the IRES

is often significantly lower than that of the upstream gene,

typically around 20-50% (Mizuguchi et al, 2000) in

bicistronic plasmid vectors in relation to the upstream

gene, and even lower in retroviral vectors (de Felipe,

2002). Another major stumbling block is the inconsistency

of gene expression depending on the composition and

arrangement of genes in the vector (Hennecke et al, 2001).

VIII. Future directions

The vast majority of cancers result from defects in

multiple pathways, and hence an effective gene

therapeutic approach will probably have to be multi-

pronged, requiring delivery of different transgenes that

target the different pathways. The studies detailed in

Table 1 have demonstrated proof of concept for

employing IRESs to effect the co-expression of multiple

genes in diverse fields of cancer gene therapy. As noted

above more information concerning the activity of various

IRESs in a tissue/cell-type, both in vivo and in vitro, is

required to facilitate decision-making in the choice of

IRES. It is envisaged that the incorporation of IRESs with

desirable properties will result in polycistronic vectors

with improved downstream gene expression, and

consequently result in enhanced clinical efficacy.

ReferencesBarzon L, Bonaguro R, Castagliuolo I, Chilosi M, Gnatta E,

Parolin C, Boscaro M, Palu G (2002) Transcriptionally

targeted retroviral vector for combined suicide and

immunomodulating gene therapy of thyroid cancer. J Clin

Endocrinol Metab 87, 5304-5311.

Berzofsky JA, Terabe M, Oh S, Belyakov IM, Ahlers JD, Janik

JE, Morris JC (2004) Progress on new vaccine strategies for

the immunotherapy and prevention of cancer. J Clin Invest

113, 1515-1525.

Buller RE, Runnebaum IB, Karlan BY, Horowitz JA, Shahin M,

Buekers T, Petrauskas S, Kreienberg R, Slamon D, Pegram

M (2002) A phase I/II trial of rAd/p53 (SCH 58500) gene

replacement in recurrent ovarian cancer. Cancer Gene Ther

9, 553-566.

Chappell SA, Edelman GM, Mauro VP (2000) A 9-nt segment of

a cellular mRNA can function as an internal ribosome entry

site (IRES) and when present in linked multiple copies

greatly enhances IRES activity. Proc Natl Acad Sci U S A

97, 1536-1541.

de Felipe P (2002) Polycistronic viral vectors. Curr Gene Ther

2, 355-378.

Emerman M, Temin HM (1984) Genes with promoters in

retrovirus vectors can be independently suppressed by an

epigenetic mechanism. Cell 39, 449-467.

Fernandez J, Yaman I, Mishra R, Merrick WC, Snider MD,

Lamers WH, Hatzoglou M (2001) Internal ribosome entry

site-mediated translation of a mammalian mRNA is regulated

by amino acid availability. J Biol Chem 276, 12285-12291.

Fuerer C, Iggo R (2004) 5-Fluorocytosine increases the toxicity

of Wnt-targeting replicating adenoviruses that express

cytosine deaminase as a late gene. Gene Ther 11, 142-151.

Gottesman MM (2003) Cancer gene therapy: an awkward

adolescence. Cancer Gene Ther 10, 501-508.

Hellen CU, Sarnow P (2001) Internal ribosome entry sites in

eukaryotic mRNA molecules. Genes Dev 15, 1593-1612.

Hennecke M, Kwissa M, Metzger K, Oumard A, Kroger A,

Schirmbeck R, Reimann J, Hauser H (2001) Composition

and arrangement of genes define the strength of IRES-driven

translation in bicistronic mRNAs. Nucleic Acids Res 29,

3327-3334.

Hermiston TW, Kuhn I (2002) Armed therapeutic viruses:

strategies and challenges to arming oncolytic viruses with

therapeutic genes. Cancer Gene Ther 9, 1022-1035.

Hildinger M, Schilz A, Eckert HG, Bohn W, Fehse B, Zander A,

Ostertag W, Baum C (1999) Bicistronic retroviral vectors for

combining myeloprotection with cell-surface marking. Gene

Ther 6, 1222-1230.

Jopling CL, Willis AE (2001) N-myc translation is initiated via

an internal ribosome entry segment that displays enhanced

activity in neuronal cells. Oncogene 20, 2664-2670.

Jounaidi Y, Waxman DJ (2004) Use of replication-conditional

adenovirus as a helper system to enhance delivery of P450

prodrug-activation genes for cancer therapy. Cancer Res 64,

292-303.

Kleinman HK, Liau G (2001) Gene therapy for antiangiogenesis.

J Natl Cancer Inst 93, 965-967.

Kuball J, Wen SF, Leissner J, Atkins D, Meinhardt P, Quijano E,

Engler H, Hutchins B, Maneval DC, Grace MJ, Fritz MA,

Storkel S, Thuroff JW, Huber C, Schuler M (2002)

Successful adenovirus-mediated wild-type p53 gene transfer

in patients with bladder cancer by intravesical vector

instillation. J Clin Oncol 20, 957-965.

Lang KJ, Kappel A, Goodall GJ (2002) Hypoxia-inducible

factor-1! mRNA contains an internal ribosome entry site that

allows efficient translation during normoxia and hypoxia.

Mol Biol Cell 13, 1792-1801.

McNeish IA, Bell SJ, Lemoine NR (2004) Gene therapy progress

and prospects: cancer gene therapy using tumour suppressor

genes. Gene Ther 11, 497-503.

Mizuguchi H, Xu Z, Ishii-Watabe A, Uchida E, Hayakawa T

(2000) IRES-dependent second gene expression is

significantly lower than cap-dependent first gene expression

in a bicistronic vector. Mol Ther 1, 376-382.

Nevins TA, Harder ZM, Korneluk RG, Holcik M (2003) Distinct

regulation of internal ribosome entry site-mediated

translation following cellular stress is mediated by apoptotic

fragments of eIF4G translation initiation factor family

members eIF4GI and p97/DAP5/NAT1. J Biol Chem 278,

3572-3579.

Ngoi SM, Chien AC, Lee CG (2004) Exploiting internal

ribosome entry sites in gene therapy vector design. Curr

Gene Ther 4, 15-31.


437

Okada H, Giezeman-Smits KM, Tahara H, Attanucci J, Fellows

WK, Lotze MT, Chambers WH, Bozik ME (1999) Effective

cytokine gene therapy against an intracranial glioma using a

retrovirally transduced IL-4 plus HSVtk tumor vaccine.

Gene Ther 6, 219-226.

Pagliaro LC, Keyhani A, Williams D, Woods D, Liu B, Perrotte

P, Slaton JW, Merritt JA, Grossman HB, Dinney CP (2003)

Repeated intravesical instillations of an adenoviral vector in

patients with locally advanced bladder cancer: a phase I

study of p53 gene therapy. J Clin Oncol 21, 2247-2253.

Palu G, Cavaggioni A, Calvi P, Franchin E, Pizzato M,

Boschetto R, Parolin C, Chilosi M, Ferrini S, Zanusso A,

Colombo F (1999) Gene therapy of glioblastoma multiforme

via combined expression of suicide and cytokine genes: a

pilot study in humans. Gene Ther 6, 330-337.

Pelletier J, Sonenberg N (1988) Internal initiation of translation

of eukaryotic mRNA directed by a sequence derived from

poliovirus RNA. Nature 334, 320-325.

Pizzato M, Franchin E, Calvi P, Boschetto R, Colombo M,

Ferrini S, Palu G (1998) Production and characterization of a

bicistronic Moloney-based retroviral vector expressing

human interleukin 2 and herpes simplex virus thymidine

kinase for gene therapy of cancer. Gene Ther 5, 1003-1007.

Ponnazhagan S, Mahendra G, Kumar S, Shaw DR, Stockard CR,

Grizzle WE, Meleth S (2004) Adeno-associated virus 2-

mediated antiangiogenic cancer gene therapy: long-term

efficacy of a vector encoding angiostatin and endostatin over

vectors encoding a single factor. Cancer Res 64, 1781-1787.

Rivera AA, Wang M, Suzuki K, Uil TG, Krasnykh V, Curiel DT,

Nettelbeck DM (2004) Mode of transgene expression after

fusion to early or late viral genes of a conditionally

replicating adenovirus via an optimized internal ribosome

entry site in vitro and in vivo. Virology 320, 121-134.

Schiavi A, Hudder A, Werner R (1999) Connexin43 mRNA

contains a functional internal ribosome entry site. FEBS Lett

464, 118-122.

Schuler M, Herrmann R, De Greve JL, Stewart AK, Gatzemeier

U, Stewart DJ, Laufman L, Gralla R, Kuball J, Buhl R,

Heussel CP, Kommoss F, Perruchoud AP, Shepherd FA,

Fritz MA, Horowitz JA, Huber C, Rochlitz C (2001)

Adenovirus-mediated wild-type p53 gene transfer in patients

receiving chemotherapy for advanced non-small-cell lung

cancer: results of a multicenter phase II study. J Clin Oncol

19, 1750-1758.

Sherrill KW, Byrd MP, Van Eden ME, Lloyd RE (2004) BCL-2

translation is mediated via internal ribosome entry during cell

stress. J Biol Chem. 279, 29066-29074.

Soler MN, Milhaud G, Lekmine F, Treilhou-Lahille F,

Klatzmann D, Lausson S (1999) Treatment of medullary

thyroid carcinoma by combined expression of suicide and

interleukin-2 genes. Cancer Immunol Immunother 48, 91-

99.

Sorrentino BP (2002) Gene therapy to protect haematopoietic

cells from cytotoxic cancer drugs. Nat Rev Cancer 2 , 431-

441.

Stein I, Itin A, Einat P, Skaliter R, Grossman Z, Keshet E (1998)

Translation of vascular endothelial growth factor mRNA by

internal ribosome entry: implications for translation under

hypoxia. Mol Cell Biol 18, 3112-3119.

Stoneley M, Willis AE (2004) Cellular internal ribosome entry

segments: structures, trans-acting factors and regulation of

gene expression. Oncogene 23, 3200-3207.

Takebe N, Zhao SC, Adhikari D, Mineishi S, Sadelain M, Hilton

J, Colvin M, Banerjee D, Bertino JR (2001) Generation of

dual resistance to 4-hydroperoxycyclophosphamide and

methotrexate by retroviral transfer of the human aldehyde

dehydrogenase class 1 gene and a mutated dihydrofolate

reductase gene. Mol Ther 3, 88-96.

Voelkel-Johnson C, King DL, Norris JS (2002) Resistance of

prostate cancer cells to soluble TNF-related apoptosis-

inducing ligand (TRAIL/Apo2L) can be overcome by

doxorubicin or adenoviral delivery of full-length TRAIL.


Waxman DJ, Schwartz PS (2003) Harnessing apoptosis for

improved anticancer gene therapy. Cancer Res 63, 8563-

8572.

Wen XY, Mandelbaum S, Li ZH, Hitt M, Graham FL, Hawley

TS, Hawley RG, Stewart AK (2001) Tricistronic viral

vectors co-expressing interleukin-12 (1L-12) and CD80 (B7-

1) for the immunotherapy of cancer: preclinical studies in

myeloma. Cancer Gene Ther 8, 361-370.

Wong ET, Ngoi SM, Lee CG (2002) Improved co-expression of

multiple genes in vectors containing internal ribosome entry

sites (IRESes) from human genes. Gene Ther 9, 337-344.

Zeimet AG, Marth C (2003) Why did p53 gene therapy fail in

ovarian cancer? Lancet Oncol 4, 415-422

Benedict J Yan Caroline GL Lee


438


439


The pathway of uptake of SV40 pseudovirions

packaged in vitro: from MHC class I receptors to the

nucleusResearch Article

Chava Kimchi-Sarfaty1, Susan Garfield2, Nathan S. Alexander1, Saadia Ali1,

Carlos Cruz1, Dhanalakshmi Chinnasamy3, and Michael M. Gottesman1*1Laboratory of Cell Biology, 2Laboratory of Experimental Carcinogenesis, National Cancer Institute, National Institutes of

Health, Bethesda, Maryland 20892, USA3Vince Lombardi Gene Therapy Laboratory, Immunotherapy Program, St. Luke’s Medical Center, Milwaukee, WI 53215,

USA

__________________________________________________________________________________

*Correspondence: Michael M. Gottesman, M.D., Laboratory of Cell Biology, National Cancer Institute, NIH, 37 Convent Drive, Room

2108, Bethesda, MD 20892-4256, USA, Tel: (301) 496-1530; Fax: (301) 402-0450, Email: [email protected]

Key words: Gene delivery; SV40 in vitro packaging; pathway of SV40 pseudovirions; MHC I receptors

Abbreviations: 5-Aza-2’-deoxycytidine, (DAC); bovine albumin, (BSA); Brefeldin A, (BFA); central polypurine tract sequence,

(cPPT); central polypurine tract, (cPPT); cholera toxin, (CT); Dulbecco’s modified Eagle medium, (DMEM); elongation factor 1(EF1);

endoplasmic reticulum, (ER); enhanced green fluorescent protein, (EGFP); fetal bovine serum, (FBS); green fluorescent protein, (GFP);

multidrug resistance gene, (MDR1); nuclear extracts, (NE); nuclear localization sequences, (NLS); paraformaldehyde, (PFA);

phosphate-buffered saline, (PBS); pigment epithelium derived factor, (PEDF); polyethyleneimine, (PEI); polyethyleneglycol, (PEG);

Propidium iodide, (PI); Trichostatin A, (TSA); trichostatin A, (TSA)

Received: 14 October 2004; Revised: 27 October 2004

Accepted: 16 November 2004; electronically published: November 2004

Summary

SV40 vectors packaged in vitro are an efficient delivery system in vitro and in vivo using plasmids up to 17.7 kb, with

or without SV40 sequences. Using confocal microscopy, we followed the pathway of SV40 pseudovirions in human

lymphoblastoid cells, which are rich in MHC I receptors, using fluorescence-tagged DNA and an antibody against

the main capsid protein, VP1. The wild-type SV40 virus as well as the pseudovirions enter the cells after binding to

MHC I. However, the MHC I route is not the only way that SV40 pseudovirions enter cells. From the cell surface,

the vectors progress through the Golgi to the ER, where they are unpackaged. Only the reporter DNA proceeds to

the nucleus; VP1 remains at the ER. Results indicate that some of the reporter DNA, carried by these vectors, is

trapped in the ER. Delivery of DNA plasmids which harbor nuclear localization sequences, such as the enhancer of

wild-type SV40 or the cPPT sequence from the HIV-1 virus upstream from the GFP cDNA, did not improve GFP

expression. However, improved expression from the EGFP reporter gene carried by SV40 vectors was achieved

using the histone deacetylase inhibitor, TSA.

I. IntroductionPackaging of SV40 pseudovirions in vitro results in a

non-viral delivery system which satisfies the criteria for a

successful gene transfer system: high efficiency, short-

term expression with no integration, non-immunogenic,

and relatively safe (Kimchi-Sarfaty et al, 2004b). The

SV40 wild-type virus capsid is composed of three viral

proteins: VP1, VP2, and VP3 (Tooze, 1981). The SV40 in

vitro packaging system uses nuclear extracts from Sf9

cells, transduced with VP1 baculovirus, to form SV40

capsids around any reporter gene up to 17.7 kb in length.

The efficiency of the system is very high, as almost every

cell is transduced. The expression is transient, and

relatively low compared to retroviral transduction

(Kimchi-Sarfaty et al, 2003). SV40 pseudovirions can

deliver DNA plasmids to a variety of cell lines (non-

dividing as well as cycling cells), and appear to be non-

immunogenic. SV40 pseudovirion vectors very efficiently

deliver reporter genes such as green fluorescent protein

(GFP), ABC transporter genes such as the multidrug

resistance gene (MDR1), a suicide gene (the Pseudomonas

exotoxin) and antiangiogenic genes (the pigment

Kimchi-Sarfaty et al: In vitro-packaged SV40 vector pathway

440

epithelium derived factor, PEDF) (Kimchi-Sarfaty et al,

2004b). Although the pseudovirions are an excellent

vehicle for gene transfer, it is important to understand how

DNA packaged in SV40 capsids is delivered to the nucleus

in order to improve expression levels.

The entry of wild-type SV40 is thought to begin with

the virus binding to major histocompatibility complex

class I molecules that cover the cell surface (Norkin,

2001). The virus then enters via caveolin-1-containing

vesicles, and is transported to the endoplasmic reticulum

(ER). This pathway is similar to that taken by cholera

toxin (CT), which enters the Golgi via caveolae and is then

transported to the ER (Norkin, 1999, 2001, 2002; Parton

and Lindsay, 1999). However, it is possible that this

pathway bypasses the Golgi (Pelkmans et al, 2001;

Pelkmans and Helenius, 2002). Tsai and colleagues

(2003) showed that wild-type SV40 enters the cell using

specific ganglioses as receptors. Most other viruses enter

through the clathrin-coated, pit-mediated endosomal

pathway. Viruses which enter cells by endocytosis

generally disassemble in endosomes, where the pH is low.

However, since the SV40 wild-type entry pathway does

not lead to endosomes (Colomar et al, 1993; Khalili and

Stoner, 2001), SV40 disassembly is not dependent on low

pH in the endosomal compartment. For a number of years

it was believed that SV40 virions enter the nucleus and

disassemble there, but more recently it has been shown

that disassembly occurs in the ER. However, most of the

SV40 wild-type DNA does not enter the nucleus (Parton

and Lindsay, 1999; Norkin, 1999, 2001; Khalili and

Stoner, 2001; Norkin et al, 2002; Pelkmans et al, 2001,

2002).

Some viral delivery systems overcome low efficiency

and expression using viral sequences which can target the

nucleus, such as nuclear localization sequences of wild-

type SV40 or the cPPT sequence from the HIV-1 virus. In

a non-viral delivery system, the addition of

polyethyleneimine (PEI) or polyethyleneglycol (PEG)

increased delivery, mostly through the cell membrane, but

also to the nucleus (Ross and Hui, 1999).

In this study, we examined the pathway of entry of

SV40 pseudovirions packaged in vitro in human

lymphoblastoid cells. We tested different stages of the

pathway to find the limiting step responsible for the

relatively low expression found with SV40 pseudovirions

for gene delivery. Our findings indicate that disassembly

of the pseudovirions is not the rate-limiting step for gene

expression. We suggest that two steps in the

pseudovirion’s pathway are rate-limiting: DNA is trapped

in the ER so that it does not reach the nucleus, and

inefficient transcription from the DNA histone complex.

II. Materials and methodsA. Cell lines and cell culture.45 cells, human lymphoblastoid cells with high levels of

MHC I, .221 cells, human lymphoblastoid cells with low MHC I

receptors, and K562 human erythroleukemia cells were

maintained in RPMI media (Invitrogen, Carlsbad, CA). HeLa

cells and the HeLa subclone, KB-3-1 (Akiyama et al, 1985),

were maintained in Dulbecco’s modified Eagle medium

(DMEM) (Invitrogen, Carlsbad, CA). Bone marrow stem cells

from Cambrex (East Rutherford, NJ) were plated in HMSGM

medium with 10% FBS from Cambrex, but were grown in

DMEM, and were a gift of Louis Scavo, NIDDK, NIH.

Mesenchymal stem cells from teeth were grown in !MEM

(Invitrogen) with 20% fetal bovine serum (FBS) and were a gift

of Pamela Robey, NIDCR, NIH. All other media were

supplemented with 10% FBS (Hyclone, Logan, UT), 5 mM L-

glutamine, 50 µg/ml penicillin, and 50 µg/ml streptomycin

(Quality Biological, Gaithersburg, MD). All cell lines were

cultured at 37°C, in 5% CO2.

B. Infection of Sf9 cells with baculovirus,

preparation of nuclear extracts (NE) from Sf9

cells, and preparation of in vitro packaging

vectorsInfecting Sf9 cells, preparing NE and preparing in vitro

packaging vectors were as previously described (Kimchi-Sarfaty

et al, 2002, 2003) .The nuclear extract contained VP1, one of the

four viral late proteins (VP1, VP2, VP3, and agno). Packaged

DNA in this study included the pEGFP-C1 construct (4.7Kb;

Clontech, Palo Alto, CA), the pLUC construct (6.7Kb, Gene

Therapy Systems, Inc., San Diego, CA), and pGeneGrip

Fluorescein/ Luciferase (Gene Grip) (6.7Kb; Gene Therapy

Systems, Inc., San Diego, CA). In vitro vector titers were

calculated to be 5 " 104-5 " 105 particles per 1 ml, using CMT4

cells as previously described (Sandalon et al, 1997). In all the

experiments empty capsids, DNA only, and non-transduced cells

were used as controls.

C. Construction of plasmid DNAs carrying

the SV40 enhancer element or the central

polypurine tract (cPPT) sequence of HIV-1 as a

nuclear localization signalTo compare the effectiveness of the SV40 enhancer

sequence in translocating the plasmid, we used the pVitro2-

GFP/LacZ (InvivoGen, San Diego, CA) plasmid encoding the

enhanced green fluorescent protein (EGFP) cDNA under

transcriptional control of a human ferritin heavy chain (hFerH)

promoter in which the 5’UTR had been replaced by the 5’ UTR

of mouse elongation factor 1(EF1). This plasmid also contained a

72 bp repeat from the SV40 enhancer upstream from the hFerH

promoter to enhance gene expression and nuclear localization of

plasmid DNA. For comparison, we constructed a plasmid with a

similar backbone but devoid of the SV40 enhancer (pVitrop2-

GFP#NLS). To construct pVitrop2-GFP#NLS, we deleted the

SV40 enhancer sequence by digesting the pVitro2-GFP/LacZ

vector plasmid with NotI/PacI restriction enzymes. The E.coli

origin of replication (pMB1 ori) released from the pVitro2-

GFP/LacZ plasmid during NotI/PacI digestion (as ~720 bp

PacI/PacI fragment) was reinserted into the vector by blunt end

ligation. To generate the plasmid containing cPPT, a 118-bp

fragment of the central polypurine tract was amplified from

plasmid pCMV#R 8.91 (Naldini et al, 1996) utilizing the primers

cPPT 5’(5’-GCGGGGATCCTTTTAAAAGAAAAGGGGGG-

3’) and cPPT 3’ (5’-GCGGAGATCTAAA

ATTTTGAATTTTTGTAATTTG-3’), digested with BamHI and

BglII, and inserted at the BamHI site upstream of the internal

CMV promoter used to drive the transcription of GFP cDNA in

the lentiviral vector plasmid pCS-CG (Miyoshi et al, 1998).

D. Transduction of .45, .221, and K562 cells

with in vitro-packaged vectors and transfection of

HeLa and KB-3-1 cells with Lipofectamine-PlusAt concentrations indicated in each figure, cells were

transduced in suspension with the in vitro-packaged SV40


441

vectors in 10 tubes (104 cells each) or in a 60 mm culture dish

(105 cells in each). The dishes were then placed on an orbital

shaker at a constant speed for 2.5 h (at 37°C, 5% CO2), after

which the infection was stopped by the addition of RPMI

medium supplemented as before (Invitrogen, Carlsbad, CA)

(Kimchi-Sarfaty et al, 2004a). Every in vitro packaging

transduction experiment was done 3-6 times, and all the results

were comparable. Control transfections of HeLa and KB-3-1

cells (Akiyama et al, 1985) with the plasmid DNAs using

lipofectamine-plus were done according to the protocol provided

by ‘Lipofectamine-Plus’ (Invitrogen, Carlsbad, CA) without

modification. Every transfection experiment was done 4-6 times,

each with a similar resulting pattern.

E. GFP and multidrug resistance (MDR1)

expression detectionThe GFP reporter gene that was used in this study was

EGFP-C1 from Clontech (Palo Alto, CA). Two to forty days

post-infection, 2 x 105 cells were washed and suspended in 200

µl phosphate-buffered saline (PBS) (Invitrogen, Carlsbad, CA),

0.1% bovine albumin (BSA) (Sigma-Aldrich, St. Louis, MO) at

4°C and analyzed by FACS (FL1) for GFP as previously

described (Cormack et al, 1996) or studied by confocal

microscopy (detailed in Collection of confocal images below).

pHaMDR1 plasmid DNA, 15.2 kb in size, carried the multidrug

resistance gene (MDR1). Detection of the MDR protein was done

using a specific cell surface monoclonal antibody, MRK16, as

described previously (Kimchi-Sarfaty et al, 2003).

F. Brefeldin A (BFA), 5-Aza-2’-deoxycytidine

(DAC), and Trichostatin A (TSA) treatments of

.45 human lymphoblastoid and HeLa cellsBFA, which inhibits transport into the ER from the Golgi,

was used at 0.5-2.5 µg/ml 24 hours and 2 hours prior to

transduction, at the same time as transduction, and 2 1/2 hours

after transduction, to determine whether the pathway of entry of

pseudovirions is exclusively through the ER. TSA was added to

cells at a concentration of 0.1, 1, 10, 100 and 1000 ng/ml prior to

transduction. 5-Aza-2’-deoxycytidine (DAC) (Sigma, St. Louis,

MO) was added to cells at a concentration of 1-10 µM 24-72

hours prior to transduction.

G. Preparation of cells for confocal imagingPrior to immunostaining and between each

immunostaining step, transduced cells were washed twice with

PBS (Invitrogen, Carlsbad, CA) supplemented with 0.1% BSA

(Sigma-Aldrich, St. Louis, MO). Transduced cells were first

fixed for 0.5 h with 4% paraformaldehyde (PFA) (Sigma-

Aldrich, St. Louis, MO) or with additional fixation for 0.5 h with

70% ethanol at room temperature. Ethanol fixation could not be

performed when it was necessary to observe GFP in cells. The

presence of MHC I was detected using FITC – Anti-Human HLA

– A,B,C (1:100, Becton, Dickinson, and Co., Franklin Lakes,

NJ). The Golgi was detected using monoclonal antibody, #G2404

(Sigma, St. Louis, MO). For ER staining, fixed cells at 37°C

were treated with 10% normal donkey serum (Sigma-Aldrich, St.

Louis, MO). Cells were then washed once with PBS / 0.1% BSA

and stained with a primary antibody (calregulin, goat, 1:100,

Santa Cruz Biotechnology, Inc., Santa Cruz, CA) against the

lumen endoplasmic reticulum (also called calreticulin). Primary

immunostaining was done with a polyclonal VP1 antiserum

(rabbit, 1:40) to detect the presence of the VP1 protein.

Following each primary immunostain, cells were washed and

incubated with an appropriate secondary immunostain. For VP1,

Alexa 568 (red) conjugated goat anti-rabbit IgG (Molecular

Probes, Inc., Eugene, OR) and for the ER or the Golgi antibodies,

Alexa 488 (green)-conjugated donkey anti-goat IgG (Molecular

Probes, Inc., Eugene) were used as secondary antibodies. All

secondary antibodies were used at a dilution of 1:250. In all

experiments, cells were stained using a secondary antibody alone

to determine non-specific staining. All serum, antiserum, and

antibody incubations were performed for 1 h at room

temperature. After the last antibody incubation, the cells were

washed with PBS/ 0.1% BSA as before, dropped onto lysine-

coated microscope slides (Erie Scientific Co., Portsmouth, NH),

and allowed to dry. Fluorescent mounting medium (DAKO

Corp., Carpinteria, CA) was then used to affix a glass coverslip

to the microscope slide, and the slides were stored in the absence

of light at 4°C.

H. Propidium iodide (PI) nuclear staining of

.45 and KB-3-1 cells for confocal imagingKB-3-1 cells were seeded on glass coverslips in wells of a

6-well plate, while .45 cells were grown in suspension in a T-25

flask. .45 cells were transduced with in vitro-packaged

pGeneGrip Fluorescein/Luciferase (pGeneGrip)

(GeneTherapySystems, San Diego, CA) DNA and KB-3-1 cells

(Akiyama, 1985) were lipo–transfected with the same construct

using the transduction protocols described above. Cells were

washed three times with PBS/ 0.1% BSA and then fixed with

70% ethanol for 15 minutes at -20°C. Cells were washed again

three times in PBS/ 0.1% BSA and then stained for 1 hour at

room temperature with 100 µl PI staining solution, which was

composed of 5 µl PI stock (100 µg/mL), 2 µl of RNAse

(10mg/ml), and 5 ml of PBS without Ca or Mg. Cells were then

washed three times with PBS/ 0.1% BSA. Coverslips with

KB-3-1 cells were dried, inverted, and mounted on lysine-coated

microscope slides. .45 cells were applied to slides as described

above.

I. Collection of confocal imagesConfocal fluorescent images were collected with a Bio-Rad

MRC 1024 confocal scan head mounted on a Nikon Optihot

microscope with a 60X planapochromat lens. Excitation at 488

nm and 568 nm was provided by a krypton-argon laser. Emission

filters of 598/40 and 522/32 were used for sequentially collecting

red and green fluorescence, respectively, in channel one and two

while phase contrast images of the same cell(s) were collected in

the third channel using a transmitted light detector. Z-sections

were taken at ~0.7 µm intervals at each wavelength, where

applicable, and after sequential excitation, red and green

fluorescent images of the same cell were merged for co-

localization using LaserSharp software (Bio-Rad, Hercules, CA),

and animation sequences were produced.

III. ResultsA. Entry of VP1 does not always correlate

with levels of MHC I receptorsIt has previously been shown that SV40 wild-type

binds MHC I receptors (Norkin, 1999). We investigated

whether the level of MHC I expression is a limiting factor

in gene expression in different cell lines, using the SV40-

based pseudovirion delivery system after in vitro

packaging. The results shown here, and our extensive

experience with other cell lines (data not shown), do not

demonstrate a direct correlation between MHC I levels

and GFP expression.

Four different cell lines expressing different levels of

MHC I (Figure 1, a,b,c,d left column) as detected by

FACS were tested for transduction using GFP DNA


442

encapsidated in VP1 (right column). We used one full

reaction of 660 µl (as defined by Kimchi-Sarfaty et al,

2004a), which saturates the cellular receptors (multiplicity

of infection of 0.5-5). This is the maximum volume of

pseudovirions enough to transduce cells without reducing

their viability. As can readily be seen, there was no

correlation between the levels of MHC I and GFP

expression (compare Figure 1, left and right columns).

Some cells with high MHC I levels (Figure 1d, left

column) had little or no GFP expression (Figure 1d, right

column), while other cells with low MHC I levels (Figure

1c, left column) showed strong GFP expression (Figure 1

c, right column).

To determine if the site of VP1 entry into cells is

coincident with the location of MHC I receptors, we

stained simultaneously for VP1 and MHC I in the human

lymphoblastoid cell line .45, which has high MHC I levels

(Figure 2). MHC I receptors appeared fairly uniformly

around the plasma membrane (panel b), but VP1 (panel a)

appeared in scattered locations around the membrane.

Some colocalization of VP1 and MHC I is seen (panel c),

but it is clear that the presence of MHC I (green

fluorescence) does not predict binding of VP1. A similar

phenomenon was observed in .221 stained cells although

less MHC I staining was observed, it was also not

colocalized with VP1 staining (data not shown).

All the experiments in this section were repeated 4

times, and each resulted in a similar pattern of staining.

Figure 1. Expression of major histocompatability complex I (MHC I) receptors and of Green Fluorescent Protein (GFP) using FACS

analysis in different cell lines. Cell lines were: H190 stem cells (a), .45 human lymphoblastoid cells (b), .221 human lymphoblastoid

cells (c), and Human Mesenchymal Stem Cells (d). Cells were tested for their MHC I receptor levels (grey) and background

fluorescence was detected using control antibody IGg2a (black) (left column). Expression studies of the EGFP-C1 reporter gene were

done using FACS two to four days after transduction (grey) (right column). All control cells, cells transduced with DNA only, mock-

transduction without reporter DNA, and untreated cells were tested for GFP expression in the same way as the experimental cells in all

the experiments described in this paper (black).


443

Figure 2. Expression of major histocompatability complex I (MHC I) receptors using confocal microscopy. Immediately after

transduction, cells for confocal analysis were fixed as described in the Materials and Methods section, and the following parallel

treatments were applied to cells: (1) VP1 polyclonal antibody staining with a secondary Texas Red antibody staining; (2) MHC I

antibody staining conjugated to a secondary FITC antibody; (3) VP1 polyclonal antibody staining with its secondary Texas Red

antibody, together with MHC I antibody staining conjugated to a secondary FITC antibody. No background was seen in secondary

antibody staining only. (a) .45 cell immunostained for SV40 VP1 using rabbit anti-SV40 polyclonal antiserum, followed by a Alexa-568-

conjugated (red) goat anti-rabbit IgG secondary antiserum. (b) .45 cells immunostained for MHC-I receptors using FITC-conjugated to

anti-human MHC-I (HLA-A, -B, -C). (c) Merge of panels a and b.

Figure 3. VP1 entry relative to Golgi apparatus in .45 cells. The following parallel treatments were applied to cells: (1) Same as in Fig.

2; (2) Monoclonal mouse anti-Golgi 58K protein antiserum staining, followed by a Alexa–488-conjugated (green) goat anti-mouse IgG

secondary antiserum staining; (3) VP1 polyclonal antibody staining with its secondary Texas Red antibody, together with monoclonal

mouse anti-Golgi 58K protein antiserum staining, with a Alexa–488-conjugated (green) goat anti-mouse IgG secondary antibody. No

background was seen in secondary antibody staining only. .45 cells were fixed and immunostained for SV40 VP1 capsid protein using

rabbit anti-SV40 polyclonal antiserum, followed by a Alexa-568-conjugated (red) goat anti-rabbit IgG secondary antiserum (a); then

cells were immunostained with monoclonal mouse anti-Golgi 58K protein antiserum, followed by a Alexa-488-conjugated (green) goat

anti-mouse IgG secondary antiserum (b). Panel c is a merge of panels a and b. Left top white arrow indicates Golgi staining only, Left

bottom white arrow indicates costaining of VP1 and Golgi and right white arrow indicate VP1 staining only. Scale bar, 5 µm.

B. Some of the VP1 capsid protein is

localized to the Golgi thirty minutes after

transduction.45 human lymphoblastoid cells (105 cells) were

transduced with in vitro-packaged GFP, and were

harvested immediately after transduction, and 10, 30, and

120 minutes later, as described in Materials and Methods.

Figure 3 demonstrates partial colocalization of VP1 and

the Golgi apparatus 30 minutes after transduction; some of

the VP1 (red) sites are costained with the Golgi (green)

and appear dark yellow (lower left arrow), while other

VP1 are not in the Golgi and appear red (right arrow).

Some of the Golgi staining is not covered by VP1 (upper

left arrow). The same pattern is seen at the other harvest

time-points full colocalization was not found. In 60% of

the cells there was no costaining of VP1 and the Golgi,

and in 40% there was some colocalization. All these

experiments were repeated five times with comparable

results.

C. Initial colocalization of VP1 with

calregulin, an ER marker, 30 minutes after

transductionThirty minutes after transduction, VP1 staining

appears throughout the cell, but not in the nucleus. To

verify the location of VP1 staining, .45 human

lymphoblastoid cells (105 cells) were transduced with in

vitro-packaged GFP, and were harvested immediately after

transduction, and at 10, 30, 120, and 240 minutes, 1, 2, 4,

and 7 days later, as described in Materials and Methods.

Figure 4 is a panel of Z sections of a cell seen via

confocal microscopy, as described in Materials and

Methods. We demonstrated that in 60% of the cells, 30

minutes after transduction, all VP1 (red) is colocalized to


444

Figure 4. Z stacks of sections of .45 cells stained for VP1 and ER. .45 cells were harvested and fixed at 30 minutes post-transduction

before immunostaining. The confocal microscope Z sections were collected at 0.3 µm intervals using sequential excitation for each

fluorophore. The following parallel treatments were applied to cells: (1) Same as in Fig. 2; (2) Monoclonal mouse ER lumen protein,

calregulin staining, against calreticulin, an ER membrane protein, followed by a Alexa–488-conjugated (green) donkey anti-goat IgG

secondary antiserum staining; (3) VP1 polyclonal antibody staining with its secondary Texas Red antibody, together with a monoclonal

ER lumen protein, calregulin, with a Alexa–488-conjugated (green) donkey anti-goat IgG secondary antiserum staining. No background

was seen with secondary antibody staining only.

the ER (green), where it appears as yellow. The same

phenomena is observed in the other 40% of the cells, but

later in the time course at the 120-minute time point, we

could observe green and yellow staining only. The same

pattern of full co-localization is seen at the other harvest

time-points beginning at 120 minutes. All these

experiments were repeated 6 times, and the results were all

similar.

D. EGFP expression is reduced in BFA-

treated cells transduced with SV40 in vitro-

packaged DNASince all VP1 was co-localized with calregulin to the

ER lumen, we wanted to determine whether VP1 transit

through the ER is essential for gene expression. This was

determined by blocking retrograde entry into the ER using

BFA, and monitoring the expression of EGFP delivered by

SV40 vectors. .45 cells were treated with different

concentrations of BFA (0.5-2.5 µg/ml) according to

Norkin and colleagues, (2002), 24, and 2 hours before

transduction, at the time of transduction, or at the end of

the transduction process, when fresh medium is added to

the cells. The effect of BFA treatment on GFP expression

was monitored in transduced cells at various time points

between 0-6 days post-transduction and compared with

that of BFA-untreated GFP-transduced cells. We found a

reduction in GFP expression in cells treated with 2.5

µg/ml BFA, but not a complete inhibition of GFP

expression. Even very high concentrations of BFA (25

µg/ml) did not completely inhibit GFP expression. A

concentration of 2.5 µg/ml led to a 50% reduction in GFP

expression on day one. However, 48 hours after

transduction, the reduction in GFP expression was less

than 20% compared to untreated cells. From day three

onward, decreasing the concentration of BFA (from 2.5


445

µg/ml to 0.6 µg/ml) actually increased the GFP expression

by 100% as compared to untreated cells (data not shown).

BFA experiments were repeated 6 times, and the results

were comparable in all experiments.

E. Dissociation of VP1 from fluorescent-

labeled DNA occurs in the ER 20 hours after

transduction.45 human lymphoblastoid cells (105 cells) were

transduced with SV40 vectors carrying fluorescent

pGeneGrip DNA and were harvested immediately after

transduction and at 2.5, 5.5, 10, 20, 30, 120, and 240

minutes, 1, 2, 4, and 7 days later, as described in Materials

and Methods. Several investigators (Oppenheim et al,

1986; Oppenheim and Peleg, 1989; Dalyot-Herman et al,

1999; Strayer, 1999, 2000; Strayer and Zern, 1999;

Kimchi-Sarfaty et al, 2002, 2003) have determined that all

types of SV40 delivery systems are able to deliver DNA

which is expressed in virtually all cells of many different

cell types that have been tested. In the present study, using

confocal microscopy to detect fluorescent-tagged DNA,

every .45 cell contains a label 3.5 hours after transduction.

These results clearly indicate that entry into cells is a very

efficient process using VP1 only for encapsidation in the

SV40-based delivery system.

Cells shown in Figure 5a are 5.5 hours post

transduction. The yellow staining clearly shows that VP1

(red) and the green Grip signal are co-localized, which

suggests that disassembly has not yet occurred at this time

point. However, 20 hours post-transduction (Figure 5b),

some of the red and the green staining is no longer co-

localized, which indicates that disassembly has occurred

and the DNA is no longer trapped within the VP1. 50

randomly chosen cells were examined thoroughly for each

time point.

F. Twenty hours post-transduction and

thereafter, Grip-DNA can be visualized in the

nucleusDoes disassociation of the DNA from VP1, starting

at 20 hours post-transduction, enable it to enter the

nucleus? .45 cells were harvested 2.5, 4, 5, 20, 24, 26, 28

hours after transduction. Grip-DNA and confocal sections

of cells were used to distinguish whether the green signal

was in the nucleus or just close to it. Figure 6a-c

demonstrates 3 stages of entry of the Grip-DNA into the

nucleus, taken from the animated movies, 4.5, 22.5, and 53

hours post-transduction. By 53 hours (Figure 6c), the

DNA (green) appears to be in the nucleus, stained with

propidium iodide (red).

We compared DNA entry into the nucleus using in

vitro-packaged SV40 pseudovirions and using a non-viral

delivery system Lipofectamine-Plus from Invitrogen.

Since lipofection of cells in suspension is not an efficient

process, we transfected KB-3-1 (HeLa) adherent cells. At

the same time points (4.5, 22.5, and 53 hours post-

transduction) we examined GeneGrip DNA entry to the

nucleus using lipofection as demonstrated in Figure 6d-f .

It is important to note that the only valid comparison

between the methods is the proportion of DNA in the

cytoplasm vs. in the nucleus, since the amount of DNA

used in the SV40 delivery system is approximately 103

lower compared to the Lipofectamine-Plus method. DNA

is delivered to the nucleus earlier using the Lipofectamine-

Plus delivery system. Based on our observation of 200

cells, 53 hours after transduction 59% of the DNA was

still located in the ER.

G. Neither nuclear localization sequences

(NLS) from SV40 wild-type, nor cPPT

sequences from the HIV-1 virus facilitated

DNA entry into the nucleus using the SV40

delivery systemPreviously it has been shown that an SV40 enhancer

comprised of a 72-base pair repeat could direct nuclear

localization of plasmids and allows the enhancement of

gene expression in a broad range of hosts (Dean, 1997,

1999; Vacik et al, 1999; Li et al, 2001). Similarly, the 188

bp central polypurine tract sequence (cPPT), a part of the

polymerase gene of HIV-1 virus, has been shown to

facilitate nuclear entry of HIV-1 preintegration complexes

in the context of wild-type HIV-1 virus as well as HIV-1-

based replication defective lentiviral vectors (Sirven et al,

2000; Zennou et al, 2000). To examine whether the

inclusion of these sequences could improve the nuclear

transfer of plasmid DNAs encapsidated in SV40

pseudovirions, we constructed plasmid DNAs encoding

Figure 5. VP1 and SV40 IVP-DNA

colocalization and disassembly in .45

cells. .45 cells transduced with IVP-

pGeneGrip (green), fixed and

immunostained for VP1 (red) at 5.5

hours post transduction (a) and at 20

hours post transduction (b).


446

Figure 6. pGeneGrip-DNA entry to the nucleus followed by PI staining. .45 cells transduced with SV40 IVP-pGeneGrip (panels a-c),

and KB-3-1 cells transduced with the same DNA using lipofectamine-plus (panels d-f) were fixed and immunostained at 5.5, 22.5, and

53 hours post-transduction. The nucleus is labeled with propidium iodide (PI).

the GFP reporter gene with an SV40 enhancer or HIV-1

cPPT sequences placed upstream of the promoter used to

drive transcription of GFP cDNA. We also constructed

identical plasmids without these sequences and used these

as controls for comparison.

A time course (1, 2, 3, 4, 5, and 6 days after

transduction) analysis of GFP expression from these two

constructs delivered to .45 cells by the SV40 system was

carried out using flow cytometry. As clearly seen in

Figure 7a (3 days post-transduction), there was no

detectable difference in GFP expression from constructs in

the presence or absence of the SV40 enhancer. As a

control, we compared the expression of GFP in HeLa and

KB-3-1 cells that were transfected with the same

constructs using Lipofectamine-Plus reagent and analyzed

at the same time points as before. Interestingly, in this

case, the plasmid carrying the SV40 enhancer sequence

clearly revealed higher GFP expression than that lacking

the NLS (Figure 7b – 4 days post transfection). Similar

experiments were carried out using two other GFP DNA

plasmids constructed with or without the cPPT sequence

from HIV-1 downstream to the GFP gene. As expected,

neither the in vitro-packaged SV40 vector (Figure 7c – 4

days after transduction), nor the transfection delivery

system carrying these DNA plasmids revealed any

differences in GFP expression over time (Figure 7d – 5

days post-transfection). These experiments were repeated

8 times, with similar results.

H. DNA histone acetylation, but not DNA

demethylation, promotes DNA expression via

SV40 in vitro vectorsIn order to increase gene expression, we treated .45

cells prior to transduction using the SV40 delivery system

with various concentrations of the DNA histone

deacetylase inhibitor, TSA. In order not to saturate the

cells, and to see the effect of TSA, only 2/3 of a

pseudovirion reaction (Kimchi-Sarfaty et al, 2004) was

used. Acetylation of histones allows DNA to be more

accessible to transcription factors by separating basic N-

termini of histones. This makes histone-DNA interaction

looser which results in gene activation. GFP expression

was monitored every day for 6 days. Expression was

higher starting 48 hours after transduction in treated cells.

An 8.6-fold increase in GFP expression (4.39 in cells

transduced with in vitro-packaged GFP as compared to

37.73 in cells treated with TSA and transduced with in

vitro-packaged GFP-median fluorescence intensity,

arbitrary units) was observed in cells treated with 10 ng/ml

6 days after transduction. A similar experiment using the

pHaMDR1 plasmid packaged in vitro revealed similar

results expression using the MRK16 monoclonal antibody

was 30% higher 48 hours post transduction after treating

the cells with 10 ng/ ml 24 prior to transduction.

TSA treatment (0.1, 1, 10 ng/ml) was used on KB-3-

1 and HeLa cells 24 hours prior to transfection with EGFP

using Lifofectamine-Plus reagent. Measuring 24 and 48

hours post transduction, we found that treatment with 0.1

and 1 ng/ml slightly increased GFP expression (1627.48 in

cells transduced with GFP as compared to 1968.52 in cells

treated with 0.1 ng/ml TSA and transduced with GFP-

median fluorescence intensity, arbitrary units), A higher

concentration of 10 ng/ml did not change GFP expression

level.

Treating cells with the DNA methylase inhibitor,

DAC which incorporates into the DNA in place of

cytosine but cannot be methylated, results in loss of DNA

methylation, and in some cases, gene reactivation. In

contrast to TSA treatment, treatment of cells with DAC

prior to transduction (24, 48, 72 hours prior to


447

Figure 7. GFP expression via Lipofectamine-Plus or SV40 delivery system using NLS sequences. (a) – .45 cells transduced with in vitro

packaged-EGFP-C1 plasmid DNA which carries the SV40 enhancer as NLS sequence (-__-), or with no NLS sequence (–––) 3 days

after transduction. Mock transduced cells are indicated with a solid line. (b) – HeLa cells transduced with GFP plasmid DNA which

carries the NLS sequence (-__-), or with no NLS (–––) sequence using lipofectamine-plus 4 days after transduction. Mock transduced

cells appear as a solid line . (c) – .45 cells transduced with in vitro packaged-GFP plasmid DNA which carries the HIV-1 cPPT sequence

(-__-), or with no cPPT (–––) sequence 4 days after transduction. Mock transduced cells appear as a solid line. Panel (d – HeLa cells

transduced with GFP plasmid DNA which carries the cPPT sequence (-__-), or with no cPPT (–––) sequence using lipofectamine-plus 5

days after transduction. Mock transduced cells appear as a solid line

.

transduction) at different concentrations (1-10 µM) did not

change the reporter gene expression (data not shown).

IV. DiscussionVectors which use the SV40 major capsid protein

VP1 can be used to package supercoiled plasmids up to

17.7 kb in size in vitro without an SV40 viral sequence

(Kimchi-Sarfaty et al, 2003). Previously we have shown

the high efficiency of delivery of SV40 pseudovirions, but

expression from in vitro encapsidated DNA is lower than

retroviral delivery systems (Kimchi-Sarfaty et al, 2003).

One of the aims of this work was to identify the limiting

step in the pathway of entry of SV40 pseudovirions in

order to improve expression of packaged DNA. Studying

the SV40 pseudovirion pathway in a human

lymphoblastoid cell line, we show here that the

pseudovirions colocalized to MHC I receptors as does the

wild-type SV40 virus, but a high level of MHC I is neither

necessary nor sufficient for entry. Over a period of several

hours, VP1 protein as well as packaged plasmid DNA

labeled with a fluorescent tag was detected by confocal

microscopy, and were shown to move from the surface of

the cell into the Golgi, eventually accumulating in the ER.

Initial disassembly of the packaged DNA from VP1 occurs


448

in the ER, with some of the tagged DNA appearing in or

near the nucleus 53 hours post transduction. No staining of

VP1 was observed within the nucleus. Trapping of some

of the DNA in the cytoplasm might explain the known

limitation in expression of in vitro packaged virions. To

overcome these limitations, we constructed GFP reporter

DNAs harboring the enhancer repeat of the SV40 early

promoter or the cPPT sequence from the HIV-1 virus, but

saw no effect on gene expression. However, GFP

expression was elevated when cells were treated with a

histone deacetylase inhibitor TSA prior to transduction.

A. Entry of pseudovirions into cellsThe efficiency of the entry of pseudovirions was

monitored here using a GRIP-fluorescent DNA, with

which we were able to demonstrate a fluorescent tag in

every cell. Wild-type SV40 utilizes MHC I as a receptor

(Norkin, 1999). Increased SV40 wild-type entry to cells

can be achieved by transfecting more MHC I molecules

into these cells (Breau et al, 1992). The results shown

here, and our extensive experience with other cell lines

(data not shown), do not demonstrate a direct correlation

between MHC I levels and GFP expression. These results

indicate that the MHC I level is not the limiting factor for

reporter gene expression using the SV40 in vitro

packaging delivery system. In some cell lines we found

high levels of MHC I receptors, but GFP expression was

low. These observations confirm our previous conclusions

about in vitro packaging, that enhancing MHC I receptor

levels in cells using interferon-$ does not enhance GFP

expression via the SV40 delivery system. Previously we

also measured MHC I receptors of .45 cells after multiple

pseudovirion transductions, and we found that even after

the third transduction, more than 60% of the cells still

express MHC I (unpublished data of the authors). We

speculate that other coreceptor(s) are needed for the entry

of the pseudovirions, and without these coreceptors even

high levels of MHC I are not sufficient for the entry of the

pseudovirions. SV40 vectors transit from the cell

membrane to the ER in .45 cells. However, blocking the

pathway to the ER did not completely inhibit GFP

expression, suggesting that alternative pathways are

available under these conditions.

B. The pathway of SV40 pseudovirions

from the ER to the nucleusThe process of DNA entry to the nucleus is slower

using the SV40 delivery system compared to transfection

using Lipofectamine-Plus, another type of non-viral gene

delivery. Godbey and colleagues (1999) used

poly(ethylenimine)/DNA complexes and showed that the

DNA initially appeared in the nucleus 4-5 hours post-

transfection. Similarly, our study showed that transfection

using lipids initially delivered the DNA to the nucleus 4.5

hours post-transduction. Using the SV40 system, the DNA

reporter plasmid appeared in the nucleus later, and a small

amount of DNA was localized in the nucleus 20 hours post

transduction. It was clear that most of the DNA did not

move to the nucleus, but was trapped in the ER. For mouse

polyomavirus, VP1 accumulates on nuclear membranes,

and its entry is not inhibited by BFA. The majority of the

polyomavirus viral DNA is also not delivered to the

nucleus, but moves back to the cytosol, and possibly

degrades (Mannova and Forstova, 2003). An earlier study

examining the pathway of the poly(ethylenimine)/DNA

complexes also revealed similar results: some of the DNA

was trapped in the cytoplasm and did not reach the nucleus

(Godbey et al, 1999).

C. The known NLS sequences, the

enhancer of SV40 wild-type virus and cPPT

sequence from lentivirus do not improve gene

expression using the SV40 pseudovirion

vectorsThe function of the nuclear membrane as a barrier

against macromolecules was described in the 1970s

(Dingwall and Laskey, 1992). However, according to

Whittaker and colleagues (2000), polyoma and papilloma

virus particles (up to 60 nm) are able to pass into the

nucleus. Previously, we have shown that the size of the

pseudovirions did not exceed 55 nm (while SV40 wild-

type is 45 nm). Therefore, it was surprising that we did not

find any VP1 staining within the nucleus.

NLS were used previously as peptides delivered in

trans to the DNA or in cis carried by the plasmid DNA

that needed to be delivered to the nucleus (Akuta et al,

2002). In the latter, fusion protein was expressed initially

in the cytosol, but moved to the nucleus under the

influence of the NLS. The enhancer repeat of the SV40

early promoter has been shown to increase the nuclear

transport of transfected plasmid DNAs and also enhance

the expression of transgenes in several cell types (Dean,

1997; Dean et al, 1999; Vacik et al, 1999; Li et al, 2001).

We could only detect a marked increase in GFP expression

when the same plasmid was tranfected into cells.

It has been shown that the SV40 enhancer contains

binding sites for several transcription factors. Several

cellular transcription factors have been demonstrated to

form nucleoprotein complexes after binding to their

specific DNA sequences in the SV40 enhancer. The DNA

sequences could interact with NLS receptors and enter the

nucleus using the normal nuclear protein import

machinery (Nigg, 1997). Other SV40 delivery systems

such as the one developed by Vera et al, (2004) always

imprint the NLS sequence of wild-type SV40. The failure

to obtain nuclear delivery of the plasmid DNA harboring

the SV40 enhancer using in vitro-packaged SV40 vectors,

and our success using a Lipofectamine-Plus delivery

system in the current study suggests that the NLS

sequences or binding sites of cellular transcriptional

factors in the SV40 enhancer might have been blocked or

inactive due to conformational changes when packaged in

the SV40 delivery system. Alternatively, we could

speculate that the cellular factor(s) necessary to facilitate

the SV40 enhancer-mediated nuclear transport is absent in

cell lines used in this study.

The cPPT sequence of HIV-1 virus pol gene virus

has been shown to increase nuclear transport of

preintegration DNA complexes formed after reverse

transcription of wild type HIV-1 genome or replication


449

defective HIV-1-based vectors in infected cells (Sirven et

al, 2000; Zennou et al, 2000). Although the nuclear

transport function of the cPPT sequence has been well

documented in the context of the wild type HIV-1 viral

infection or transduction with HIV-1-based vector

systems, its effectiveness in the context of plasmid DNA

delivery and/or gene expression has not been studied. Not

surprisingly, in the present study we were unable to detect

any differences in GFP expression when we used plasmid

DNA carrying or not carrying the cPPT sequence.

However, these results suggest that the SV40 system could

effectively package the HIV-1 based vectors and generate

pseudovirions capable of delivering the vector plasmid

into cells.

D. Inhibition of histone deacetylation

increases GFP expression delivered via SV40

pseudovirionsThese results led us to search for different ways to

increase the reporter gene expression via the SV40

delivery system. In this work, we show that inhibition of

histone deacetylation, but not DNA demethylation,

dramatically improves GFP expression delivered by the

SV40 in vitro packaging vectors. Treatment of cultured

cells with trichostatin A (TSA), a specific histone 4

deacetylase inhibitor, was shown to change gene

expression, probably by inducing hyperacetylation of

histones. Sowa and colleagues, (1997) and others

(Schuettengruber et al, 2003) demonstrated activation of

genes or gene promoters using TSA, but others (Siddiqui

et al, 2003) showed that TSA might repress transcription.

Treating other cell lines (KB-3-1 and HeLa) prior to

transduction using another delivery system-

Lipofectamine-Plus-produced only very slightly higher

GFP expression, as compared to delivery using the SV40

vectors. Therefore, we suggest that treatment with TSA

might not be a useful method to increase gene expression

for other delivery systems. White and Strayer, (2003)

found that DNA methylation can occur during SV40

production in the packaging cell line and this may explain

the relatively low expression of transgenes using other

SV40 virions for gene delivery. Our results, however,

indicated that inhibition of DNA methylation did not

increase transgene expression.

The SV40 in vitro packaging pathway characterized

in this study has many similarities to the wild-type

pathway. Both pathways are very efficient, both use MHC

I for entry, in both the virions are delivered to the ER, and

in both the efficiency of the delivery to the nucleus is not

very high. However, some differences were observed.

MHC I is not an exclusive pathway for the pseudovirions,

not all the pseudovirions travel through the Golgi, and a

large proportion of the reporter DNA is trapped in the ER.

Although we were not successful in improving the

efficiency of DNA delivery to the nucleus, blocking

acetylation of histone H4 appears to substantially increase

expression of DNA delivered by SV40 pseudovirions, and

this approach may prove useful in exploiting SV40-based

delivery systems.

AcknowledgmentsWe thank Ariella Oppenheim (The Hebrew

University, Hadassah Medical School and Hadassah

University Hospital, Jerusalem, Israel) for fruitful

collaboration on the SV40 vectors, and for providing us

the VP1, and VP2/3 polyclonal antibodies. We thank

Pamela Robey, and Sergei Kuznetsov, National Institutes

of Dental and Craniofacial Research, NIH, and Louis

Scavo, National Institute of Diabetes and Digestive and

Kidney Diseases, NIH for providing us with adult stem

cells, and George Leiman for insightful editorial

assistance.

ReferencesAkiyama S, Fojo A, Hanover JA, Pastan I, Gottesman MM

(1985) Isolation and genetic characterization of human KB

cell lines resistant to multiple drugs. Somat Cell Mol Genet

11, 117-126.

Akuta T, Eguchi A, Okuyama H, Senda T, Inokuchi H, Suzuki

Y, Nagoshi E, Mizuguchi H, Hayakawa T, Takeda K,

Hasegawa M, Nakanishi M (2002) Enhancement of phage-

mediated gene transfer by nuclear localization signal.


Breau WC, Atwood WJ, Norkin LC (1992) Class I major

histocompatibility proteins are an essential component of the

simian virus 40 receptor. J Virol 66, 2037-2045.

Colomar MC, Degoumois-Sahli C, Beard P (1993) Opening and

refolding of simian virus 40 and in vitro packaging of foreign

DNA. J Virol 67, 2779-2786.

Cormack BP, Valdivia RH, Falkow S (1996) FACS-optimized

mutants of the green fluorescent protein (GFP). Gene 173,

33-38.

Dalyot-Herman N, Rund D, Oppenheim A (1999) Expression of

beta-globin in primary erythroid progenitors of beta-

thalassemia patients using an SV40-based gene delivery

system. J Hematother Stem Cell Res 8, 593-599.

Dean DA (1997) Import of plasmid DNA into the nucleus is

sequence specific. Exp Cell Res 230, 293-302.

Dean DA, Dean BS, Muller S, Smith LC (1999) Sequence

requirements for plasmid nuclear import. Exp Cell Res 253,

713-722.

Dingwall C, Laskey R (1992) The nuclear membrane. Science

258, 942-947.

Follenzi A, Ailles LE, Bakovic S, Geuna M, Naldini, L (2000)

Gene transfer by lentiviral vectors is limited by nuclear

translocation and rescued by HIV-1 pol sequences. Nat

Genet 25, 217-222.

Godbey WT, Wu KK, Mikos AG (1999) Tracking the

intracellular path of poly(ethylenimine)/DNA complexes for


Khalili KAS, Stoner GL (2001) Human Polyomaviruses. New

York: Wiley-Liss, Inc.

Kimchi-Sarfaty C, Ben-Nun-Shaul O, Rund D, Oppenheim A,

Gottesman MM (2002) In Vitro-Packaged SV40

Pseudovirions as Highly Efficient Vectors for Gene Transfer.


Kimchi-Sarfaty C, Arora M, Sandalon Z, Oppenheim A,

Gottesman MM (2003) High cloning capacity of in vitro

packaged SV40 vectors with no SV40 virus sequences. Hum

Gene Ther 14, 167-177.

Kimchi-Sarfaty C, Alexander NS, Brittain S, Ali S, Gottesman

MM (2004a) Transduction of multiple cell types using

improved conditions for gene delivery and expression of

SV40 pseudovirions packaged in vitro. BioTechniques 37,

270-275.


450

Kimchi-Sarfaty C., Garfield, S., Alexander, N. S., Ali, S.,

Brittain, S., Cruz, C., Chinnasamy, D., and Gottesman, M.

M. (2004b) SV40 pseudovirions as highly efficient vectors

for gene transfer and their potential application in cancer

therapy. Curr Pharm Biotech 5, 451-458,

Li S, Maclaughlin FC, Fewell JG, Gondo M, Wang J, Nicol F,

Dean DA, Smith, LC (2001) Muscle-specific enhancement of

gene expression by incorporation of SV40 enhancer in the

expression plasmid. Gene Ther 8, 494-497.

Mannova P, Forstova J (2003) Mouse polyomavirus utilizes

recycling endosomes for a traffic pathway independent of

COPI vesicle transport. J Virol 77, 1672-1681.

Miyoshi H, Blomer U, Takahashi M, Gage FH, Verma IM (1998)

Development of a self-inactivating lentivirus vector. J Virol

72, 8150-8157.

Naldini L, Blomer U, Gage FH, Trono D, Verma IM (1996)

Efficient transfer, integration, and sustained long-term

expression of the transgene in adult rat brains injected with a

lentiviral vector. Proc Natl Acad Sci U S A 93, 11382-

11388.

Nigg EA (1997) Nucleocytoplasmic transport: signals,

mechanisms and regulation. Nature 386, 779-787.

Norkin LC (1999) Simian virus 40 infection via MHC class I

molecules and caveolae. Immunol Rev 168, 13-22.

Norkin LC (2001) Caveolae in the uptake and targeting of

infectious agents and secreted toxins. Adv Drug Deliv Rev

49, 301-315.

Norkin LC, Anderson HA, Wolfrom SA, Oppenheim A (2002)

Caveolar endocytosis of simian virus 40 is followed by

brefeldin A-sensitive transport to the endoplasmic reticulum,

where the virus disassembles. J Virol 76, 5156-5166.

Oppenheim A, Peleg A, Fibach E, Rachmilewitz EA (1986)

Efficient introduction of plasmid DNA into human

hemopoietic cells by encapsidation in simian virus 40

pseudovirions. Proc Natl Acad Sci U S A 83, 6925-6929.

Oppenheim A, Peleg A (1989) Helpers for efficient

encapsidation of SV40 pseudovirions. Gene 77, 79-86.

Parton RG, Lindsay M (1999) Exploitation of major

histocompatibility complex class I molecules and caveolae

by simian virus 40. Immunol Rev 168, 23-31.

Pelkmans L, Kartenbeck J, Helenius A (2001) Caveolar

endocytosis of simian virus 40 reveals a new two-step

vesicular-transport pathway to the ER. Nat Cell Biol 3, 473-

483.

Pelkmans L, Helenius A (2002) Endocytosis via caveolae.

Traffic 3, 311-320.

Ross PC and Hui SW (1999) Polyethylene glycol enhances

lipoplex-cell association and lipofection, Biochim Biophys

Acta 1421, 273-83

Schuettengruber B, Simboeck E, Khier H, Seiser C (2003)

Autoregulation of mouse histone deacetylase 1 expression.

Mol Cell Biol 23, 6993-7004.

Siddiqui H, Solomon DA, Gunawardena RW, Wang Y, Knudsen

ES (2003) Histone deacetylation of RB-responsive

promoters: requisite for specific gene repression but

dispensable for cell cycle inhibition. Mol Cell Biol 23, 7719-

7731.

Sirven A, Pflumio F, Zennou V, Titeux M, Vainchenker W,

Coulombel L, Dubart-Kupperschmitt A, Charneau P, (2000)

The human immunodeficiency virus type-1 central DNA flap

is a crucial determinant for lentiviral vector nuclear import

and gene transduction of human hematopoietic stem cells.

Blood 96, 4103-4110.

Sowa Y, Orita T, Minamikawa S, Nakano K, Mizuno T, Nomura

H, Sakai, T (1997) Histone deacetylase inhibitor activates the

WAF1/Cip1 gene promoter through the Sp1 sites. Biochem

Biophys Res Commun 241, 142-150.

Strayer DS, Zern MA (1999) Gene delivery to the liver using

simian virus 40-derived vectors. Semin Liver Dis 19, 71-81.

Strayer DS (1999) Gene delivery to human hematopoietic

progenitor cells to address inherited defects in the erythroid

cellular lineage [editorial; comment]. J Hematother Stem

Cell Res 8, 573-574.

Strayer DS (2000) Effective gene transfer using viral vectors

based on SV40. Methods Mol Biol 133, 61-74.

Tsai B, Gilbert JM, Stehle T, Lencer W, Benjamin TL, Rapoport

TA (2003) Gangliosides are receptors for murine polyoma

virus and SV40. EMBO J 22, 4346-55.

Tooze J (1981) DNA Tumor Viruses. New York: Cold Spring

Harbor Laboratory.

Vacik J, Dean BS, Zimmer WE, Dean DA (1999) Cell-specific

nuclear import of plasmid DNA. Gene Ther 6, 1006-1014.

Vera M, Prieto J, Strayer DS, Fortes P (2004) Factors

Influencing the Production of Recombinant SV40 Vectors.

Mol Ther 10, 780-91.

White MK and Strayer DS (2003) DNA methylation modulates

expression of transgenes transduced by recombinant SV40

vectors. Molecular Therapy, Abstracts from the Sixth Annual

Meeting of the American Society of Gene Therapy, 7, S473.

Whittaker GR, Kann M, Helenius A (2000) Viral entry into the

nucleus. Annu Rev Cell Dev Biol 16, 627-651.

Zennou V, Petit C, Guetard D, Nerhbass U, Montagnier L,

Charneau P (2000) HIV-1 genome nuclear import is

mediated by a central DNA flap. Cell 101, 173-185.

Michael M. Gottesman


451


The importance of PTHrP for cancer developmentReview Article

Jürgen DittmerUniversität Halle-Wittenberg, Universitätsklinik und Poliklinik für Gynäkologie, Ernst-Grube-Str. 40, 06097 Halle (Saale),

Germany

__________________________________________________________________________________

*Correspondence: Jürgen Dittmer, Universität Halle-Wittenberg, Universitätsklinik und Poliklinik für Gynäkologie, Ernst-Grube-Str.

40, 06097 Halle (Saale), Germany; Tel: +49-345-557-1338; Fax: +49-345-557-5261; e.mail: [email protected]

Key words : PTHrP for cancer development, cancer proliferation, invasion, metastasis, apoptosis, osteolysis, ets transcription factors,

regulating factors

Abbreviations: adenovirus protein E1A, (AdV E1A); adult T-cell leukemia/lymphoma, (ATLL); calcium-sensing receptor, (CaR);

cAMP-responsive element, (CRE); epidermal growth factor, (EGF)); extracellular matrix, (ECM); G-protein coupled receptors, (GPCR);

human T lymphotropic virus type I, (HTLV-I); hypercalcaemia of malignancy, (HHM); interleukin-6, (IL-6); nuclear localization

sequence, (NLS); parathyroid hormone 1 receptor, (PTH1R); parathyroid hormone, (PTH); Parathyroid hormone-related protein,

(PTHrP); protein kinase A, (PKA); protein kinase C, (PKC); receptor activator of NF-!B ligand, (RANKL); transforming growth factor

"2, (TGF"2); urokinase type plasminogen activator, (uPA); vascular smooth muscle, (VSM)

Received: 2 November 2004; Revised: 15 November 2004;

Accepted: 19 November 2004; electronically published: November 2004

Summary

Parathyroid hormone-related protein (PTHrP) is expressed by many cells and usually acts as an autocrine,

paracrine and/or intracrine factor to play numerous roles in embryonic development and normal physiology.

Evidence has been accumulated suggesting that PTHrP may also serve important functions in tumor development.

PTHrP has the potential to cause humoral hypercalcaemia of malignancy and is able to induce local osteolysis

which facilitates growth of tumor cells that have metastasized to bone. Furthermore, PTHrP has been shown to

stimulate proliferation as well as invasiveness of cancer cells and to protect cancer cells from apoptosis. In this

review, I summarize the current knowledge about the role of PTHrP in cancer development and about the factors

that control PTHrP expression in cancer.

I. Discovery of PTHrPPTHrP was originally discovered as a systemic

humoral factor that is released by tumor cells and causes

hypercalcaemia of malignancy (HHM) (Suva et al, 1987;

Wysolmerski and Broadus, 1994; Rankin et al, 1997; Grill

et al, 1998). The hypercalcaemic activity of PTHrP is

based on its partial homology to parathyroid hormone

(PTH) (Horiuchi et al, 1987; Kemp et al, 1987), a protein

that regulates calcium homeostasis. By being able to bind

to the parathyroid hormone 1 receptor (PTH1R) with equal

affinity as PTH (Juppner et al, 1991), PTHrP mimics PTH

action and stimulates cAMP production in bone and

kidney (Mannstadt et al, 1999). This results in bone

resorption and renal calcium retention eventually leading

to HHM.

It became clear that PTHrP is also expressed by non-

transformed cells in almost all tissues (dePapp and

Stewart, 1993) where it serves specific functions as an

autocrine or paracrine factor (Moseley and Gillespie;

1995, Philbrick et al, 1996; Strewler, 2000). In

embryogenesis, PTHrP plays an essential role in

mammary gland and bone development (Vortkamp et al,

1996, Wysolmerski et al, 1998). Disruption of the PTHrP

gene in mice leads to fatal skeletal dysplasia (Karaplis et

al, 1994; Karaplis and Deckelbaum, 1998). Rescued

PTHrP k.o. mice, carrying a transgenic PTHrP gene under

the control of a bone-specific promoter, lack mammary

epithelial ducts (Wysolmerski et al, 1998). The actions of

PTHrP in the developing bone and breast are paracrine in

nature and depend on PTH1R. In the developing bone,

PTHrP secreted from periarticular perichondrium activates

PTH1R on chondrocytes, thereby preventing premature

ossification (Vortkamp et al, 1996). In the developing

mammary gland, PTHrP from embryonic mammary

epithelial cells stimulates the mammary mesenchyme via

interaction with PTH1R to differentiate into mammary-

specific mesenchyme which then triggers ductal

morphogenesis (Dunbar et al, 1998).

II. The functional domains of PTHrPThe PTHrP transcripts are translated into three

different isoforms, PTHrP (-36/139), PTHrP (-36/141) and

!"##$%&'()$*+&#,-.%(+/(012&0(/+&(.,-.%&(3%4%5+*$%-#(

!

!"#$%&'!()!!"#$%&'()*+',-$.+/,*'0$+%$ )"#$"&/,'$1!231$43+)#*'$,'.$*)0$ *')#3,()*+'$4,3)'#305$6#),*-0$,3#$7*8#'$*'$)"#$)#9)5$!:1$.#'+)#0$

4"+04"+3;-,)*+'$+%$!"3<=5$>>!>$0),'.0$%+3$3#0*.&#0$>#3??@A$>#3?BCA$!"3?BD$,'.$>#3?B<$,'.$EEEE$.#'+)#0$)"#*3$3#4-,(#/#')0$F;$,-,'*'#05$

G6H$ I$ (;(-*':.#4#'.#')$ J*',0#A$K1GL$I$K:43+)#*'$ (+&4-#.$ 3#(#4)+35$K3##'$ F,30$ 0"+M$ #9)#')*+'$ +%$ )"#$ 1!231$ 43+)#*'$ *'$ 04-*(*'7$

8,3*,')0$NBOP?Q?$,'.$NBOP?RB5$

$

$

1!231$ S:BOP?RBT$ S"#$%&'! (T5$ !"#;$ ,--$ (+'),*'$ )"#$ U:

)#3/*',-$ 0*7',-$ 0#V&#'(#$ %+3$ #')3,'(#$ *')+$ )"#$

#'.+4-,0/,)*($ 3#)*(&-&/$ ,'.$ )"#$ (+.*'7$ 3#7*+'$ F#)M##'$

3#0*.&#0$ ?$ ,'.$ ?B@$ SW,3)*'$ #)$ ,-A$ ?@@?X$ 1"*-F3*(J$ #)$ ,-A$

?@@OX$ >)3#M-#3A$ DCCCT5$ !"#$ %*30)$ ???$ ,/*'+$ ,(*.0$ +%$ )"#$

(+.*'7$3#7*+'$,3#$"*7"-;$(+'0#38#.$F#)M##'$/*(#A$3,)0$,'.$

"&/,'0$ 0&77#0)*'7$ )",)$ )"#;$ ,3#$ (3&(*,-$ %+3$ 1!231$

%&'()*+'5$ Y'$ (+')3,0)A$ )"#$ G:)#3/*'&0$ *0$ "*7"-;$ 8,3*,F-#5$

!"#$ *0+%+3/0$ 1!231$ S:BOP?Q?T$ ,'.$ )"#$ "&/,':04#(*%*($

1!231$S:BOP?RBT$43+.&()$%#,)&3#$#9)#'.#.$G:)#3/*'*5$!"#$

1!231$43+)#*'$*0$4+0):)3,'0-,)*+',--;$(-#,8#.$,)$,$'&/F#3$

+%$.*F,0*($0*)#0$ S6*#%#'F,(":Z,77#3$#)$,-A$?@@=X$6*)/#3$#)$

,-A$?@@OX$[&$#)$,-A$?@@OT$-#,.*'7$)+$)"#$3#/+8,-$+%$)"#$43#:

43+$ 0#V&#'(#$ F#)M##'$ NBO$ ,'.$ N?$ ,'.$ )+$ ,$ -*/*)#.$

%3,7/#'),)*+'$+%$)"#$43+)#*'5$!"#0#$%3,7/#')0$(+'),*'$+'#$

+3$/+3#$+%$)"#$)"3##$%&'()*+',-$.+/,*'0$M"*("$,3#$)"#$U:

)#3/*',-$S1!231$?:BOTA$)"#$/*.:3#7*+'$S1!231$B<:@QT$,'.$

)"#$G:)#3/*',-$.+/,*'$S1!231$?CR:?B@T5$

!"#$U:)#3/*',-$.+/,*'A$1!231$S?:BOTA$*0$3#04+'0*F-#$

%+3$)"#$1!2:-*J#$,()*8*);$+%$1!231$,'.$*0$,F-#$)+$F*'.$,'.$

,()*8,)#$ 1!2?L5$ E()*8,)*+'$ +%$ )"*0$ K:43+)#*'$ (+&4-#.$

3#(#4)+3$ SK1GLT$ -#,.0$ )+$ )"#$ 0)*/&-,)*+'$ +%$ )"#$ 43+)#*'$

J*',0#$E$S1HETA$43+)#*'$J*',0#$G$S1HGT$,'.P+3$(,-(*&/:

.#4#'.#')$4,)"M,;0$ SW,''0),.)$ #)$ ,-A$?@@@X$G,),*00+'$#)$

,-A$DCCCX$W,*+-*$,'.$\+3)*'+A$DCCQ,T5$$

W,';$+%$)"#$1!2?L:.#4#'.#')$1!231$#%%#()0$(,'$F#$

/*/*(J#.$F;$(EW1$*'.*(,)*'7$)",)$1HE$*0$,$/,]+3$),37#)$

+%$,()*8,)#.$1!2?L5$$

!"#$/*.:3#7*+'$.+/,*'$ *0$,F-#$ )+$#')#3$ )"#$'&(-#&05$

Y)$(+'),*'0$,$F*4,3)*)#$'&(-#,3$-+(,-*^,)*+'$0#V&#'(#$SU_>T$

(+'0*0)*'7$ +%$ 3#0*.&#0$ <<:@?$ ,'.$ ?CD:?CO$ SW,00%#-.#3$ #)$

,-A$?@@RT5$!"*0$0#V&#'(#$,-0+$,--+M0$1!231$)+$,((&/&-,)#$

*'$ )"#$ '&(-#+-&0$ S2#'.#30+'$ #)$ ,-A$ ?@@=T$ ,'.$ )+$ F*'.$ )+$

LUE$SE,3)0$#)$,-A$?@@@T5$U&(-#,3$),37#)*'7$(,'$F#$%&3)"#3$

,("*#8#.$ F;$ 3#0*.&#0$ OO:@Q$ M"*("$ *0$ 3#(+7'*^#.$ F;$

*/4+3)*'$!$S_,/$#)$,-A$?@@@,X$G*'7+-,'*$#)$,-A$DCCDT5$!"#$

/*.3#7*+'$ 0#V&#'(#$ ,-0+$ "+-.0$ ,$ G6H?S(.(DTPG6HD$

4"+04"+3;-,)*+'$ 0*)#$ S_,/$ #)$ ,-A$ ?@@@FT5$ \+--+M*'7$ *)0$

4"+04"+3;-,)*+'A$ 1!231$ *0$ 3#),*'#.$ *'$ )"#$ (;)+4-,0/$

0&77#0)*'7$)",)$)"#$,()*8*);$+%$'&(-#,3$1!231$*0$3#7&-,)#.$

F;$)"#$(#--$(;(-#5$$

!"#$ G:)#3/*',-$ .+/,*'A$ ,-0+$ (,--#.$ +0)#+0),)*'A$ *0$

,F-#$ )+$ *'"*F*)$ F+'#$ 3#0+34)*+'$ ,'.A$ )"#3#F;A$ ,'),7+'*^#0$

)"#$,()*+'$+%$ )"#$U:)#3/*',-$.+/,*'$+%$1!231$S\#')+'$#)$

,-A$ ?@@QX$ G+3'*0"$ #)$ ,-A$ ?@@RT5$ !"*0$ *'"*F*)+3;$ #%%#()$ +%$

+0)#+0),)*'$/,;$F#$ F,0#.$+'$ )"#$ ,F*-*);$+%$ )"*0$ 43+)#*'$ )+$

4";0*(,--;$*')#3,()$M*)"$!:E33#0)*'$SG+'-,'$#)$,-A$DCCDT5$!:

E33#0)*'0$ ,3#$ J'+M'$ )+$ 3#7&-,)#$ *')#3',-*^,)*+'$ ,'.$

.#0#'0*)*^,)*+'$ +%$ -*7,'.:0)*/&-,)#.$ K1GL0A$ 0&("$ ,0$

1!231:,()*8,)#.$ 1!2?L$ S\#33,3*$ #)$ ,-A$ ?@@@T5$ !"#$ G:

)#3/*',-$ .+/,*'$ ,-0+$ ",3F+30$ %+&3$ 4+)#')*,-$ ),37#)0$ %+3$

J*',0#0$,)$3#0*.&#0$??@A$?BCA$?BD$,'.$?B<$M"+0#$/&),)*+'$

%3+/$ ,$ 0#3*'#$ +3$ )"3#+'*'#$ )+$ ,'$ ,-,'*'#$ ,F3+7,)#.$ )"#$

/*)+7#'*($ ,()*8*);$ +%$ 1!231$ *'$ 8,0(&-,3$ 0/++)"$ /&0(-#$

(#--0$S\*,0("*:!,#0("$#)$,-A$DCCQT$

E'+)"#3$.+/,*'$0##/0$)+$F#$-+(,)#.$*'$)"#$#9)#'.#.$

G:)#3/*'&0$ +%$ )"#$ 1!231$ S:BOP?RBT$ )3,'0(3*4)*+',-$

43+.&()5$!"#$0#V&#'(#$F#)M##'$3#0*.&#0$?QC$,'.$?RB$",0$

F##'$ 0"+M'$ )+$ *')#3%#3#$ M*)"$ )"#$ '&(-#,3$ -+(,-*^,)*+'$ +%$

1!231$SK++/#3$#)$,-A$DCCCT$,'.$)+$3,*0#$)"#$(EW1$-#8#-$

S2,0)*'70$#)$,-A$DCCQT5$$

>;')"#0*^#.$ *'$)"#$#'.+4-,0/*($3#)*(&-&/A$1!231$*0$

,$ 0#(3#)+3;$ 43+)#*'$ M"*("$ '##.0$ )+$ *')#3,()$ M*)"$ 04#(*%*($

(#--$/#/F3,'#$3#(#4)+30$*'$+3.#3$)+$#9#3)$*)0$%&'()*+'5$>+$

%,3A$ +'#$ 0&("$ 3#(#4)+3A$ 1!2?LA$ ",0$ F##'$ *.#')*%*#.$ )",)$

3#(+7'*^#0$ )"#$1!231$U:)#3/*',-$.+/,*'5$L#(#4)+30$ )",)$

04#(*%*(,--;$*')#3,()$M*)"$+'#$+%$)"#$+)"#3$1!231$.+/,*'0$

/,;$ #9*0)$ ,0$ M#--5$ !"*0$ *0$ *'.*(,)#.$ F;$ )"#$ +F0#38,)*+'0$

)",)$ %3,7/#')0$ '+)$ (+'),*'*'7$ )"#$U:)#3/*',-$ .+/,*'$ ,3#$

43#0#')$+&)0*.#$+%$(#--0$S>+*%#3$#)$,-A$?@@DX$[&$#)$,-A$?@@OT$

,'.$)",)$)"+0#$%3,7/#')0$,3#$,F-#$)+$*')#3%#3#$M*)"$(#--&-,3$

%&'()*+'$M"#'$,..#.$#9+7#'+&0-;$SW,00%#-.#3$#)$,-A$?@@RX$

Q=D$


453

Luparello et al, 2001). In particular, the mid-regional

PTHrP (67-86) peptide, devoid of a functional NLS, has

been shown to mobilize calcium through a phospholipase

C-dependent pathway in squamous carcinoma cells (Orloff

et al, 1996). For NLS-containing mid-region fragments, an

intracrine way of action has been discussed. In order for

PTHrP to enter the nucleus, PTHrP is supposed to be

either synthesized directly in the cytosol or produced in

the endoplasmic reticulum and then re-translocated to the

cytosol (Fiaschi-Taesch and Stewart, 2003).

III. PTHrP and cancer growthThere is evidence that PTHrP has a tumor growth

effect. Mammary gland specific overexpression of PTHrP

led to a higher incidence of tumor formation in mice

(Wysolmerski et al, 2002). Also, a polymorphic PTHrP

variant is associated with increased incidence of skin

cancer in mice (Manenti et al, 2000). Furthermore, the

growth of rat pituitary cancer cells in the brain of rats was

found to be decreased upon treatment with anti-sense

oligonucleotides against PTHrP-RNA (Akino et al, 1996).

Similarly, the tumor volume formed by H-500 Leydig

cells inoculated into rats was reduced after PTHrP anti-

sense RNA had been administered to the animals (Rabbani

et al, 1995). And, treatment of tumor-bearing mice with

PTHrP-specific antibodies was shown to suppress growth

of human breast cancer metastasized to bone and renal

carcinoma injected into the skin (Guise et al, 1996;

Massfelder et al, 2004). Furthermore, PTHrP

overexpressing prostate cancer cells grew faster in

MatLyLu rats than control cancer cells (Dougherty et al,

1999) while, in athymic mice, the level of PTHrP

expression in human squamous cancer cells increased with

tumor growth (Yamato et al, 1995).

As for the value of PTHrP as a prognostic marker for

cancer, especially for breast cancer, the data are

conflicting. On the one hand, a study of Martin and

collegues showed that, in a cohort of 367 breast cancer

patients, immunoreactivity against N-terminal PTHrP in

paraffin sections of the primary tumor tissues correlated

with improved survival (Henderson et al, 2001). In

contrast, Linforth et al reported that, in a cohort of 176

breast cancer patients, positive immunohistochemical

staining for N-terminal PTHrP in primary tumors was

associated with a reduced disease-free survival (Linforth

et al, 2002). In the same study, it was shown that the RNA

level of PTH1R correlated with a decreased survival as

well and, interestingly, that co-expression of PTHrP with

its receptor predicted the worst clinical outcome. In

another study including 177 breast cancer patients,

tumoral PTHrP protein expression was found to be a

marker of poor prognosis (Yoshida et al, 2000). The

reason for the discrepancy between the outcomes of these

studies is not yet known. In other human cancers, PTHrP

expression seems to correlate with advanced disease. E.g.,

a study on a cohort of 108 colorectal tumor patients

showed that positive staining for PTHrP in the tumor was

associated with an increased incidence of lymph nodes and

liver metastasis (Nishihara et al, 1999). Increased PTHrP

serum levels in cancer patients were also found to

correlate with increased mortality (Hiraki et al, 2002;

Truong et al, 2003).

IV. PTHrP and metastasisIt is generally accepted that PTHrP plays a role in

bone metastasis. By inducing local osteolysis PTHrP

facilitates growth of osteotropic tumors, such as breast

cancer, in the dense bony tissue (Goltzman et al, 2000;

Guise, 1997; Kakonen and Mundy, 2003). PTHrP triggers

osteolysis by stimulating osteoblasts to produce

osteoclastogenesis-activating factors, such as receptor

activator of NF-!B ligand (RANKL) or interleukin-11

(Morgan et al, 2004; Thomas et al, 1999). However,

PTHrP does not appear to directly interfere with the

metastastic potential of tumor cells, at least not in mice

(Wysolmerski et al, 2002).

The importance of PTHrP for bone metastasis has

been demonstrated by a number of studies. A correlation

between PTHrP expression and formation of bone

metastasis was shown for breast and lung cancer cell lines

in nude mice (Guise et al, 1996; Miki et al, 2000).

Moreover, colonialization of bone tissue by MDA-MB-

231 breast cancer cells could be inhibited in nude mice by

PTHrP-specific antibodies (Guise et al, 1996). Similarly,

the formation of bone metastases, but not metastases in

other organs by SBC-5 small-lung cancer cells could be

reduced by anti-PTHrP antibodies in immuno-

compromised SCID mice (Miki et al, 2004). The

propensity of metastastic tumors in bone to express PTHrP

could further been shown for human breast cancer: the

highest frequency of PTHrP expression (73-92%) was

found in bone metastatic lesions, whereas only a minority

(17-20%) of breast cancer metastases at non-bone sites

produced PTHrP (Powell et al, 1991; Vargas et al, 1992).

PTHrP induces osteolysis in cooperation with other

factors, such as TGF" (Yin et al, 1999). TGF", a factor

that can either inhibit or promote tumor growth (Blobe et

al, 2000; Roberts and Wakefield, 2003), is present in the

bone matrix and is activated upon PTHrP-induced

osteolysis. The activation of TGF" initiates a vicious cycle

as active TGF" stimulates MDA-MB-231 cells to produce

more PTHrP. This, in turn, leads to more osteolysis and,

thus, higher levels of activated TGF" (Yin et al, 1999).

Another study compared the features of bone-seeking and

brain-seeking MDA-MB-231 sublines. The brain-seeking

subline expressed less PTHrP than the bone-seeking one

and also showed a much higher sensitivity to the growth-

inhibitory activity of TGF" (Yoneda et al, 2001). The

latter feature may have precluded survival of the brain-

seeking subline in the TGF"-rich environment of the bone.

Another support for a link between PTHrP and bone

metastasis comes from two studies with MCF-7 breast

cancer cells. Both down- and upregulation of the

endogenous PTHrP production interfered with the ability

of this cell line to form metastasic lesions in the bone

(Kitazawa and Kitazawa, 2002; Thomas et al, 1999).

In addition to TGF", also interleukin-6, tumor

necrosis factor # or transforming growth factor #, have

been shown to be able to enhance the bone destructive

effect of PTHrP (de la Mata et al, 1995; Guise et al, 1993;

Dittmer: Importance of PTHrP for cancer development

454

Tumber et al, 2001; Uy et al, 1997). In some cases, PTHrP

may not be the major factor that facilitates colonialization

of breast cancer cells in the bone. Prostaglandine E2,

interleukin-6 and interleukin-8 may well substitute for

PTHrP (Bendre et al, 2003; Martin, 2002). E.g.,

interleukin-8 has been shown to mediate osteolysis of the

highly metastatic MDA-MET cell line that produces less

PTHrP, but higher amounts of interleukin-8 than the

MDA-MB-231 parental cell line (Bendre et al, 2002). On

the other hand, PTHrP and interleukin-8 expression may

be connected. This was shown for prostate cancer cells,

where PTHrP increased interleukin-8 production via its

intracrine pathway (Gujral et al, 2001). In contrast to

PTHrP, interleukin-8 can directly activate osteoclast

formation.

V. Biological effects of PTHrP on

cancer cellsNumerous studies have been conducted to analyze

the impact of PTHrP on proliferation, invasiveness and

resistance to apoptosis, biological activities that are crucial

for survival and growth of cancer cells. The results of

these studies are discussed below.

A. PTHrP and cancer proliferationDuring murine endochondrial ossification PTHrP

serves an important function by preventing chondrocytes

to prematurely differentiate into hypertrophic cells

(Vortkamp et al, 1996). In a positive feedback loop,

prehypertrophic chondrocytes secrete Indian hedgehog

(Ihh) that, by activating transforming growth factor "2

(TGF"2) (Alvarez et al, 2002), stimulates the periarticular

perichondrium to produce PTHrP (Vortkamp et al, 1996;

Karp et al, 2000; Kobayashi et al, 2002). PTHrP, in turn,

induces proliferation of the chondrocytes by interacting

with PTH1R. The activated receptor induces a decline in

the expression of cell cycle inhibitor p57kip2 (MacLean et

al, 2004) and an increase in the production of cyclin D1

(Beier et al, 2001). This well-studied example shows that

PTHrP can play a role in the regulation of the cell cycle.

This notion is further supported by a detailed study on

keratinocytes showing that PTHrP expression increases

when cells in G1-Phase enter S-Phase, an event that is

accompanied by relocation of PTHrP from the nucleolus

to the cytoplasm (Lam et al, 1997). Strikingly, PTHrP

expression in squamous cancer cells is constantly high

throughout the cell cycle (Lam et al, 1997) suggesting that

PTHrP expression becomes dysregulated in the course of

carcinogenesis.

1.Autocrine actions via PTH1RThere are a number of reports suggesting that PTHrP

may contribute to the high proliferative activity of cancer

cells. One report demonstrated that, in breast cancer,

PTH1R expression correlates well with the expression of

the proliferation marker Ki67 (Downey et al, 1997). In

another study, the mitogenic effect of PTHrP on MCF-7

breast cancer cells was found to be increased when

PTH1R was overexpressed (Hoey et al, 2003). In a third

study using the same cell line, the PTH1R ligand PTHrP

(1-34) alone could induce proliferation, which was

accompanied by an increase in the intracellular cAMP

level (Birch et al, 1995). The same peptide was also shown

to be able to stimulate growth of PC-3 and LnCaP prostate

cancer cells (Asadi et al, 2001) as well as of lung

squamous BEN-57 cancer cells (Burton and Knight,

1992). In the latter case, the effect of PTHrP (1-34) could

be reversed by addition of a PTHrP antibody.

Furthermore, proliferation of clear cell renal carcinoma in

nude mice could be equally inhibited by antibodies against

PTHrP or by a PTH1R antagonist (Massfelder et al, 2004).

These examples show that cancer cells can use the

PTHrP/PTH1R interaction to stimulate their own

proliferative activity.

2. Intracrine actionsSome reports also show anti-proliferative effects of

PTHrP on MCF-7 breast cancer and vascular smooth

muscle (VSM) cells (Massfelder et al, 1997; Falzon and

Du, 2000; Luparello et al, 2001; Pasquini et al, 2002).

Interestingly, in two of these cases, the anti-proliferative

activity of PTHrP was only observed when PTHrP

peptides (1-34, 1-36, 1-86, 1-108, 1-139, 1-141) were

exogenously administered to the cells (Massfelder et al,

1997; Falzon and Du, 2000). When PTHrP (1-139) was

transfected into the cells instead, proliferation was

increased (Massfelder et al, 1997; Falzon and Du, 2000;

Tovar Sepulveda et al, 2002). This mitogenic effect

required the integrity of the NLS suggesting that here the

mitogenic activity of PTHrP was entirely dependent on the

intracrine nuclear pathway of PTHrP. In VSM cells, the

mitogenic effect of PTHrP via the intracrine pathway was

also dependent upon three serines and one threonine

residues between positions 119 and 138 of the C-terminus

(Fiaschi-Taesch et al, 2004) suggesting that certain

phosphorylation events are essential for this PTHrP

activity.

The results by Falzon and Du (2000) showing an

anti-proliferative effect of the PTHrP (1-34) peptide on

MCF-7 breast cancer cells contradict the data obtained by

two other groups demonstrating a mitogenic effect of the

same peptide on these cells (Birch et al, 1995; Hoey et al,

2003) This discrepancy may be explained by the genetic

variability in MCF-7 sublines (Nugoli et al, 2003). In

different MCF-7 sublines, PTH1R may activate PKA,

PKC and the Ca2+ pathway to a different extent which may

lead to different proliferative activities (Maioli and

Fortino, 2004b). Alternatively, the PKA/cAMP pathway

may have different effects on proliferation in different

MCF-7 sublines. It is noteworthy in this respect that B-Raf

is able to convert cAMP from an anti-mitogenic to a

mitogenic factor (Fujita et al, 2002).

Overall, PTHrP seems to predominantly act as a

mitogenic factor on cancer cells. However, under certain

conditions (certain type of tumor, certain features of the

individual cell clone, the particular way PTHrP was

administered) PTHrP may also inhibit proliferation. How

easily PTHrP can switch from a mitogenic to an anti-

mitogenic agent is nicely demonstrated for a C-terminal

PTHrP peptide (Whitfield et al, 1992). This peptide was

found to inhibit proliferation of dividing keratinocytes, yet


455

it was shown to trigger cell cycle entrance of quiescent

cells.

B. PTHrP and invasionInvasive behavior is a hallmark of metastasizing

cancer cells. For the acquisition of an invasive phenotype,

cancer cells need to coordinate the interaction of many

proteins involved in adhesion, migration and proteolysis of

the extracellular matrix (ECM) (Price et al, 1997). PTHrP

has been found to interfere with the expression of some of

those proteins. In MCF-7 breast cancer cells and PC3

prostate cancer cells, overproduction of PTHrP induced

the expression of a number of integrins, in particular

integrins #6 and "4 (Shen and Falzon, 2003; Shen et al,

2004). Elevated levels of these integrins correlated with an

enhanced ability of PTHrP-treated MCF-7 cells to migrate

on the integrin #6/"4 ligand laminin and to invade

extracellular matrix. Integrin #6/"4 has also been shown

to increase invasiveness of MDA-MB-435 breast cancer

cells (Shaw et al, 1997). Modulation of invasiveness and

integrin expression by PTHrP in PC-3 and MCF-7 cells

required the integrity of the PTHrP-NLS suggesting that

PTHrP regulates invasiveness in these cells through the

intracrine pathway.

Effects of PTHrP on cellular invasiveness and on

proteins involved in this process were also observed when

PTHrP peptides were added exogenously. Administered to

chondrocytes, PTHrP (1-141) and (1-84) peptides induced

an increased expression of matrix metalloproteases

MMP2, MMP3 and MMP9 (Kawashima-Ohya et al,

1998). Added to 8701-BC breast cancer cells, the PTHrP

(67-86) peptide increased invasion and, at the same time,

upregulated urokinase type plasminogen activator (uPA)

(Luparello et al, 2003). This serine protease is involved in

cancer mediated ECM degradation (Price et al, 1997) and

has prognostic value for the survival of breast cancer

patients (Harbeck et al, 2002). On the other hand, PTHrP

(38-94) was found to reduce the ECM degrading activities

of a number of breast cancer cell lines (Luparello et al,

2001).

A single-nucleotide polymorphism in the C-terminal

region of the murine PTHrP revealed that also the C-

terminal part of PTHrP is important for invasion. Mice

carrying the PthlhPro allele at amino acid 130 of the mature

protein showed a higher susceptibility to skin

tumorigenesis than mice harboring the PthlhThr allele

(Manenti et al, 2000). When transfected into the human

squamous cell carcinoma line NCI-H520, PthlhPro

conferred to these cells a much greater ability to migrate

than PthlhThr (Benelli et al, 2003).

C. PTHrP and apoptosisEscaping apoptosis enables tumor cells to survive

and proceed in the neoplastic process (Naik et al, 1996).

By interfering with the apoptotic machinery, PTHrP may

contribute to this important step in carcinogenesis.

Overexpression of rat PTHrP rendered chondrocytes

resistant to serum starvation-induced apoptosis

(Henderson et al, 1995). Similarly, ectopic expression of

PTHrP (-5/139) protected MCF-7 breast cancer cells from

apoptosis which was accompanied by a rise in the

expression of anti-apoptotic proteins Bcl-2 and Bcl-xL

(Tovar Sepulveda et al, 2002). In both cases, the anti-

apoptotic PTHrP effect was mediated by the nuclear

pathway of PTHrP. Also exogenous PTHrP peptides are

potent anti-apoptotic factors. Treatment of chondrocytes

with PTHrP (1-37) stimulated the expression of Bcl-2 in a

PKA-dependent manner (Amling et al, 1997). PTHrP (1-

34) and PTHrP (140-173), but not PTHrP (38-64), PTHrP

(67-86) or PTHrP (107-139), were shown to protect lung

cancer cells from UV-induced caspase 3 activation and

apoptosis (Hastings et al, 2003). PTHrP (140-173) also

prevented Fas-dependent apoptosis in these cells. Both

PTHrP (1-37) and PTHrP (140-173) exerted their anti-

apoptotic effects by activating PKA (Amling et al, 1997,

Hastings et al, 2004). PTH1R-interacting peptides, namely

PTH (1-34), can also promote apoptosis. This was

demonstrated for confluent PTH1R-expressing

mesenchymal stem cells (Chen et al, 2002). Interestingly,

at lower cell density, the same peptide induced the inverse

effect. Both effects were dependent upon cAMP

demonstrating again the dual character of the cAMP

signaling system. Also Ca2+ can be involved in pro-

apoptotic effects of PTH1R ligands, as was found for the

apoptosis-inducing PTH effect on PTH1R overexpressing

human embryonal kidney 293 cells (Turner et al, 2000).

VI. Regulation of PTHrP expression

in cancerGiven the evidence that links PTHrP expression to

cancer progression, it is important to understand the

mechanism(s) by which PTHrP is(are) regulated in cancer

cells. PTHrP expression is mainly regulated on the

transcriptional level (Inoue et al, 1993; Wysolmerski et al,

1996; Falzon, 1997; Lindemann et al, 2001). In humans,

transcription of the PTHrP gene can be driven by three

different promoters, P1, P2 and P3 (Figure 2). Of these

promoters, the distal (P1) and proximal promoters (P3)

were identified first (Suva et al, 1989; Mangin et al, 1990)

and subsequently called P1 and P2, respectively. Later,

when a third GC-rich promoter was found inbetween P1

and P2 (Vasavada et al, 1993), the GC-rich promoter

became P2 and the proximal was renamed P3. The PTHrP

transcripts that are generated by each promoter can easily

be distinguished by certain non-coding exons that they

specifically contain (Southby et al, 1995; Lindemann et al,

2001). This allows to assess the contribution of each

promoter to the PTHrP expression in a given cell

population. In solid cancers, the P3 promoter was found to

be always active (Southby et al, 1995) and to increase its

activity when breast cancers metastasize (Bouizar et al,

1999).

A. Regulation by Ets transcription factorsOne of the first proteins that have been shown to

activate the P3 promoter was HTLV-I Tax1 (Dittmer et al,

1993). HTLV-I Tax1 is a unique viral protein encoded by

the human T lymphotropic virus type I (HTLV-I) that

causes adult T-cell leukemia/lymphoma (ATLL)

(Franchini, 1995). In almost all ATLL patients, the PTHrP

!"##$%&'()$*+&#,-.%(+/(012&0(/+&(.,-.%&(3%4%5+*$%-#(

!

!!

"#$%&'!*)!`37,'*^,)*+'$+%$)"#$"&/,'$1!231$7#'#5$!"#$/,7'*%*#.$,3#,$0"+M0$)"#$/,]+3$%&'()*+',-$#-#/#')0$+%$)"#$1!231$1B$43+/+)#3$

,'.$)"#$)3,'0(3*4)*+'$%,()+30$)",)$",8#$F##'$0"+M'$)+$*')#3,()$M*)"$)"#0#$6UE$0#V&#'(#05$!"#$;#--+M$F,30$*'.*(,)#$M"*("$6UE$F*'.*'7$

/+)*%P8#0$*0P,3#$#00#')*,-$%+3$3#7&-,)*+'$+%$)"#$1B$43+/+)#3$F;$!K\!A$2!_a:Y$!,9A$3#)*'+*($,(*.A$4"+3F+-$#0)#3A$,.#'+8*3&0$43+)#*'$b?E$

SE.a$b?ET$+3$bK\5$6#),*-0$,3#$7*8#'$*'$)"#$)#9)5$

$

$

43+)#*'$ -#8#-$ *'$ )"#$ F-++.$ *0$ *'(3#,0#.$ Sc,/,7&("*$ #)$ ,-A$

?@@QT$ ,'.$ 1!231$ *0$ .#)#(),F-#$ *'$ )"#$ -#&J#/*($ (#--0$

S[,),',F#$#)$,-A$?@@CT5$!,9?$ *0$,$)3,'0(3*4)*+',-$,()*8,)+3$

)",)$ F;$ *)0#-%$ *0$ &',F-#$ )+$ F*'.$ )+$ 6UE$ ,'.A$ *'0)#,.A$

*')#3,()0$ M*)"$ )3,'0(3*4)*+'$ %,()+30$ )+$ /,'*4&-,)#$ )"#$

)3,'0(3*4)*+',-$ /,("*'#3;$ SK*)-*'$ #)$ ,-A$ ?@@BX$ _#'^/#*#3$

,'.$U;F+37A$?@@@T5$[#$%+&'.$)",)$!,9?$)#)"#30$)+$b)0?A$,$

/#/F#3$+%$)"#$b)0$%,/*-;$+%$)3,'0(3*4)*+'$%,()+30$S6*))/#3A$

DCCBTA$)+$,()*8,)#$)"#$1!231$1B$43+/+)#35$!"#$*')#3,()*+'$

+%$ b)0?$ M*)"$ )"#$ 43+/+)#3$ ),J#0$ 4-,(#$ ,)$ ,$ );4*(,-$ b)0$

KKEE:(+'),*'*'7$ F*'.*'7$ 0*)#$ *'$ (-+0#$ 43+9*/*);$ )+$ ,$

GGGEG$ #-#/#')5$ !"#$ GGGEG$ #-#/#')$ M,0$ 0"+M'$ )+$

3#(3&*)$>4?$)+$)"#$43+/+)#3$)+$%+3/$,'$b)0?P>4?$(+/4+0*)#$

#-#/#')$ )+7#)"#3$M*)"$ )"#$b)0$ 3#(+7'*)*+'$/+)*%$ ,--+M*'7$

b)0?$ ,'.$ >4?$ )+$ (++4#3,)*8#-;$ ,()*8,)#$ )"#$ 43+/+)#3$

S6*))/#3$ #)$ ,-A$ ?@@QT5$ !,9?$ *0$ ,F-#$ )+$ %+3/$ ,$ )#3',3;$

(+/4-#9$ M*)"$ F+)"$ )3,'0(3*4)*+'$ %,()+30$ )+$ %&3)"#3$

0)*/&-,)#$ )3,'0(3*4)*+'$ %3+/$ )"#$ 1B$ 43+/+)#3$ S6*))/#3$ #)$

,-A$?@@RT5$$

b)0$ ,'.$ >4?$ F*'.*'7$ 0*)#0$ ,-0+$ 4-,;$ ,$ 3+-#$ *'$ 1B:

.#4#'.#')$ 1!231$ )3,'0(3*4)*+'$ *'$ F3#,0)$ (,'(#3$ (#--05$ Y'$

W6E:Wd:DB?$(#--0A$!K\!:*'.&(#.$)3,'0(3*4)*+'$%3+/$)"#$

1B$ 43+/+)#3$ 3#V&*3#0$ )"#$ 3#04+'0*8#$ #-#/#')0$ %+3$ b)0?A$

>4?$ ,'.$ ,'$ EKEG$ F*'.*'7$ 0*)#A$ M"*("$ M,0$ %+&'.$ )+$

3#(3&*)$ )"#$!K\!$#%%#()+30$>/,.BP>/,.Q$)+$)"#$43+/+)#3$

S_*'.#/,''$ #)$ ,-A$ DCC?T5$ Y'$ )"#$ 43#0#'(#$ +%$ !K\!A$ b)0?$

M,0$ 0"+M'$ )+$ 0;'#37*0)*(,--;$ ,()*8,)#$ )"#$ 1!231$ 1B$

43+/+)#3$ *'$ (+'(#3)$M*)"$ >/,.B5$ Y'$ ,73##/#')$M*)"$ )"*0$

%*'.*'7A$ 0),F-#$ )3,'0%#()*+'$ +%$ W6E:Wd:DB?$ (#--0$ M*)"$

>/,.$ 43+)#*'0$ M#3#$ %+&'.$ )+$ *'(3#,0#$ !K\!:.#4#'.#')$

1!231$ 0#(3#)*+'$ SH,J+'#'$ #)$ ,-A$ DCCDT5$ G+'8#30#-;A$

43#8#')*'7$ !K\!:/#.*,)#.$ >/,.B$ '&(-#,3$ */4+3)$ F;$

*'"*F*)*'7$4B<$WE1$J*',0#$,F+-*0"#.$)"#$!K\!$#%%#()$+'$

1!231$#943#00*+'$SH,J+'#'$#)$,-A$DCCDX$_*'.#/,''$#)$,-A$

DCCB(T5$$

!K\!:.#4#'.#')$ 1!231$ #943#00*+'$ (+&-.$ ,-0+$ F#$

.*/*'*0"#.$ F;$ 1HG$ *'"*F*)+30$ S_*'.#/,''$ #)$ ,-A$ DCC?T5$

1,3)*(&-,3-;A$ 1HG"$ M,0$ %+&'.$ )+$ F#$ */4+3),')$ %+3$ )"#$

!K\!:.#4#'.#')$ ,()*8,)*+'$ +%$ )"#$ 1B$ 43+/+)#3$ *'$ F3#,0)$

(,'(#3$ (#--05$ !"*0$ J*',0#$ *0$ 3#V&*3#.$ )+$ ,--+M$ b)0?$ )+$

,()*8,)#$)"#$1B$43+/+)#3$*'$F3#,0)$(,'(#3$(#--0$S_*'.#/,''$

#)$,-A$DCCB,T$,'.$)+$/,*'),*'$b)0?$43+)#*'$#943#00*+'$*'$,$

8,3*#);$ +%$ (,'(#3$ (#--0$ Sa#))#3$ #)$ ,-A$ DCCQT5$ \&3)"#3$

#8*.#'(#$ %+3$ 1HG0$ F#*'7$ *'8+-8#.$ *'$ 1B:.3*8#'$ 1!231$

#943#00*+'$ *0$ 43+8*.#.$ F;$ 0)&.*#0$ &0*'7$ 4"+3F+-$ #0)#3$

S1WET$ )+$ &43#7&-,)#$ 1!231$ #943#00*+'$ *'$b)0?:.#%*(*#')$

WG\:R$ (#--0$ S_*'.#/,''$ #)$ ,-A$ DCCBFT5$ E$ 0;'#37*0)*($

#%%#()$ F#)M##'$ b)0DA$ ,$ (-+0#$ 3#-,)*8#$ +%$ b)0?A$ ,'.$ 1HG#$

M,0$ %+&'.$ )+$/#.*,)#$ )"#$1WE:*'.&(#.$,()*8,)*+'$+%$ )"#$

1!231$ 1B$ 43+/+)#35$ E7,*'$ )"#$ *')#73*);$ +%$ )"#$ >4?$

F*'.*'7$0*)#$M,0$3#V&*3#.5$$

b)0?$ ,'.P+3$b)0D$",8#$ ,-0+$F##'$ %+&'.$ )+$F#$4+)#')$

,()*8,)+30$ +%$ )"#$ 1!231$ 43+/+)#3$ *'$ 43*/,3;$ "&/,'$

J#3,)*'+(;)#0$ SG"+$ #)$ ,-A$ DCCQTA$ *'$ 1?@$ #/F3;+',-$

(,3(*'+/,$ (#--0$ SH,34#3*#'$ #)$ ,-A$ ?@@RT$ ,'.$ )&/+3*7#'*($

F3#,0)$ #4*)"#-*,-$ (#--$ -*'#$ U>D!DE?$ SG,),*00+'$ #)$ ,-A$

DCCBT5$ Y'$,..*)*+'A$ )"#$b)0$F*'.*'7$0*)#$",0$F##'$3#4+3)#.$

)+$ /#.*,)#$ ,)$ -#,0)$ *'$ 4,3)$ )"#$ #%%#()$ +%$ 3#)*'+*($ ,(*.$

SH,34#3*#'$ #)$ ,-A$ ?@@RT$ ,'.$ ,.#'+8*3&0$ b?E$ +'$ 1B$

43+/+)#3$,()*8*);$ S\+-#;$#)$,-A$?@@@T5$E-0+$0)*/&-,)*+'$+%$

Q=O$


457

PTHrP expression by epidermal growth factor (EGF)-like

factors may involve the Ets binding site (Cho et al, 2004).

EGF and EGF-like factors, such as transforming growth

factor # and amphiregulin, are potent activators of PTHrP

expression in a variety of cells (Allinson and Drucker,

1992; Burton and Knight, 1992; Ferrari et al, 1994; Heath

et al, 1995; Cramer et al, 1996b; Cho et al, 2004). They

are ligands of the EGF receptor (EGF-R, ErbB1) which is

aberrantly expressed in many cancers (Kolibaba and

Druker, 1997) and plays an important role in regulating

proliferation in estrogen receptor-negative breast

carcinoma cells (Biswas et al, 2000).

Ets1 and Ets2 are both involved in carcinogenesis

(Dittmer, 2003; Foos and Hauser, 2004) and are targets of

the Ras/MEK1/Erk1/2 pathway (Yang et al, 1996; Seidel

and Graves, 2002). Activation of this pathway leads to

phosphorylation and superactivation of these Ets proteins.

The Ras/MEK1/Erk1/2 pathway has shown to play a role

in the regulation of PTHrP expression. E.g. in rat Leydig

tumor H-500 cells, activation of the Ras/MEK/Erk

pathway stimulated PTHrP expression (Aklilu et al, 2000)

and, in keratinocytes, dominant negative versions of the

Ras and Raf protein downregulated PTHrP P3 promoter

activity (Cho et al, 2004). In addition, transfection with

Ras alone or in combination with Src increased PTHrP

production in fibroblasts (Li and Drucker, 1994; Motokura

et al, 1995; Aklilu et al, 1997). Also cotransfection of

fibroblasts with Ras and mutant p53 activated PTHrP

expression (Motokura et al, 1995). In particular, the

Ras/mutant p53 cooperative effect might have been

mediated by Ets1, as mutant p53 has been shown to

physically and functionally interact with this Ets protein

(Sampath et al, 2001). Given the importance of Ets1 for

PTHrP expression and the involvement of both proteins in

invasion, it is reasonable to suggest that Ets1 may exert

part of the invasion-promoting function through PTHrP.

B. Other PTHrP regulating factorsA variety of other proteins have been shown to

stimulate PTHrP expression in cancer cells. In lung cancer

cells, PTHrP production is increased in response to tumor

necrosis factor # (TNF#) and interleukin-6 (IL-6) (Rizzoli

et al, 1994). In HTLV-I infected MT-2 leukaemic cells and

in the human lung cancer cell line BEN, PTHrP expression

can be augmented by agents that raise the cAMP level

(Ikeda et al, 1993b; Chilco et al, 1998). Calcitonin and

cAMP have been shown to activate the P1 and the P3

promoter (Chilco et al, 1998). In the P1 promoter, a

cAMP-responsive element (CRE) could be identified that

mediates these effects.

Steriods, such as 1,25-dihydroxyvitamin D3,

dexamethasone and androgens, have been found to inhibit

PTHrP expression in cancer cells on the transcriptional

level (Ikeda et al, 1993a; Inoue et al, 1993; Glatz et al,

1994; Rizzoli et al, 1994; Falzon, 1997; Tovar Sepulveda

and Falzon, 2002; Pizzi et al, 2003). Vitamin D was shown

to affect P3 and upstream PTHrP promoters (Endo et al,

1994). Dexamethasone and non-calcaemic vitamin D

analogues were also demonstrated to inhibit tumor-

dependent hypercalcaemia and to reduce tumor burden in

mice (Endo et al, 1994; Cohen-Solal et al, 1995; El

Abdaimi et al, 1999).

There are conflicting data about the effect of

estrogen, an important mitogen in mammary

carcinogenesis (Keshamouni at al, 2002), on the regulation

of PTHrP expression in breast cancer cells. In MCF-7

cells, both estrogen and anti-estrogen tamoxifen where

shown to increase PTHrP mRNA levels in MCF-7 breast

cancer cells (Funk and Wei, 1998), whereas, in KPL-3C

breast cancer cells, estrogen inhibited and tamoxifen

stimulated PTHrP secretion (Kurebayashi and Sonoo,

1997). Estrogen has also been demonstrated to interfere

with PTHrP action by inhibiting PTHrP-induced bone

resorption (Kanatani et al, 1998).

PTHrP and calcium seem to be linked in several

ways. Not only can PTHrP increase the blood calcium

level and intracellularly activate the calcium-signalling

pathway, but it also can respond to extracellular calcium

(Buchs et al, 2000; Tfelt-Hansen et al, 2003). Extracellular

calcium is an important regulator of proliferation and

differentiation of normal cells. Deregulation of its

receptor, the calcium-sensing receptor (CaR), in cancer

cells can lead to cancer progression (Rodland, 2004). CaR

was shown to be responsible for the calcium-dependent

activation of PTHrP transcription in H-500 cells (Tfelt-

Hansen et al, 2003). CaR has also been found to

upregulate PTHrP synthesis and secretion in astrocytomas,

menigiomas and breast cancer cells (Chattopadhyay et al,

2000; Sanders et al, 2000). Overexpression and activation

of CaR in HEK293 cells revealed that MAP kinases

ERK1/2 and p38 are involved in the CaR effect on PTHrP

expression (MacLeod et al, 2003).

PTHrP expression is also influenced by the

substratum cells are attached to. Depending on the

extracellular matrix protein pancreatic adenocarcinoma

cells were grown on, PTHrP expression was either up- or

downregulated (Grzesiak et al, 2004). Reduced expression

of PTHrP was found when cells were plated on type I and

IV collagen or laminin, whereas higher expression was

observed with fibronectin or vitronectin.

Gene silencing may be another way by which PTHrP

abundance is regulated. Gene silencing can be

epigenetically induced by CpG island methylation which

appear to occur in cancer cells in an increased rate (Jones

and Laird, 1999). In the PTHrP gene, a single CpG island

is located upstream of the P3 promoter (Ganderton et al,

1995; Holt et al, 1993). In lung cancer biopsies, PTHrP

expression was found to be independent of the methylation

status of this CpG island (Ganderton and Briggs, 2000).

However, Methylation of certain CpG dinucleotides

upstream of the CpG island were shown to influence

PTHrP expression in renal carcinoma cell lines (Holt et al,

1993).

PTHrP expression seems also be controlled on the

post-trancriptional level. Von Hippel-Landau tumor

suppressor gene has been demonstrated to negatively

regulate PTHrP in clear cell renal carcinoma via a post-

transcriptional mechanism (Massfelder et al, 2004). In oral

squamous carcinoma cells, TGF" has been shown to

stimulate expression of PTHrP in part by increasing the

stability of its RNA (Sellers et al, 2002). In osteosarcoma


458

cells, serum increased PTHrP expression by both

upregulation of transcription and stabilization of PTHrP

RNA (Falzon, 1996). There is also evidence, that in

prostate cancer, PSA inactivates PTHrP by proteolytic

cleavage (Cramer et al, 1996a; Iwamura et al, 1996).

VII. Concluding remarksOriginally identified as a tumor-derived factor that

induces the paraneoplastic syndrome HHM, it is now

generally accepted that PTHrP also plays a role in

stimulating local osteolysis, thereby, facilitating growth of

metastatic cancer in the bony tissue. In addition, PTHrP

has the potential to regulate proliferation, invasion and

apoptosis in cancer cells in a way that is beneficial for

tumor growth. On the other hand, PTHrP has shown to

have anti-mitogenic effects and to inhibit angiogenesis

(Bakre et al, 2002) suggesting that PTHrP may also act as

an anti-tumor factor. Which of these activities of PTHrP

prevail might depend on the type of tumor and tumor

stage.

While the prognostic value of PTHrP in human

cancer is still unclear, PTHrP may be a useful predictive

marker for anti-PTHrP treatment response in bone

metastasis. A number of attempts have been made to

suppress PTHrP expression in cancer cells. Factors that

downregulate PTHrP transcription, such as vitamin D

analogues and modified guanosine nucleotides, have been

successfully used to inhibit PTHrP expression,

hypercalcaemia, osteolysis and bone metastasis in mice

(El Abdaimi et al, 1999; Gallwitz et al, 2002). PKC

inhibitors, novel anti-cancer drugs that have entered

clinical trials (Roychowdhury and Lahn, 2003), may also

be suitable to attenuate PTHrP synthesis on the

transcriptional level (Lindemann et al, 2001). By a

different mechanism, prostate secretory protein PSP-94

was found to suppress the ability of prostate cancer cells to

synthesize PTHrP, to grow and to form skeletal metastases

in rats (Shukeir et al, 2004). In another approach, PTHrP

activity is inhibited by an anti-PTHrP antibody, originally

shown by Guise et al (1996) to reduce formation of bone

metastasis in tumor-bearing mice and now being

humanized (Sato et al, 2003) for the use in clinical trials.

Further analysis of the mechanism underlying the

regulation of PTHrP expression in cancer is needed to

identify further targets for an anti-PTHrP therapy. It is also

important to identify the PTHrP-responsive genes and to

clarify the role of nuclear PTHrP in order to understand

the action of PTHrP in cancer.

AcknowledgmentsThis work was supported by BMBF grant NBL3

FKZ 6/07.

ReferencesAarts MM, Levy D, He B, Stregger S, Chen T, Richard S and

Henderson JE (1999) Parathyroid hormone-related protein

interacts with RNA. J Biol Chem 274, 4832-4838.

Akino K, Ohtsuru A, Yano H, Ozeki S, Namba H, Nakashima M,

Ito M, Matsumoto T and Yamashita S (1996) Antisense

inhibition of parathyroid hormone-related peptide gene

expression reduces malignant pituitary tumor progression

and metastases in the rat. Cancer Res 56, 77-86.

Aklilu F, Gladu J, Goltzman D and Rabbani SA (2000) Role of

mitogen-activated protein kinases in the induction of

parathyroid hormone-related peptide. Cancer Res 60, 1753-

1760.

Aklilu F, Park M, Goltzman D and Rabbani SA (1997) Induction

of parathyroid hormone-related peptide by the Ras oncogene:

role of Ras farnesylation inhibitors as potential therapeutic

agents for hypercalcemia of malignancy. Cancer Res 57,

4517-4522.

Allinson ET and Drucker DJ (1992) Parathyroid hormone-like

peptide shares features with members of the early response

gene family: rapid induction by serum, growth factors and

cycloheximide. Cancer Res 52, 3103-3109.

Alvarez J, Sohn P, Zeng X, Doetschman T, Robbins DJ and

Serra R (2002) TGF2 mediates the effects of hedgehog on

hypertrophic differentiation and PTHrP expression.

Development 129, 1913-1924.

Amling M, Neff L, Tanaka S, Inoue D, Kuida K, Weir E,

Philbrick WM, Broadus AE and Baron R (1997) Bcl-2 lies

downstream of parathyroid hormone-related peptide in a

signaling pathway that regulates chondrocyte maturation

during skeletal development. J Cell Biol 136, 205-213.

Asadi F, Faraj M, Malakouti S and Kukreja SC (2001) Effect of

parathyroid hormone related protein and dihydrotestosterone

on proliferation and ornithine decarboxylase mRNA in

human prostate cancer cell lines. Int Urol Nephrol 33, 417-

422.

Bakre MM, Zhu Y, Yin H, Burton DW, Terkeltaub R, Deftos LJ

and Varner JA (2002) Parathyroid hormone-related peptide is

a naturally occurring, protein kinase A-dependent

angiogenesis inhibitor. Nat Med 8, 995-1003.

Beier F, Ali Z, Mok D, Taylor AC, Leask T, Albanese C, Pestell

RG and LuValle P (2001) TGF" and PTHrP control

chondrocyte proliferation by activating cyclin D1 expression.

Mol Biol Cell 12, 3852-3863.

Bendre MS, Gaddy-Kurten D, Mon-Foote T, Akel NS, Skinner

RA, Nicholas RW and Suva LJ (2002) Expression of

interleukin 8 and not parathyroid hormone-related protein by

human breast cancer cells correlates with bone metastasis in

vivo. Cancer Res 62, 5571-5579.

Bendre MS, Montague DC, Peery T, Akel NS, Gaddy D and

Suva LJ (2003) Interleukin-8 stimulation of

osteoclastogenesis and bone resorption is a mechanism for

the increased osteolysis of metastatic bone disease. Bone 33,

28-37.

Benelli R, Peissel B, Manenti G, Gariboldi M, Vanzetto C,

Albini A and Dragani TA (2003) Allele-specific patterns of

the mouse parathyroid hormone-related protein: influences

on cell adhesion and migration. Oncogene 22, 7711-7715.

Birch MA, Carron JA, Scott M, Fraser WD and Gallagher JA

(1995) Parathyroid hormone (PTH)/PTH-related protein

(PTHrP) receptor expression and mitogenic responses in

human breast cancer cell lines. Br J Cancer 72, 90-95.

Biswas DK, Cruz AP, Gansberger E and Pardee AB (2000)

Epidermal growth factor-induced nuclear factor kappa B

activation: A major pathway of cell-cycle progression in

estrogen-receptor negative breast cancer cells. Proc Natl

Acad Sci U S A 97, 8542-8547.

Blobe GC, Shiemann WP and Lodish HF (2000) Role of

Transforming growth factor in Human Disease. N. Eng. J.

Med. 342, 1350-1358.

Bouizar Z, Spyratos F and De vernejoul MC (1999) The

parathyroid hormone-related protein (PTHrP) gene: use of

downstream TATA promotor and PTHrP 1-139 coding

pathways in primary breast cancers vary with the occurrence

of bone metastasis. J Bone Miner Res 14, 406-414.


459

Buchs N, Manen D, Bonjour JP and Rizzoli R (2000) Calcium

stimulates parathyroid hormone-related protein production in

Leydig tumor cells through a putative cation-sensing

mechanism. Eur J Endocrinol 142, 500-505.

Burton PB and Knight DE (1992) Parathyroid hormone-related

peptide can regulate the growth of human lung cancer cells

and may form part of an autocrine TGF-" loop. FEBS Lett

305, 228-232.

Cataisson C, Gordon J, Roussiere M, Abdalkhani A, Lindemann

RK, Dittmer J, Foley J and Bouizar Z (2003) Ets-1 activates

parathyroid hormone-related protein gene expression in

tumorigenic breast epithelial cells. Mol. Cell. Endocrinol

204, 155-168

Cataisson C, Lieberherr M, Cros M, Gauville C, Graulet AM,

Cotton J, Calvo F, de Vernejoul MC, Foley J and Bouizar Z

(2000) Parathyroid hormone-related peptide stimulates

proliferation of highly tumorigenic human SV40-

immortalized breast epithelial cells. J Bone Miner Res 15,

2129-2139.

Chattopadhyay N, Evliyaoglu C, Heese O, Carroll R, Sanders J,

Black P and Brown EM (2000) Regulation of secretion of

PTHrP by Ca(2+)-sensing receptor in human astrocytes,

astrocytomas and meningiomas. Am J Physiol Cell Physiol

279, C691-C699.

Chen HL, Demiralp B, Schneider A, Koh AJ, Silve C, Wang CY

and McCauley LK (2002) Parathyroid hormone and

parathyroid hormone-related protein exert both pro- and anti-

apoptotic effects in mesenchymal cells. J Biol Chem 277,

19374-19381.

Chilco PJ, Leopold V and Zajac JD (1998) Differential

regulation of the parathyroid hormone-related protein gene

P1 and P3 promoters by cAMP. Mol Cell Endocrinol 138,

173-184.

Cho YM, Lewis DA, Koltz PF, Richard V, Gocken TA, Rosol

TJ, Konger RL, Spandau DF and Foley J (2004) Regulation

of parathyroid hormone-related protein gene expression by

epidermal growth factor-family ligands in primary human

keratinocytes. J Endocrinol 181, 179-190.

Cingolani G, Bednenko J, Gillespie MT and Gerace L (2002)

Molecular basis for the recognition of a nonclassical nuclear

localization signal by importin ". Mol Cell 10, 1345-1353.

Cohen-Solal ME, Bouizar Z, Denne MA, Graulet AM, Gueris J,

Bracq S, Jullienne A and de Vernejoul MC (1995) 1,25

dihydroxyvitamin D and dexamethasone decrease in vivo

Walker carcinoma growth, but not parathyroid hormone

related protein secretion. Horm Metab Res 27, 403-407.

Conlan LA, Martin TJ and Gillespie MT (2002) The COOH-

terminus of parathyroid hormone-related protein (PTHrP)

interacts with "-arrestin 1B. FEBS Lett 527, 71-75.

Cornish J, Callon KE, Nicholson GC and Reid IR (1997)

Parathyroid hormone-related protein-(107-139) inhibits bone

resorption in vivo. Endocrinology 138, 1299-1304.

Cramer SD, Chen Z and Peehl DM (1996a) Prostate specific

antigen cleaves parathyroid hormone-related protein in the

PTH-like domain: inactivation of PTHrP-stimulated cAMP

accumulation in mouse osteoblasts. J Urol 156, 526-531.

Cramer SD, Peehl DM, Edgar MG, Wong ST, Deftos LJ and

Feldman D (1996b) Parathyroid hormone--related protein

(PTHrP) is an epidermal growth factor-regulated secretory

product of human prostatic epithelial cells. Prostate 29, 20-

29.

de la Mata J, Uy HL, Guise TA, Story B, Boyce BF, Mundy GR

and Roodman GD (1995) Interleukin-6 enhances

hypercalcemia and bone resorption mediated by parathyroid

hormone-related protein in vivo. J Clin Invest 95, 2846-

2852.

dePapp AE and Stewart AF (1993) Parathyroid hormone-related

protein: a peptide of diverse physiologic functions. Trends


Diefenbach-Jagger H, Brenner C, Kemp BE, Baron W, McLean

J, Martin TJ, and Moseley JM (1995) Arg21 is the preferred

kexin cleavage site in parathyroid-hormone-related protein.

Eur J Biochem 229, 91-8.

Ditmer LS, Burton DW, and Deftos LJ (1996) Elimination of the

carboxy-terminal sequences of parathyroid hormone-related

protein 1-173 increases production and secretion of the

truncated forms. Endocrinology 137, 1608-17.

Dittmer J (2003) The Biology of the Ets1 Proto-Oncogene. Mol

Cancer 2, 29.

Dittmer J, Gegonne A, Gitlin SD, Ghysdael J and Brady JN

(1994) Regulation of parathyroid hormone-related protein

(PTHrP) gene expression. Sp1 binds through an inverted

CACCC motif and regulates promoter activity in cooperation

with Ets1. J Biol Chem 269, 21428-21434.

Dittmer J, Gitlin SD, Reid RL and Brady JN (1993)

Transactivation of the P2 promoter of parathyroid hormone-

related protein by human T-cell lymphotropic virus type I

Tax1: evidence for the involvement of transcription factor

Ets1. J Virol 67, 6087-6095.

Dittmer J, Pise-Masison CA, Clemens KE, Choi KS and Brady

JN (1997) Interaction of human T-cell lymphotropic virus

type I Tax, Ets1 and Sp1 in transactivation of the PTHrP P2

promoter. J Biol Chem 272, 4953-4958.

Dougherty KM, Blomme EA, Koh AJ, Henderson JE, Pienta KJ,

Rosol TJ and McCauley LK (1999) Parathyroid hormone-

related protein as a growth regulator of prostate carcinoma.

Cancer Res 59, 6015-6022.

Downey SE, Hoyland J, Freemont AJ, Knox F, Walls J and

Bundred NJ (1997) Expression of the receptor for

parathyroid hormone-related protein in normal and malignant

breast tissue. J Pathol 183, 212-217.

Dunbar ME, Young P, Zhang JP, McCaughern-Carucci J, Lanske

B, Orloff JJ, Karaplis A, Cunha G and Wysolmerski JJ

(1998) Stromal cells are critical targets in the regulation of

mammary ductal morphogenesis by parathyroid hormone-

related protein. Dev Biol 203, 75-89.

El Abdaimi K, Papavasiliou V, Rabbani SA, Rhim JS, Goltzman

D and Kremer R (1999) Reversal of hypercalcemia with the

vitamin D analogue EB1089 in a human model of squamous

cancer. Cancer Res 59, 3325-3328.

Endo K, Ichikawa F, Uchiyama Y, Katsumata K, Ohkawa H,

Kumaki K, Ogata E and Ikeda K (1994) Evidence for the

uptake of a vitamin D analogue (OCT) by a human

carcinoma and its effect of suppressing the transcription of

parathyroid hormone-related peptide gene in vivo. J Biol

Chem 269, 32693-32699.

Falzon M (1996) Serum stimulation of parathyroid hormone-

related peptide gene expression in ROS 17/2.8 osteosarcoma

cells through transcriptional and posttranscriptional

mechanisms. Endocrinology 137, 3681-3688.

Falzon M (1997) The noncalcemic vitamin D analogues EB1089

and 22-oxacalcitriol interact with the vitamin D receptor and

suppress parathyroid hormone-related peptide gene

expression. Mol Cell Endocrinol 127, 99-108.

Falzon M and Du P (2000) Enhanced growth of MCF-7 breast

cancer cells overexpressing parathyroid hormone-related

peptide. Endocrinology 141, 1882-1892.

Fenton AJ, Martin TJ and Nicholson GC (1994) Carboxyl-

terminal parathyroid hormone-related protein inhibits bone

resorption by isolated chicken osteoclasts. J Bone Miner

Res 9, 515-519.

Ferrari SL, Behar V, Chorev M, Rosenblatt M and Bisello A

(1999) Endocytosis of ligand-human parathyroid hormone

receptor 1 complexes is protein kinase C-dependent and


460

involves "-arrestin2. Real-time monitoring by fluorescence

microscopy. J Biol Chem 274, 29968-29975.

Ferrari SL, Rizzoli R and Bonjour JP (1994) Effects of epidermal

growth factor on parathyroid hormone-related protein

production by mammary epithelial cells. J Bone Miner Res

9, 639-644.

Fiaschi-Taesch N, Takane KK, Masters S, Lopez-Talavera JC

and Stewart AF (2004) Parathyroid hormone-related protein

as a regulator of pRb and the cell cycle in arterial smooth

muscle. Circulation 110, 177-185.

Fiaschi-Taesch NM and Stewart AF (2003) Minireview:

parathyroid hormone-related protein as an intracrine factor--

trafficking mechanisms and functional consequences.

Endocrinology 144, 407-411.

Foley J, Wysolmerski JJ, Missero C, King CS and Philbrick WM

(1999) Regulation of parathyroid hormone-related protein

gene expression in murine keratinocytes by E1A isoforms: a

role for basal promoter and Ets-1 site. Mol Cell Endocrinol

156, 13-23.

Franchini G (1995) Molecular mechanisms of human T-cell

leukemia/lymphotropic virus type I infection. Blood 86,

3619-3639.

Fujita T, Meguro T, Fukuyama R, Nakamuta H and Koida M

(2002) New signaling pathway for parathyroid hormone and

cyclic AMP action on extracellular-regulated kinase and cell

proliferation in bone cells. Checkpoint of modulation by

cyclic AMP. J Biol Chem 277, 22191-22200.

Funk JL, and Wei H (1998) Regulation of parathyroid hormone-

related protein expression in MCF-7 breast carcinoma cells

by estrogen and antiestrogens. Biochem Biophys Res

Commun 251, 849-54.

Gallwitz WE, Guise TA and Mundy GR (2002) Guanosine

nucleotides inhibit different syndromes of PTHrP excess

caused by human cancers in vivo. J Clin Invest 110, 1559-

1572.

Ganderton RH and Briggs RS (2000) Increased upstream

methylation has no influence on the overexpression of the

parathyroid hormone-related protein gene in squamous cell

carcinoma of the lung. Eur J Cancer 36, 2128-2136.

Ganderton RH, Day IN and Briggs RS (1995) Patterns of DNA

methylation of the parathyroid hormone-related protein gene

in human lung carcinoma. Eur J Cancer 31A, 1697-1700.

Glatz JA, Heath JK, Southby J, O'Keeffe LM, Kiriyama T,

Moseley JM, Martin TJ and Gillespie MT (1994)

Dexamethasone regulation of parathyroid hormone-related

protein (PTHrP) expression in a squamous cancer cell line.

Mol Cell Endocrinol 101, 295-306.

Goltzman D, Karaplis AC, Kremer R and Rabbani SA (2000)

Molecular basis of the spectrum of skeletal complications of

neoplasia. Cancer 88, 2903-2908.

Goomer RS, Johnson KA, Burton DW, Amiel D, Maris TM,

Gurjal A, Deftost LJ and Terkeltaub R (2000) The tetrabasic

KKKK(147-150) motif determines intracrine regulatory

effects of PthrP 1-173 on chondrocyte PPi metabolism and

matrix synthesis. Endocrinology 141, 4613-4622.

Grill V, Rankin W and Martin TJ (1998) Parathyroid hormone-

related protein (PTHrP) and hypercalcaemia. Eur J Cancer

34, 222-229.

Grzesiak JJ, Clopton P, Chalberg C, Smith K, Burton DW,

Silletti S, Moossa AR, Deftos LJ and Bouvet M (2004) The

extracellular matrix differentially regulates the expression of

PTHrP and the PTH/PTHrP receptor in FG pancreatic cancer

cells. Pancreas 29, 85-92.

Guise TA (1997) Parathyroid hormone-related protein and bone

metastases. Cancer 80, 1572-1580.

Guise TA, Yin JJ, Taylor SD, Kumagai Y, Dallas M, Boyce BF,

Yoneda T and Mundy GR (1996) Evidence for a causal role

of parathyroid hormone-related protein in the pathogenesis of

human breast cancer-mediated osteolysis. J Clin Invest 98,

1544-1549.

Guise TA, Yoneda T, Yates AJ and Mundy GR (1993) The

combined effect of tumor-produced parathyroid hormone-

related protein and transforming growth factor-a enhance

hypercalcemia in vivo and bone resorption in vitro. J Clin


Gujral A, Burton DW, Terkeltaub R and Deftos LJ (2001)

Parathyroid hormone-related protein induces interleukin 8

production by prostate cancer cells via a novel intracrine

mechanism not mediated by its classical nuclear localization

sequence. Cancer Res 61, 2282-2288.

Harbeck N, Schmitt M, Kates RE, Kiechle M, Zemzoum I,

Janicke F and Thomssen C (2002) Clinical utility of

urokinase-type plasminogen activator and plasminogen

activator inhibitor-1 determination in primary breast cancer

tissue for individualized therapy concepts. Clin Breast

Cancer 3, 196-200.

Hastings RH, Araiza F, Burton DW, Bedley M and Deftos LJ

(2004) Parathyroid Hormone-Related Protein Regulates

Apoptosis in Lung Cancer Cells through Protein Kinase A.

Am J Physiol Cell Physiol, in press

Hastings RH, Araiza F, Burton DW, Zhang L, Bedley M and

Deftos LJ (2003) Parathyroid hormone-related protein

ameliorates death receptor-mediated apoptosis in lung cancer

cells. Am J Physiol Cell Physiol 285, C1429-C1436.

Heath JK, Southby J, Fukumoto S, O'Keeffe LM, Martin TJ and

Gillespie MT (1995) Epidermal growth factor-stimulated

parathyroid hormone-related protein expression involves

increased gene transcription and mRNA stability. Biochem J

307 ( Pt 1), 159-167.

Henderson JE, Amizuka N, Warshawsky H, Biasotto D, Lanske

BM, Goltzman D and Karaplis AC (1995) Nucleolar

localization of parathyroid hormone-related peptide enhances

survival of chondrocytes under conditions that promote

apoptotic cell death. Mol Cell Biol 15, 4064-4075.

Henderson M, Danks J, Moseley J, Slavin J, Harris T, McKinlay

M, Hopper J and Martin T (2001) Parathyroid hormone-

related protein production by breast cancers, improved

survival and reduced bone metastases. J Natl Cancer Inst

93, 234-237.

Hiraki A, Ueoka H, Bessho A, Segawa Y, Takigawa N, Kiura K,

Eguchi K, Yoneda T, Tanimoto M and Harada M (2002)

Parathyroid hormone-related protein measured at the time of

first visit is an indicator of bone metastases and survival in

lung carcinoma patients with hypercalcemia. Cancer 95,

1706-1713.

Hoey RP, Sanderson C, Iddon J, Brady G, Bundred NJ and

Anderson NG (2003) The parathyroid hormone-related

protein receptor is expressed in breast cancer bone

metastases and promotes autocrine proliferation in breast

carcinoma cells. Br J Cancer 88, 567-573.

Holt EH, Vasavada RC, Bander NH, Broadus AE and Philbrick

WM (1993) Region-specific methylation of the parathyroid

hormone-related peptide gene determines its expression in

human renal carcinoma cell lines. J Biol Chem 268, 20639-

20645.

Horiuchi N, Caulfield MP, Fisher JE, Goldman ME, McKee RL,

Reagan JE, Levy JJ, Nutt RF, Rodan SB, Schofield TL, et al

(1987) Similarity of synthetic peptide from human tumor to

parathyroid hormone in vivo and in vitro. Science 238, 1566-

1568.

Ikeda K, Charles L, Weir EC, Mangin M and Broadus AE

(1993a) Transcriptional regulation of the parathyroid

hormone-related gene by glucocorticoids and vitamin D in a

human C-cell line. J Biol Chem 264, 15743-15746.

Ikeda K, Okazaki R, Inoue D, Ogata E and Matsumoto T (1993b)

Transcription of the gene for parathyroid hormone-related


461

peptide from the human is activated through a cAMP-

dependent pathway by prostaglandin E1 in HTLV-I-infected

T cells. J Biol Chem 268, 1174-1179.

Inoue D, Matsumoto T, Ogata E and Ikeda K (1993) 22-

Oxacalcitriol, a noncalcemic analogue of calcitriol,

suppresses both cell proliferation and parathyroid hormone-

related peptide gene expression in human T cell

lymphotrophic virus, type I-infected T cells. J Biol Chem

268, 16730-16736.

Iwamura M, Hellman J, Cockett AT, Lilja H and Gershagen S

(1996) Alteration of the hormonal bioactivity of parathyroid

hormone-related protein (PTHrP) as a result of limited

proteolysis by prostate-specific antigen. Urology 48, 317-

325.

Jones PA and Laird PW (1999) Cancer epigenetics comes of age.

Nat Genet 21, 163-167.

Juppner H, Abou-Samra AB, Freeman M, Kong XF, Schipani E,

Richards J, Kolakowski LF, Jr., Hock J, Potts JT, Jr.,

Kronenberg HM, et al (1991) A G protein-linked receptor for

parathyroid hormone and parathyroid hormone-related

peptide. Science 254, 1024-1026.

Kakonen SM and Mundy GR (2003) Mechanisms of osteolytic

bone metastases in breast carcinoma. Cancer 97, 834-839.

Kakonen SM, Selander KS, Chirgwin JM, Yin JJ, Burns S,

Rankin WA, Grubbs BG, Dallas M, Cui Y and Guise TA

(2002) Transforming growth factor-" stimulates parathyroid

hormone-related protein and osteolytic metastases via Smad

and mitogen-activated protein kinase signaling pathways. J

Biol Chem 277, 24571-24578.

Kanatani M, Sugimoto T, Takahashi Y, Kaji H, Kitazawa R, and

Chihara K (1998) Estrogen via the estrogen receptor blocks

cAMP-mediated parathyroid hormone (PTH)-stimulated

osteoclast formation. J Bone Miner Res 13, 854-62.

Karaplis AC and Deckelbaum RA (1998) Role of PTHrP and

PTH-1 receptor in endochondral bone development. Front

Biosci 3, D795-D803.

Karaplis AC, Luz A, Glowacki J, Bronson RT, Tybulewicz VL,

Kronenberg HM and Mulligan RC (1994) Lethal skeletal

dysplasia from targeted disruption of the parathyroid

hormone-related peptide gene. Genes Dev 8, 277-289.

Karp SJ, Schipani E, St-Jacques B, Hunzelman J, Kronenberg H

and McMahon AP (2000) Indian hedgehog coordinates

endochondral bone growth and morphogenesis via

parathyroid hormone related-protein-dependent and -

independent pathways. Development 127, 543-548.

Karperien M, Farih-Sips H, Lowik CW, de Laat SW, Boonstra J

and Defize LH (1997) Expression of the parathyroid

hormone-related peptide gene in retinoic acid-induced

differentiation: involvement of ETS and Sp1. Mol

Endocrinol 11, 1435-1448.

Kawashima-Ohya Y, Satakeda H, Kuruta Y, Kawamoto T, Yan

W, Akagawa Y, Hayakawa T, Noshiro M, Okada Y,

Nakamura S and Kato Y (1998) Effects of parathyroid

hormone (PTH) and PTH-related peptide on expressions of

matrix metalloproteinase-2, -3 and -9 in growth plate

chondrocyte cultures. Endocrinology 139, 2120-2127.

Kemp BE, Moseley JM, Rodda CP, Ebeling PR, Wettenhall RE,

Stapleton D, Diefenbach-Jagger H, Ure F, Michelangeli VP,

Simmons HA, et al (1987) Parathyroid hormone-related

protein of malignancy: active synthetic fragments. Science

238, 1568-1570.

Keshamouni VG, Mattingly RR, and Reddy KB (2002)

Mechanism of 17-"-estradiol-induced Erk1/2 activation in

breast cancer cells. A role for HER2 AND PKC-delta. J Biol

Chem 277, 22558-65.

Kitazawa S and Kitazawa R (2002) RANK ligand is a

prerequisite for cancer-associated osteolytic lesions. J Pathol

198, 228-236.

Kobayashi T, Chung UI, Schipani E, Starbuck M, Karsenty G,

Katagiri T, Goad DL, Lanske B and Kronenberg HM (2002)

PTHrP and Indian hedgehog control differentiation of growth

plate chondrocytes at multiple steps. Development 129,

2977-2986.

Kolibaba KS and Druker BJ (1997) Protein tyrosine kinases and

cancer. Biochim Biophys Acta 1333, F217-F248.

Kurebayashi J, and Sonoo H (1997) Parathyroid hormone-related

protein secretion is inhibited by oestradiol and stimulated by

antioestrogens in KPL-3C human breast cancer cells. Br J

Cancer 75, 1819-25.

Lam MH, Briggs LJ, Hu W, Martin TJ, Gillespie MT and Jans

DA (1999a) Importin " recognizes parathyroid hormone-

related protein with high affinity and mediates its nuclear

import in the absence of importin. J Biol Chem 274, 7391-

7398.

Lam MH, House CM, Tiganis T, Mitchelhill KI, Sarcevic B,

Cures A, Ramsay R, Kemp BE, Martin TJ and Gillespie MT

(1999b) Phosphorylation at the cyclin-dependent kinases site

(Thr85) of parathyroid hormone-related protein negatively

regulates its nuclear localization. J Biol Chem 274, 18559-

18566.

Lam MH, Olsen SL, Rankin WA, Ho PW, Martin TJ, Gillespie

MT and Moseley JM (1997) PTHrP and cell division:

expression and localization of PTHrP in a keratinocyte cell

line (HaCaT) during the cell cycle. J Cell Physiol 173, 433-

446.

Lenzmeier BA and Nyborg JK (1999) Molecular mechanisms of

viral transcription and cellular deregulation associated with

the HTLV-I Tax protein. Gene Ther Mol Biol 3, 327-345.

Li X and Drucker DJ (1994) Parathyroid hormone-related

peptide is a downstream target for ras and src activation. J

Biol Chem 269, 6263-6266.

Lindemann RK, Ballschmieter P, Nordheim A and Dittmer J

(2001) Transforming growth factor " regulates parathyroid

hormone-related protein expression in MDA-MB-231 breast

cancer cells through a novel Smad/Ets synergism. J Biol

Chem 276, 46661-46670.

Lindemann RK, Braig M, Ballschmieter P, Guise TA, Nordheim

A and Dittmer J (2003a) Protein kinase C regulates Ets1

transcriptional activity in invasive breast cancer cells. Int J

Oncol 22, 799-805.

Lindemann RK, Braig M, Hauser CA, Nordheim A and Dittmer J

(2003b) Ets2 and PKCepsilon are important regulators of

parathyroid hormone-related protein expression in MCF-7

breast cancer cells. Biochem J 372, 787-797.

Lindemann RK, Nordheim A and Dittmer J (2003c) Interfering

with TGF"-induced Smad3 nuclear accumulation

differentially affects TGF"-dependent gene expression. Mol

Cancer 2, 20.

Linforth R anderson N, Hoey R, Nolan T, Downey S, Brady G,

Ashcroft L and Bundred N (2002) Coexpression of

parathyroid hormone related protein and its receptor in early

breast cancer predicts poor patient survival. Clin Cancer

Res 8, 3172-3177.

Luparello C, Romanotto R, Tipa A, Sirchia R, Olmo N, Lopez de

Silanes I, Turnay J, Lizarbe MA and Stewart AF (2001)

Midregion parathyroid hormone-related protein inhibits

growth and invasion in vitro and tumorigenesis in vivo of

human breast cancer cells. J Bone Miner Res 16, 2173-

2181.

Luparello C, Sirchia R and Pupello D (2003) PTHrP [67-86]

regulates the expression of stress proteins in breast cancer

cells inducing modifications in urokinase-plasminogen

activator and MMP-1 expression. J Cell Sci 116, 2421-2430.

MacLean HE, Guo J, Knight MC, Zhang P, Cobrinik D and

Kronenberg HM (2004) The cyclin-dependent kinase


462

inhibitor p57(Kip2) mediates proliferative actions of PTHrP

in chondrocytes. J Clin Invest 113, 1334-1343.

MacLeod RJ, Chattopadhyay N and Brown EM (2003) PTHrP

stimulated by the calcium-sensing receptor requires MAP

kinase activation. Am J Physiol Endocrinol Metab 284,

E435-E442.

Maioli E and Fortino V (2004a) The complexity of parathyroid

hormone-related protein signalling. Cell Mol Life Sci 61,

257-262.

Maioli E and Fortino V (2004b) PTHrP on MCF-7 breast cancer

cells: a growth factor or an antimitogenic peptide? Br J

Cancer 90, 1293-1294

Manenti G, Peissel B, Gariboldi M, Falvella FS, Zaffaroni D,

Allaria B, Pazzaglia S, Rebessi S, Covelli V, Saran A and

Dragani TA (2000) A cancer modifier role for parathyroid

hormone-related protein. Oncogene 19, 5324-5328.

Mangin M, Ikeda K, Dreyer BE and Broadus AE (1990)

Identification of an up-stream promoter of the human

parathyroid hormone-related peptide gene. Mol Endocrinol

4, 851-858.

Mannstadt M, Juppner H and Gardella TJ (1999) Receptors for

PTH and PTHrP: their biological importance and functional

properties. Am J Physiol 277, F665-F675.

Martin TJ (2002) Manipulating the environment of cancer cells

in bone: a novel therapeutic approach. J Clin Invest 110,

1399-1401.

Martin TJ, Moseley JM and Gillespie MT (1991) Parathyroid

hormone-related protein: biochemistry and molecular

biology. Crit Rev Biochem Mol Biol 26, 377-395.

Massfelder T, Dann P, Wu TL, Vasavada R, Helwig JJ and

Stewart AF (1997) Opposing mitogenic and anti-mitogenic

actions of parathyroid hormone-related protein in vascular

smooth muscle cells: a critical role for nuclear targeting.


Massfelder T, Lang H, Schordan E, Lindner V, Rothhut S,

Welsch S, Simon-Assmann P, Barthelmebs M, Jacqmin D

and Helwig JJ (2004) Parathyroid hormone-related protein is

an essential growth factor for human clear cell renal

carcinoma and a target for the von Hippel-Lindau tumor

suppressor gene. Cancer Res 64, 180-188.

Miki T, Yano S, Hanibuchi M and Sone S (2000) Bone

metastasis model with multiorgan dissemination of human

small-cell lung cancer (SBC-5) cells in natural killer cell-

depleted SCID mice. Oncol Res 12, 209-217.

Miki T, Yano S, Hanibuchi M, Kanematsu T, Muguruma H and

Sone S (2004) Parathyroid hormone-related protein (PTHrP)

is responsible for production of bone metastasis, but not

visceral metastasis, by human small cell lung cancer SBC-5

cells in natural killer cell-depleted SCID mice. Int J Cancer

108, 511-515.

Morgan H, Tumber A and Hill PA (2004) Breast cancer cells

induce osteoclast formation by stimulating host IL-11

production and downregulating granulocyte/macrophage

colony-stimulating factor. Int J Cancer 109, 653-660.

Moseley JM and Gillespie MT (1995) Parathyroid hormone-

related protein. Crit Rev Clin Lab Sci 32, 299-343.

Motokura T, Endo K, Kumaki K, Ogata E and Ikeda K (1995)

Neoplastic transformation of normal rat embryo fibroblasts

by a mutated p53 and an activated ras oncogene induces

parathyroid hormone-related peptide gene expression and

causes hypercalcemia in nude mice. J Biol Chem 270,

30857-30861.

Naik P, Karrim J and Hanahan D (1996) The rise and fall of

apoptosis during multistage tumorigenesis: down-modulation

contributes to tumor progression from angiogenic

progenitors. Genes Dev 10, 2105-2116.

Nishihara M, Ito M, Tomioka T, Ohtsuru A, Taguchi T and

Kanematsu T (1999) Clinicopathological implications of

parathyroid hormone-related protein in human colorectal

tumours. J Pathol 187, 217-222.

Nugoli M, Chuchana P, Vendrell J, Orsetti B, Ursule L, Nguyen

C, Birnbaum D, Douzery EJ, Cohen P and Theillet C (2003)

Genetic variability in MCF-7 sublines: evidence of rapid

genomic and RNA expression profile modifications. BMC

Cancer 3, 13.

Orloff JJ, Ganz MB, Nathanson MH, Moyer MS, Kats Y,

Mitnick M, Behal A, Gasalla-Herraiz J and Isales CM (1996)

A midregion parathyroid hormone-related peptide mobilizes

cytosolic calcium and stimulates formation of inositol

trisphosphate in a squamous carcinoma cell line.


Pasquini GM, Davey RA, Ho PW, Michelangeli VP, Grill V,

Kaczmarczyk SJ and Zajac JD (2002) Local secretion of

parathyroid hormone-related protein by an osteoblastic

osteosarcoma (UMR 106-01) cell line results in growth

inhibition. Bone 31, 598-605.

Philbrick WM, Wysolmerski JJ, Galbraith S, Holt E, Orloff JJ,

Yang KH, Vasavada RC, Weir EC, Broadus AE and Stewart

AF (1996) Defining the roles of parathyroid hormone-related

protein in normal physiology. Physiol Rev 76, 127-173.

Pizzi H, Gladu J, Carpio L, Miao D, Goltzman D and Rabbani

SA (2003) Androgen regulation of parathyroid hormone-

related peptide production in human prostate cancer cells.


Powell GJ, Southby J, Danks JA, Stillwell RG, Hayman JA,

Henderson MA, Bennett RC and Martin TJ (1991)

Localization of parathyroid hormone-related protein in breast

cancer metastases: increased incidence in bone compared

with other sites. Cancer Res 51, 3059-3061.

Price JT, Bonovich MT and Kohn EC (1997) The biochemistry

of cancer dissemination. Crit Rev Biochem Mol Biol 32,

175-253.

Rabbani SA, Gladu J, Liu B and Goltzman D (1995) Regulation

in vivo of the growth of Leydig cell tumors by antisense

ribonucleic acid for parathyroid hormone-related peptide.


Rankin W, Grill V and Martin TJ (1997) Parathyroid hormone-

related protein and hypercalcemia. Cancer 80, 1564-1571.

Rizzoli R, Feyen JH, Grau G, Wohlwend A, Sappino AP and

Bonjour JP (1994) Regulation of parathyroid hormone-

related protein production in a human lung squamous cell

carcinoma line. J Endocrinol 143, 333-341.

Roberts AB, and Wakefield LM (2003) The two faces of

transforming growth factor _ in carcinogenesis. Proc Natl

Acad Sci U S A 100, 8621-3.

Rodland KD (2004) The role of the calcium-sensing receptor in

cancer. Cell Calcium 35, 291-295.

Roychowdhury D and Lahn M (2003) Antisense therapy directed

to protein kinase C (Affinitak, LY900003/ISIS 3521):

potential role in breast cancer. Semin Oncol 30, 30-33.

Sampath J, Sun D, Kidd VJ, Grenet J, Gandhi A, Shapiro LH,

Wang Q, Zambetti GP and Schuetz JD (2001) Mutant p53

cooperates with ETS and selectively up-regulates human

MDR1 not MRP1. J Biol Chem 276, 39359-39367.

Sanders JL, Chattopadhyay N, Kifor O, Yamaguchi T, Butters

RR and Brown EM (2000) Extracellular calcium-sensing

receptor expression and its potential role in regulating

parathyroid hormone-related peptide secretion in human

breast cancer cell lines. Endocrinology 141, 4357-4364.

Sato K, Onuma E, Yocum RC, and Ogata E (2003) Treatment of

malignancy-associated hypercalcemia and cachexia with

humanized anti-parathyroid hormone-related protein

antibody. Semin Oncol 30, 167-73.

Seidel JJ and Graves BJ (2002) An ERK2 docking site in the

Pointed domain distinguishes a subset of ETS transcription

factors. Genes Dev 16, 127-137.


463

Sellers RS, Capen CC and Rosol TJ (2002) Messenger RNA

stability of parathyroid hormone-related protein regulated by

transforming growth factor-"1. Mol Cell Endocrinol 188,

37-46.

Shaw LM, Rabinovitz I, Wang HH, Toker A and Mercurio AM

(1997) Activation of phosphoinositide 3-OH kinase by the

6"4 integrin promotes carcinoma invasion. Cell 91, 949-60.

Shen X and Falzon M (2003) Parathyroid hormone-related

protein upregulates integrin expression via an intracrine

pathway in PC-3 prostate cancer cells. Regul Pept 113, 17-

29.

Shen X, Qian L and Falzon M (2004) PTH-related protein

enhances MCF-7 breast cancer cell adhesion, migration and

invasion via an intracrine pathway. Exp Cell Res 294, 420-

433.

Shukeir N, Arakelian A, Chen G, Garde S, Ruiz M, Panchal C

and Rabbani SA (2004) A synthetic 15-mer peptide

(PCK3145) derived from prostate secretory protein can

reduce tumor growth, experimental skeletal metastases and

malignancy-associated hypercalcemia. Cancer Res 64,

5370-5377.

Soifer NE, Dee KE, Insogna KL, Burtis WJ, Matovcik LM, Wu

TL, Milstone LM, Broadus AE, Philbrick WM and Stewart

AF (1992) Parathyroid hormone-related protein. Evidence

for secretion of a novel mid-region fragment by three

different cell types. J Biol Chem 267, 18236-18243.

Southby J, O'Keeffe LM, Martin TJ and Gillespie MT (1995)

Alternative promoter usage and mRNA splicing pathways for

parathyroid hormone-related protein in normal tissues and

tumours. Br J Cancer 72, 702-707.

Strewler GJ (2000) The physiology of parathyroid hormone-

related protein. N Engl J Med 342, 177-185.

Suva LJ, Mather KA, Gillespie MT, Webb GC, Ng KW,

Winslow GA, Wood WI, Martin TJ and Hudson PJ (1989)

Structure of the 5' flanking region of the gene encoding

human parathyroid-hormone-related protein (PTHrP). Gene

77, 95-105.

Suva LJ, Winslow GA, Wettenhall RE, Hammonds RG, Moseley

JM, Diefenbach-Jagger H, Rodda CP, Kemp BE, Rodriguez

H, Chen EY, et al (1987) A parathyroid hormone-related

protein implicated in malignant hypercalcemia: cloning and

expression. Science 237, 893-896.

Tfelt-Hansen J, MacLeod RJ, Chattopadhyay N, Yano S, Quinn

S, Ren X, Terwilliger EF, Schwarz P and Brown EM (2003)

Calcium-sensing receptor stimulates PTHrP release by

pathways dependent on PKC, p38 MAPK, JNK and ERK1/2

in H-500 cells. Am J Physiol Endocrinol Metab 285, E329-

E337.

Thomas RJ, Guise TA, Yin JJ, Elliott J, Horwood NJ, Martin TJ

and Gillespie MT (1999) Breast cancer cells interact with

osteoblasts to support osteoclast formation. Endocrinology

140, 4451-4458.

Tovar Sepulveda VA and Falzon M (2002) Regulation of PTH-

related protein gene expression by vitamin D in PC-3

prostate cancer cells. Mol Cell Endocrinol 190, 115-124.

Tovar Sepulveda VA, Shen X and Falzon M (2002) Intracrine

PTHrP protects against serum starvation-induced apoptosis

and regulates the cell cycle in MCF-7 breast cancer cells.


Truong NU, de BEMD, Papavasiliou V, Goltzman D and Kremer

R (2003) Parathyroid hormone-related peptide and survival

of patients with cancer and hypercalcemia. Am J Med 115,

115-121.

Tumber A, Morgan HM, Meikle MC and Hill PA (2001) Human

breast-cancer cells stimulate the fusion, migration and

resorptive activity of osteoclasts in bone explants. Int J

Cancer 91, 665-672.

Turner PR, Mefford S, Christakos S and Nissenson RA (2000)

Apoptosis mediated by activation of the G protein-coupled

receptor for parathyroid hormone (PTH)/PTH-related protein

(PTHrP). Mol Endocrinol 14, 241-254.

Uy HL, Mundy GR, Boyce BF, Story BM, Dunstan CR, Yin JJ,

Roodman GD and Guise TA (1997) Tumor necrosis factor

enhances parathyroid hormone-related protein-induced

hypercalcemia and bone resorption without inhibiting bone

formation in vivo. Cancer Res 57, 3194-3199.

Vargas SJ, Gillespie MT, Powell GJ, Southby J, Danks JA,

Moseley JM and Martin TJ (1992) Localization of

parathyroid hormone-related protein mRNA expression in

breast cancer and metastatic lesions by in situ hybridization.

J Bone Miner Res 7, 971-979.

Vasavada RC, Wysolmerski JJ, Broadus AE and Philbrick WM

(1993) Identification and characterization of a GC-rich

promoter of the human parathyroid hormone-related peptide

gene. Mol Endocrinol 7, 273-282.

Vetter M, Blumenthal SG, Lindemann RK, Manns J, Wesselborg

S, Thomssen C and Dittmer J (2004) Ets1 is a downstream

effector of protein kinase C in cancer cells. Oncogene in

press

Vortkamp A, Lee K, Lanske B, Segre GV, Kronenberg HM and

Tabin CJ (1996) Regulation of rate of cartilage

differentiation by Indian hedgehog and PTH-related protein.

Science 273, 613-622.

Watanabe T, Yamaguchi K, Takatsuki K, Osame M and Yoshida

M (1990) Constitutive expression of parathyroid hormone-

related protein gene in human T cell leukemia virus type 1

(HTLV-1) carriers and adult T cell leukemia patients that can

be trans-activated by HTLV-1 tax gene. J Exp Med 172,

759-765.

Whitfield JF, Chakravarthy BR, Durkin JP, Isaacs RJ,

Jouishomme H, Sikorska M, Williams RE and Rixon RH

(1992) Parathyroid hormone stimulates protein kinase C but

not adenylate cyclase in mouse epidermal keratinocytes. J

Cell Physiol 150, 299-303.

Wu TL, Vasavada RC, Yang K, Massfelder T, Ganz M, Abbas

SK, Care AD and Stewart AF (1996) Structural and

physiologic characterization of the mid-region secretory

species of parathyroid hormone-related protein. J Biol Chem

271, 24371-24381.

Wysolmerski JJ and Broadus AE (1994) Hypercalcemia of

malignancy: the central role of parathyroid hormone-related

protein. Annu Rev Med 45, 189-200.

Wysolmerski JJ, Dann PR, Zelazny E, Dunbar ME, Insogna KL,

Guise TA and Perkins AS (2002) Overexpression of

parathyroid hormone-related protein causes hypercalcemia

but not bone metastases in a murine model of mammary

tumorigenesis. J Bone Miner Res 17, 1164-1170.

Wysolmerski JJ, Philbrick WM, Dunbar ME, Lanske B,

Kronenberg H and Broadus AE (1998) Rescue of the

parathyroid hormone-related protein knockout mouse

demonstrates that parathyroid hormone-related protein is

essential for mammary gland development. Development

125, 1285-1294.

Wysolmerski JJ, Vasavada R, Foley J, Weir EC, Burtis WJ,

Kukreja SC, Guise TA, Broadus AE and Philbrick WM

(1996) Transactivation of the PTHrP gene in squamous

carcinomas predicts the occurrence of hypercalcemia in

athymic mice. Cancer Res 56, 1043-1049.

Yamaguchi K, Kiyokawa T, Watanabe T, Ideta T, Asayama K,

Mochizuki M, Blank A and Takatsuki K (1994) Increased

serum levels of C-terminal parathyroid hormone-related

protein in different diseases associated with HTLV-1

infection. Leukemia 8, 1708-1711.

Yamato H, Nagai Y, Inoue D, Ohnishi Y, Ueyama Y, Ohno H,

Matsumoto T, Ogata E and Ikeda K (1995) In vivo evidence


464

for progressive activation of parathyroid hormone-related

peptide gene transcription with tumor growth and stimulation

of osteoblastic bone formation at an early stage of humoral

hypercalcemia of cancer. J Bone Miner Res 10, 36-44.

Yang BS, Hauser CA, Henkel G, Colman MS, Van Beveren C,

Stacey KJ, Hume DA, Maki RA and Ostrowski MC (1996)

Ras-mediated phosphorylation of a conserved threonine

residue enhances the transactivation activities of c-Ets1 and

c-Ets2. Mol Cell Biol 16, 538-547.

Yin JJ, Selander K, Chirgwin JM, Dallas M, Grubbs BG, Wieser

R, Massague J, Mundy GR and Guise TA (1999) TGF"

signaling blockade inhibits PTHrP secretion by breast cancer

cells and bone metastases development. J Clin Invest 103,

197-206.

Yoneda T, Williams PJ, Hiraga T, Niewolna M and Nishimura R

(2001) A bone-seeking clone exhibits different biological

properties from the MDA-MB-231 parental human breast

cancer cells and a brain-seeking clone in vivo and in vitro. J

Bone Miner Res 16, 1486-1495.

Yoshida A, Nakamura Y, Shimizu A, Harada M, Kameda Y,

Nagano A, Inaba M and Asaga T (2000) Significance of the

parathyroid hormone-related protein expression in breast

carcinoma. Breast Cancer 7, 215-220.

Jürgen Dittmer


465


Gene-based vaccines for immunotherapy of prostate

cancer - lessons from the pastReview Article

Milcho Mincheff* and Serguei ZoubakThe George Washington University Medical Center

__________________________________________________________________________________

*Correspondence: Milcho Mincheff, Head, Tumor Immunology Laboratory, Department of Medicine, The George Washington

Medical Center, 2300 Eye Street, N.W., Ross Hall 705, Washington, DC 20037; Tel: 202 994 7765; fax: 202 994 0465; e-mail:

[email protected]

Key words: PSMA, Gene-based vaccine, immunodominance, CTLA-4

Abbreviations: activation-inducible TNF receptor, (AITR); antigen-presenting cells, (APCs); cytotoxic T lymphocyte antigen 4,

(CTLA-4); delayed type hypersensitivity, (DTH); glucocorticoid-induced tumor necrosis factor receptor, (GITR); GITR ligand, (GITR-

L); prostate acidic phosphatase, (PAP); prostate-specific membrane antigen, (PSMA); “secreted” prostate-specific membrane antigen,

(sPMSA); T cell receptor, (TCR); truncated prostate-specific membrane antigen, (tPSMA); tumor-infiltrating lymphocytes, (TILs);

tyrosinase-related protein-1, (TRP-1)

Supported in part by the American Foundation for Biolological Research and by the Bulgarian Foundation for Biomedical

Research.

Supported in part by grant N00014-00-1-0787 from the Office of Naval Research.

Supported in part by award No DAMD17-02-1-0239. The U.S. Army Medical Research Acquisition Activity, 820

Chandler Street, Fort Detrick, MD 21702-5014 is the awarding and administering acquisition office.

The content of the information does not necessarily reflect the position or the policy of the Government, and no official

endorsement should be inferred. For purpose of this article, information includes news releases, articles, manuscripts,

brochures, advertisements, still and motion pictures, speeches, trade association proceedings etc.

Received: 15 October 2004; Accepted: 15 November 2004; electronically published: November 2004

Summary

Gene-based vaccination in its current mode of application is effective in breaking tolerance to a self- or tumor-

associated antigen, but the response is narrow and restricted to few of the potential epitopes due to

immunodominance. In cancer, immunodominance carries the risk of inefficient immune surveillance due to loss of

MHC alleles or point mutations in the recognized sequences. We have found that a T cell response to sub-dominant

epitopes can be primed with transfected dendritic cells in which the newly expressed antigen is purposefully

targeted for proteasomal degradation. Beginning in May 1998, we performed a phase I/II clinical trial for

immunotherapy of prostate cancer that targeted the prostate-specific membrane antigen (PSMA). The primary

objective of the study was to determine the safety of the described vaccines after repeated intradermal injections

(Mincheff et al., 2000a; Mincheff et al., 2000b), since using PSMA as a target could be seriously offset by the

development of autoimmunity (Gilboa, 1999b; Overwijk and Restifo, 2000). So far, six years since the study has

begun, no patient has experienced any short- or long-term side effects, including anti-DNA antibody. Twenty-nine

patients from this random population were treated solely by immunotherapy. Eighteen of them had biochemical

recurrence following radical prostatectomy and eleven responded to the therapy with a PSA drop exceeding 50% of

pre-therapy value. Patients with advanced disease and distant metastases were not influenced by the

immunotherapy despite the fact that they all showed signs of T cell immunity towards PSMA. We found, however,

that the post-vaccination T cell response was directed against only two of the potential 4 PSMA epitopes that had

high affinity for binding. At least in vitro, priming with one of our vaccines led to a poly-epitope response.

Unfortunately, even in such instances, consequent exposure to poly-epitope expressing dendritic cells during re-

immunization led to selection of an immunodominant clone. To alleviate immunodominance and decrease tumor

evasion due to loss of antigenic determinants, a poly-epitope T cell response would need to be maintained. Ensuring

Mincheff and Zoubak: DNA vaccines for prostate cancer

466

such a cytotoxic T cell response, therefore, would require either construction of separate epitope encoding vectors

for boosting, an approach with limited therapeutic application, or identifying conditions during boosting that would

restrict immunodominance. CD4 T cell depletion, GITR-L signaling or CTLA-4 all show promise in achieving this

goal.

I. IntroductionA. Tumor antigen recognitionEvidence that the immune system recognizes tumor

antigens is supported by the existence of tumor infiltrating

lymphocytes but, since cancer cells fail to establish and

support an effective immune milieu, tumors often prevail

and survive. Worsening the problem is the fact that

recognition of cancer antigens on tumor cells seems to

evoke a tolerant state by induction of anergy in antigen-

reactive T cells. In the past few years it has become

increasingly evident that induction of tissue-specific

autoimmunity can lead to tumor destruction. Initially

Coulie and colleagues (Coulie et al, 1994) discovered that

the target for a melanoma-specific CD8+ T cell clone

grown from a melanoma patient was wild-type tyrosinase,

a melanosomal enzyme selectively expressed in

melanocytes. Subsequently, a number of investigators

found that their melanoma-specific CD8+ T cells indeed

recognized melanocyte-specific antigens rather than

melanoma-specific antigens (Bakker et al, 1994; Cox et al,

1994; Kawakami et al, 1994). Most of these antigens

appear to be normal melanosomal proteins, and a number

of them, including tyrosinase, tyrosinase-related protein-1

(TRP-1), TRP-2, and glycoprotein 100 (gp100), are

involved in melanin biosynthesis. Other melanosomal

proteins such as MART1/Melan A have no known

function but are nonetheless melanocyte-specific tissue

differentiation antigens. As time progressed, evidence

accumulated that the dominant targets of immune

responses against tumors were tissue-specific or

differentiation antigens. In contrast, recognition of

peptides derived from unique tumor-specific mutations

represented infrequent reactivities (Coulie et al, 1995;

Wolfel et al, 1995; Robbins et al, 1996). Similar analysis

of the specificities of tumor-infiltrating lymphocytes

(TILs) in prostate cancer biopsies also revealed responses

against tissue-specific antigens (McNeel and Disis, 2000).

Possible targets included the prostate-specific membrane

antigen (PSMA) (Murphy et al, 1996; Eder et al, 2000),

the prostate-specific antigen (PSA) (Kim et al, 1998;

Sanda et al, 1999) and prostate acidic phosphatase (PAP)

(Fong et al, 2001).

The findings that the existing anti-tumor immune

responses are predominantly targeting tissue-specific

antigens open a new venue for cancer immunotherapy. In

practical terms, however, harnessing autoimmunity for

cancer therapy presents several problems:

i. Identification of a target antigen or a combination

thereof that will confer protection. In a recent study

performed in mice, anti-TRP-1 but not anti-TRP-2 or anti-

gp-100 specific T cells induced vitiligo and anti-tumor

immunity (Overwijk et al, 1999). This may have been true

for the particular mouse strain in that study but it does

show that targeting a single antigen based on analysis of T

cell responses from tumor bearing patients or animals may

be misleading. It also shows the shortcomings of using a

single peptide derived from a tissue specific antigen for

raising sustained autoimmunity sufficient to eradicate

tumor. A cancer vaccine against a multitude of peptides

against a tissue-specific antigen will definitely offer some

advantages. This approach is strengthened by the

discovery that, as is the case with different animal strains,

particular autoantigen in different people may manifest

different ability to break tolerance and induce

autoimmunity (Hammer et al, 1997).

ii. The prostate-specific membrane antigen (PSMA)

is a type II integral membrane glycoprotein with a

molecular weight of ~100 kDa (Israeli et al, 1993). It has

a folate hydrolase, as well as neuropeptidase activity.

PSMA is highly expressed in benign prostate secretory-

acinar epithelium, prostatic intraepithelial neoplasia and

prostate adenocarcinoma (Murphy et al, 1998). There is

good evidence that PSMA expression is increased in high

Gleason score tumors and in hormone-refractory tumor

cells (Troyer et al, 1995), which makes it an excellent

target for immunotherapy. More recently, weak expression

has been described in several normal tissues such as a

subset of proximal renal tubules, duodenal and colonic

mucosa. A shorter, alternatively spliced cytosolic form of

PSMA, named PSM’, is the predominant form expressed

in benign prostate epithelium (Grauer et al, 1998).

Recently PSMA expression has been detected in tumor

neovasculature (Chang et al, 1999), as well as in other

healthy tissues both in human (Renneberg et al, 1999) and

in mice (Bacich et al, 2001).

II. Clinical trialBreaking of tolerance to tissue-specific antigens

requires presentation of antigen to T cells by specialized,

antigen presenting cells: the dendritic cells. This can be

performed by a procedure known as naked DNA

immunization. We have already performed a clinical trial

on immunotherapy of prostate cancer using this approach

and we have demonstrated its safety. Beginning in May

1998, we performed in Sofia, Bulgaria, a phase I/II clinical

trial for immunotherapy of prostate cancer that targeted

the prostate-specific membrane antigen (PSMA). The

primary objective of the study was to determine the safety

of the described vaccines after repeated intradermal

injections (Mincheff et al, 2000a, b, 2001), since using

PSMA as a target could be seriously offset by the

development of autoimmunity (Overwijk and Restifo,

2000; Gilboa, 2001).

Sixty-five patients were accessed into the study and

were repeatedly immunized. Fifty-nine of them were in the

study for a period between 2.5 and 3 years. No patient

experienced short or long-term side effects including the

development of anti-DNA antibody (Mincheff et al,


467

2000a). We also found that repeated local intradermal

injection of rHuGM-CSF (Sargramostim) was a safe

procedure and was well tolerated. Heterologous

immunization regimen that consisted of two initial

intradermal immunizations at 3-week intervals with a

cocktail consisting of 200 µg plasmid DNA and 9 IU/m2

b.s.a., followed by a recombinant adenoviral boost (5x108

PFUs of Ad5PSMA) led to uniform immunization as

judged by the development of delayed type

hypersensitivity reaction (DTH) to PSMA. DTH was

measured 24 and 48 hours following intradermal injection

of the plasmid immunization cocktail and was compared

to reactions developing after intradermal injection at two

separate sites of plasmid cocktail that contained the empty

plasmid backbone instead, or of GM-CSF only. The

patients were heterogeneous with regard to local

advancement of disease, presence of distant metastases, or

hormone treatment and refractoriness, which does not

permit unequivocal interpretation of the results.

Nevertheless, several responders to the immunotherapy

could be identified. Twenty-nine patients from this

random population were treated solely by immunotherapy

(Table 1). Eighteen of them had biochemical recurrence

following radical prostatectomy and eleven responded to

the therapy with a PSA drop exceeding 50% of pre-

therapy value (Table 1). In contrast, only one of the 11

patients with advanced metastatic disease was influenced

by IT with the PSA remaining flat at 10-13 ng/ml and a

decrease in bone pains. The remaining 10 patients

experienced disease progression despite immunizations.

The PSA curve of a typical responder to

immunotherapy is shown on Figure 3. The patient was

prostatectomized in January, 1996, Gleason score 5,

negative margins. Biochemical recurrence was first

detected in February, 1999. Immunotherapy, consisting of

two plasmid immunizations followed by a recombinant

adenoviral boost was initiated in March, 1999. Regular

boosts were performed at 3-4 month intervals alternating

between the plasmid DNA and the adenoviral vector.

Patients with advanced disease and distant metastases

were not influenced by the immunotherapy despite the fact

that they all showed signs of T cell immunity towards

PSMA. Anti-PSMA immunity was assayed by the

presence of PSMA-reactive, !IFN-producing T cells in

their peripheral blood (Figure 2).

The escape of tumor cells from immune surveillance

despite presence of anti-PSMA T cell immunity in those

patients could be mediated through a number of

mechanisms:

III. Tumor evasionA. Tumor evasionEspecially in advanced disease with a big tumor load,

can be mediated through multiple pathways (Gilboa,

1999a; Ohm et al, 1999; Shah and Lee, 2000; Beck et al,

2001; Cefai et al, 2001; Garrido and Algarra, 2001;

Pasche, 2001; Smyth et al, 2001; Carbone and Ohm, 2002;

Dunn et al, 2002; Koyama et al, 2002; Ng et al, 2002;

Schreiber et al, 2002). Tumor cells secrete lymphokines

such as TGF-" and VEGF which suppress dendritic cell

and T cell function (Ohm et al, 1999; Shah and Lee, 2000;

Beck et al, 2001; Pasche, 2001; Dunn et al, 2002; Koyama

et al, 2002). Fas-L and other apoptosis inducing agents are

expressed on tumor cells and induce programmed cell

death in infiltrating lymphocytes (Cefai et al, 2001;

Koyama et al, 2002).

Figure 1. Serum PSA of a patient following radical

prostatectomy (1996), biochemical recurrence (January, 1999)

and immunotherapy (March 1999 – August 2000). SDs represent

three separate determination of PSA in serum derived from three

venipunctures on three consecutive days.

(P-thPSMA plasmid; Ad5 – Ad5PSMA)

Figure 2. . !-interferon-positive CD8+T cells following 6-hour

stimulation of peripheral blood from HLA-A2+ cancer patients

with HLA-A2-specific, PSMA-derived peptide

(MMNDQLMFL). Cells were stained using the FastImmune

CD8 intracellular cytokine detection kit. Diamonds – prior to

immunization (control), squares – post immunization. Data are

from five different experiments involving five patients.


468

B. ImmunodominanceThe response of the host immune system to only a

few of the many possible epitopes in an antigen,

additionally exacerbates the problem (Zinkernagel and

Doherty, 1979; Yin et al, 1993; Yewdell and Bennink,

1999; Wherry et al, 1999; Belz et al, 2000; Chen et al,

2000; Hislop et al, 2002; Palmowski et al, 2002;

Rodriguez et al, 2002). We find gene-based vaccination in

its current mode of application effective in breaking

tolerance to a self-antigen, but the boosting narrows and

restricts the response to few of the potential epitopes

(Mincheff et al, 2003). For example, the post-vaccination

T cell response of some of the HLA A2 patients from the

clinical trial performed by us was directed against only

two of the potential 4 PSMA peptide motifs that had high

affinity for binding (Figure 3).

Table 1. Results from a clinical trial on DNA

immunization for immunotherapy of prostate cancer

Immunotherapy only

Outcome Post-

Prostatectomy

Distant

metastases

Disease Progression 7 10

Improvement

(Responders* to

Therapy)

11 1

Total Number of

Patients

18 11

Responders* – Decrease of PSA exceeding 50% of initial value,

decrease in bone pains (where applicable).

Figure 3. !-IFN-positive CD3+ T cells following 6-hour

stimulation of peripheral blood of HLA-A2+ prostate cancer

patients. The following PSMA peptides were identified by

BIMAS to bind with high affinity to HLA A2, synthesized and

tested in an in vitro assay: MMNDQLMFL (PSMA663),

ALFDIESKV (PSMA711), LMFLERAFI (PSMA668) and

GIUDALFDI (PSMA707). Legend: Stimulation was performed by

a) squares – PSMA663, b) diamonds – PSMA711, c) triangles –

PSMA668. Results with PSMA707 are not shown but are

comparable to pre-immunization values (see Figure 1). Data are

from three separate experiments with blood from one patient.

Cells were stained using the FastImmune CD8 intracellular

cytokine detection kit.

Immunodominance ensures the tight specificity of

the immune reaction and prevents untoward autoimmunity

(Yewdell and Bennink, 1999; Rodriguez et al, 2002).

However, it carries the risk of inefficient immune

surveillance in cases such as cancer in which mutations of

the epitope or downregulation of MHC alleles occur

(Hicklin et al, 1998; Hiraki et al, 1999; Dunn et al, 2002;

Schreiber et al, 2002). Malignant transformation and

tumor progression are frequently associated with loss of

HLA class I antigens. For example, a recent review of the

literature (Ferrone and Marincola, 1995) reported that

~15% and ~55% of surgically removed primary and

metastatic melanoma lesions, respectively, were not

stained in immunohistochemical reactions by monoclonal

antibodies to monomorphic determinants of HLA class I

antigens. Loss or reduced HLA class I antigen expression

enables tumor cells to evade the host's immune response

(Cordon-Cardo et al, 1991; Rivoltini et al, 1995; Hicklin et

al, 1998; de la Salle et al, 1999; Hiraki et al, 1999) and

downregulation of HLA class I antigens in metastases

from patients with malignant melanoma is associated with

poorer prognosis (van Duinen et al, 1988).

Numerous factors combine to establish an

immunodominance hierarchy (Yewdell and Bennink,

1999). They include among others:

1. Lack of T cells that are responsive to a sub-

dominant epitope (Baldwin et al, 1999)

2. Low affinity of the epitope for binding to MHC

(Ma and Kapp, 2001)

3. Ineffective generation and transport of sub-

dominant epitopes by APCs (Mo et al, 2000)

4. Intrinsic control of CD8 T cells to respond to sub-

dominant epitopes (Noel et al, 1996; Boise and Thompson,

1996; Rabinowitz et al, 1996; Kersh et al, 1998; Schwartz

et al, 2001; Guntermann and Alexander, 2002)

5. Extrinsic regulatory networks (T regulatory cells)

(Suri-Payer et al, 1998; Thornton and Shevach, 1998;

Thornton and Shevach, 2000; Levings et al, 2001;

Piccirillo and Shevach, 2001; Shevach, 2001; Sanchez-

Fueyo et al, 2002; Sakaguchi, 2003).

We concentrated our efforts on studying the effects

of the extrinsic regulatory networks, particularly CTLA-4

and GITR-L signaling and T regulatory cell influence on

the establishment of immunodominance during priming

and boosting with a gene-based vaccine.

1. Immunodominance and CTLA-4 inhibitionA homologue of CD28, CTLA-4 also binds to the B-7

family members (Greene et al, 1996; Sanchez-Fueyo et al,

2002) but inhibits T cell activation (van der Merwe et al,

1997). Mice lacking CTLA-4 reveal a striking phenotype

of polyclonal T cell activation and tissue infiltration which

results in death by 3-4 weeks of age, indicating a powerful

regulatory role for CTLA-4 (Thompson and Allison, 1997;

Waterhouse et al, 1995). Weak signals through the T cell

receptor (TCR) are prompt to inhibition (Manzotti et al,

2002) and, at least in vitro, no CTL stimulation to

subdominant epitopes occurs if CTLA-4 is not inhibited

(Mincheff et al, 2004). Alternatively, CTLA-4 may act as

a non-signaling "decoy" receptor reducing the available

ligand for CD28 costimulation (Masteller et al, 2000;


469

Doyle et al, 2001; Mincheff et al, 2004). No matter what

the mechanism is, inhibition of CTLA-4 may alleviate

immunodominance and thus improve the efficacy of anti-

tumor vaccines.

2. CD4+CD25+ T cell depletion and cancer

immunodominanceEnhanced priming to sub-dominant epitopes by

CTLA-4 inhibition is at least partially mediated through

the inhibition of CD4+CD25+ T cell function (Mincheff et

al, 2004). These CD4+ T cells are a minor subpopulation

(10%) that co-expresses the IL-2 receptor #-chain (CD25)

(Sakaguchi et al, 1995) and they can prevent both the

induction and effector function of autoreactive T cells

(Suri-Payer et al, 1998; Shevach, 2001; Levings et al,

2001). Additionally, they suppress polyclonal T cell

activation in vitro by inhibiting IL-2 production (Thornton

and Shevach, 1998). Based on these data, we speculate

that immunodominance that develops after re-

immunization may be reduced by CD4+CD25+ T cell

depletion prior to boosting.

3. CD4+CD25+ T cell regulationVery little is known of the physiologic regulation of

CD4+CD25+ T cells in vivo (McHugh et al, 2002). Recent

reports suggest that glucocorticoid-induced tumor necrosis

factor receptor (GITR), also known as TNFRSF18 – a

member of the TNF-nerve growth factor receptor gene

superfamily – is predominantly expressed on CD4+CD25+

T cells (McHugh et al, 2002; Shimizu et al, 2002) and

stimulation of GITR abrogates CD4+CD25+ T cell-

mediated suppression (Shimizu et al, 2002). The gene

encoding the natural ligand of murine GITR has been

cloned and characterized. The putative GITR ligand

(GITR-L) is composed of 173 amino acids with features

resembling those of type II membrane proteins and is 51%

identical to the human activation-inducible TNF receptor

(AITR) ligand, TL6. Expression of the GITR-L is

restricted to immature and mature splenic dendritic cells.

GITR-L binds GITR expressed on HEK 293 cells and

triggers NF-$B activation. Functional studies reveal that

soluble CD8-GITR-L prevents CD4+CD25+ regulatory T-

cell-mediated suppressive activities (Kim JD et al, 2003).

Stimulation through this receptor has been shown to break

immunologic tolerance (Shimizu et al, 2002), i.e. it acts

similarly to CD4+CD25+ T cell depletion (Kwon et al,

2003).

IV. Immunodominance during

priming and boostingA. “Truncated” vs. secreted vaccines

(tVacs vs. sVacs). Dendritic cells transfected

with truncated vaccines primes to both

dominant and subdominant epitopes of the

target antigenTo enhance priming to sub-dominant epitopes, we

designed a vaccine (hPSMAT; truncated (tPSMA);

tVac)(Mincheff et al, 2003) whose product encoded for

only the extracellular domain of PSMA. The product,

expressed following transfection with this vector, is

retained in the cytosol and is degraded by the proteasomes.

For the “secreted” (sPMSA) vaccine, a signal peptide

sequence was added to the expression cassette. The

expressed protein following transfection with such

vaccines is glycosylated and directed to the secretory

pathway. Dendritic cells transfected in vitro with tVacs

primed T cells to both dominant and subdominant epitopes

(Mincheff et al, 2003). Subsequent boosting with antigen-

presenting cells (APCs) that expressed both dominant and

sub-dominant epitopes, however, narrowed the immune

response to the dominant ones (Mincheff et al, 2003).

Research from other groups has gained similar results

(Firat et al, 1999; Mateo et al, 1999; Loirat et al, 2000;

Smith et al, 2001; Palmowski et al, 2002). In all these

instances, boosting with polyepitope encoding constructs

resulted in failure to expand polyepitope CTLs. A likely

explanation is that competition between T cells for antigen

on individual APC leads to obscuring of responses to sub-

dominant epitopes when both the dominant and

subdominant epitopes are present on the same APC

(Palmowski et al, 2002; Kedl et al, 2003).

New vaccines (separate DNA vaccines encoding

isolated dominant and subdominant epitopes (Barouch et

al, 2001) might maximize epitope dispersal among APCs

thus inducing broad immunity against numerous epitopes,

dominant and subdominant. Due to the HLA

polymorphism of the human population, however,

construction of such separate vaccines is mainly of

academic interest and will have limited therapeutic

application. Different approaches for the maintenance of a

poly-epitope CTL response following repeated boosting,

therefore, are necessary. Some of those are listed below:

B. CTLA-4 inhibition and

immunodominance. Addition of anti-CTLA-4

antibodies during priming alleviates

immunodominanceWe find that in vitro priming to subdominant

responses is enhanced by CTLA-4 inhibition (Mincheff et

al, 2003). Will similar CTLA-4 inhibition during in vivo

re-immunization (boosting) preserve a poly-epitope CTL

response (Mincheff et al, 2004)? What will be the cytokine

production profile of the sub-dominant T cell clones?

T1/T2 polarization (!-IFN vs. IL-4 secretion) has been

shown to depend on the amount of the antigen and on the

affinity of the peptide for MHC (Kumar et al, 1995), with

weaker signals promoting IL-4 secretion. CTLA-4

inhibition may promote T cell activation at instances of

weak T cell receptor engagement (Manzotti et al, 2002).

Will there be a difference in the cytokine profile of the

sub-dominant clones raised by either minigene re-

immunization or CTLA-4 inhibition? Will sub-dominant

clones be cytotoxic to tumor cells?

C. CD4+CD25+ T cell prior to priming

reduces immunodominanceResults from our laboratory show that the enhanced

priming to sub-dominant epitopes by CTLA-4 inhibition is

at least partially mediated through the inhibition of


470

CD4+CD25+ T cell function (Mincheff et al, 2004). For

obvious reasons, CD4+CD25+ T cell depletion prior to in

vivo boosting may lead to serious side effects (Sakaguchi

et al, 2001). Could alleviation of immunodominance be

achieved by means other than CD4+CD25+ T cell

depletion?

D. In some cases, GITR-signaling during

priming reduces immunodominanceWe find that while CD4+CD25+ T cell depletion

prior to in vitro priming with sVacDCs alleviates

immunodominance, co-transfection of dendritic cells with

GITR-L does so in some but not all cases(Mincheff et al,

2004). Could immunodominance in vivo be restricted by

GITR signaling? Could this be achieved by the co-

administration of anti-GITR antibodies or by enhanced

GITR-L co-expression during re-immunization?

Preliminary results from our laboratory (Mincheff et al,

2004) suggest that in some cases in vitro, co-transfection

of dendritic cells with GITR-L alleviate

immunodominance.

V. ConclusionImmunotherapy is a safe, non-invasive, relatively

inexpensive procedure that can avoid side effects that

often result from surgical, cryosurgical or radiation

therapy. Gene based vaccination is effective in breaking

tolerance to tumor-associated antigens, but the response is

directed towards few of the potential epitopes due to

immunodominance. Tumor cells that have lost the

immunodominant epitope due to mutations are no-longer

recognized and evade immune surveillance. Designing a

protocol for immunotherapy, therefore, necessitates

stimulation of an immune response directed against a

multitude of epitopes. Increasing the number of epitopes

available for presentation to T cells is the initial step. It

mandates increased degradation of the antigen following

DNA immunization and we have already initiated

experimentation directed at this (Mincheff et al, 2003). A

logical continuation to the current work involves

manipulation of the intimate mechanisms controlling the

processes of stimulation and/or suppression of T cells

recognizing the “sub-dominant” epitopes.

ReferencesBacich DJ, Pinto JT, Tong WP and Heston WD (2001) Cloning,

expression, genomic localization, and enzymatic activities of

the mouse homolog of prostate-specific membrane

antigen/NAALADase/folate hydrolase. Mamm Genome 12,

117-123.

Bakker AB, Schreurs MW, de Boer AJ, Kawakami Y, Rosenberg

SA, Adema GJ and Figdor CG (1994) Melanocyte lineage-

specific antigen gp100 is recognized by melanoma-derived

tumor-infiltrating lymphocytes. J Exp Med 179, 1005-1009.

Baldwin KK, Trenchak BP, Altman JD and Davis MM (1999)

Negative selection of T cells occurs throughout thymic

development. J Immunol 163, 689-698.

Barouch DH, Craiu A, Santra S, Egan MA, Schmitz JE, Kuroda

MJ, Fu TM, Nam JH, Wyatt LS, Lifton MA, Krivulka GR,

Nickerson CE, Lord CI, Moss B, Lewis MG, Hirsch VM,

Shiver JW and Letvin NL (2001) Elicitation of high-

frequency cytotoxic T-lymphocyte responses against both

dominant and subdominant simian-human immunodeficiency

virus epitopes by DNA vaccination of rhesus monkeys. J

Virol 75, 2462-2467.

Beck C, Schreiber H and Rowley D (2001) Role of TGF-" in

immune-evasion of cancer. Microsc Res Tech 52, 387-395.

Belz GT, Stevenson PG and Doherty PC (2000) Contemporary

analysis of MHC-related immunodominance hierarchies in

the CD8+ T cell response to influenza A viruses. J Immunol

165, 2404-2409.

Boise LH and Thompson CB (1996) Hierarchical control of

lymphocyte survival. Science 274, 67-68.

Carbone JE and Ohm DP (2002) Immune dysfunction in cancer

patients. Oncology (Huntingt) 16, 11-18.

Cefai D, Favre L, Wattendorf E, Marti A, Jaggi R and Gimmi

CD (2001) Role of Fas ligand expression in promoting

escape from immune rejection in a spontaneous tumor

model. Int J Cancer 91, 529-537.

Chang SS, Reuter VE, Heston WD, Bander NH, Grauer LS and

Gaudin PB (1999) Five different anti-prostate-specific

membrane antigen (PSMA) antibodies confirm PSMA

expression in tumor-associated neovasculature. Cancer Res

59, 3192-3198.

Chen W, Anton LC, Bennink JR and Yewdell JW (2000)

Dissecting the multifactorial causes of immunodominance in

class I-restricted T cell responses to viruses. Immunity 12,

83-93.

Cordon-Cardo C, Fuks Z, Drobnjak M, Moreno C, Eisenbach L

and Feldman M (1991) Expression of HLA-A,B,C antigens

on primary and metastatic tumor cell populations of human

carcinomas. Cancer Res 51, 6372-6380.

Coulie PG, Brichard V, Van Pel A, Wolfel T, Schneider J,

Traversari C, Mattei S, De Plaen E, Lurquin C and Szikora

JP (1994) A new gene coding for a differentiation antigen

recognized by autologous cytolytic T lymphocytes on HLA-

A2 melanomas. J Exp Med 180, 35-42.

Coulie PG, Lehmann F, Lethe B, Herman J, Lurquin C,

Andrawiss M and Boon T (1995) A mutated intron sequence

codes for an antigenic peptide recognized by cytolytic T

lymphocytes on a human melanoma. Proc Natl Acad Sci U

S A 92, 7976-7980.

Cox AL, Skipper J, Chen Y, Henderson RA, Darrow TL,

Shabanowitz J, Engelhard VH, Hunt DF and Slingluff CL, Jr

(1994) Identification of a peptide recognized by five

melanoma-specific human cytotoxic T cell lines. Science

264, 716-719.

de la Salle H, Zimmer J, Fricker D, Angenieux C, Cazenave JP,

Okubo M, Maeda H, Plebani A, Tongio MM, Dormoy A and

Hanau D (1999) HLA class I deficiencies due to mutations in

subunit 1 of the peptide transporter TAP1. J Clin Invest 103,

R9-R13.

Doyle AM, Mullen AC, Villarino AV, Hutchins AS, High FA,

Lee HW, Thompson CB and Reiner SL (2001) Induction of

cytotoxic T lymphocyte antigen 4 (CTLA-4) restricts clonal

expansion of helper T cells. J Exp Med 194, 893-902.

Dunn GP, Bruce AT, Ikeda H, Old LJ and Schreiber RD (2002)

Cancer immunoediting: from immunosurveillance to tumor

escape. Nat Immunol 3, 991-998.

Eder JP, Kantoff PW, Roper K, Xu GX, Bubley GJ, Boyden J,

Gritz L, Mazzara G, Oh WK, Arlen P, Tsang KY, Panicali D,

Schlom J and Kufe DW (2000) A phase I trial of a

recombinant vaccinia virus expressing prostate-specific

antigen in advanced prostate cancer. Clin Cancer Res 6,

1632-1638.

Ferrone S and Marincola FM (1995) Loss of HLA class I

antigens by melanoma cells: molecular mechanisms,

functional significance and clinical relevance. Immunol

Today 16, 487-494.


471

Firat H, Garcia-Pons F, Tourdot S, Pascolo S, Scardino A, Garcia

Z, Michel ML, Jack RW, Jung G, Kosmatopoulos K, Mateo

L, Suhrbier A, Lemonnier FA and Langlade-Demoyen P

(1999) H-2 class I knockout, HLA-A2.1-transgenic mice: a

versatile animal model for preclinical evaluation of antitumor

immunotherapeutic strategies. Eur J Immunol 29, 3112-

3121.

Fong L, Brockstedt D, Benike C, Breen JK, Strang G, Ruegg CL

and Engleman EG (2001) Dendritic cell-based xenoantigen

vaccination for prostate cancer immunotherapy. J Immunol

167, 7150-7156.

Garrido F and Algarra I (2001) MHC antigens and tumor escape

from immune surveillance. Adv Cancer Res 83, 117-158.

Gilboa E (1999a) How tumors escape immune destruction and

what we can do about it. Cancer Immunol Immunother 48,

382-385.

Gilboa E (1999b) The makings of a tumor rejection antigen.

Immunity 11, 263-270.

Gilboa E (2001) The risk of autoimmunity associated with tumor

immunotherapy. Nat Immunol 2, 789-792.

Grauer LS, Lawler KD, Marignac JL, Kumar A, Goel AS and

Wolfert RL (1998) Identification, purification, and

subcellular localization of prostate-specific membrane

antigen PSM' protein in the LNCaP prostatic carcinoma cell

line. Cancer Res 58, 4787-4789.

Greene JL, Leytze GM, Emswiler J, Peach R, Bajorath J, Cosand

W and Linsley PS (1996) Covalent dimerization of

CD28/CTLA-4 and oligomerization of CD80/CD86 regulate

T cell costimulatory interactions. J Biol Chem 271, 26762-

26771.

Guntermann C and Alexander DR (2002) CTLA-4 suppresses

proximal TCR signaling in resting human CD4(+) T cells by

inhibiting ZAP-70 Tyr(319) phosphorylation: a potential role

for tyrosine phosphatases. J Immunol 168, 4420-4429.

Hammer J, Sturniolo T and Sinigaglia F (1997) HLA class II

peptide binding specificity and autoimmunity. Adv

Immunol 66, 67-100.

Hicklin DJ, Wang Z, Arienti F, Rivoltini L, Parmiani G and

Ferrone S (1998) "2-Microglobulin mutations, HLA class I

antigen loss, and tumor progression in melanoma. J Clin

Invest 101, 2720-2729.

Hiraki A, Kaneshige T, Kiura K, Ueoka H, Yamane H, Tanaka

M and Harada M (1999) Loss of HLA haplotype in lung

cancer cell lines: implications for immunosurveillance of

altered HLA class I/II phenotypes in lung cancer. Clin

Cancer Res 5, 933-936.

Hislop AD, Annels NE, Gudgeon NH, Leese AM and Rickinson

AB (2002) Epitope-specific evolution of human CD8(+) T

cell responses from primary to persistent phases of Epstein-

Barr virus infection. J Exp Med 195, 893-905.

Israeli RS, Powell CT, Fair WR and Heston WD (1993)

Molecular cloning of a complementary DNA encoding a

prostate-specific membrane antigen. Cancer Res 53, 227-

230.

Kawakami Y, Eliyahu S, Delgado CH, Robbins PF, Sakaguchi

K, Appella E, Yannelli JR, Adema GJ, Miki T and

Rosenberg SA (1994) Identification of a human melanoma

antigen recognized by tumor-infiltrating lymphocytes

associated with in vivo tumor rejection. Proc Natl Acad Sci

U S A 91, 6458-6462.

Kedl RM, Kappler JW and Marrack P (2003) Epitope

dominance, competition and T cell affinity maturation. Curr

Opin Immunol 15, 120-127.

Kersh EN, Shaw AS and Allen PM (1998) Fidelity of T cell

activation through multistep T cell receptor zeta

phosphorylation. Science 281, 572-575.

Kim JD, Choi BK, Bae JS, Lee UH, Han IS, Lee HW, Youn BS,

Vinay DS and Kwon BS (2003) Cloning and characterization

of GITR ligand. Genes Immun 4, 564-569.

Kim JJ, Trivedi NN, Wilson DM, Mahalingam S, Morrison L,

Tsai A, Chattergoon MA, Dang K, Patel M, Ahn L, Boyer

JD, Chalian AA, Schoemaker H, Kieber-Emmons T,

Agadjanyan MA, Weiner DB and Shoemaker H (1998)

Molecular and immunological analysis of genetic prostate

specific antigen (PSA) vaccine. Oncogene 17, 3125-3135.

Koyama S, Koike N and Adachi S (2002) Expression of TNF-

related apoptosis-inducing ligand (TRAIL) and its receptors

in gastric carcinoma and tumor-infiltrating lymphocytes: a

possible mechanism of immune evasion of the tumor. J

Cancer Res Clin Oncol 128, 73-79.

Kumar V, Bhardwaj V, Soares L, Alexander J, Sette A and

Sercarz E (1995) Major histocompatibility complex binding

affinity of an antigenic determinant is crucial for the

differential secretion of interleukin 4/5 or interferon g by T

cells. Proc Natl Acad Sci U S A 92, 9510-9514.

Kwon B, Kim BS, Cho HR, Park JE and Kwon BS (2003)

Involvement of tumor necrosis factor receptor

superfamily(TNFRSF) members in the pathogenesis of

inflammatory diseases. Exp Mol Med 35, 8-16.

Levings MK, Sangregorio R and Roncarolo MG (2001) Human

cd25(+)cd4(+) t regulatory cells suppress naive and memory

T cell proliferation and can be expanded in vitro without loss

of function. J Exp Med 193, 1295-1302.

Loirat D, Lemonnier FA and Michel ML (2000) Multiepitopic

HLA-A*0201-restricted immune response against hepatitis B

surface antigen after DNA-based immunization. J Immunol

165, 4748-4755.

Ma H and Kapp JA (2001) Peptide affinity for MHC influences

the phenotype of CD8(+) T cells primed in vivo. Cell

Immunol 214, 89-96.

Manzotti CN, Tipping H, Perry LC, Mead KI, Blair PJ, Zheng Y

and Sansom DM (2002) Inhibition of human T cell

proliferation by CTLA-4 utilizes CD80 and requires CD25+

regulatory T cells. Eur J Immunol 32, 2888-2896.

Masteller EL, Chuang E, Mullen AC, Reiner SL and Thompson

CB (2000) Structural analysis of CTLA-4 function in vivo. J

Immunol 164, 5319-5327.

Mateo L, Gardner J, Chen Q, Schmidt C, Down M, Elliott SL,

Pye SJ, Firat H, Lemonnier FA, Cebon J and Suhrbier A

(1999) An HLA-A2 polyepitope vaccine for melanoma

immunotherapy. J Immunol 163, 4058-4063.

McHugh RS, Whitters MJ, Piccirillo CA, Young DA, Shevach

EM, Collins M and Byrne MC (2002) CD4(+)CD25(+)

immunoregulatory T cells: gene expression analysis reveals a

functional role for the glucocorticoid-induced TNF receptor.

Immunity 16, 311-323.

McNeel DG and Disis ML (2000) Tumor vaccines for the

management of prostate cancer. Arch Immunol Ther Exp

(Warsz) 48, 85-93.

Mincheff M, Altankova I, Zoubak S, Tchakarov S, Botev C,

Petrov S, Krusteva E, Kurteva G, Kurtev P, Dimitrov V,

Ilieva M, Georgiev G, Lissitchkov T, Chernozemski I and

Meryman HT (2001) In vivo transfection and/or cross-

priming of dendritic cells following DNA and adenoviral

immunizations for immunotherapy of cancer--changes in

peripheral mononuclear subsets and intracellular IL-4 and

IFN-g lymphokine profile. Crit Rev Oncol Hematol 39,

125-132.

Mincheff M, Tchakarov S, Zoubak S, Loukinov D, Botev C,

Altankova I, Georgiev G, Petrov S and Meryman HT

(2000a) Naked DNA and adenoviral immunizations for

immunotherapy of prostate cancer: a phase I/II clinical trial.

Eur Urol 38, 208-217.


472

Mincheff M, Zoubak S, Altankova I, Tchakarov S,

Makogonenko Y, Botev C, Ignatova I, Dimitrov R,

Madarzhieva K, Hammett M, Pomakov Y, Meryman H and

Lissitchkov T (2003) Human dendritic cells genetically

engineered to express cytosolically retained fragment of

prostate-specific membrane antigen prime cytotoxic T-cell

responses to multiple epitopes. Cancer Gene Ther 10, 907-

917.

Mincheff M, Zoubak S, Altankova I, Tchakarov S, Pogribnyy P,

Makogonenko Y, Botev C and Meryman HT (2004)

Depletion of CD25+ cells from human T-cell enriched

fraction eliminates immunodominance during priming and

boosting with genetically modified dendritic cells. Cancer

Gene Ther, (accepted).

Mincheff M, Zoubak S and Meryman HT (2000b) Use of in

Vitro and in Vivo Genetically Manipulated Cells for

Immunotherapy of Cancer. In: Th Smit Sibinga C (ed).

Proceedings of the 25th International Symposium of Blood

Transfusion, Groningen, The Netherlands, 1999. Kluwer

Academic Publishers: Dordrecht, Boston and London, pp.

11-19.

Mo AX, van Lelyveld SF, Craiu A and Rock KL (2000)

Sequences that flank subdominant and cryptic epitopes

influence the proteolytic generation of MHC class I-

presented peptides. J Immunol 164, 4003-4010.

Murphy G, Tjoa B, Ragde H, Kenny G and Boynton A (1996)

Phase I clinical trial: T-cell therapy for prostate cancer using

autologous dendritic cells pulsed with HLA-A0201-specific

peptides from prostate-specific membrane antigen. Prostate

29, 371-380.

Murphy GP, Elgamal AA, Su SL, Bostwick DG and Holmes EH

(1998) Current evaluation of the tissue localization and

diagnostic utility of prostate specific membrane antigen.

Cancer 83, 2259-2269.

Ng CS, Novick AC, Tannenbaum CS, Bukowski RM and Finke

JH (2002) Mechanisms of immune evasion by renal cell

carcinoma: tumor-induced T-lymphocyte apoptosis and

NFkB suppression. Urology 59, 9-14.

Noel PJ, Boise LH and Thompson CB (1996) Regulation of T

cell activation by CD28 and CTLA4. Adv Exp Med Biol

406, 209-217.

Ohm JE, Shurin MR, Esche C, Lotze MT, Carbone DP and

Gabrilovich DI (1999) Effect of vascular endothelial growth

factor and FLT3 ligand on dendritic cell generation in vivo. J

Immunol 163, 3260-3268.

Overwijk WW, Lee DS, Surman DR, Irvine KR, Touloukian CE,

Chan CC, Carroll MW, Moss B, Rosenberg SA and Restifo

NP (1999) Vaccination with a recombinant vaccinia virus

encoding a "self" antigen induces autoimmune vitiligo and

tumor cell destruction in mice: requirement for CD4(+) T

lymphocytes. Proc Natl Acad Sci U S A 96, 2982-2987.

Overwijk WW and Restifo NP (2000) Autoimmunity and the

immunotherapy of cancer: targeting the "self" to destroy the

"other". Crit Rev Immunol 20, 433-450.

Palmowski MJ, Choi EM, Hermans IF, Gilbert SC, Chen JL,

Gileadi U, Salio M, Van Pel A, Man S, Bonin E, Liljestrom

P, Dunbar PR and Cerundolo V (2002) Competition between

CTL narrows the immune response induced by prime-boost

vaccination protocols. J Immunol 168, 4391-4398.

Pasche B (2001) Role of transforming growth factor " in cancer.

J Cell Physiol 186, 153-168.

Piccirillo CA and Shevach EM (2001) Cutting edge: control of

CD8+ T cell activation by CD4+CD25+ immunoregulatory

cells. J Immunol 167, 1137-1140.

Rabinowitz JD, Beeson C, Wulfing C, Tate K, Allen PM, Davis

MM and McConnell HM (1996) Altered T cell receptor

ligands trigger a subset of early T cell signals. Immunity 5,

125-135.

Renneberg H, Friedetzky A, Konrad L, Kurek R, Weingartner K,

Wennemuth G, Tunn UW and Aumuller G (1999) Prostate

specific membrane antigen (PSM) is expressed in various

human tissues: implication for the use of PSM reverse

transcription polymerase chain reaction to detect

hematogenous prostate cancer spread. Urol Res 27, 23-27.

Rivoltini L, Barracchini KC, Viggiano V, Kawakami Y, Smith

A, Mixon A, Restifo NP, Topalian SL, Simonis TB,

Rosenberg SA and et al (1995) Quantitative correlation

between HLA class I allele expression and recognition of

melanoma cells by antigen-specific cytotoxic T lymphocytes.

Cancer Res 55, 3149-3157.

Robbins PF, El-Gamil M, Li YF, Kawakami Y, Loftus D,

Appella E and Rosenberg SA (1996) A mutated "-catenin

gene encodes a melanoma-specific antigen recognized by

tumor infiltrating lymphocytes. J Exp Med 183, 1185-1192.

Rodriguez F, Harkins S, Slifka MK and Whitton JL (2002)

Immunodominance in virus-induced CD8(+) T-cell

responses is dramatically modified by DNA immunization

and is regulated by g interferon. J Virol 76, 4251-4259.

Sakaguchi S (2003) Regulatory T cells: mediating compromises

between host and parasite. Nat Immunol 4, 10-11.

Sakaguchi S, Sakaguchi N, Asano M, Itoh M and Toda M (1995)

Immunologic self-tolerance maintained by activated T cells

expressing IL-2 receptor #-chains (CD25). Breakdown of a

single mechanism of self-tolerance causes various

autoimmune diseases. J Immunol 155, 1151-1164.

Sanchez-Fueyo A, Weber M, Domenig C, Strom TB and Zheng

XX (2002) Tracking the immunoregulatory mechanisms

active during allograft tolerance. J Immunol 168, 2274-

2281.

Sanda MG, Smith DC, Charles LG, Hwang C, Pienta KJ, Schlom

J, Milenic D, Panicali D and Montie JE (1999) Recombinant

vaccinia-PSA (PROSTVAC) can induce a prostate-specific

immune response in androgen-modulated human prostate

cancer. Urology 53, 260-266.

Schreiber H, Wu TH, Nachman J and Kast WM (2002)

Immunodominance and tumor escape. Semin Cancer Biol

12, 25-31.

Schwartz JC, Zhang X, Fedorov AA, Nathenson SG and Almo

SC (2001) Structural basis for co-stimulation by the human

CTLA-4/B7-2 complex. Nature 410, 604-608.

Shah AH and Lee C (2000) TGF-"-based immunotherapy for

cancer: breaching the tumor firewall. Prostate 45, 167-172.

Shevach EM (2001) Certified professionals: CD4(+)CD25(+)

suppressor T cells. J Exp Med 193, F41-46.

Shimizu J, Yamazaki S, Takahashi T, Ishida Y and Sakaguchi S

(2002) Stimulation of CD25(+)CD4(+) regulatory T cells

through GITR breaks immunological self-tolerance. Nat

Immunol 3, 135-142.

Smith SG, Patel PM, Porte J, Selby PJ and Jackson AM (2001)

Human dendritic cells genetically engineered to express a

melanoma polyepitope DNA vaccine induce multiple

cytotoxic T-cell responses. Clin Cancer Res 7, 4253-4261.

Smyth MJ, Godfrey DI and Trapani JA (2001) A fresh look at

tumor immunosurveillance and immunotherapy. Nat

Immunol 2, 293-299.

Suri-Payer E, Amar AZ, Thornton AM and Shevach EM (1998)

CD4+CD25+ T cells inhibit both the induction and effector

function of autoreactive T cells and represent a unique

lineage of immunoregulatory cells. J Immunol 160, 1212-

1218.

Thompson CB and Allison JP (1997) The emerging role of

CTLA-4 as an immune attenuator. Immunity 7, 445-450.

Thornton AM and Shevach EM (1998) CD4+CD25+

immunoregulatory T cells suppress polyclonal T cell

activation in vitro by inhibiting interleukin 2 production. J

Exp Med 188, 287-296.


473

Thornton AM and Shevach EM (2000) Suppressor effector

function of CD4+CD25+ immunoregulatory T cells is

antigen nonspecific. J Immunol 164, 183-190.

Troyer JK, Beckett ML and Wright GL, Jr (1995) Detection and

characterization of the prostate-specific membrane antigen

(PSMA) in tissue extracts and body fluids. Int J Cancer 62,

552-558.

van der Merwe PA, Bodian DL, Daenke S, Linsley P and Davis

SJ (1997) CD80 (B7-1) binds both CD28 and CTLA-4 with a

low affinity and very fast kinetics. J Exp Med 185, 393-403.

van Duinen SG, Ruiter DJ, Broecker EB, van der Velde EA,

Sorg C, Welvaart K and Ferrone S (1988) Level of HLA

antigens in locoregional metastases and clinical course of the

disease in patients with melanoma. Cancer Res 48, 1019-

1025.

Waterhouse P, Penninger JM, Timms E, Wakeham A, Shahinian

A, Lee KP, Thompson CB, Griesser H and Mak TW (1995)

Lymphoproliferative disorders with early lethality in mice

deficient in Ctla-4. Science 270, 985-988.

Wherry EJ, Puorro KA, Porgador A and Eisenlohr LC (1999)

The induction of virus-specific CTL as a function of

increasing epitope expression: responses rise steadily until

excessively high levels of epitope are attained. J Immunol

163, 3735-3745.

Wolfel T, Hauer M, Schneider J, Serrano M, Wolfel C,

Klehmann-Hieb E, De Plaen E, Hankeln T, Meyer zum

Buschenfelde KH and Beach D (1995) A p16INK4a-

insensitive CDK4 mutant targeted by cytolytic T

lymphocytes in a human melanoma. Science 269, 1281-

1284.

Yewdell JW and Bennink JR (1999) Immunodominance in major

histocompatibility complex class I-restricted T lymphocyte

responses. Annu Rev Immunol 17, 51-88.

Yin L, Poirier G, Neth O, Hsuan JJ, Totty NF and Stauss HJ

(1993) Few peptides dominate cytotoxic T lymphocyte

responses to single and multiple minor histocompatibility

antigens. Int Immunol 5, 1003-1009.

Zinkernagel RM and Doherty PC (1979) MHC-restricted

cytotoxic T cells: studies on the biological role of

polymorphic major transplantation antigens determining T-

cell restriction-specificity, function, and responsiveness. Adv

Immunol 27, 51-177.

Milcho Mincheff Serguei Zoubak


474


481

Figure 4. Effect of the HSFE on retroviral !-globin promoter DNase I sensitivity. (a) r!G, rH!G, and r2H!G construct maps

showing EcoR I (E), Asc I (A), and Sst I (S), and restriction sites, location of Southern blot probe, and size of parental band. (b) DNase I

assays of r!G, rH!G, and r2H!G pools. Intact nuclei were incubated with increasing concentrations of DNase I. Genomic DNA was

digested with the appropriate restriction enzymes. Parental bands are indicated by P, DNase I hypersensitive sites by arrows. (c)

Locations of the DNase I HSs for r!G, rH!G, and r2H!G. An approximately 110 bp HS maps over 20% of the promoter of integrated

r!G constructs. In the rH!G pool, the HS is approximately 230 bp in size and maps to the HSFE and the first 20 bp of the promoter. The

HS in the r2H!G pool is approximately 190 bp in size and maps to the promoter and 3' HSFE.

Nemeth and Lowrey: A chromatin opening element increases !-globin expression

482

The Bln I concentration at which maximum promoter

digestion was achieved was in excess of 80 units per

reaction (data not shown). Pools were digested with 100

units of Bln I and representative Southern blot analyses are

shown in Figure 5b. In pools containing the r!G vector,

45% of the promoters were digested by Bln I (Figure 5c).

When a single HSFE or the enhancer plus an HSFE were

added, the proportion of accessible promoters increased by

5%. Tandem copies of the HSFE were able to increase the

percentage of open promoters to 56% (p < .01).

Figure 5. Quantitative effects of

the HSFE on retroviral !-globin

promoter accessibility. (a) r!G,

rH!G, rEH!G, and r2H!G construct

maps showing EcoR I (E), Sst I (S),

Xma I and Xho I restriction sites,

site of Bln I digestion (arrow) and

sizes of parental and Bln I digestion

products. (b) Representative

Southern blots from r!G, rH!G,

rEH!G, and r2H!G pools. Three

pools for each construct are shown.

Intact nuclei were incubated with

100 units of Bln I. Genomic DNA

was then isolated and digested with

the appropriate restriction enzymes

for Southern blotting. Parental bands

are indicated by P and sub-bands

resulting from Bln I digestion are

indicated with arrowheads. (c) Mean

percentage cutting +/- 1 SD for all

constructs (n=4). The p-values were

determined by Student's t-test.


483

B. The effect of the HSFE on human !-

globin gene expressionTo address the effects of the HSFE on gene

expression, we chemically induced globin gene expression

with hexamethylene bisacetamide (HMBA) and performed

ribonuclease protection assays on the isolated RNA

(Figure 6a). Human !-globin expression was normalized

to mouse "-globin expression and corrected for both the

average copy number of the pool and the different specific

activities of the probes. In pools containing the r!G vector,

human !-globin expression was 2.6% +/- 0.8% of mouse

!-globin (Figure 6b). Upon incorporation of the HSFE, !-

globin expression increased to 9.6%, a significant increase

of nearly 4-fold (p < .01) and incorporation of tandem

copies of the HSFE resulted in a 5-fold increase in !-

globin expression (p < .001). With the addition of the 36

bp HS2 enhancer 5' to the HSFE, human !-globin

expression also increased 4-fold compared to the promoter

alone (p = .01). When the positions of the HSFE and

enhancer were exchanged, !-globin expression was

increased only 3-fold (p = .01). There was no observable

difference between placing the enhancer element 5’ to the

HSFE compared to 3’.

IV. DiscussionWe have demonstrated that the HSFE is able to form

its characteristic structure in the context of a retroviral

vector and that tandem HSFEs increased the extent of

DNase I accessible promoter chromatin structure.

Furthermore, the HSFE, when present as single or tandem

copies, is able to increase retroviral !-globin expression up

to 5-fold compared to the promoter alone. These results

indicate a tissue-specific chromatin-opening element such

as the HSFE is able to significantly increase gene

expression in the context of a retroviral vector.

Additionally, an advantage of using the 101 bp HSFE

with a retroviral vector is that the probability of genetic

rearrangement and other technical barriers associated with

the use of larger LCR fragments vectors is reduced

By itself, the integrated human !-globin promoter

can form a weak hypersensitive site. The formation of this

site is consistent with previous reports describing the

formation of a weak hypersensitive site by the globin

promoters alone (Tuan et al, 1985; Forrester et al, 1986;

Dhar et al, 1990; Iler et al, 1999). The inclusion of the

HSFE doubled the region of hypersensitive chromatin in

the neighborhood of the !-globin promoter to

approximately 230 bp. However, the larger HS is almost

entirely localized to the HSFE sequence, encompassing

approximately 20% of the !-globin promoter. Although

the majority of promoter region is not hypersensitive for

either construct, the two critical CACCC boxes, which

bind EKLF, do reside within the HS (Miller and Bieker,

1993). However, when tandem copies of the HSFE were

used, the detected HS mapped to a region that included the

entire minimal promoter. This HS is formed by the 3’

HSFE. We observed a similar localization of the 3’ HS

when we stably transfected the tandem HSFE cassette into

MEL cells. We were unable to observe the HS formed by

the proximal HSFE, although in earlier studies we have

shown that both HSFE elements can establish distinct HSs.

Overall, the structural characteristics of the HSFE are still

intact in the context of a retroviral vector.

The incorporation of the HSFE did not increase the

percentage of open promoters. This was a somewhat

surprising result, as we had previously observed that the

addition of the HSFE resulted in a 20% increase in the

Figure 6. Effect of the HSFE on retroviral !-globin

expression. (a) Representative ribonuclease protection assays for

each set of pools for all constructs. Human bone marrow and

mouse fetal liver controls are indicated. Experimental samples

are underneath the black bar. Protected human !-globin (H!) and

mouse "-globin (M") mRNAs are indicated by arrows. Copy

numbers for each pool is shown in the top row of numbers

beneath each assay. Human !-globin gene expression for each

pool is shown in the second row of numbers. Expression was

quantified using densitometry. (b) Mean human b-globin

expression of each construct (n = 4). P-values were determined

by t-test.


484

percentage of open promoters (Iler et al, 1999). However,

tandem HSFEs (r2H!G) were able to significantly

increase the number of accessible promoters by 10%. The

question remains whether such an increase is

physiologically meaningful. Thus, it appears that our

elements have the capability to increase the size of the

region of hypersensitive chromatin but not the proportion

of promoters in an open configuration.

Even though inclusion of the HSFE did not cause

formation of hypersensitive chromatin along the entire

promoter, its presence resulted in a significant four-fold

increase in human !-globin expression compared to the

promoter alone. This increase was comparable to that

observed when we stably transfected the HSFE into MEL

cells (Nemeth et al, 2001). Novak et al, demonstrated a

similar 6-fold increase in clones containing a !-globin

retroviral vector incorporating the entire HS4 (Novak et al,

1990). Overall, we observed significant increases in gene

expression with all combinations tested. Combining the

HS2 enhancer element with the HSFE did not increase

gene expression compared to a single HSFE. Since the 36

bp enhancer has been shown to double expression in a !-

globin retroviral vector and the HSFE alone leads to a 4-

fold increase, the addition of the enhancer may be

redundant as the HSFE has already augmented expression

in all the permissive cells in the pool population (Liu et al,

1992).

The mechanism by which the HSFE augments gene

expression is still not clear. Our original hypothesis was

that the HSFE would increase the opportunity for critical

transcription factors to interact with the minimal !-globin

promoter resulting in increased transcription regardless of

the chromatin structure in which the vector was integrated.

However, our results, combined with other studies,

indicate that expression levels do not always correlate with

chromatin accessibility (Milot et al, 1996; Pikaart et al,

1998; Nemeth et al, 2001).

A simple model of increased transcription factor

accessibility does not explain the increased expression

observed with the HSFE. HS4, where the HSFE was first

mapped, has been shown to contain no classical enhancer

activity when studied in transient assays (Tuan et al,

1989). The HSFE may be inducing more subtle changes in

chromatin structure such as alterations in promoter

nucleosome acetylation or methylation patterns by

bringing important factors in these processes in proximity

to the promoter. For example, NF-E2, which binds to the

HSFE, has been shown to play a role in histone

hyperacetylation (Kiekhaefer et al, 2002). HSFE-bound

proteins may also recruit factors, such as CBP and p300,

which have endogenous histone acetyltransferase activity

and have been implicated in hematopoietic transcription

(reviewed in Blobel et al, 2000).

In order to meet the minimum level of in vivo

expression (roughly 15 to 20% of endogenous globin

expression) that could be therapeutically beneficial, cis-

elements in addition to the HSFE will have to be

considered. One candidate is the 1.2 kb fragment from

HS4 of the chicken !-globin LCR that has been shown to

act as a chromatin insulator in several in vitro and in vivo

systems (Chung et al, 1993; Pikaart et al, 1998). In

retroviral vectors, it has been shown that the insulator

increases gene expression by increasing the probability of

transcription (Rivella et al, 1998; Emery et al, 2000).

Another example is the inclusion of scaffold attachment

regions in retroviral vectors to achieve increased

expression (Murray et al, 2000). Potentially, the use of

different chromatin remodeling elements to achieve

specific molecular effects will be a useful strategy in the

development of vectors capable of long-term, high-level

therapeutic gene expression.

AcknowledgmentsThe authors wish to thank Drs. Brian Sorrentino, Elio

Vanin, Steve Fiering, Phillipe Leboulch and Jane

McInerney for reagents and helpful discussion. This

research was supported by grants HL52243 and HL73442

(CHL). MN was the recipient of Ryan Foundation and

Rosalind Borison Memorial Pre-Doctoral Fellowships.

ReferencesBarklis E, Mulligan RC and Jaenisch R (1986) Chromosomal

position or virus mutation permits retrovirus expression in

embryonal carcinoma cells. Cell 47, 391-399.

Blobel GA (2000) Creb-binding protein and p300: Molecular

integrators of hematopoietic transcription. Blood 95, 745-

755.

Challita P-MandKohn DB (1994) Lack of expression from a

retroviral vector after transduction of murine hematopoietic

stem cells is associated with methylation in vivo . Proc Natl

Acad Sci U S A 91, 2567-2571.

Chang JC, Liu D and Kan YW (1992) A 36-base-pair core

sequence of locus control region enhances retrovirally

transferred human !-globin gene expression. Proc Natl

Acad Sci U S A 89, 3107-3110.

Chen WYandTownes TM (2000) Molecular mechanism for

silencing virally transduced genes involves histone

deacetylation and chromatin condensation. Proc Natl Acad

Sci U S A 97, 377-382.

Chung JH, Whiteley M and Felsenfeld G (1993) A 5' element of

the chicken !-globin domain serves as an insulator in human

erythroid cells and protects against position effect in

drosophila. Cell 74, 505-514.

Dhar V, Nandi A, Schildkraut CL and Skoultchi AI (1990)

Erythroid-specific nuclease-hypersensitive sites flanking the

human b-globin domain. Mol. Cell Biol. 10, 4324-4333.

Emery DW, Yannaki E, Tubb J, Nishino T, Li Q and

Stamatoyannopoulos G (2002) Development of virus vectors

for gene therapy of ! chain hemoglobinopathies: Flanking

with a chromatin insulator reduces #-globin gene silencing in

vivo. Blood 100, 2012-2019.

Emery DW, Yannaki E, Tubb J and Stamatoyannopoulos G

(2000) A chromatin insulator protects retrovirus vectors from

chromosomal position effects. Proc Natl Acad Sci U S A 97,

9150-9155.

Epner E, Reik A, Cimbora D, Telling A, Bender MA, Fiering S,

Enver T, Martin DI, Kennedy M, Keller G and Groudine M

(1998) The !-globin lcr is not necessary for an open

chromatin structure or developmentally regulated

transcription of the native mouse !-globin locus. Molecular

Cell 2, 447-455.

Forrester W, Thompson C, Elder J and Groudine M (1986) A

developmentally stable chromatin structure in the human !-


485

globin gene cluster. Proc Natl Acad Sci U S A 83, 1359-

1363.

Goodwin AJ, McInerney JM, Glander MA, Pomerantz O and

Lowrey CH (2001) In vivo formation of a human b-globin

locus control region core element requires binding sites for

several factors including gata-1, nf-e2, eklf, and sp-1. J Biol

Chem 276, 26883-26892.

Grosveld F, Blom van Assendelft G, Greaves D and Kollias G

(1987) Position-independent, high-level expression of the

human !-globin gene in transgenic mice. Cell 51, 975-985.

Hardison R, Slightom JL, Gumucio DL, Goodman M, Stojanovic

N and Miller W (1997) Locus control regions of mammalian

!-globin gene clusters: Combining phylogenetic analyses and

experimental results to gain functional insights. Gene 205,

73-94.

Hawley RG, Lieu FH, Fong AZ and Hawley TS (1994) Versatile

retroviral vectors for potential use in gene therapy. Gene

Ther 1, 136-138.

Hoeben RC, Migchielsen AAJ, van der Jagt RCM, van Ormondt

H and van der Eb AJ (1991) Inactivation of the moloney

murine leukemia virus long terminal repeat in murine

fibroblast cell lines is associated with methylation and

dependent on its chromosomal position. J Virol 65, 904-912.

Iler N, Goodwin A, McInerney J, Nemeth M, Pomerantz O,

Layon M and Lowrey C (1999) Targeted remodeling of

human !-globin promoter chromatin structure produces

increased expression and decreased silencing. Blood Cells

Mol. Dis. 25, 47-60.

Imren S, Payen E, Westerman KA, Pawliuk R, Fabry ME, Eaves

CJ, Cavilla B, Wadsworth LD, Beuzard Y, Bouhassira EE,

Russell R, London IM, Nagel RL, Leboulch P and

Humphries RK (2002) Permanent and panerythroid

correction of murine ! thalassemia by multiple lentiviral

integration in hematopoietic stem cells. Proc Natl Acad Sci

U S A 99, 14380-14385.

Jahner DandJaenisch (1985) Retrovirus-induced de novo

methylation of flanking host sequences correlates with gene

activity. Nature 315, 594-597.

Karlsson S, Papayannopoulou T, Schweiger S,

Stamatoyannopoulos G and Nienhuis A (1987) Retroviral-

mediated transfer of genomic globin genes leads to regulated

production of rna and protein. Proc Natl Acad Sci U S A 84,

2411-2415.

Karpen G (1994) Position-effect variegation and the new biology

of heterochromatin. Curr. Opin. Gen. Dev. 4, 281-291.

Kiekhaefer CM, Grass JA, Johnson KD, Boyer ME and Bresnick

EH (2002) Hematopoietic-specific activators establish an

overlapping pattern of histone acetylation and methylation

within a mammalian chromatin domain. Proc Natl Acad Sci

U S A 99, 14309-14314.

Leboulch P, Huang GM, Humphries RK, Oh YH, Eaves CJ,

Tuan DY and London IM (1994) Mutagenesis of retroviral

vectors transducing human !-globin gene and !-globin locus

control region derivatives results in stable transmission of an

active transcriptional structure. EMBO J 13, 3065-3076.

Liu D, Chang JC, Moi P, Liu W, Kan YW and Curtin PT (1992)

Dissection of the enhancer activity of !-globin 5' dnase i-

hypersensitive site 2 in transgenic mice. Proc Natl Acad Sci

U S A 89, 3899-3903.

Lowrey CH, Bodine DM and Nienhuis AW (1992) Mechanism

of dnase i hypersensitive site formation within the human

globin locus control region. Proc Natl Acad Sci U S A 89,

1143-1147.

Miller IJandBieker JJ (1993) A novel, erythroid cell-specific

murine transcription factor that binds to the caccc element

and is related to the kruppel family of nuclear proteins. Mol.

Cell. Biol. 13, 2776-2786.

Milot E, Strouboulis J, Trimborn T, Wijgerde M, de Boer E,

Langeveld A, Tan-Un K, Vergeer W, Yannoutsos N,

Grosveld F and Fraser P (1996) Heterochromatin effects on

the frequency and duration of lcr-mediated gene

transcription. Cell 87, 105-114.

Murray L, Travis M, Luens-Abitorabi K, Olsson K, Plavec I,

Forestell S, Hanania EG and Hill B (2000) Addition of the

human interferon ! scaffold attachment region to retroviral

vector backbones increases the level of in vivo transgene

expression among progeny of engrafted human

hematopoietic stem cells. Hum Gene Ther 11, 2039-2050.

Nemeth MJ, Bodine DM, Garrett LJ and Lowrey CH (2001) An

erythroid-specific chromatin opening element reorganizes !-

globin promoter chromatin structure and augments gene

expression. Blood Cells Mol Dis 27, 767-780.

Novak U, Harris E, Forrester W, Groudine M and Gelinas R

(1990) High-level !-globin expression after retroviral

transfer of locus activation region-containing human !-

globin gene derivatives into murine erythroleukemia cells.


Orkin SH and Motulsky AG (1995) Report and recommendations

of the panel to assess the nih investment in research on gene

therapy, pp. Office of Recombinant DNA activities website.

Persons DA, Allay ER, Sawai N, Hargrove PW, Brent TP,

Hanawa H, Nienhuis AW and Sorrentino BP (2003a)

Successful treatment of murine !-thalassemia using in vivo

selection of genetically modified, drug-resistant

hematopoietic stem cells. Blood 102, 506-513.

Persons DA, Hargrove PW, Allay ER, Hanawa H and Nienhuis

AW (2003b) The degree of phenotypic correction of murine

!-thalassemia intermedia following lentiviral-mediated

transfer of a human #-globin gene is influenced by

chromosomal position effects and vector copy number.

Blood 101, 2175-2183.

Philipsen S, Pruzina S and Grosveld F (1993) The minimal

requirements for activity in transgenic mice of hypersensitive

site 3 of the ! globin locus control region. EMBO J 12,

1077-1085.

Philipsen S, Talbot D, Frase P and Grosveld F (1990) The !-

globin dominanat control region: Hypersensitive site 2.

EMBO J 9, 2159-2167.

Pikaart MJ, Recillas-Targa F and Felsenfeld G (1998) Loss of

transcriptional activity of a transgene is accompanied by

DNA methylation and histone deacetylation and is prevented

by insulators. Genes and Development 12, 2852-2862.

Pomerantz O, Goodwin AJ, Joyce T and Lowrey CH (1998)

Conserved elements containing nf-e2 and tandem gata

binding sites are required for erythroid-specific chromatin

structure reorganization within the human !-globin locus

control region. Nucleic Acids Res 26, 5684-5691.

Pruzina S, Hanscombe O, Whyatt D, Grosveld F and Philipsen S

(1991) Hypersensitive site 4 of the human ! globin locus

control region. Nucleic Acids Res 19, 1413-1419.

Ramezani A, Hawley TS and Hawley RG (2003) Performance-

and safety-enhanced lentiviral vectors containing the human

interferon-! scaffold attachment region and the chicken !-

globin insulator. Blood 101, 4717-4724.

Reik A, Telling A, Zitnik G, Cimbora D, Epner E and Groudine

M (1998) The locus control region is necessary for gene

expression in the human !-globin locus but not the

maintenance of an open chromatin structure in erythroid

cells. Mol. Cell. Biol. 18, 5992-6000.

Rivella S, Callegari J, May C and Sadelain M (1998) The

insulator element chs4 increases expression and prevents

promotor methylation of integrated retroviral vectors. Blood

Cells, Molecules and Diseases 24, 483.


486

Stamatoyannopoulos JA, Goodwin A, Joyce T and Lowrey CH

(1995) Nf-e2 and gata binding motifs are required for the

formation of dnase i hypersensitive site 4 of the human !-

globin locus control region. EMBO J 14, 106-116.

Talbot D, Philipsen S, Fraser P and Grosveld F (1990) Detailed

analysis of the site 3 region of the human !-globin dominant

control region. EMBO J. 9, 2169-2178.

Tuan D, Solomon W, Li Q and London I (1985) The "!-like-

globin" gene domain in human erythroid cells. Proc Natl

Acad Sci U S A 82, 6384-6388.

Tuan DYH, Solomon WB, London IM and Lee DP (1989) An

erythroid-specific, developmental- stage- independent

enhancer far upstream of the human "!-like globin" genes.


Wang L, Robbins PB, Carbonaro DA and Kohn DB (1998) High-

resolution analysis of cytosine methylation in the 5long

terminal repeat of retroviral vectors. Human Gene Therapy

9, 2321-2330.


475


An erythroid-specific chromatin opening element

increases !-globin gene expression from integrated

retroviral gene transfer vectorsResearch Article

Michael J. Nemeth1 and Christopher H. Lowrey2,3,4,*1Hematopoiesis Section, Genetics and Molecular Biology Branch, National Human Genome Research Institute, Bethesda,

MD, USA,2Departments of Medicine3Pharmacology/Toxicology4The Norris Cotton Cancer Center, Dartmouth Medical School, Hanover, NH 03755, USA

__________________________________________________________________________________

*Correspondence: Christopher H. Lowrey, M.D., Norrris Cotton Cancer Center, Dartmouth-Hitchcock Medical Center, Lebanon, NH

03756; Phone: 603-653-9967; Fax: 603-653-3543; e-mail: [email protected]

Key words: chromatin structure, !-globin, retrovirus, DNase I hypersensitive site, locus control region

Abbreviations: Fetal Bovine Serum, (FBS); green fluorescent protein, (GFP); hexamethylene bisacetamide, (HMBA); hypersensitive

sites, (HS); locus control region, (LCR); multiple cloning site, (MCS); murine stem cell virus, (MSCV)

Received: 14 November 2004; Accepted: 29 November 2004; electronically published: December 2004

Summary

Gene therapy strategies requiring long-term high-level expression from integrated genes are currently limited by

inconsistent levels of expression. This may be observed as variegated, silenced or position-dependent gene

expression. Each of these phenomena involve suppressive chromatin structures. We hypothesized that by actively

conferring an open chromatin structure on integrated vectors would increase transgene expression. To test this idea

we used a 100bp element from the !-globin locus control region (LCR) which is able to independently open local

chromatin structure in erythroid tissues. This element includes binding sites for GATA-1, NF-E2, EKLF and Sp-1

and is evolutionarily conserved. We constructed a series of MSCV-based vectors containing the !-globin gene

driven by a minimal !-globin promoter with combinations of the HSFE and LCR derived enhancer elements. Pools

of MEL clones containing integrated vectors were analyzed for chromatin structure and !-globin gene expression.

The HSFE increased the extent of nuclease sensitive chromatin over the promoters of the constructs. The most

effective vector included tandem copies of the HSFE and produced a 5-fold increase in expression compared to the

promoter alone. These results indicate that the HSFE is able to augment the opening of !-globin promoter

chromatin structure and significantly increase gene expression in the context of an integrated retroviral vector.

I. IntroductionClinical applications of gene therapy that require

long-term expression have been limited by an inability to

achieve consistent, high-level expression from integrated

gene therapy vectors such as retroviruses (Orkin and

Motulsky, 1995). These vectors exhibit highly variable or

position-dependent expression, which is proposed to be

due in part to the formation of highly condensed,

suppressive local chromatin structures at sites of

integration. In this model, transgene expression can range

from high to non-existent depending upon whether

integration occurs into a region of transcriptionally active

or inactive chromatin structure (Barklis et al, 1986). The

wide range in expression is often due to position effect

variegation, where local chromatin structure affects the

probability that a given cell within a population will

express the integrated gene (Karpen, 1994). Viral

integration into transcriptionally favorable chromatin

structure increases the probability of expression but some

cells within a clonal population will still not express the

transferred gene. Furthermore, integration could occur

initially into a region that is transcriptionally favorable but

becomes less permissive over time due to repressive

alterations in local chromatin structure. The resultant

transcriptional silencing is not due to a gradual decrease in

expression of all cells but rather the complete loss of

expression in an increasing proportion of cells (Hoeben et

al, 1991) Changes in chromatin structure, specifically


476

increased DNA methylation and histone deacetylation, are

often associated with transcriptional silencing (Jahner and

Jaenisch, 1985; Hoeben et al, 1991; Challita and Kohn,

1994; Wang et al, 1998; Chen and Townes, 2000).

Chromatin structure can affect the ability of the

integrated retroviral vector to achieve therapeutically

relevant levels of gene expression. Overcoming this

barrier is especially critical since retroviral vectors are the

most frequently used vector in clinical and scientific

applications where long-term gene expression is desired.

Recent generation lenteviral vectors are still subject to

these chromatin-related effects (Persons et al, 2003b).

While strategies such as drug selection (Persons et al,

2003a) and methods to achieve improved rates of

transduction (Imren et al, 2002) have been applied to

overcome low levels of expression from retrovirally

transduced globin genes, most approaches have focused on

combining various fragments of the LCR and testing them

to see which ones give optimal expression. Recently

genetic insulators and scaffold attachment regions have

been used to protect globin genes from the negative effects

of surrounding chromatin and enhance expression (Emery

et al, 2000,2003; Ramezani et al, 2003). Our approach has

been to investigate development of gene transfer vectors

that are able to autonomously open and maintain

surrounding domains of active chromatin structure

regardless of their site of integration within the genome

(Iler et al, 1999; Nemeth et al, 2001). In this study, we

have examined the strategy of incorporating a relatively

small cis-acting element which is able to alter local

chromatin structure in an erythroid-specific manner within

a globin-expressing retroviral vector.

The HSFE is an erythroid-specific chromatin

remodeling element derived from the human !-globin

LCR. The LCR is comprised of five DNase I

hypersensitive sites (HS) located 5 to 25 kb upstream of

the !-globin locus and is necessary for high-level

expression of the !-globin genes (Tuan et al, 1985;

Grosveld et al, 1987; Epner et al, 1998; Reik et al, 1998).

Originally, the HSFE was derived as a 101 bp element

from the core of HS4 and was found to be both necessary

and sufficient for the formation of a DNase I HS typical of

the LCR HS core structures (Lowrey et al, 1992). The

HSFE contains binding sites for the erythroid-specific

factors NF-E2, GATA-1, and EKLF and the ubiquitous

factor Sp-1, all of which are necessary to establish a

hypersensitive chromatin domain (Pruzina et al, 1991;

Lowrey et al, 1992; Stamatoyannopoulos et al, 1995;

Goodwin et al, 2001). Similar clusters of binding sites are

found within the other erythroid-specific LCR HS cores

where they are also required for HS formation and are

evolutionarily conserved (Philipsen et al, 1990; Talbot et

al, 1990; Philipsen et al, 1993; Hardison et al, 1997;

Pomerantz et al, 1998). Previously, we have demonstrated

that the HSFE can mediate functional tissue-specific

"opening" of a minimal human !-globin promoter and

increase expression of a linked human !-globin gene in

both MEL cell clones and in transgenic mice (Iler et al,

1999; Nemeth et al, 2001). We hypothesized that

incorporation of the HSFE into a !-globin retroviral vector

would result in a similar remodeling of human !-globin

promoter chromatin structure and a subsequent increase in

expression.

II. Materials and methodsA. !-globin retroviral vectorsAll retroviral !-globin constructs were generated using a

parent murine stem cell virus (MSCV) vector (Hawley et al,

1994). A 1.3 kb EcoR I-Hind III fragment was removed and

replaced with a multiple cloning site (MCS) that contained 5' -

EcoR I/Sal I/Xho I/Hind III-3'. A 1.3 kb Xho I-Sal I fragment

containing an IRES-GFP sequence was inserted into the Sal I site

of MSCV-MCS to create MSCV-GFP.

To construct r!G, a human !-globin gene vector (p141)

containing a 372 bp deletion within the second intern was

provided by Dr. Phillipe Leboulch (Harvard University, Boston,

MA). A BamH I-Eco R I fragment from p141 containing the

intern deletion (Genbank #U01317.1; bp 62718-63092) was then

subcloned into a wild-type human !-globin sequence between the

BamH I and EcoR I sites. The modified human !-globin gene

and minimal 110 bp human b-globin promoter was then inserted

into MSCV-GFP as an intact Xho I – Sal I fragment in an anti-

sense orientation with regards to viral transcription.

To construct rH!G, a 190 bp PCR fragment containing the

HSFE was synthesized (Genbank #U01317.1; bp 1060-1222) and

inserted into the Xho I site of r!G. This fragment also serves as

the 5' HSFE in the r2HbG construct. Both rEH!G and r2H!G

were constructed by inserting Xho I-Bgl II fragments excised

from the previously described pEH!G and p2H!G constructs

that contain the cis-acting elements as well as 10 bp of the

minimal promoter into the corresponding Xho I and Bgl II sites

located within the minimal !-globin promoter in r!G (Nemeth et

al, 2001). rHE!G was constructed by inserting a 220 bp Xho I-

Bgl II fragment containing the 36 bp enhancer sequence

upstream of the HSFE into the Xho I and Bgl II sites of r!G.

rE'H!G was constructed by inserting a 385 bp PCR fragment

from HS2 (Genbank #U01317.1; nucleotides 8480-8865) into

rH!G at the Xho I site upstream of the HSFE.

B. Retroviral transductionBriefly, 3 µg of each retroviral construct was transiently

co-transfected along with 3 µg pVPack-GP vector and 3 µg

pVPack-VSV-G vector (Stratagene, La Jolla, CA) into 2 x 106

293T cells by CaPO4 transfection using the CellPhect

transfection kit (Amersham Biosciences, Piscataway, NJ). The

293T cells were maintained in Dulbecco’s Modified Eagle

Medium supplemented with 10% Fetal Bovine Serum (FBS)

(Invitrogen Gibco, Carlsbad, CA). Cells were incubated under

cell culture conditions with the DNA precipitate for 8 hours.

Media was then removed and the cells treated with 15% glycerol

in isotonic HEPES (pH 7.5) for 3 minutes. The glycerol/HEPES

solution was then removed and the cells washed once with media

before being replenished with media and returned to culture

conditions. Twenty-four hours later, the media was removed

from the 293T cells and replaced with pre-warmed media and

collection of viral particles begun. Media containing viral

particles was collected 48 hours later and added to 1 x 105 MEL

cells. Pre-warmed media was then added to the packaging cells,

collected 24 hours later, and added to the MEL cells. Viral

transduction was facilitated through the addition of 6 ng/ml

hexamethedrine bromide (Polybrene$; Sigma, St. Louis, MO) to

MEL cells co-cultured with viral supernatant. MEL cells were

then cultured for 48 hours before FACS analysis.

Transduced MEL cells were collected and assayed for GFP

expression. Approximately 1.5 x 104 GFP+ cells per experimental

vector were sorted in 1 ml FBS. The cells were then centrifuged

and resuspended in 10 ml Improved MEM Zinc Option media


477

(Invitrogen Gibco) supplemented with 10% FBS and maintained

at 37°C. To determine intact transfer of the !-globin and

associated LCR sequence to the MEL cell, 10 µg of genomic

DNA from each pool was digested with Xho I and Sal I.

Digestion products were detected by Southern blotting as

described. The bamboo-EcoR I region of the !-globin gene was

used as the probe. To determine the multiplicity of infection, 10

µg genomic DNA from pools containing the r!G and rH!G

vectors were digested with EcoR I. Digestion products were

detected by Southern blotting using the same !-globin probe.

Copy number for each pool was determined by slot-blot analysis.

C. Nuclease sensitivity assaysDNase I hypersensitivity assays were performed on nuclei

isolated from transduced pools as previously described (Iler et al,

1999). Pools were maintained in culture conditions until they

reached log phase growth (8 x 105 - 1 x 106 cells/ml). Nuclei

corresponding to approximately 200 µg per reaction were

incubated with DNase I (Worthington Biochemical, Lakewood,

NJ) at concentrations ranging from 0 to 4.0 mg/ml DNase I for

10 minutes at 37°C. Regions of DNase I hypersensitivity were

mapped by plotting the migration distance of the molecular

weight markers versus the logarithm of their size in base pairs for

each blot. These data points were then fitted to the equation:

fragment size (bp) = m % e i % migration d i s t a n c e in cm( )&

' ( )

This produces a straight line where "m" is the slope of the

line and "i" is the y-intercept. By measuring the migration

distances of the upper and lower limits of each DNase I HS and

applying the above formula, the size, and therefore location, of

the HS boundaries within the parental fragment was determined.

Restriction endonuclease sensitivity assays using Bln I

were performed on intact nuclei as described (Iler et al, 1999).

For initial experiments, nuclei (200 µg DNA/reaction) were

digested with Bln I at amounts of 0, 10, 20, 40, 80 and 160 units

at 37°C for 20 minutes. In subsequent experiments Bln I amounts

of 0 and 100 units were used because complete cutting was

consistently obtained above 80 units per reaction. Relative band

intensities were determined by densitometry performed on

images captured on a Phosphor Screen and resolved with the

PhosphorImager 445 SI (Molecular Dynamics, Sunnyvale, CA).

The percentage of restriction enzyme digestion was determined

by dividing the intensity of the sub-band by the sum of the

intensities of the sub-band and the parental band (S/(P+S)).

Statistical analysis was performed using Student's t-test.

D. Human !-globin RNA analysisFor all pools, globin expression was induced by 3mM

HMBA for 4 days. RNA was isolated with Trizol (Invitrogen)

Human !-globin and mouse "-globin expression were quantified

using ribonuclease protection analysis using the RPA III kit

(Ambion, Austin, TX). RNA probes were synthesized using the

T7 MaxiScript kit (Ambion). pT7M" and pT7!M were used to

generate probes for mouse "-globin and human !-globin

respectively and were a kind gift from Dr. Qiliang Li (University

of Washington, Seattle, WA). pT7M" protects a 128 bp fragment

and pT7!M protects a 206 bp fragment. Each hybridization

reaction consisted of approximately 1 µg of RNA and 1 x 106

cpm of both probes (the specific activity of each probe generally

ranged from 1-2 x 106 cpm/ng). Hybridization products were

electrophoresed on an 8.0% acrylamide/6 M urea gel and relative

expression levels were quantified by PhosphorImager analysis.

Human !-globin expression was corrected for both copy number

and the different specific activities of the probes and normalized

to mouse "-globin. Statistical analysis was performed using

Student's t-test.

III. ResultsWe subcloned the HSFE element upstream of a

minimal human !-globin promoter and gene in the context

of a MSCV vector (Figure 1a). This vector also contains

the enhanced green fluorescent protein (GFP) gene, which

is transcribed from the viral 5' LTR. In order to prevent

removal of the !-globin introns, which are necessary for

high-level expression, the LCR, promoter, and gene

sequences are oriented in an antisense direction with

respect to viral transcription (Karlsson et al, 1987). A 372

bp region from the second intern of the !-globin gene was

also removed, which has been shown that this deletion

improves both viral titer and the genetic stability of the

vector without adversely affecting !-globin gene

expression (Leboulch et al, 1994). Altogether, six !-globin

vectors were made (Figure 1b). Briefly, r!G contains the

110 bp minimal human !-globin promoter alone, rH!G

contains the HSFE upstream of the promoter, rEH!G

contains a 36 bp erythroid-specific enhancer derived from

HS2 located at the 5' end of the HSFE (Chang et al, 1992),

r2H!G contains tandem HSFE elements separated by

approximately 150 bp, rHE!G contains the 36 bp enhancer

and the HSFE in reverse order, and rE'H!G contains a 374

bp fragment from HS2 (which contains the 36 bp

enhancer) upstream of the HSFE.

These constructs were transduced into MEL cells

using a transient VSV-G packaging cell line. FACS

analysis was then used to select GFP+ MEL cells (Figure

2). After transduction of MEL cells with either r!G or

rH!G, approximately 1-3% of MEL cells were positive for

GFP expression. Similar percentages were observed for

the other constructs (data not shown). GFP+ cells were

sorted and separated into three to four pools per construct.

To ensure the intact transfer of the human !-globin

gene and any associated regulatory elements, genomic

DNA was isolated from the transduced pools and analyzed

for copy number and the integrity of the !-globin gene

sequence (Figure 3a). The !-globin gene, promoter, and

any associated LCR elements were integrated intact into

the MEL genome for all constructs except rE'H!G. This

vector, which contains a 374 bp HS2 enhancer, was

genetically rearranged as indicated by loss of the !-globin

gene.

To determine whether our retroviral pools contained

multiple integration sites, genomic DNA was digested

with EcoR I, which cuts the human !-globin gene at a

single site in all vectors. A representative analysis is

shown in Figure 3b for the r!G and rH!G vectors. For

both constructs, each pool contained multiple integration

sites, as indicated by " smearing" of the Southern blot

signal over a wide range.

A. Chromatin structure of the integrated

human !-globin promoterTo determine the extent of the hypersensitive domain

in our retroviral constructs, we performed DNase I

sensitivity assays on the retroviral pools and mapped the

size and location of detected HSs (Figure 4).

Representative Southern blot analyses depicting formation


478

of the hypersensitive sites are shown in Figure 4b. The

integrated r!G vector, which contains the minimal

promoter by itself, contained a hypersensitive site

approximately 110 bp long and included the first 20 bp of

the promoter itself (Figure 4c). The addition of the HSFE

approximately doubled the region of hypersensitive

chromatin from 110 bp to 230 bp. In both the presence and

absence of the HSFE, only approximately 20bp of the

distal promoter was hypersensitive. However, while the

incorporation of tandem HSFE elements created a

similarly sized 190 bp HS, this HS was shifted to include

most of the minimal !-globin promoter.

Figure 1. Retroviral !-globin vectors used to evaluate HSFE activity. (a) Design of the !-globin retroviral vector. The parent vector

is the murine stem cell retrovirus (MSCV). The vector contains a GFP gene transcribed from the 5' LTR and the human !-globin gene

transcribed from the minimal human !-globin promoter in an anti-sense orientation. A 372 bp region of the second !-globin intron has

been deleted. The chromatin opening elements are subcloned 3' of the promoter in an anti-sense orientation. (b) !-globin retroviral

vectors. Construction of vectors is described in Methods. Elements used to construct the vectors include the 110 bp minimal human !-

globin promoter (Pro), HSFE, the 36 bp erythroid-specific HS2 enhancer (Enh), and a 385 bp fragment from HS2, containing which the

36 bp enhancer (Enh’).


479

Figure 2. Generation of !-globin retroviral vector pools. GFP-FACS analysis of transduced MEL cells. Representative histograms

displaying the percentage of GFP expressing MEL cells after transduction with r!G and rH!G vectors. Wild-type MEL cells and a MEL

clone that expresses GFP served as negative and positive controls respectively.


480

Figure 3. Analysis of integrated !-globin vector DNA. (a) Top:

Vector schematic displaying Xho I (X) and Sal I (S) restriction

sites and the range of sizes of the digestion products. Bottom:

Integrity of retroviral vectors. Southern blot displaying intact !-

globin sequences for 5 out of 6 vectors. Human bone marrow

DNA (H!) was digested with Pst I/Bgl II as a positive control.

Genomic DNA from each pool was isolated and digested with

Xho I/Sal I. (b) Multiple integration sites of retroviral pools.

Genomic DNA isolated from r!G and rH!G pools was digested

with Eco RI which cuts once within the vector.

To quantify the proportion of !-globin promoters

accessible to restriction endonuclease digestion, and

therefore in an open chromatin configuration, we

performed restriction endonuclease assays on all pools

generated from selected constructs. Intact nuclei were

performed restriction endonuclease assays on all pools

generated from selected constructs. Intact nuclei were

digested with Bln I, which uniquely digests at a single site

within the !-globin promoter (Figure 5a).


487


Decreased tumor growth using an IL-2 amplifier

expression vectorResearch Article

Xianghui He1, Farha H Vasanwala2, Tom C Tsang1, Phoebe Luo1, Tong Zhang3

and David T Harris1

1Gene Therapy Group, Department of Microbiology and Immunology, University of Arizona, Tucson, Arizona 85724,

USA2Department of Microbiology and Immunology, Indiana University, Indianapolis, IN 462023Department of Microbiology and Immunology, Dartmouth Medical School, Dartmouth-Hitchcock Medical Center,

Lebanon, NH 03766

__________________________________________________________________________________

*Correspondence: Dr. David T. Harris, Gene Therapy Group, Department of Microbiology and Immunology, PO Box 245049, 1501 N.

Campbell Ave, Life Sciences North, University of Arizona, Tucson, AZ 85724; Tel: +1-520-626-5127; Fax: +1-520-626-2100; E-mail

address: [email protected]

Key words: Cancer, interleukin-2, amplifier vector, gene therapy

Abbreviations: cytomeglovirus, (CMV); enzyme-linked immunosorbent assay, (ELISA); horseradish peroxidase, (HRP); interferon-!,

(IFN-!); interleukin-2, (IL-2)

Received: 3 December 2004; Accepted: 10 December 2004; electronically published: December 2004

Summary

The success of gene therapy relies on sufficient gene expression in the target tissue. The application of non-viral

vectors, such as plasmid DNA, is limited by low in vivo transfection efficiency compared to viral vectors. Strategies

to enhance gene transcription should augment target gene expression and make the vector more efficient. In the

present study we describe a transcription factor- based amplifier strategy to enhance transgene expression. Our

data showed that compared to CMV promoter driven IL-2 expression, expression of TAT in the same plasmid

downstream of the HIV LTR significantly enhanced the expression level of IL-2 (up to 20-fold). Gene-modification

of murine B16 melanoma with the amplifier IL-2 expression vector resulted in decreased tumor growth and

prolonged animal survival in vivo.

I. IntroductionGene therapy is one of the newest strategies for

treating human disease. Since Rosenberg et al. performed

the first human gene therapy trial in 1989, over 900

clinical trials have been completed or are ongoing

worldwide (Edelstein et al, 2004). Non-viral vectors have

been used in approximately 25% of the trails performed to

date. Non-viral vectors are safe and easy to manufacture.

However, their application is hindered by the lower levels

of transgene expression compared to viral vectors. Efforts

to increase transgene production are of great interest.

Strategies explored to increase transgene production

include improvement in the efficiency of gene delivery

through application of new technologies such as

electroporation and polycations, and enhancement in the

activity of gene transcription and translation by

manipulation of expression cassettes such as the use of

strong promoters, proper introns and even chromatin

regulatory elements (Xu et al, 2001; Thomas and

Klibanov, 2003; Jaroszeski et al, 2004; Recillas-Targa et

al, 2004). Currently, the most widely used promoter in

gene therapy trials is the cytomeglovirus (CMV) promoter,

which is considered to be the strongest of the commonly

used promoters (Yew et al, 1997). However, therapeutic

levels of transgene expression are not achieved in many

cases, especially for cytokine-based cancer immuno-gene

therapy.

Because of its prevalence and tendency to recur after

traditional therapy, cancer has been targeted by two-thirds

of gene therapy clinical trials. Cytokine-based immuno-

gene therapy is a major player and one quarter of genes

transferred in clinical trails are cytokine genes (Jaroszeski

et al, 2004). Cytokines such as interleukin-2 (IL-2) and

interferon-! (IFN-!) can augment immune responses. IL-2

gene therapy experiments with laboratory mice have

shown cures of up to 100% of established tumors

(Porgador et al, 1993; Toloza et al, 1996), but the level of

success in human clinical trials has lagged behind. Similar

He et al: Gene therapy using amplifier IL-2 expression vectors

488

results have been seen for other stimulatory cytokines in

cancer therapy. Low levels of transgene expression have

been thought to be a limiting factor in these trails. In a

previous study we developed amplifier gene expression

plasmid vectors to achieve high levels of IL-2 expression

(Tsang et al, 2000). Here, we compare these vectors with

traditional CMV promoter-based vectors and apply them

for immuno-gene therapy of murine melanoma.

II. Materials and MethodsA. Mice and cell linesC57BL/6J mice (aged 6-12 weeks) mice were purchased

from Jackson Laboratories (Bar Harbor, ME). Animals were

maintained under specific pathogen-free conditions in the animal

facility at the University of Arizona. Human lung carcinoma

A549 cells, the human breast carcinoma cell line MCF-7, mouse

melanoma B16 cells and mouse mammary carcinoma 4T1 cells

were obtained from American Type Culture Collection

(Manassas, VA). All cells were maintained in RPMI 1640

medium supplemented with 10% fetal bovine serum (Irvine

Scientific, CA), 2mM glutamine, 1mM pyruvate, 50µM 2-

mercaptoethanol, penicillin (200units/ml), and streptomycin

(200µg/ml) at 37°C in a 5% CO2/95% air atmosphere. For gene-

modified cells, Geneticin (G418, 600µg/ml, Invitrogen, Carlsbad,

CA) was added to the medium.

B. Genetic constructsThe following plasmid vectors were constructed (Figure

1): (1) pCI-IL2-neo: CMV promoter driving the expression of

human IL-2. (2) pHi1-IL2-neo-C-TAT: HIV1 long terminal

repeat driving the expression of human IL-2, and the CMV

promoter driving the expression of HIV Tat. (3) pHi2-IL2-neo-

C-TAT: HIV2 long terminal repeat driving the expression of

human IL-2, and the CMV promoter driving the expression of

HIV TAT.

To construct pCI-IL-2-neo, the human IL-2 gene (a gift

from Dr. Evan Hersh, University of Arizona, Tucson, AZ) was

adapted for the EcoR I site of pCI-neo (Promega, Madison, WI)

with the Sac-Kiss-Lambda vector (Tsang et al, 1996). The IL-2

gene was then excised from pSac-Kiss-IL2 as an EcoR I

fragment and inserted into the EcoR I site of pCI-neo. To

construct pHi2-IL2-neo-C-TAT, the HIV2 LTR was excised

from pGL2-HIV2 (a gift from Dr. Gunther Krauss, Vienna

University Medical School, Austria) by Bgl II digestion followed

by partial digestion with Hind III. The 0.8 kb Bgl II-Hind III

fragment containing the HIV2 promoter then replaced the CMV

promoter in Bgl II and Hind III digested pCI-neo to create

pHIV2-neo. The IL-2 gene excised from pSac-Kiss-IL2 with

EcoR I was inserted into the EcoR I site of pHIV2-neo to yield

the plasmid, pHIV2-IL2 neo. A pCEP4 (Invitrogen, Carlsbad,

CA) –derived CMV promoter was then inserted at the BamH I

site of pHIV2-IL2 neo to create pHi2-IL-2-neo-C. The tat gene

was excised from the plasmid pTAT (Arya et al, 1985) with Xba

I and ligated with Xba I digested Kpn-Kiss-Lambda to create

Kpn-Kiss-TAT. The tat gene was then cut back out with Not I

and inserted into the Not I site following the CMV promoter in

pHi2-IL2-neo-C and resulted in the pHi2-IL2-neo-C-TAT.

Similarly, the HIV1 LTR was excised with Hind III from pGL2-

HIV1 (obtained from Dr. L. Luznick, University of Arizona,

Tucson, AZ) and replaced the HIV-2 promoter in the Hind III

site of pHIV2-IL2 –neo to generate pHIV1-IL2-neo. The CMV

promoter was then inserted into pHIV1-IL2-neo to generate

pHi1-IL2-neo-C. pHi1-IL2-neo-C-TAT was created by inserting

the Not I fragment from Kpn-Kiss-TAT into the Not I site of

pHi1-IL2-neo-C. In addition, to assess transfection efficiencies,

the EGFP (Enhanced Green Fluorescence Protein) gene was also

cloned into the same site as IL-2 in these vectors to generate pCI-

EGFP, pHi2-EGFP-neo-C-TAT, and pHi1-EGFP-neo-C-TAT.

C. Cell transfectionTumor cells were transfected with plasmid DNA using

cationic lipid DMRIE-C (Invitrogene, Carlsbad, CA) according

to the manufacturer’s protocol. Briefly, 1µg DNA of DNA and

4µl of lipid were mixed separately with 500µl of OPTI-MEM

media (GIBCO, Rockville, MD). The two solutions were then

mixed together and allowed to incubate for 45 min. at room

temperature to form lipid/DNA complexes. The target cells were

washed once with OPTI-MEM media, the transfection mixture

added and the cells were incubated with lipid/DNA complexes

for 4 hours. The medium was then replaced with fresh culture

medium. While selecting stable transgene expressing clones, the

tumor cells were selected in 600µg/ml Geneticin containing

medium 48 hours after transfection, and cloned by limiting

dilution in 96-well plates. The transfection efficiency was

determined by measuring the percent of GFP positive cells

within the EGFP-expressing plasmids transfected groups by flow

cytometry.

D. Cytokine expression and bioactivity assaysIL-2 expression was tested by enzyme-linked

immunosorbent assay (ELISA) using either the IL-2 EASIA kit

(Medgenix Diagnostic, Fleurus, Belgium) or the OptEIA Human

IL-2 Set (Pharmingen, San Diego, CA) according to the

manufacturer’s protocol. Briefly, after washing, a standardized

IL-2 solution and cell culture supernatants were then added to the

wells of capture monoclonal antibody-coated 96 well plate.

Following two hours of incubation, the plate was washed. A

biotin-labeled detection antibody and avidin-horseradish

peroxidase (HRP) was then added. After another 1-hour

incubation and washing, the substrate solution was added and

then read at 450nm. A standard curve was plotted and IL-2

concentrations were determined by interpolation from the

standard curve. Results were calculated as IU/ml of IL-2 and the

values of IL-2 were reported as per million cells per ml. The

biological activity of the IL-2 in the culture supernatants of IL-2

expressing plasmid transfected cells was determined by

stimulation of cell proliferation with a mouse cytotoxic T cell

line, CTLL-2, which requires IL-2 for growth (Gillis and Smith,

1977).

E. In vivo tumor growth studiesC57BL/6 mice were injected subcutaneously in the hind

flank with either 0.5 x 106 B16 cells, 0.5 x 106 B-10 cells (B16

cells transfected with the pCI-IL2 plasmid) or 0.5 x 106 BB-15

cells (B16 cells transfected with the pHi2-IL2-neo-C-TAT

plasmid) in 100µl of PBS. Tumor growth was monitored over

time and tumor size was measured with vernier calipers.

III. ResultsA. Construction of amplifier gene

expression vectorsThe CMV promoter is the most commonly used

promoter in gene therapy. We constructed the plasmid

pCI-IL2-neo, in which the CMV promoter drives human

IL-2 gene expression, as a control to develop high level

gene expression vectors. We first replaced the CMV

promoter with either the HIV-1 or the HIV-2 LTR to drive

IL-2 expression (plasmids pHi1-IL2-neo-C and pHi-IL2-

neo-C, respectively). The CMV promoter was placed

downstream of the neo gene, to drive second gene


489

expression in these plasmids. The HIV transcriptional

activator, the tat gene, was then introduced into these

plasmids under the control of the CMV promoter, resulting

in pHi1-IL2-neo-C-TAT and pHi2-IL2-neo-C-TAT

(Figure 1). The expression of the tat gene should enhance

the transcriptional activity of the LTR and result in

enhanced gene product. In addition, to assess transfection

efficiencies, the EGFP gene was also cloned into these

vectors replacing the IL-2 gene, resulting in plasmids

termed pCI-EGFP, pHi2-EGFP-neo-C-TAT, and pHi1-

EGFP-neo-C-TAT.

B. High level gene expression through co-

expression of a transcription factor within the

same plasmidThe IL-2 expression plasmids and the EGFP

expression plasmids were transfected individually into two

different human cell lines, A549 and MCF-7. Supernatants

were collected 24 hours after transfection to measure IL-2

secretion, and the cells transfected with the EGFP

expression plasmids were harvested to assess EGFP

expression by flow cytometry as a measure of transfection

efficiency. Figure 2 shows that higher levels of IL-2 were

achieved by the pHi2-IL2-neo-C-TAT and pHi1-IL2-neo-

C-TAT plasmids, as compared to the plasmid pCI-IL-2-

neo, after transfection of both A549 and MCF-7 cells. In

A549 cells, pHi2-IL2-neo-C-TAT and pHi1-IL2-neo-C-

TAT transfection resulted in 357 IU/ml and 182 IU/ml of

IL-2 respectively, whereas pCI-IL2 resulted in 18 IU/ml.

The EGFP flow cytometry data indicated that the three

different plasmids had similar transfection efficiencies

(around 70%) in A549 cells (Figure 3). Thus, the

differences observed in the IL-2 levels must therefore have

resulted from differences in transcriptional activity of

these plasmids.

The IL-2 expression plasmids were also tested in

mouse tumor cells. B16 melanoma and breast carcinoma

4T1 cells were transfected and IL-2 levels were measured

24 hours post-transfection. As shown in Figure 4 , higher

levels of IL-2 were obtained from the pHi2-IL2-neo-C-

TAT plasmid (140 pg/ml in B16 cells and 136 pg/ml in

4T1 cells) than from the CMV IL-2 plasmid (14 pg/ml in

B16 cells and 18.5 pg/ml in 4T1 cells), indicating that the

HIV promoter and tat gene were active in these mouse cell

lines. The IL-2 levels obtained from the pHi1-IL2-neo-C-

TAT (60 pg/ml in B16 cells) were also higher than IL-2

levels from the pCI-IL2-neo plasmid, but lower than pHi2-

IL2-neo-C-TAT. In addition, the biological activity of the

transgenic IL-2 harvested from the culture supernatants of

IL-2 expressing plasmid transfected cells was confirmed

by CTLL-2 assay (data not shown).

C. Gene-modification of B16 melanomaB16 cells were transfected with either the pCI-IL2-

neo or the pHi2-IL2-neo-C-TAT plasmid and neomycin-

resistant clones were obtained 14 days after selection with

G418. The clones were assayed for IL-2 secretion by

ELISA. Figure 5 shows four representative clones. Clone

B-10 (9.6 pg/ml) was derived from cells transfected with

pCI-IL2-neo, in which the IL-2 gene is under the control

of CMV promoter. Clone BB-15 (165 pg/ml) was derived

from cells transfected with pHi2-IL2-neo-C-TAT, in

which the IL-2 gene is driven by HIV2 LTR and the tat

gene is under the control of CMV promoter. These two

clones had the same doubling time in vitro as the parental

(untransfected) B16 cells and were used in the in vivo

study.

D. Decreased tumorigenicity of amplified

IL-2 expressing B16 tumorsThe same number of parental B16, B-10 and BB-15

cells (0.5 x 106 per mouse) were injected subcutaneously

into syngeneic C57BL/6 mice in the hind flank. Tumor

size was monitored for 46 days. Figure 6A shows the

average tumor growth in each group of mice over time.

The results demonstrated that tumor cells transfected with

the highest IL-2 producing clone, BB-15 (B16 cells

transfected with pHi2-IL2-neo-C-TAT) showed slower

tumor growth, although it did not prevent tumor

development. The tumor sizes were smaller for B-10

injected mice (B16 cells transfected with pCI-IL2-neo)

than mice injected with the parental B16 tumor. Mice

injected with the BB-15 cells had smaller tumors than the

mice injected with the B-10 cells.

Figure 1 . Diagrammatic representation of the different IL-2 constructs. The expression cassettes of plasmids pCI-IL-2-neo, pHi1-IL2-

neo-C-TAT, and pHi2-IL2-neo-C-TAT are shown. CMV: cytomegalovirus; HIV1 LTR: human immunodeficiency virus 1 long terminal

repeat; HIV2 LTR: human immunodeficiency virus 2 long terminal repeat; pA: polyadenylation signal; SVneo: SV40 promoter driving

the neomycin resistant gene. TAT: HIV tat (trans-activator of transcription).


490

On day 18 after injection, the average tumor size for the

B16 injected group was 327mm2, while the average tumor

size of the B-10 group was 119mm2 and that of the BB-15

group was 41mm2.

The mean survival time for each group of mice is

shown in Figure 6B. There was an increase in survival

time in mice that had been injected with tumor cells

transfected with the pHi2-IL2-neo-C-CMV plasmid 46

days (BB-15) as compared to the group of mice injected

with either the parental B16 tumor (21 days) or the group

of mice injected with the clone B10 tumor (36 days).

Figure 2. IL-2 levels secreted by transfected MCF-7 and A549 cells. MCF-7 and A549 cells were transfected with DMRIE-C and cell

culture supernatants were harvested 24 hours later. IL-2 secretion was determined using an IL-2 EASIA kit. Data represent the IL-2

production in IU/ml from 1"106 MCF-7 and 1"106 A549 cells transfected with pHi2-IL2-neo-C-TAT, pHi1-IL2-neo-C-TAT or the pCI-

IL2-neo plasmid. Data is representative of three experiments.


491

Figure 3. Flow cytometric analysis of EGFP expression by transfected A549 cells. A549 cells were transfected with either the pCI-

EGFP (B), pHi1-EGFP-neo-C-TAT (D) or pHi2-EGFP-neo-C-TAT (C) plasmid. Cells were harvested 24 hours after transfection and

analyzed by flow cytometry. Wild type A559 cells (A) were used as control.

Figure 4. IL-2 production by transfected B16 and 4T1 tumor cells. 1 "106 B16 (A) and 4T1 tumor (B) cells were transfected with pHi2-

IL2-neo-C-TAT, pHi1-IL2-neo-C-TAT or the pCI-IL2-neo plasmid. Supernatants were analyzed 48 hours after transfection for IL-2

levels by ELISA and are reported as pg/ml IL-2. (*p<0.05). Data is representative of three experiments.


492

Figure 5. Decreased growth of IL-2 expressing B16 tumors in C57BL/6 mice. Three groups of C57BL/6 mice were injected with either

B16 cells, clone B-10 (pCI-IL2-neo gene-modified B16 cells) or clone BB-15 (pHi2-IL2-neo-C-TAT gene-modified B16 cells), and

tumor growth was monitored. Each group consisted of four mice. Average tumor sizes with standard deviations within each group are

shown in mm2 (*p<0.05).

Figure 6 . Survival curves of mice challenged with wild type B16 or IL-2 gene-modified B16 tumor cells. Three group of mice (four

mice per group) were injected with either parental B16 tumor cells, clone B-10 (pCI-IL2-neo gene-modified B16 cells) or clone BB-15

(pHi2-IL2-neo-C-TAT gene-modified B16 cells), and the survival of injected mice was monitored.


493

IV. DiscussionThe success of gene therapy relies on sufficient gene

expression in the target tissue. Non-viral vectors, such as

plasmid DNA are safe, ease to produce and administer,

and low in immunogenicity. However, the application of

non-viral vectors is limited by the relatively low target

gene expression in vivo. Although improved gene delivery

protocols, such as electroporation can increase the overall

amount of gene product by increasing transfection

efficiency, strategies to enhance gene transcription should

further augment target gene expression. In the present

study, we describe a transcriptional amplifier strategy to

enhance IL-2 gene expression through co-expression of a

transactivator gene in the plasmid vector. Applying this

gene-modification to mouse melanoma resulted in

decreased tumor growth and prolonged animal survival in

vivo.

The expression levels of a transgene depend

primarily on the strength of transcription and the gene

delivery efficiency (McKnight and Tjian, 1986). Great

efforts have been made to develop gene transfer vectors.

Viral vectors are widely used in gene therapy clinical trails

because of their relatively high gene delivery efficiency.

However, their efficiency may be compromised by the

immune responses induced after repeated administration.

Non-viral vectors are less immunogenic, but need to be

improved in order to achieve sufficient gene expression.

Traditionally, extensive efforts have been made in search

of gene promoters capable of the highest levels of

expression (Pasleau et al, 1985; Martin-Gallardo et al,

1988). Studies comparing different cellular and viral gene

promoters have generally concluded that the CMV

promoter is the strongest available promoter (Boshart et al,

1985; Oellig and Seliger, 1990). Indeed, the CMV

promoter is the most commonly available commercial

promoter and is widely used in human clinical trails. Other

transcriptional regulatory elements, such as introns and

polyadenylation signal sequences have also been evaluated

(Xu et al, 2001), and with the latter found to have

significant effects on transgene expression. In the present

study, we describe a HIV promoter and transcription

factor-based amplifier strategy to enhance transgene

expression. HIV Tat (trans-activator of transcription)

protein binds to the TAR (transactivation response

element) in the R region of HIV LTR (long terminal

repeat) to greatly increase the efficiency of transcription

elongation (Cullen, 1991). Our data showed that compared

to CMV promoter driven IL-2 expression, expression of

TAT in the same plasmid downstream of the HIV LTR-

driven IL-2 expression cassette significantly enhanced the

expression level of IL-2. pHi1-IL2-neo-C-TAT, which has

the HIV1 LTR driving IL-2 expression, gave rise to an

over 20-fold increase of IL-2 expression in human A549

cells (357 IU/ml of HIV1 LTR vs. 18 IU/ml of CMV in

A549 cells). Of note, lower levels of IL-2 secretion were

seen upon transfection of these plasmids into murine cell

lines as compared to the absolute IL-2 levels obtained in

human cell lines. This result may be due to the fact that the

tat gene is known to interact with human cellular factors

needed for HIV transcription (Wang et al, 2000). The

absence/modification of such host factors in murine cell

lines may account for the lower IL-2 levels observed.

IL-2 is a T-cell growth factor capable of stimulating

antigen-specific cytotoxic T lymphocytes (CTL) and non-

specific immune responses such as those mediated by

natural killer (NK) cells. Recombinant IL-2 (rIL-2) has

been used to treat malignant melanoma and renal cell

carcinoma (Parkinson et al, 1990; Toloza et al, 1996).

However, systemic administration of IL-2 can cause

serious side-effects such as pulmonary vascular leak and

liver toxicity (Siegel and Puri, 1991). IL-2 gene therapy

provides a promising alternative. Animal models have

shown that tumor cells genetically engineered to express

the IL-2 gene can cause rejection of IL-2 –modified and

unmodified tumor cells (Porgador et al, 1993). In addition,

vaccination with IL-2 gene-modified tumor cells can

induce rejection of pre-established metastatic lesions (Palu

et al, 1999). Clinical trials including vaccination with

tumor cells engineered to express IL-2 or direct intra-

tumoral injection of IL-2 expressing plasmid vectors (with

or without lipid) have shown that these IL-2 gene therapy

approaches had very low toxicity and in some cases, there

was evidence that anti-tumor immunity was induced

(Galanis et al, 1999; Palmer et al, 1999; Walsh et al,

2000). Unfortunately, few patients showed significant

clinical responses. One reason for the lack of clinical

responses may be insufficient IL-2 production. In the

present study, we developed new vectors that can produce

higher levels of IL-2 than the CMV promoter-based

vectors. Our animal data showed that the amplifier IL-2

expression vectors resulted in decreased tumor growth and

prolonged animal survival compared to CMV promoter-

based vectors.

In summary, we developed a high level IL-2

expression plasmid vector though a HIV LTR and TAT-

based amplifier strategy. Increased IL-2 expression

resulted in decreased tumor growth of gene-modified

mouse melanoma cells. The amplifier strategy described

here resulted in significantly increased transgene

expression. The application of the amplifier strategy is not

limited to non-viral systems. In a viral system, increasing

transgene expression could help to decrease the amount of

viral vector required to achieve a clinical effect as well as

any side effects. In addition, other than expressing

cytokines for immunotherapy, the amplifier strategy can

be used to express other therapeutic molecules, such as

small interfering RNA (siRNA) directed against cancer or

infectious diseases. This strategy may also apply to

mammalian expression systems to more efficiently

produce large molecules such as antibodies or growth

factors.

ReferencesArya SK, Guo C, Josephs SF, and Wong-Staal F (1985) Trans-

activator gene of human T-lymphotropic virus type III

(HTLV-III) Science 229, 69-73.

Boshart M, Weber F, Jahn G, Dorsch-Hasler K, Fleckenstein B,

and Schaffner W (1985) A very strong enhancer is located

upstream of an immediate early gene of human

cytomegalovirus. Cell 41, 521-530.

Cullen BR (1991) Human immunodeficiency virus as a

prototypic complex retrovirus. J Virol 65, 1053-1056.


494

Edelstein ML, Abedi M R, Wixon J, and Edelstein RM (2004)

Gene therapy clinical trials worldwide 1989-2004-an

overview. J Gene Med 6, 597-602.

Galanis E, Hersh EM, Stopeck AT, Gonzalez R, Burch P, Spier

C, Akporiaye ET, Rinehart JJ, Edmonson J, Sobol RE,

Forscher C, Sondak VK, Lewis BD, Unger EC, O'Driscoll

M, Selk L, and Rubin J (1999) Immunotherapy of advanced

malignancy by direct gene transfer of an interleukin-2

DNA/DMRIE/DOPE lipid complex: phase I/II experience. J

Clin Oncol 17, 3313-3323.

Gillis S and Smith KA (1977) Long term culture of tumour-

specific cytotoxic T cells. Nature 268, 154-156.

Jaroszeski MJ, Heller LC, Gilbert R, and Heller R (2004)

Electrically mediated plasmid DNA delivery to solid tumors

in vivo. Methods Mol Biol 245, 237-244.

Martin-Gallardo A, Montoya-Zavala M, Kelder B, Taylor J,

Chen H, Leung FC, and Kopchick JJ (1988) A comparison of

bovine growth-hormone gene expression in mouse L cells

directed by the Moloney murine-leukemia virus long

terminal repeat, simian virus-40 early promoter or

cytomegalovirus immediate-early promoter. Gene 70, 51-56.

McKnight S and Tjian R (1986) Transcriptional selectivity of

viral genes in mammalian cells. Cell 46, 795-805.

Oellig C and Seliger B (1990) Gene transfer into brain tumor cell

lines: reporter gene expression using various cellular and

viral promoters. J Neurosci Res 26, 390-396.

Palmer K, Moore J, Everard M, Harris J.D, Rodgers S, Rees RC,

Murray AK, Mascari R, Kirkwood J, Riches PG, Fisher C,

Thomas JM, Harries M, Johnston SR, Collins MK, and Gore

ME (1999) Gene therapy with autologous, interleukin 2-

secreting tumor cells in patients with malignant melanoma.

Hum Gene Ther 10, 1261-1268.

Palu G, Cavaggioni A, Calvi P, Franchin E, Pizzato M,

Boschetto R, Parolin C, Chilosi M, Ferrini S, Zanusso A, and

Colombo F (1999) Gene therapy of glioblastoma multiforme

via combined expression of suicide and cytokine genes: a

pilot study in humans. Gene Ther. 6, 330-337.

Parkinson DR, Abrams JS, Wiernik PH, Rayner AA, Margolin

KA, Van Echo DA, Sznol M, Dutcher JP, Aronson FR, and

Doroshow JH (1990) Interleukin-2 therapy in patients with

metastatic malignant melanoma: a phase II study. J Clin

Oncol 8, 1650-1656.

Pasleau F, Tocci M.J, Leung F, and Kopchick JJ (1985) Growth

hormone gene expression in eukaryotic cells directed by the

Rous sarcoma virus long terminal repeat or cytomegalovirus

immediate-early promoter. Gene 38, 227-232.

Porgador A, Gansbacher B, Bannerji R, Tzehoval E, Gilboa E,

Feldman M, and Eisenbach L (1993) Anti-metastatic

vaccination of tumor-bearing mice with IL-2-gene-inserted

tumor cells. Int J Cancer 53, 471-477.

Recillas-Targa F, Valadez-Graham V, and Farrell CM (2004)

Prospects and implications of using chromatin insulators in

gene therapy and transgenesis. Bioessays 26, 796-807.

Siegel JP and Puri RK (1991) Interleukin-2 toxicity. J Clin

Oncol 9, 694-704.

Thomas M and Klibanov AM (2003) Non-viral gene therapy:

polycation-mediated DNA delivery. Appl Microbiol

Biotechnol 62, 27-34.

Toloza EM, Hunt K, Swisher S, McBride W, Lau R, Pang S,

Rhoades K, Drake T, Belldegrun A, Glaspy J, and Economou

JS (1996) In vivo cancer gene therapy with a recombinant

interleukin-2 adenovirus vector. Cancer Gene Ther. 3, 11-

17.

Tsang TC, Brailey JL, Vasanwala FH, Wu RS, Liu F, Clark PR,

Meade-Tollin L, Luznick L, Stopeck AT, Akporiaye ET, and

Harris DT (2000) Construction of new amplifier expression

vectors for high levels of IL-2 gene expression. Int J Mol

Med 5, 295-300.

Tsang TC, Harris DT, Akporiaye ET, Schluter SF, Bowden G.T,

and Hersh EM (1996) Simple method for adapting DNA

fragments and PCR products to all of the commonly used

restriction sites. Biotechniques 20, 51-52.

Walsh P, Gonzalez R, Dow S, Elmslie R, Potter T, Glode LM,

Baron AE, Balmer C, Easterday K, Allen J, and Rosse P

(2000) A phase I study using direct combination DNA

injections for the immunotherapy of metastatic melanoma.

University of Colorado Cancer Center Clinical Trial. Hum

Gene Ther 11, 1355-1368.

Wang WK, Chen MY, Chuang CY, Jeang KT, and Huang LM

(2000) Molecular biology of human immunodeficiency virus

type 1. J Microbiol Immunol Infect 33, 131-140.

Xu ZL, Mizuguchi H, Ishii-Watabe A, Uchida E, Mayumi T, and

Hayakawa T (2001) Optimization of transcriptional

regulatory elements for constructing plasmid vectors. Gene

272, 149-156.

Yew NS, Wysokenski DM, Wang KX, Ziegler RJ, Marshall J,

McNeilly D, Cherry M, Osburn W, and Cheng SH (1997)

Optimization of plasmid vectors for high-level expression in

lung epithelial cells. Hum Gene Ther 8, 575-584.

From the left to the right: Dr. Xianghui He, Dr. David T Harris, Dr. Tom C Tsang


495


Multiple detection of chromosomal gene correction

mediated by a RNA/DNA oligonucleotideResearch Article

Alvaro Galli, Grazia Lombardi, Tiziana Cervelli and Giuseppe Rainaldi*Laboratorio di Terapia Genica e Molecolare, Istituto di Fisiologia Clinica CNR , Area della Ricerca CNR, via G. Moruzzi

1, 56124 Pisa, Italy

__________________________________________________________________________________

*Correspondence: Giuseppe Rainaldi, Laboratorio di Terapia Genica e Molecolare, Istituto di Fisiologia Clinica CNR, Area della

Ricerca CNR, via G. Moruzzi 1, 56124 Pisa, Italy; Tel +39 050 3153108; Fax + 39 050 3153328; e-mail: [email protected]

Key words: chimeric RNA/DNA oligonucleotide, gene correction, chromosomal target, HeLa cells, HygB/EGFP fusion gene.

Abbreviations: Dulbecco’s medium, (DMEM); enhanced green fluorescence gene, (EGFP); Restriction fragment length polymorphism,

(RFLP); RNA/DNA oligonucleotide, (RDO);

Received: 25 November 2004; Revised: 10 December 2004

Accepted: 15 December 2004; electronically published: December 2004

Summary

Chimeric RNA/DNA oligonucleotide (RDO)-mediated gene correction of a single base mutation in a gene of an

eukaryotic cell is still a controversial strategy. To better define the potential and applicability of this strategy, new

systems, that allow to detect RDO-mediated gene correction in the chromosomal DNA of human cells, are needed.

Here, we developed a construct containing hygromycin resistance mutant gene fused to the EGFP gene as target for

correction. HeLaS3 cells were transfected with the fusion gene and clones, which had integrated one or two copies

of the mutated fusion gene, were isolated and expanded. These cells were transfected with a RDO with a mismatch

at the position 336 of the bacterial hygromycin resistance gene. If the gene correction occurs, the expression of both

hygromycin resistance and EGFP genes is recovered. The RFLP and FACS analysis demonstrated that hygromycin

resistance phenotype was due to the correction of the mutation.

I. IntroductionA chimeric RNA/DNA oligonucleotide (RDO) is a

double stranded molecule consisting of RNA and DNA

residues, usually 70-80 bases in length, capped at both

ends by sequences which fold in a hairpin (Kmiec et al,

1994; Cervelli et al, 2002). The chimeric RDO contains a

single nucleotide that differs from the target sequence and,

therefore, forms a specific mismatch.

The method of targeted gene correction by specific

RDO or modified DNA oligonucleotide was developed to

generate or correct point mutations (Rice et al, 2001;

Brachman and Kmiec, 2002; Liu et al, 2003). This strategy

has been successfully used in several genetic systems both

in vitro using mammalian cells or mammalian and plant

cell free extracts, and in vivo using several animal models

(Cole-Strauss et al, 1996; Yoon et al, 1996; Kren et al,

1997, 1999; Xiang et al, 1997; Alexeev and Yoon, 1998;

Bartlett et al, 2000; Gamper et al, 2000; Rando et al, 2000;

Liu et al, 2001; Kenner et al, 2002, 2004; Parekh-Olmedo

and Kmiec, 2003). Recent data have contributed to

understand the mechanisms and the genetic requirements

of gene correction (Rice et al, 2001; Liu et al, 2001,

2002a, b; Parekh-Olmedo et al, 2002). It has been

proposed that the DNA strand of RDO is responsible for

gene correction activity and that the active DNA strand

has to be generated inside the cell nearby the target site of

correction (Andersen et al, 2002; Liu et al, 2003;

Igoucheva et al, 2004). The stimulation of gene correction

was also observed after DNA damage induction and

following the activation of homologous recombination

indicating that in mammalian cells the efficiency of gene

correction may depend on the ability of the cells to

undergo homologous recombination (Ferrara and Kmiec,

2004; Ferrara et al, 2004). However, the frequency of gene

correction still remains highly variable and the reason for

these differences is not yet clear. The lack of standardized

assays for evaluating the gene correction at phenotypic

level without the PCR analysis and the not yet proved

mechanism that can direct the RDO-mediated correction

of a chromosomal gene are the two main concerns about

the applicability (Zhang et al, 1998; Rice et al, 2001; Yoon

et al, 2002; Kmiec 2003). In this work, we generated two

HeLa–derivative cell lines that contain in the genome a

fusion construct composed by a mutated antibiotic-

resistance gene (Hygromycin B) and the enhanced green

fluorescence gene (EGFP). We report that, when gene

Galli et al: Chromosomal gene correction by a RNA/DNA oligonucleotide

496

correction was measured following RDO transfection,

cells both resistant to hygromycin and expressing EGFP

were recovered indicating that RDO is able to induce gene

correction at chromosomal level.

II. Materials and methodsA. Cell line and culture conditionsHeLaS3 cells (from Margherita Bignami, ISS, Rome, Italy)

were routinely cultured in Dulbecco’s medium (DMEM)

supplemented with 10% fetal calf serum, 100UI/ml penicillin and

100 µg/ml streptomycin at 37°C in a humidified atmosphere

containing 6% CO2.

B. Construction of the plasmid pHygNSNeo,

transfection and Southern analysisPlasmid pHygNSNeo was constructed from pHygEGFP

(Clontech) (Figure 1A) and pMC1neo (Stratagene). pHygEGFP

was restricted with HindIII and SalI. This resulted in 2 fragments

that are 2123 bp and 3669 bp long, respectively. The 2123 bp

fragment was further digested with NcoI obtaining 2 fragments

that are 714 bp and 1409 bp long. The 714 bp NcoI-HindIII

fragment was PCR amplified from pHygEGFP. The forward

primer, 5'-TAGAAGCTTTATTGCGGTAGTTTATCACAG-3',

was designed with HindIII restriction site at 5’end. The reverse

primer, 5'-TTTCCATGGCCTCCGCGACCGGCTACA-3', was

designed with NcoI restriction site at the 5’end such to introduce

a point mutation (A) at the position 336 of hygB gene. This

mutation produces a stop codon and the loss of the PstI

restriction site. Amplification was performed by denaturation at

94°C for 3 min, followed by 35 cycles of 94°C for 30 sec, 67°C

for 45 sec, and then extension at 72°C for 2 min. The direct

ligation of the new 714 bp NcoI-HindIII fragment containing the

stop codon with the 1409 bp NcoI-SalI fragment and the 3669 bp

HindIII-SalI fragment formed the plasmid pHygNS. Afterward,

the neomycin resistance gene (neo) was inserted into the SalI site

of pHygNS by cloning the 1100 bp XhoI-SalI fragment from

pMC1neo. The new vector containing a stop codon 336 bases

downstream to the ATG of the hygB-EGFP fusion and the neo

marker was named pHygNSNeo. The presence of the stop codon

was confirmed by sequence analysis.

Plasmid pHygNSNeo was transfected in HeLaS3 by

electroporation. A sample of 3.5x106 exponentially growing cells

and 10 µg of pHygNSNeo linearized with restriction enzyme

ClaI were resuspended in 250 µl DMEM without serum and

antibiotics. The suspension was then transferred to 50 x 4 mm

cuvette (Equibio) and incubated on ice for 10 min. Afterward, the

cuvette was exposed to one pulse (330 V, 1000 µF, 200 !) using

the Electroporator II apparatus (Invitrogen) connected to a power

supply (330 V, 25 mA, 25 W). The cell suspension was then

cooled for 15 min on ice, resuspended in complete medium and

seeded in four 100 mm diameter dishes at density of 5x105 cells

per dish. After 24 hours, 1000 µg/ml G418 (Invitrogen) were

added to every dish. After 15-21 days, one G418 resistant

(G418R) colony per dish was isolated, expanded to clonal

population and analyzed for the presence of pHygNSNeo as

follows. Genomic DNA was digested with HindIII and analyzed

by standard Southern blot procedures. Briefly, 10µg DNA per

sample was electrophoresed on 0.8% agarose gel, transferred to

nylon positively charged membrane (Roche) and hybridized with

digoxigenin labeled HygEGFP as probe. The labeling was

carried out by Random primed DNA labeling kit (Roche).

C. Synthesis and transfection of the chimeric

RNA/DNA oligonucleotide (Ch867)

The chimeric RDO, named Ch867, was obtained by using

the standard phosphoramidite chemistry in an automatic

synthesizer Expedite 8909 (Millipore). After ammonia

deprotection, Ch867 was purified, desalted and stocked at –20°C.

The structure of Ch867 is depicted in Figure 1C.

Cells of HeLa S3/G418R clones were seeded at density of

4x105 cells per 30 mm diameter dish in 3 ml of growth medium.

18 µg of Ch867 were diluted with DMEM without serum and

antibiotics to a total volume of 100 µl and incubated with 22 µl

of PolyFect Lipofection Reagent (Qiagen). The lipofection

complex was added according to the manufacture’s

recommendation.

Each transfected clone was grown for 96 h in normal

medium to allow the correction and the expression of hyg gene.

At that time, 3x105 cells were seeded on 100 mm diameter dish

in selective medium containing 300 µg/ml hygromycin (Roche),

a selective dose derived from dose response curve carried out for

HeLaS3 (data not shown). The selective medium was changed

every 4 days and after 12 days, hygromycin resistant colonies

were harvested, expanded as polyclonal population in complete

growth medium without hygromycin, and analyzed by RFLP and

FACS analysis.

D. Flow cytometryThe count of fluorescent HeLaS3 cells was performed by

flow-cytometry on a fluorescence-activated cell sorting apparatus

(FACScan, Lysys II software, Becton Dickinson, San Jose, CA).

Briefly, 5x105 cells were resuspended in 100 µl PBS and the

fluorescence of 104 cells was determined.

E. Restriction fragment length polymorphism

(RFLP)Genomic DNA extracted from polyclonal populations was

amplified by PCR. The forward and reverse primers sequences

were 5’-TGATGCAGCTCTCGGAGG-3’ and 5’-

AGTGTATTGACCGATTCCTTG-3’ respectively. The PCR

conditions to generate a 361-bp fragment were 94°C for 30 sec,

54°C for 30 sec, 72°C for 45 sec for 35 cycles. 10 µl PCR

product was incubated overnight with PstI in a final volume of

20 µl. Later on, 10 µl were loaded onto 2% agarose gel (1X TBE,

EtBr 1 µg/ml), electrophoresed for 2 h at 50 V, and the migration

profile analyzed.

40 ng of 361 bp PCR product were submitted to the

automatic sequencing to verify the occurrence of base correction.

III. ResultsTo study the chimeric RDO-mediated gene

correction in the chromosomal DNA of HeLaS3 cells we

first constructed the plasmid pHygNSNeo containing a

point mutation within the coding region of bacterial hygB

gene at the position 336 (C"T) generating a stop codon

(TAG) and the loss of PstI restriction site (Figure 1A).

Therefore, the hygB gene is not functional and the fused

EGFP gene is not translated. Thereafter, we transfected

HeLaS3 cells with pHygNSNeo and then selected them in

medium containing G418. Two independent G418

resistant colonies were isolated, expanded to clonal

population and analyzed for the presence of hygB gene.

Genomic DNA was digested with HindIII, which cuts only

once in pHygNSNeo, blotted and hybridized with DIG-

labeled HygEGFP fusion gene as probe. As shown in the

Figure 1B, the clone 20105.3A (lane 3) has at least 2

copies and the clone 20105.6A (lane 4) only one copy of

the integrated vector. Furthermore, the migration profile


497

Figure 1. Plasmid pHygNSNeo and chimeric RNA/DNA oligonucleotide Ch867. (A) Diagram of the pHygNSNeo plasmid containing a

single point mutation, thymine, at the position 336 in the coding region of hygB gene (bold letter). (B) Southern blot analysis of G418

resistant clones. Sample of DNA (10 µg) were digested with HindIII and analyzed by Southern blotting. The fused gene was used as

probe. Lane 1: pHygNSNeo, lane 2: HeLaS3, lane 3: 20105.3A and lane 4: 20105.6A. (C) Sequences of the target site before and after

correction by Ch867. Ch867 consists of a 35 bp long duplex bracket by 4 base long hairpin loops. Each RNA residue (small letters) is

modified by the inclusion of a 2’-O-methyl group on ribose sugar. The DNA (capital letters) contains the designed base for correction.

analysis indicated that the integration occurred at different

genomic sites. A chimeric RDO, named Ch867, was

designed according to Gamper and colleagues who

demonstrated that the most efficient chimeric RDO has

one strand containing 2’-O-methyl RNA homologous to

the target site and a DNA strand bearing the mismatched

base (Figure 1C)(Gamper et al, 2000). A gene correction

event mediated by Ch867 not only will recover the hygB

wild type sequence, but also restore the PstI site and,

consequently, the right frame leading to the expression of

the fusion HygEGFP. We then transfected the chimeric

RDO Ch867 in the two clones 20105.3A and .6A

according to the transfection protocol that gives high level

of nuclear localization of the RDO (Cervelli et al, 2002).

The Ch867 transfection increased significantly (p#0.01)

the frequency of hygR clones by 6.7 fold (20105.3A) and

3.7 fold (20105.6A) above the spontaneous level (Table

1). Vice versa, 20105.3A and 20105.6A cells transfected

with an unrelated RDO showed no increase in hygromycin

resistance frequency as compared to the non-transfected

control has been observed (data not shown) (Cervelli et al,

2002).

To test whether the enhancement of hygromycin

resistance frequency was due to the correction of the stop

mutation of hygB gene, hygromycin resistant colonies

formed after 12 days of growth in selective medium were

analyzed as a whole population (pools of 10-20 clones) for

the presence of PstI restriction site in the integrated hygB

target. Therefore, genomic DNA extracted from

polyclonal hygR populations was subjected to PCR and the

amplification products were digested with PstI. The

digestion of the 361 bp PCR fragment with PstI yielded a

fragment of 98 bp and one of 263 bp as shown by the PstI

digestion of pHygNSNeo (Figure 2A, panel 1). As shown

in the Figure 3A, the PstI site was present in the two

populations 20105.3A and 20105.6A transfected with

Ch867 (Figure 2A panel 3 and 4). On the other hand, the

PstI site is not present in 361bp hygB fragment amplified


498

Table 1. Effect of Ch867 on hygromycin resistance frequency in HeLaS3 cells

hygromycin resistance frequency x 10-5 a

G418R clones - Ch867 + Ch867 Fold increaseb

20105.3A 0.78±0.66 5.25±0.98** 6.7

20105.6A 2.08±1.39 7.75±2.06** 3.7

Results are reported as mean±standard deviation of at least 3 independent experiments. Results are statistically analysed with the Student

“t” test; ** p#0.01a hygromycin resistance frequency has been calculated dividing the number of hygR colonies by the number of viable cells.b Fold increase represents the ratio between the two hygR frequencies obtained with and without transfection of Ch867.

Figure 2. (A) RFLP analysis of the 361 bp PCR fragment from pHygNSNeo (panel 1), from hygR polyclonal population of 20105.3A

and .6A transfected with Ch867 (panel 3 and 4), and from hygR polyclonal population of non transfected 20105.3A (panel 2). 500-600ng

DNA were digested with PstI and loaded in each lane (+). The same amount of DNA was loaded as control (-). (B) Sequence of the PCR

fragment from a PstI positive polyclonal population. Only the region flanking the nucleotide 336 is shown. Arrow indicates the targeted

base for correction.

by genomic DNA extracted from the polyclonal

hygromycin resistant population derived from 20105.3A

non transfected (Figure 2A, panel 2) and 20105.6A (data

not shown). Moreover, PstI restriction of PCR fragment

from pHygNSNeo was complete, whereas, PstI restriction

of PCR fragments from polyclonal transfected populations

was only partial (Figure 2A, panel 1, 3 and 4). This

observation was also confirmed by the sequencing of a

PstI-positive polyclonal population that showed a mixture

of T (mutated nucleotide) and C (correct wild type

nucleotide) at position 336 of hygB gene (Figure 2B).

This indicated that Ch867 corrected the mutant sequence.

To ascertain whether the base correction, which

restored the PstI site, allows the expression of the fused

EGFP gene, spontaneous and Ch867-induced hygromycin

resistant clones were analyzed by FACS. Fluorescence

profile of PstI negative clone (thick line) was overlapped

that of parental population (thin line), whereas that PstI

positive clone was only in part overlapped that of parental

population (Figure 3A and 3B). Thus, the fluorescence of

the PstI positive clone was higher than PstI negative clone

demonstrating that the correction also restored the EGFP

expression.

IV. DiscussionThe reason for the differences in the gene correction

rate observed in several experiments is not yet elucidated

(Santana et al, 1998; Rice et al, 2001; Brachman and


499

Figure 3. Flow cytometry of spontaneous PstI negative hygR clone (A) and PstI positive hygR clone of 20105.3A cells (B). The

fluorescence profile of both clones (red area) (thick line) is compared to the profile of the parental cell population (thin line).

Kmiec 2002). The major concerns on the chimeric RDO

mediated-gene correction derive from the use of PCR

amplification as primary screen for the detection of the

correction event (Zhang et al, 1998). The set up of new

systems where the gene correction events leads to the

reversion of a mutation in a gene conferring more than one

phenotype is ideal to overcome the problem. Here, we

described an additional eukaryotic assay to study

chromosomal gene correction in human cells in which the

gene correction event is screened by multiple detection. A

fusion HygEGFP gene was mutated by the insertion of a

stop codon in the HygB sequence. Therefore, cells having

this construct integrated in the genome are hygromycin

sensitive and do not express EGFP. We designed a

chimeric RDO, named Ch867, to correct the stop mutation

of the hygB gene. After transfection with Ch867, HeLaS3

containing the hygB mutated gene integrated as single or

multiple copies showed an enhancement of hygromycin

resistance frequency over the spontaneous baseline, and

restored both PstI site and EGFP expression. The RDO

transfection increased 6.7 fold the frequency of gene

correction in the cells containing at least two copies of the

hygB mutated gene, and 3.7 fold in cells with one copy of

the hygB mutated gene suggesting that the copy number of

the integrated target may have an influence on gene

correction. However, the direct comparison of the

frequencies demonstrated that the difference is not

statistically significant (p= 0.114).

A confounding effect in the detection of gene

correction is represented by the presence of hygR

spontaneous clones. For that, we were forced to carry out

the analyses in the polyclonal populations. To rule out the

possibility to get false positive results due to PCR artifact,

in other words, to exclude that chimeric RDO itself could

serve as primer and template in the PCR amplification

(Zhang et al, 1998), we analyzed hygR polyclonal

population of transfected and non transfected cells after

growing them for 12 days in presence of hygromycin. The

RFLP analysis (Figure 2A) and the sequencing of PCR

fragments (Figure 2B) revealed a mixture of correct and

mutant sequences in hygR polyclonal populations derived

from Ch867 transfected cells. Fluorescence intensity of a

PstI positive hygR clone obtained from Ch867 transfection

was significantly higher than that of PstI negative hygR

clone. All these results demonstrated that Ch867 precisely

corrected the base mutation given that the expression of

the fused HygEGFP gene was obtained. Therefore, a

system in which the gene correction is tested by multiple

detection, such as hygromycin resistance, RFLP and

FACS analysis, may be useful to select for accurate

correction event.

The results of this study confirm that the chimeric

RDO strategy may be feasible to correct single base

mutation and, therefore, useful to treat single gene

diseases.

AcknowledgementsAuthors wish to thank Margherita Bignami for

HeLaS3 cell line, Antonio Piras and Federica Mori for

their technical support, and Lorenzo Citti for RDO

synthesis.

ReferencesAlexeev V and Yoon K (1998) Stable and inheritable changes in

genotype and phenotype of albino melanocytes induced by

an RNA-DNA oligonucleotide. Nat Biotechnol 16, 1343-

1346.

Andersen MS, Sorensen CB, Bolund L and Jensen TG (2002)

Mechanisms underlying targeted gene correction using

chimeric RNA/DNA and single-stranded DNA

oligonucleotides. J Mol Med 80, 770-781.

Bartlett RJ, Stockinger S, Denis MM, Bartlett WT, Inverardi L,

Le TT, thi Man N, Morris GE, Bogan DJ, Metcalf-Bogan J

and Kornegay JN (2000) In vivo targeted repair of a point

mutation in the canine dystrophin gene by a chimeric

RNA/DNA oligonucleotide. Nat Biotechnol 18, 615-622.

Brachman EE and Kmiec EB (2002) The 'biased' evolution of

targeted gene repair. Curr Opin Mol Ther 4, 171-176.

Cervelli T, Lombardi G, Citti L, Galli A, Locci MT and Rainaldi

G (2002) Targeting of A701G nucleotide at the human


500

ATP1A1 locus using a RNA/DNA chimera. Nucleosides

Nucleotides Nucleic Acids 21, 775-784.

Cole-Strauss A, Yoon K, Xiang Y, Byrne BC, Rice MC, Gryn J,

Holloman WK and Kmiec EB (1996) Correction of the

mutation responsible for sickle cell anemia by an RNA-DNA

oligonucleotide. Science 273, 1386-1389.

Ferrara L and Kmiec EB (2004) Camptothecin enhances the

frequency of oligonucleotide-directed gene repair in

mammalian cells by inducing DNA damage and activating

homologous recombination. Nucleic Acids Res 32, 5239-

5248.

Ferrara L, Parekh-Olmedo H and Kmiec EB (2004) Enhanced

oligonucleotide-directed gene targeting in mammalian cells

following treatment with DNA damaging agents. Exp Cell

Res 300, 170-179.

Gamper HB, Jr., Cole-Strauss A, Metz R, Parekh H, Kumar R

and Kmiec EB (2000) A plausible mechanism for gene

correction by chimeric oligonucleotides. Biochemistry 39,

5808-5816.

Gamper HB, Parekh H, Rice MC, Bruner M, Youkey H and

Kmiec EB (2000) The DNA strand of chimeric RNA/DNA

oligonucleotides can direct gene repair/conversion activity in

mammalian and plant cell-free extracts. Nucleic Acids Res

28, 4332-4339.

Igoucheva O, Alexeev V and Yoon K (2004) Oligonucleotide-

directed mutagenesis and targeted gene correction: a

mechanistic point of view. Curr Mol Med 4, 445-463.

Kenner O, Kneisel A, Klingler J, Bartelt B, Speit G, Vogel W

and Kaufmann D (2002) Targeted gene correction of hprt

mutations by 45 base single-stranded oligonucleotides.


Kenner O, Lutomska A, Speit G, Vogel W and Kaufmann D

(2004) Concurrent targeted exchange of three bases in

mammalian hprt by oligonucleotides. Biochem Biophys Res

Commun 321, 1017-1023.

Kmiec EB (2003) Targeted gene repair -- in the arena. J Clin

Invest 112, 632-636.

Kmiec EB, Cole A and Holloman WK (1994) The REC2 gene

encodes the homologous pairing protein of Ustilago maydis.

Mol Cell Biol 14, 7163-7172.

Kren BT, Cole-Strauss A, Kmiec EB and Steer CJ (1997)

Targeted nucleotide exchange in the alkaline phosphatase

gene of HuH-7 cells mediated by a chimeric RNA/DNA

oligonucleotide. Hepatology 25, 1462-1468.

Kren BT, Parashar B, Bandyopadhyay P, Chowdhury NR,

Chowdhury JR and Steer CJ (1999) Correction of the UDP-

glucuronosyltransferase gene defect in the gunn rat model of

crigler-najjar syndrome type I with a chimeric

oligonucleotide. Proc Natl Acad Sci U S A 96, 10349-

10354.

Liu L, Cheng S, van Brabant AJ and Kmiec EB (2002a) Rad51p

and Rad54p, but not Rad52p, elevate gene repair in

Saccharomyces cerevisiae directed by modified single-

stranded oligonucleotide vectors. Nucleic Acids Res 30,

2742-2750.

Liu L, Parekh-Olmedo H and Kmiec EB (2003) The

development and regulation of gene repair. Nat Rev Genet

4, 679-689.

Liu L, Rice MC and Kmiec EB (2001) In vivo gene repair of

point and frameshift mutations directed by chimeric

RNA/DNA oligonucleotides and modified single-stranded

oligonucleotides. Nucleic Acids Res 29, 4238-4250.

Liu L, Rice MC, Drury M, Cheng S, Gamper H and Kmiec EB

(2002b) Strand bias in targeted gene repair is influenced by

transcriptional activity. Mol Cell Biol 22, 3852-3863.

Parekh-Olmedo H and Kmiec EB (2003) Targeted nucleotide

exchange in the CAG repeat region of the human HD gene.


Parekh-Olmedo H, Drury M and Kmiec EB (2002) Targeted

nucleotide exchange in Saccharomyces cerevisiae directed by

short oligonucleotides containing locked nucleic acids.

Chem Biol 9, 1073-1084.

Rando TA, Disatnik MH and Zhou LZ (2000) Rescue of

dystrophin expression in mdx mouse muscle by RNA/DNA

oligonucleotides. Proc Natl Acad Sci U S A 97, 5363-5368.

Rice MC, Bruner M, Czymmek K and Kmiec EB (2001) In vitro

and in vivo nucleotide exchange directed by chimeric

RNA/DNA oligonucleotides in Saccharomyces cerevisae.

Mol Microbiol 40, 857-868.

Rice MC, Czymmek K and Kmiec EB (2001) The potential of

nucleic acid repair in functional genomics. Nat Biotechnol

19, 321-326.

Santana E, Peritz AE, Iyer S, Uitto J and Yoon K (1998)

Different frequency of gene targeting events by the RNA-

DNA oligonucleotide among epithelial cells. J Invest

Dermatol 111, 1172-1177.

Xiang Y, Cole-Strauss A, Yoon K, Gryn J and Kmiec EB (1997)

Targeted gene conversion in a mammalian CD34+-enriched

cell population using a chimeric RNA/DNA oligonucleotide.

J Mol Med 75, 829-835.

Yoon K, Cole-Strauss A and Kmiec EB (1996) Targeted gene

correction of episomal DNA in mammalian cells mediated by

a chimeric RNA.DNA oligonucleotide. Proc Natl Acad Sci

U S A 93, 2071-2076.

Yoon K, Igoucheva O and Alexeev V (2002) Expectations and

reality in gene repair. Nat Biotechnol 20, 1197-1198.

Zhang Z, Eriksson M, Falk G, Graff C, Presnell SC, Read MS,

Nichols TC, Blomback M and Anvret M (1998) Failure to

achieve gene conversion with chimeric circular

oligonucleotides: potentially misleading PCR artifacts

observed. Antisense Nucleic Acid Drug Dev 8, 531-536.

Giuseppe Rainaldi


501


Nitric oxide and endotoxin-mediated sepsis: the role

of osteopontinReview Article

Philip Y. Wai and Paul C. Kuo*Department of Surgery, Duke University Medical Center, Durham, NC 27710

__________________________________________________________________________________

*Correspondence: Paul C. Kuo, M.D., Department of Surgery, 110 Bell Building, Duke University Medical Center, Durham, NC

27710; Tel: 919-668-1856; Fax: 919-684-8716; e-mail: [email protected]

Key words: osteopontin, hnRNP A/B, sepsis, endotoxin, LPS, nitric oxide

Abbreviations: bactericidal/permeability-increasing, (BPI); basic fibroblast growth factor, (bFGF); cardiac index, (CI); cholesterol ester

transfer protein, (CETP); chromatin immunoprecipitation, (ChIP); c-Jun N-terminal kinase, (JNK); cyclic monophosphate, (cGMP);

endothelial NOS, (eNOS); Gly-Arg-Gly-Asp-Ser, (GRGDS); glycosylphosphatidyinositol, (GPI); heterogeneous ribonucleoprotein A/B,

(hnRNP A/B); inducible NO synthase, (iNOS); interferon gamma, (IFN-!); interleukin-1, (IL-1); lipopolysaccharide, (LPS); mean

arterial pressure, (MAP); neuronal NOS, (nNOS); NG-nitro-L-arginine methyl ester, (L-NAME); Nitric oxide, (NO); NO synthase,

(NOS); osteopontin, (OPN); phorbol 12-myristate 13-acetate, (PMA); phospholipid transfer protein, (PLTP); platelet activating factor,

(PAF); poly-ADP ribose synthase, (PARS); protein kinase RNA-regulated, (PKR); pulmonary vascular resistance, (PVR); reactive

oxygen species, (ROS); suppression subtractive hybridization, (SSH); systemic inflammatory response syndrome, (SIRS); systemic

vascular resistance, (SVR); TNF" receptor-associated factor-6, (TRAF6); Toll-like receptor 4, (TLR4); tumor necrosis factor-", (TNF-

")


Accepted: 10 December 2004 electronically published: December 2004

Summary

Septic shock continues to be a life threatening complication of systemic infection despite advances in the clinical

care of these patients. The incidence of severe sepsis in critically ill patients has increased annually by 8.7% and

mortality rates are excessive, ranging from 30%-60%. Nitric oxide plays a central role in the molecular biology and

biochemistry of septic shock. In endotoxin-mediated sepsis and septic shock, pro-inflammatory cytokines are

elaborated and inducible nitric oxide synthase is systemically expressed in multiple cell types. The sustained

production of nitric oxide in high concentration regulates multiple cellular and biochemical functions. Multiple

studies have investigated the role of nitric oxide synthase antagonists in the treatment of septic shock in both animal

models of endotoxemia and human clinical trials. However, cumulative data from these studies have not provided

definitive evidence for a survival benefit in the use of these agents in humans. While the signalling pathways that

activate iNOS expression or activity are well characterized, little is known about the endogenous molecular

determinants that decrease NO. In this regard, osteopontin, recently identified as an intrinsic regulator of iNOS

expression in endotoxin-stimulated macrophages, represents a novel target in the understanding of nitric oxide

pathobiology in sepsis. The purpose of this review is to discuss the S-nitrosylation of heterogeneous

ribonucleoprotein A/B in the transcriptional regulation of osteopontin in nitric oxide- mediated sepsis.

I. IntroductionSepsis refers to a heterogeneous group of

inflammatory syndromes that represent various stages

involved in the host-response to infection. Septic shock

has been previously defined as sepsis-induced hypotension

that persists despite adequate fluid resuscitation with

characteristic clinical manifestations such as lactic

acidosis, oliguria or coagulopathy (Bone et al, 1992; Levy

et al, 2003). There is a continuum and natural progression

between the different stages of the inflammatory response

from systemic inflammatory response syndrome (SIRS) to

sepsis, severe sepsis, shock, and multiple organ

dysfunction (Brun-Buisson, 2000). Risk factors identified

as independently associated with severe sepsis include

age, male sex, the presence of indwelling catheters or

devices, chronic liver insufficiency, immunodepression, or

severe underlying disease (Brun-Buisson et al, 1995, 2004;

Balk, 2004). Septic shock continues to be a life threatening

complication of systemic infection despite advances in the

clinical care of these patients. The incidence of severe

sepsis in critically ill patients has increased annually by

Wai and Kuo: Regulation of NO in sepsis by OPN

502

8.7% (Balk, 2004) with mortality rates ranging from 30%-

60% (Brun-Buisson et al, 1995, 2004; Martin et al, 2003;

Balk, 2004).

Nitric oxide (NO) plays a central role in the

molecular biology and biochemistry of septic shock. In

endotoxin-mediated sepsis and septic shock, pro-

inflammatory cytokines are elaborated and inducible NO

synthase (iNOS) is systemically expressed in multiple cell

types. The sustained production of NO in high

concentration regulates multiple cellular and biochemical

functions, including inotropic and chronotropic cardiac

responses, systemic vasomotor tone, intestinal epithelial

permeability, endothelial activation, and microvascular

permeability (Finkel et al, 1992; Kilbourn et al, 1997;

Chavez et al, 1999).

In the decade since the discovery of NO as

endothelium derived relaxing factor, multiple studies have

investigated the role of NO synthase (NOS) antagonists in

the treatment of septic shock in both animal models of

endotoxemia and human clinical trials. The cumulative

data from these studies do not reach consensus and

conflict on whether NOS antagonists decrease sepsis-

related mortality. Certainly, substantial evidence supports

that NOS inhibition improves physiological endpoints

during septic shock (Vincent et al, 2000; Cobb, 2001;

Feihl et al, 2001). The non-selective and non-physiologic

effects of these inhibitors used in model systems may

account for some of the adverse effects observed in these

studies and for the failure of these agents in increasing

survival in clinical studies. Few studies have attempted to

modulate iNOS expression by manipulating the intrinsic,

homeostatic mechanisms that lead to iNOS down-

regulation. Interestingly, while the signalling pathways

that activate iNOS expression or activity are well

characterized, little is known about the endogenous

molecular determinants that decrease NO. In this regard,

the recent discovery of osteopontin (OPN) as an intrinsic

regulator of iNOS expression in endotoxin-stimulated

macrophages represents an area of investigation that may

yield novel targets for the therapeutic modulation of NO

during sepsis.

In this discussion, we review the lipopolysaccharide

(LPS) signalling pathways that lead to upregulation of

iNOS expression and the biochemistry and physiology of

NO in septic shock. In addition, we will describe the role

of OPN in the regulation of NO and the identification of

heterogeneous ribonucleoprotein A/B (hnRNP A/B) as an

endogenous, NO-dependent, transcriptional regulator of

OPN.

II. The LPS signalling pathway in

sepsisLPS endotoxin is the principal component of the

outer membrane of Gram-negative bacteria. The structural

components of LPS include an outer O-antigen

polysaccharide region; outer, intermediate, and inner core

polysaccharide regions; and the toxic lipid A moiety

embedded deep within the outer membrane (Alexander

and Rietschel, 2001; Lazaron and Dunn, 2002).

Stimulation with LPS activates the cells of the innate

immune system to produce a variety of inflammatory

cytokines including interleukin-1 (IL-1), IL-6, IL-8, tumor

necrosis factor-" (TNF-") and NO. However,

overstimulation of the monocytic signalling pathways with

LPS can lead to systemic inflammation resulting in sepsis

or shock.

The LPS signalling cascade involves the complex co-

operation of a multitude of receptors, cofactors and

messenger proteins (Figure 1).

The processing of LPS for signal transduction begins

in the extracellular space with the ligation of LPS by LPS-

binding protein (LBP). Derived from hepatic synthesis,

LBP is secreted into the serum, and responds to LPS

stimulation with a 5- to 20- fold increase in LBP

concentration (Lazaron and Dunn, 2002). Sequence

analysis and cloning of LBP cDNA has led to the

identification of a family of related proteins that include

bactericidal/permeability-increasing protein (BPI),

cholesterol ester transfer protein (CETP), and

phospholipid transfer protein (PLTP). The

glycosylphosphatidyinositol (GPI)-linked membrane

protein, CD14, is a myeloid surface antigen that lacks a

transmembrane domain. A non-GPI-containing soluble

form of CD14 is also secreted into the serum (Lazaron and

Dunn, 2002). CD14 functions by recognizing the LPS-

LBP complex (Figure 1). Loss-of-function studies have

demonstrated that LBP and CD14 are necessary for the

rapid and sensitive induction of the monocyte/macrophage

inflammatory response to LPS (Diks et al, 2001). These

cofactors appear to enhance the function of Toll-like

receptor 4 (TLR4), the putative signalling receptor for

LPS. Studies using murine macrophages with a targeted

loss-of-function in TLR4 resulted in the ablation of the

physiologic response to LPS (Guha and Mackman, 2001).

TLR4 activity was found to be dependent on MD-2, a

secreted protein that associates with TLR4 and enhances

TLR4-dependent signalling pathways (Figure 1).

TLR4 regulates multiple intracellular, inflammatory

signalling cascades including the NF-#B, ERK, JNK and

p38 pathways. Cumulative data suggests that MyD88, IL-1

receptor-associated kinase (IRAK) and TNF" receptor-

associated factor-6 (TRAF6) mediate TLR4 activation of

NF-#B by enhancing phosphorylation of IKK$, which in

turn phosphorylates I#B and leads to the translocation of

NF-#B p50 and p65 into the nucleus (Diks et al, 2001;

Guha and Mackman, 2001). LPS also activates the extra-

cellular signal-regulated kinase (ERK1/2) signalling

pathway. LPS-mediated activation of MEK-ERK1/2

appears to occur via diverse mechanisms as both Ras/c-

Raf -dependent and -independent pathways have been

identified (Guha and Mackman, 2001). One downstream

target of the MEK-ERK1/2 pathway is the transcription

factor Elk-1, which co-operates with SRF to activate target

genes. The c-Jun N-terminal kinase (JNK) signalling

pathway can also be activated by LPS. Upstream

activators of JNK include mPAK3, hPAK1, GCK,

MEKK1 and MKK4/7 and the targeted transcription

factors consist of c-Jun, ATF-2 and Elk-1 (Guha and

Mackman, 2001). The p38 signalling pathway is yet

another unique signalling pathway that is regulated by

LPS. Cdc42, PAK , Rac1, protein kinase RNA-regulated

(PKR) and MKK3/6 are some of the upstream signalling


503

Figure 1. The LPS signalling

pathway regulates transcription of

the inflammatory mediator genes IL-

1, IL-6, IL-8, TNF-", and iNOS

(Alexander and Rietschel, 2001;

Diks et al, 2001; Guha and

Mackman, 2001; Lazaron and Dunn,

2002). Please see text for details.

Partialy reproduced from Guha and

Mackman, 2001 with kind

permission from Cellular Signalling.

molecules that activate p38. Target transcription factors

activated by p38 include ATF-2, Elk-1, CHOP, MEF2C,

Sap1a, CREB and ATF-1 (Guha and Mackman, 2001).

Terminal signalling events from these different cascades

regulate gene expression of TNF-", IL-1, IL-6, IL-8, G-

CSF, GM-CSF, MCP-1, IL-2 R" and iNOS.

III. Increased nitric oxide production

in sepsisA. NO biosynthesis, mechanism of action,

and pathophysiologyAn important downstream effector of LPS signalling

is iNOS, the primary regulator of NO production in sepsis.

NO is a ubiquitous biological molecule produced by

several cell types. The terminal guanidino group of the

amino acid L-arginine gives rise to NO under redox-

regulation by NOS in a calmodulin-dependent manner

(Figure 2) (Nathan and Xie, 1994). The three known

isoforms of NOS have been identified as neuronal NOS

(nNOS/NOS-I), inducible NOS (iNOS/NOS-II), and

endothelial NOS (eNOS/NOS-III). While the expression

of nNOS and eNOS are constitutive, iNOS expression can

be significantly upregulated in response to bacterial

products and pro-inflammatory cytokines. NO production

and iNOS expression play a central role in the

pathobiology of sepsis. In the preceding section, we

briefly reviewed some of the signalling pathways by

which LPS signalling transcriptionally activates iNOS.

However, a variety of stimuli, including microbes, IL-1,

IL-6, IL-12, TNF, interferon-!, "/$ and platelet activating

factor (PAF), can promote iNOS expression (Nathan and

Xie, 1994; Nathan, 1997; Taylor and Geller, 2000).

During sepsis, these agents act synergistically to induce

iNOS gene transcription through complex signalling

pathways that involve the NF-#b, cyclic AMP-CREB-

C/EBP and Jak-Stat pathways (Nathan and Xie, 1994;

Nathan, 1997; Taylor and Geller, 2000; Diks et al, 2001).

Secondary auxiliary signalling pathways include AP-1,

phospholipase C, protein kinase C, Ras-MAP kinase, and

hypoxia inducible factor-1.

Figure 2. NO is produced by iNOS under redox conditions in a

calmodulin-dependent manner. L-arginine and oxygen are

catalytic substrates for iNOS during the production of NO and L-

citrulline. The reaction occurs with the oxidation of NAPDH to

NADP+.


504

NO is a pleuripotent regulator of multiple cellular

and biochemical functions, including allosteric receptor

modification, enzymatic activity and transcriptional

regulation (Crapo and Stamler, 1994; Morris and Billiar,

1994; Simon et al, 1996). NO, a highly-diffusable, gaseous

free-radical, binds to heme-containing proteins such as

guanylate cyclase which it activates to release guanosine

3'5'-cyclic monophosphate (cGMP), a potent intracellular

second-messenger. NO also mediates S-nitrosylation of

key target molecules in many biological processes (Feihl

et al, 2001). Using these different mechanisms, NO can

generate a variety of downstream activators. NO and its

derivatives also possess innate biochemical properties as

reactive oxygen species (ROS). ROS species include NO,

its metabolic products (nitrite, nitrate and peroxynitrite)

and other related-molecules such as superoxide anion,

hydroxyl anion and hydrogen peroxide. Production of

ROS is enhanced in sepsis and these products exert toxic

effects on nucleic acids, lipids, and proteins (Symeonides

and Balk, 1999). In particular, peroxynitrite impairs

mitochondrial respiration, activates poly-ADP ribose

synthase (PARS), reduces NAD pools, cellular glycolysis,

electron transport, and limits ATP generation (Vincent et

al, 2000). These free-radical species are thought to be

responsible for significant cellular damage during severe

sepsis.

In endotoxin-mediated sepsis and septic shock, the

sustained production of NO in high concentration in

multiple cell types modifies inotropic and chronotropic

cardiac responses, systemic vasomotor tone, pulmonary

vasomotor tone, intestinal epithelial permeability,

endothelial activation, microvascular permeability, renal

tubular-glomerular feedback, platelet adhesion and

aggregation, and insulin metabolism (Finkel et al, 1992;

Kilbourn et al, 1997; Chavez et al, 1999; Symeonides and

Balk, 1999; Vincent et al, 2000). The natural history of

septic shock stems from the combination of negative

inotropic cardiac effects, pulmonary vasoconstriction and

hypertension, decreased vasomotor tone and profound

vasodilation with resultant hyperdynamic-cardiovascular

collapse, leading to overwhelming tissue hypoxia and

multiple organ dysfunction (Symeonides and Balk, 1999).

B. The negative feedback regulation of

NOOver the past decade, studies utilizing NOS

antagonists to treat the deleterious effects of septic shock

have produced conflicting results (Symeonides and Balk,

1999; Vincent et al, 2000; Cobb, 2001; Feihl et al, 2001).

NOS antagonists can be categorized as amino-acid- or

non-amino-acid-based competitive analogs whose

members primarily exert either iNOS -selective or -non-

selective effects (Vincent et al, 2000). In preclinical

animal models of septic shock, the use of NOS inhibitors

have shown that mean arterial pressure (MAP) and

systemic vascular resistance (SVR) can be significantly

increased (Symeonides and Balk, 1999; Vincent et al,

2000). Benefit on survival, however, has been less clear.

Moreover, there are several potential detrimental effects to

non-specific NOS inhibition including decreased organ

perfusion, elevation of mean pulmonary artery pressure,

pulmonary vascular resistance (PVR), renal vascular

resistance and decreased renal blood flow (Vincent et al,

2000). The use of NOS inhibitors in animal models of

endotoxemia has been associated with a decrease in

cardiac index (CI) and tissue oxygen delivery and an

increase in lactic acidosis and hepatic toxicity (Vincent et

al, 2000; Cobb, 2001). In several studies, non-selective

NOS inhibition was found to be associated with increased

mortality (Symeonides and Balk, 1999; Vincent et al,

2000; Cobb, 2001). Clinical trials in human subjects have

been performed and they revealed similar effects on SVRI,

MAP, PVRI, CI, PCWP and CVP as those found in animal

models of sepsis (Symeonides and Balk, 1999; Vincent et

al, 2000; Cobb, 2001).

Many of these studies utilize compounds that are

added exogenously to model systems. The investigation of

in situ, homeostatic mechanisms that regulate iNOS

expression and NO production represents a novel approach

to understanding the complex biology of iNOS regulation

and may yield new therapeutic targets. In contrast to iNOS

activation pathways, the endogenous counter-regulatory

pathways which inhibit iNOS expression and activity in a

biologically relevant manner are largely unknown.

Certainly, glucocorticoids, IL-4, IL-8, IL-10, transforming

growth factor (TGF-$1, $2, $3), NAP110, kalirin and

macrophage deactivating factor are among identified

inhibitors of iNOS activation (Nathan and Xie, 1994;

Nathan, 1997; Taylor and Geller, 2000). While TGF-$-

exerts transcriptional and post-translational control of

iNOS (Nathan and Xie, 1994), kalirin and NAP110 inhibit

iNOS activity by preventing iNOS homodimer formation

(Ratovitski et al, 1999a, b). Substrate and cofactor

availability can also modulate iNOS activity (Nathan and

Xie, 1994). Studies investigating these inhibitors have

underscored the immense complexity and species-, signal-

and cell-dependent nature of iNOS regulation. Moreover,

the biological relevance of many of these inhibitors is

unknown as their effects on iNOS activity have largely

been determined in model systems in which they have

been exogenously administered. In addition, the

underlying signal transduction pathway for each inhibitory

agent has not well characterized. An interesting and

unique feature of iNOS counter-regulation is the negative

feedback characteristic of NO (DelaTorre et al, 1997). NO,

as the end-product of iNOS activity, can both directly and

indirectly feedback inhibit iNOS expression. These

endogenous inhibitory pathways by which NO feedback

regulates iNOS expression remain poorly understood. NO

may downregulate expression or activity of an iNOS

inducing stimulus or conversely, upregulate expression or

activity of an iNOS repressor. One example of how NO

can biochemically trigger iNOS regulators is the S-

nitrosylation of intermediary proteins. The biochemical

kinetics of NO-mediated S-nitrosylation of NF-#B has

been investigated and NO decreases the dissociation

constant by four-fold. This suggests that NO modifies NF-

#B active site-thiols and inhibits NF-#B DNA binding and

subsequent iNOS gene transcription (DelaTorre et al,

1997). Critical thiol and non-heme iron groups which may

serve as targets for NO are not limited to NF-#B. S-

nitrosylation targets of NO include p53, caspase-8,


505

transglutaminase, glyceraldehyde-3-phosphate de-

hydrogenase, and glutiathione reductase (Calmels et al,

1997). The ubiquity of negative feedback regulation as a

mechanism for modulation of protein activity suggests that

inhibitory mechanisms for iNOS may be NO-dependent

and that there exists a pool of NO-regulated genes and

proteins, which potentially serve as mediators in NO-

feedback regulation.

Using suppression subtractive hybridization (SSH),

we have recently identified OPN as a regulator of iNOS

that is itself NO-dependent (Guo et al, 2001). In ANA-1

murine macrophages, we hypothesized that endotoxin

(LPS)-mediated NO production induces a specific set of

genetic programs that may serve to alter cellular NO

metabolism. To identify genes differentially expressed in

LPS-stimulated cells producing NO, RNA from LPS-

treated cells was used as a "tester" and RNA from LPS

plus NG-nitro-L-arginine methyl ester (L-NAME) was used

as a "driver". Individual cDNA clones generated by SSH

were used as probes in Northern blot analysis to identify

differentially expressed genes. Using SSH, OPN was

found to be specifically induced in the presence of LPS-

induced NO synthesis.

IV. Osteopontin, nitric oxide synthase

and hnRNP A/BA. OPN structure, receptors and functionOPN is a hydrophilic and negatively charged

sialoprotein of ~298 amino acids that contains a Gly-Arg-

Gly-Asp-Ser (GRGDS) integrin-binding motif and

additional domains for calcium-binding, phosphorylation

and glycosylation (Wai and Kuo, 2004). Post-translational

modifications account for cell-type and condition-specific

OPN-isoforms, which can be measured between 41-75 kD

(Wai and Kuo, 2004). This secreted phosphoprotein

mediates diverse regulatory functions, including cell

adhesion, migration, tumor growth and metastasis,

atherosclerosis, aortic valve calcification, and repair of

myocardial injury. Many of these functions appear to be

regulated by signalling through the integrin and CD44

families of receptors (Wai and Kuo, 2004). OPN

expression is tissue-specific and subject to regulation by

many factors (Hijiya et al, 1994; Guo et al, 1995;

Chellaiah et al, 1996; Wai and Kuo, 2004). Constituitive

expression of OPN exists in several cell types but induced

expression is found in T lymphocytes, epidermal cells,

bone cells and macrophages in response to phorbol 12-

myristate 13-acetate (PMA), 1,25-dihydroxyvitamin D,

basic fibroblast growth factor (bFGF), TNF-", IL-1,

interferon gamma (IFN-!) and endotoxin. Interestingly,

OPN and iNOS are induced in response to many of the

same agents such as TNF-", IL-1$, IFN-!, and LPS

(Nathan and Xie, 1994).

B. OPN and inflammationRecently the relationship between OPN, NO and

inflammation has been examined by a number of

investigators. Rollo et al, (1996) demonstrated that

exogenous recombinant OPN protein was effective in

blocking RAW264.7 murine macrophage NO production

and cytotoxicity toward the NO-sensitive mastocytoma

cells. Their work suggested that OPN in extracellular fluid

protects certain tumor cells from the macrophage-

mediated destruction by inhibiting the synthesis of NO.

Singh et al, (1995, 1999) reported that a synthetic 20-

amino acid OPN peptide analogue decreased iNOS mRNA

and protein levels in ventricular myocytes and cardiac

microvascular endothelial cells. Transfection of cardiac

microvascular endothelial cells with an antisense OPN

cDNA increased iNOS mRNA in response to IL-$ and

IFN-!, suggesting that endogenous OPN inhibits NO

production. Using an antibody directed against the OPN

"v$3 integrin receptor, Attur et al, (2001) demonstrated

that ligand binding results in trans-dominant inhibition of

NO production in human cartilage. Hwang et al, (1994a,

b) found that OPN suppressed NO synthesis induced by

interferon and LPS in primary mouse kidney proximal

tubule epithelial cells. These studies clearly demonstrate

that endogenous OPN can inhibit induction of iNOS and

that OPN is an important regulator of the NO signalling

pathway and NO-mediated cytoregulatory processes.

However, the converse relationship, the role of NO in the

induction of OPN synthesis, has not been well studied.

In our laboratory, we have recently demonstrated that

LPS-induced NO synthesis up-regulates OPN promoter

activity and protein expression (Guo et al, 2001). We have

shown that LPS-treated ANA-1 and RAW 264.7

macrophages express high levels of OPN protein while

untreated macrophages show no detectable level of

immunoreactive OPN protein. The addition of L-NAME

(competitive NOS inhibitor) to LPS-treated cells ablates

OPN protein expression whereas the co-addition of the

NO donor, S-nitroso-N-acetylpencillamine (SNAP),

restores OPN expression in LPS + L-NAME treated cells.

These data suggest that LPS-mediated NO production is

associated with significantly increased OPN protein

secretion in both ANA-1 and RAW 264.7 macrophages.

Using nuclear run-on analysis, we showed that the NO-

mediated increase in macrophage-OPN mRNA levels was

the result of increased gene transcription. Transient

transfection of plasmid constructs containing an 865-bp

OPN promoter cloned upstream from a luciferase reporter

gene, demonstrated that LPS-induced NO production

increased OPN promoter activity by ~7-fold compared

with controls (Guo et al, 2001). Together these data

provide evidence to suggest that NO expression induced

by LPS increases OPN promoter activity, and OPN mRNA

and protein levels. We have also shown that blockade of

the OPN-integrin cell surface receptor with GRGDSP

increases macrophage NO production in response to LPS

stimulation while the addition of exogenous OPN with

LPS to ANA-1 cells maximally decreased nitrite levels by

50%. Together, these data suggest that OPN plays a

functional role in regulating LPS-mediated NO

production.


506

C. S-nitrosylation of hnRNP A/B

regulates OPN transcription during

endotoxin stimulationCloning of the human, porcine and murine OPN

promoters has uncovered numerous consensus regulatory

sequences (Wai and Kuo, 2004). Early investigations with

the human OPN promoter revealed multiple candidate

elements that contain consensus sequences for known

transcription factors including TATA-like (-27 to -22 nt)

and CCAAT-like (-73 to -68 nt) sequences, vitamin-D-

responsive (VDR)-like motifs (-1892 to -1878 and -698 to

-684 nt), GATA-1 (-851 to -847 nt), AP-1 (TGACACA, -

78 to -72 nt), PEA3 (-1695 to -1690 and -1418 to -1413 nt)

and Ets-1 (-47 to -39 nt) binding sequences and multiple

TCF-1 sites (31). Craig and Denhardt identified similar

sequences in the murine OPN promoter: a characteristic

TATA box (-27 to -22 nt), an inverted CCAAT box (-53 to

-49 nt), a positive transcription element (-543 to -253 nt)

and a negative transcription element (-777 and -543 nt)

(Craig and Denhardt, 1991). Several investigators have

since shown that transcriptional regulation of OPN is

complex and involves multiple pathways. Several inter-

related signalling pathways and transcription factors

regulate the OPN promoter including AP-1, Myc, Oct-1,

USF, v-Src, Runx/CBF, TGF-B/BMPs/Smad/Hox, Wnt/ß -

catenin/APC/GSK-3ß/Tcf-4, Ras/RRF and TP53 (Wai and

Kuo, 2004).

Recently, we have identified heterogeneous nuclear

ribonucleoprotein A/B (hnRNP A/B) as a constitutive

transcriptional repressor of OPN whose DNA binding

activity is decreased by LPS-mediated S-nitrosylation of a

key cysteine thiol. hnRNPs were originally described as a

group of chromatin-associated RNA-binding proteins that

form complexes with RNA polymerase II transcripts. The

hnRNP family is a collection of more than 20 proteins that

contribute to the complex around nascent pre-mRNA and

are thus able to modulate RNA processing (Krecic and

Swanson, 1999). Members of the group are characterized

by their ability to bind to RNA with limited specificity,

and they are among the most abundant of all of the nuclear

proteins. Despite its function in RNA handling, the precise

physiological role of hnRNPs has yet to be fully defined

and may include trans-regulatory effects. Recent studies

have shown that the hnRNPs D0B, E2BP, and K are able

to bind to double-stranded DNA motifs within the

complement receptor 2, hepatitis B virus, and c-myc

promoters, respectively (Tay et al, 1992; Tomonaga and

Levens, 1995; Tolnay et al, 1999). hnRNP K possesses

both transcriptional activator and repressor functions

(Michelotti et al, 1996).

hnRNP A/B is a unique member of the hnRNP

family in that it possesses a DNA-binding sequence

domain that is separate from the repression domain. The

p40 isoform contains 331 amino acid residues, whereas

p37 contains 284. The amino acid sequences are identical

with the exception of an additional 47 amino acids at the

C-terminal region of p40. In this regard, Yabuki et al,

(2001) found that hnRNP A/B p40 binds to the rat aldolase

B promoter to inhibit activity, whereas hnRNP A/B p37

had no effect. Further studies by this group found that the

DNA-binding region for both isoforms reside with amino

acids 67-159, 67-75, and 147-159 are absolute

requirements for binding activity (Saitoh et al, 2002). This

67-159-amino acid region contains the S-nitrosylation

target Cys 104, which was found to be responsible for NO-

mediated inhibition of DNA binding in our experiments.

Using OPN promoter deletion constructs cloned

upstream from a luciferase reporter gene we localized a

NO-sensitive cis-acting element in the OPN promoter (-

174 to -209 nt). Deletion of this segment resulted in > 4-

fold increase in OPN promoter activity (Gao et al, 2004).

Electromobility shift assay demonstrated that nuclear

protein is bound to the OPN promoter in the region of nt -

183 to nt -196 in unstimulated control cells. In the

presence of LPS and NO, binding is ablated, and OPN

promoter activity is increased. Utilizing the biotin-

streptavidin DNA affinity technique with the identified

DNA-binding sequence, the candidate repressor-

transcription factor was then purified and isolated from

nuclear extract isolated from unstimulated control RAW

264.7 macrophages. The purified proteins were separated

by SDS-PAGE and analyzed after tryptic digestion and

yielded results that matched with hnRNP A/B

(GenBankTM accession number NM 010448). Supershift

assays confirmed the identity of the gel-shift band and

chromatin immunoprecipitation (ChIP) -assay analysis

demonstrated in vivo binding of hnRNP A/B to the OPN

promoter (Gao et al, 2004). This binding was inhibited in

the presence of NO that was either endogenously induced

by LPS or exogenously delivered. Finally, we

demonstrated that S-nitrosylation of hnRNP A/B p37 is

significantly enhanced in the presence of LPS-mediated

NO synthesis and that S-nitrosylation of the p37 cysteine

residue at position 104 is associated with diminished DNA

binding in gel shift assays. Together these data suggest

that LPS-induced S-nitrosylation of hnRNP A/B inhibits

its activity as a constitutive repressor of the OPN promoter

(Figure 3).

Figure 3. S-nitrosylation of hnRNP A/B relieves transcriptional

repression of OPN during LPS-mediated production of NO and

serves as a negative feedback mechanism for iNOS regulation.


507

V. ConclusionIn sepsis, endotoxin-mediated production of NO

involves complex signalling pathways that regulate iNOS

expression. NO has wide-ranging biochemical and

physiologic effects in multiple organ systems and mediates

some of the processes that lead to cardiovascular collapse,

tissue hypoxia and organ failure in the septic patient.

While many studies have focused on the modulation of

NO production as a means of reducing the mortality

associated with septic shock, little is known about the

endogenous, homeostatic pathways that lead to down-

regulation of NO synthesis. Our current findings suggest

that LPS-induced S-nitrosylation of hnRNP inhibits its

activity as a constitutive repressor of the OPN promoter.

This represents a novel target for S-nitrosylation

regulatory functions as hnRNP proteins are better

characterized as participants in telomere biogenesis,

splicing, and mRNA transport. Further study to determine

the potential role of S-nitrosylation in these other hnRNP-

dependent functions may expand the known regulatory

roles for NO and S-nitrosylation.

ReferencesAlexander C, Rietschel ET (2001) Bacterial lipopolysaccharides

and innate immunity. J Endotoxin Res 7, 167-202

Attur MG, Dave MN, Stuchin S, Kowalski AJ, Steiner G,

Abramson SB, Denhardt DT, Amin AR (2001) Osteopontin,

an intrinsic inhibitor of inflammation in cartilage. Arthritis

Rheum 44, 578-84

Balk RA (2004) Optimum treatment of severe sepsis and septic

shock, evidence in support of the recommendations. Dis

Mon 50, 168-213

Bone RC, Balk RA, Cerra FB, Dellinger RP, Fein AM, Knaus

WA, Schein RM, Sibbald WJ (1992) Definitions for sepsis

and organ failure and guidelines for the use of innovative

therapies in sepsis. The ACCP/SCCM Consensus Conference

Committee. American College of Chest Physicians/Society

of Critical Care Medicine. Chest. 101, 1644-55.

Brun-Buisson C (2000) The epidemiology of the systemic

inflammatory response. Intensive Care Med 26 Suppl 1,

S64-74.

Brun-Buisson C, Doyon F, Carlet J, Dellamonica P, Gouin F,

Lepoutre A, Mercier JC, Offenstadt G, Regnier B (1995)

Incidence, risk factors, and outcome of severe sepsis and

septic shock in adults. A multicenter prospective study in

intensive care units. French ICU Group for Severe Sepsis.

JAMA 274, 968-74

Brun-Buisson C, Meshaka P, Pinton P, Vallet B; EPISEPSIS

Study Group (2004) EPISEPSIS, a reappraisal of the

epidemiology and outcome of severe sepsis in French

intensive care units. Intensive Care Med 30, 580-8.

Calmels S, Hainaut P, Ohshima H (1997) Nitric oxide induces

conformational and functional modifications of wild-type

p53 tumor suppressor protein. Cancer Research 57, 3365-

3369

Chavez AM, Menconi MJ, Hodin RA, Fink MP (1999) Cytokine-

induced intestinal epithelial hyperpermeability, role of nitric

oxide. Crit Care Med 27, 2246-51

Chellaiah M, Fitzgerald C, Filardo EJ, Cheresh DA, Hruska KA

(1996) Osteopontin activation of c-src in human melanoma

cells requires the cytoplasmic domain of the integrin alpha v-

subunit. Endocrinology 137, 2432-40

Cobb JP (2001) Nitric oxide synthase inhibition as therapy for

sepsis, a decade of promise. Surg Infect (Larchmt) 2, 93-

100; discussion 100-1.

Craig AM, Denhardt DT (1991) The murine gene encoding

secreted phosphoprotein 1 (osteopontin), promoter structure,

activity, and induction in vivo by estrogen and progesterone.

Gene 100, 163-71

Crapo JD and Stamler JS (1994) Signaling by nonreceptor

surface mediated redox active biomolecules. J Clin Invest

93, 2304.

DelaTorre A, Schroeder RA, Kuo PC (1997) Alteration of NF-

#B p50 binding kinetics by S-nitrosylation. Biochem

Biophys Res Commun 238, 703-706

Diks SH, van Deventer SJ, Peppelenbosch MP (2001)

Lipopolysaccharide recognition, internalisation, signalling

and other cellular effects. J Endotoxin Res 7, 335-48

Feihl F, Waeber B, Liaudet L (2001) Is nitric oxide

overproduction the target of choice for the management of

septic shock? Pharmacol Ther 91, 179-213

Finkel MS, Oddis CV, Jacob TD, Watkins SC, Hattler BG,

Simmons RL (1992) Negative inotropic effects of cytokines

on the heart mediated by nitric oxide. Science 257, 387-9

Gao C, Guo H, Wei J, Mi Z, Wai P, Kuo PC (2004) S-

nitrosylation of heterogeneous nuclear ribonucleoprotein A/B

regulates osteopontin transcription in endotoxin-stimulated

murine macrophages. J Biol Chem 279, 11236-43

Guha M, Mackman N (2001) LPS induction of gene expression

in human monocytes. Cell Signal 13, 85-94

Guo H, Cai CQ, Schroeder RA, Kuo PC (2001) Osteopontin is a

negative feedback regulator of nitric oxide synthesis in

murine macrophages. J Immunol 166, 1079-86

Guo X, Zhang YP, Mitchell DA, Denhardt DT, Chambers AF

(1995) Identification of a ras-activated enhancer in the mouse

osteopontin promoter and its interaction with a putative ETS-

related transcription factor whose activity correlates with the

metastatic potential of the cell. Mol Cell Biol 15, 476-87

Hijiya N, Setoguchi M, Matsuura K, Higuchi Y, Akizuki S,

Yamamoto S (1994) Cloning and characterization of the

human osteopontin gene and its promoter. Biochem J 303,

255-62

Hwang SM, Lopez CA, Heck DE, Gardner CR, Laskin DL,

Laskin JD, Denhardt DT (1994a) Osteopontin inhibits

induction of nitric oxide synthase gene expression by

inflammatory mediators in mouse kidney epithelial cells. J

Biol Chem 269, 711-5

Hwang SM, Wilson PD, Laskin JD, Denhardt DT (1994b) Age

and development-related changes in osteopontin and nitric

oxide synthase mRNA levels in human kidney proximal

tubule epithelial cells, contrasting responses to hypoxia and

reoxygenation. J Cell Physiol 160, 61-8

Kilbourn RG, Traber DL, Szabo C (1997) Nitric oxide and

shock. Dis Mon, 277-348

Krecic AM, Swanson MS (1999) hnRNP complexes,

composition, structure, and function. Curr Opin Cell Biol

11, 363-71

Lazaron V, Dunn DL (2002) Molecular biology of endotoxin

antagonism. World J Surg 26, 790-8. Epub 2002 Apr 15

Levy MM, Fink MP, Marshall JC, Abraham E, Angus D, Cook

D, Cohen J, Opal SM, Vincent JL, Ramsay G;

SCCM/ESICM/ACCP/ATS/SIS (2003) 2001

SCCM/ESICM/ACCP/ATS/SIS International Sepsis

Definitions Conference. Crit Care Med 31, 1250-6

Martin GS, Mannino DM, Eaton S, Moss M (2003) The

epidemiology of sepsis in the United States from 1979

through 2000. N Engl J Med 348, 1546-54

Michelotti EF, Michelotti GA, Aronsohn AI, Levens D (1996)

Heterogeneous nuclear ribonucleoprotein K is a transcription

factor. Mol Cell Biol 16, 2350-60


508

Morris SM and Billiar TR (1994) New insights into the

regulation of inducible nitric oxide synthesis. Am J Physiol

266, 829-839.

Nathan C (1997) Inducible nitric oxide synthase, what difference

does it make? J Clin Invest 100, 2417-2423

Nathan C and Xie QW (1994) Regulation of biosynthesis of

nitric oxide. J Biol Chem 269, 13725-13728

Ratovitski EA, Alam MR, Quick RA, McMillan A, Bao C,

Kozlovsky C, Hand TA, Johnson RC, Mains RE, Eipper BA,

Lowenstein CJ (1999a) Kalirin inhibition of inducible nitric-

oxide synthase. J Biol Chem 274, 993-9

Ratovitski EA, Bao C, Quick RA, McMillan A, Kozlovsky C,

Lowenstein CJ (1999b) An inducible nitric-oxide synthase

(NOS) -associated protein inhibits NOS dimerization and

activity. J Biol Chem 274, 30250-7

Rollo EE, Laskin DL, Denhardt DT (1996) Osteopontin inhibits

nitric oxide production and cytotoxicity by activated

RAW264.7 macrophages. J Leukoc Biol 60, 397-404

Saitoh Y, Miyagi S, Ariga H, Tsutsumi K (2002) Functional

domains involved in the interaction between Orc1 and

transcriptional repressor AlF-C that bind to an

origin/promoter of the rat aldolase B gene. Nucleic Acids

Res 30, 5205-12

Simon DI, Mullins ME, Jia L, Gaston B, Singel DJ, Stamler JS

(1996) Polynitrosylated proteins, characterization,

bioactivity, and functional consequences. Proc Natl Acad

Sci 93, 4736-4741

Singh K, Balligand JL, Fischer TA, Smith TW, Kelly RA (1995)

Glucocorticoids increase osteopontin expression in cardiac

myocytes and microvascular endothelial cells. Role in

regulation of inducible nitric oxide synthase. J Biol Chem

270, 28471-8

Singh K, Sirokman G, Communal C, Robinson KG, Conrad CH,

Brooks WW, Bing OH, Colucci WS (1999) Myocardial

osteopontin expression coincides with the development of

heart failure. Hypertension 33, 663-70

Symeonides S, Balk RA (1999) Nitric oxide in the pathogenesis

of sepsis. Infect Dis Clin North Am 13, 449-63

Tay N, Chan SH, Ren EC (1992) Identification and cloning of a

novel heterogeneous nuclear ribonucleoprotein C-like protein

that functions as a transcriptional activator of the hepatitis B

virus enhancer II. J Virol 66, 6841-8

Taylor BS and Geller DA (2000) Molecular regulation of the

human inducible nitric oxide synthase (iNOS) gene. Shock

13, 413-424.

Tolnay M, Vereshchagina LA, Tsokos GC (1999) Heterogeneous

nuclear ribonucleoprotein D0B is a sequence-specific DNA-

binding protein. Biochem J 338, 417-25

Tomonaga T, Levens D (1995) Heterogeneous nuclear

ribonucleoprotein K is a DNA-binding transactivator. J Biol

Chem 270, 4875-81

Vincent JL, Zhang H, Szabo C, Preiser JC (2000) Effects of

nitric oxide in septic shock. Am J Respir Crit Care Med

161, 1781-5

Wai PY, Kuo PC (2004) The role of Osteopontin in tumor

metastasis. J Surg Res 121, 228-241

Yabuki T, Miyagi S, Ueda H, Saitoh Y, Tsutsumi K (2001) A

novel growth-related nuclear protein binds and inhibits rat

aldolase B gene promoter. Gene 264, 123-9)


509


Feasibility to delineate distribution of solution

injected intraprostatic using an ex-vivo canine modelResearch Article

Charles J. Rosser1, Noriyoshi Tanaka1, R. Jason Stafford2, Roger E. Price3, John

D. Hazle2, Motoyoshi Tanaka1, Ashish M. Kamat1, Louis L. Pisters1*1Department of Urology,2Department of Imaging Physics,3Department of Veterinary Medicine and Surgery, The University of Texas M. D. Anderson Cancer Center, Houston,

Texas

__________________________________________________________________________________*Correspondence: Louis L. Pisters, M.D., Department of Urology, Unit 446, The University of Texas M. D. Anderson Cancer Center,

1515 Holcombe Blvd., Houston, TX 77030; Phone: 713-792-3250; Fax: 713-794-4824; Email: [email protected]

Key words: prostate, gadolinium, magnetic resonance imaging, gene therapy

Abbreviations: dilution of gadolinium DTPA, (Gd-DTPA); Institutional Animal Care and Use Committee, (IACUC); magnetic

resonance, (MR)

Charles J. Rosser and Noriyoshi Tanaka contributed equally to the manuscript

Supported by the Cancer Center Support Grant CA16672 from the National Cancer Institute and a grant from the American

Foundation of Urologic Disease.

Received: 5 October 2004; Accepted: 3 November 2004; electronically published: December 2004

Summary

We sought to identify an injection scheme and amount of solution injected resulting in optimal distribution of an

injected solution into the prostate and to determine whether magnetic resonance (MR) imaging is suitable for

evaluating intraprostatic distribution of an injected solution. Freshly excised canine prostates mounted in gelatin

were injected under ultrasound guidance with a standard volume (3 ml) of 1:10 dilution of gadolinium DTPA (Gd-

DTPA) and a 1:10 dilution of 1% methylene blue in phosphate-buffered saline. Three different schemes were used:

three-core, 10-core, and 20-core injection schemas. The prostates were subsequently imaged by MR imaging. After

imaging, samples were fixed in formalin, sectioned transversely, and digitally photographed. The distributions of

injected solution on photographs and MR images were compared. Findings on MR images correlated well with

photographic findings. Regions of injected solution were generally seen as hyperintense on the T1-weighted images.

A 20-core injection scheme distributed the injected solution better than a three-core or 10-core scheme. A 20-core

injection scheme resulted in optimal distribution within the prostate of injected methylene blue–Gd-DTPA solution.

MR imaging may be useful for imaging the distribution of solution injected into the prostate.

I. IntroductionIntraprostatic injection of a therapeutic solution is not

a new concept. Specifically, gene therapy for

localize/locally advanced prostate cancer routinely relies

on intraprostatic injection of vector. Since 1995, more than

55 gene therapy trials have been initiated in patients with

prostate cancer (Recombinant DNA Advisory Committee,

2003; Steiner and Gingrich, 2001). The few data we have

from such trials demonstrate the feasibility and safety of

gene therapy for prostate cancer, but show minimal if any

therapeutic benefit (Harrington et al, 2001; Steiner and

Gingrich, 2001). The disappointing results may be due to

the use of ineffective genes or the inability to transduce

the desired gene into a sufficient number of tumor cells.

Since various genes have been shown to inhibit

prostate tumor growth in vitro, (Issacs et al, 1991; Moody,

et al, 1994; Vieweg et al, 1994; Gotoh et al, 1997; Steiner

et al, 2000) we believe the disappointing clinical results

are due to the inability to transduce genes into a sufficient

number of tumor cells. In several reports on prostate

cancer gene therapy, there is no mention of gene

transduction, indicating that transduction may have been

low or may not have occurred (Eder et al, 1998; Gulley et

al, 1998; Herman et al, 1999; Lu et al, 1999; Pisters et al,

1999; Simons et al, 1999; Belldegrun et al, 2001).

Rosser et al: Intraprostatic injection to mimic gene therapy

510

Initiation of further studies relying on injection of a

therapeutic solution into the prostate will be pointless until

we determine: a) how to inject the solution into the

prostate, b) how much to inject into the prostate, and c)

can we visualize where the injected solution is in the

prostate. We believe that if we could increase the exposure

of the prostate to therapeutic solutions such as viral

vectors used in gene therapy, we could increase the gene

transduction rate and demonstrate a therapeutic response.

In this feasibility study of assessing distribution of

injectate, we set out to determine in an ex vivo model a)

the injection scheme and b) the amount of solution

injected that gives the widest distribution. We also will

compared c) the distributions of this injected solution as

observed on MR imaging and gross histologic examination

to determine whether MR imaging is suitable for

evaluating the distribution of solutions injected into the

prostate.

II. Materials and methodsTwelve random-source adult male dogs housed in the

animal care facility at The University of Texas M. D. Anderson

Cancer Center were included in this study. All the animals were

originally a part of other investigators’ protocols that had been

approved by the institution’s Institutional Animal Care and Use

Committee (IACUC). Dogs were euthanized by induction of

anesthesia, exsanguinated, and then the prostates were resected.

Then the prostate was removed as follows. A lower midline

incision was made. The peritoneal contents were reflected

superiorly, and the bladder was visualized and palpated. Inferior

to the bladder, the prostate, which is intra-abdominal, was

palpated. The urethra just distal to the prostate was sharply

transected and reflected superiorly. Then the prostate was sharply

transected at the bladder, and the specimen was placed in normal

saline.

The prostates were embedded in gelatin (Knox Gelatin,

Camden, NJ). A 5/7.5-MHz biplanar linear array transrectal

ultrasound probe (UST 664, Wallingford, CT) was used to

visualize the embedded prostates. Then a standard volume (3 ml)

of an injectable solution composed of a 1:10 dilution of Gd-

DTPA (Magnavista) and a 1:10 dilution of 1% methylene blue in

phosphate-buffered saline was injected into the prostate

according to one of three injection schemes (3-core, 10-core, or

20-core injection schema). Our choice of methylene blue was

supported by a previous study in which an adenoviral vector with

methylene blue was injected into muscles and showed that the

areas of gene transduction correlated well with the distribution of

methylene blue on gross histologic examination (O’Hara et al,

2001). For each injection of methylene blue-Gd–DTPA solution,

a 3-inch-long, 22-gauge spinal needle connected to a standard 1-

ml Luer-Lok syringe containing the appropriate aliquot for

injection was guided into the prostate according to the

appropriate injection scheme. The needle tip was localized within

the prostatic parenchyma with ultrasound guidance.

All experiments were performed on a 1.5 T scanner (Signa

Echospeed, General Electric Medical Systems, Milwaukee, WI).

The scanner is equipped with a high-performance gradient

hardware package (SR120) and fast-receiver hardware. The

maximum achievable slew rate is 120 mT/m/s, and the maximum

amplitude is 23 mT/m. The fast receiver has a bandwidth of +/-

500 MHz. Gel-mounted samples were placed in a custom 16-

element, 10-cm-diameter birdcage transmit-receive

radiofrequency coil designed in house and imaged at high

resolution (234 x 234 µm) over a 60-mm field-of-view using a

256 x 256 acquisition matrix. Two-dimensional slice thickness

was 1.6 mm with 0.5-mm gaps, and three-dimensional images

were 0.60 mm thick with no gap. T1-weighted spin-echo images

were acquired using TR/TE = 300 ms/15 ms, NEX (excitations)

= 6, and bandwidth = +/-16 kHz. T2-weighted fast spin-echo

images were acquired using TR/TE = 4,400 ms/84 ms, NEX = 8,

bandwidth = +/-16 kHz, and echo train = 8. Proton-density-

weighted images were acquired using a fast spin-echo with

TR/TE = 4400 ms/17.4 ms, NEX = 4, bandwidth = +/-25 kHz,

and echo train = 4. T2*-weighted images were acquired using a

gradient-recalled acquisition in the steady state with TR/TE =

650 ms/20 ms, flip angle = 60°, NEX = 6, and bandwidth = +/-16

kHz. The T1-weighted three-dimensional sequence was acquired

using a fast spoiled gradient-recalled echo with TR/TE = 13.4

ms/4.2 ms, flip angle = 20°, NEX = 6, bandwidth = +/-16 kHz,

and 72 scan locations per block.

After MR imaging, prostates were removed from their

containers and gelatin molds and fixed in 10% formalin.

Subsequently, samples were transversely sectioned in 3-mm-

thick sections and digitally photographed. The distribution of

methylene blue seen on photographs was then compared with the

distribution of gadolinium seen on MR imaging. Furthermore,

the distribution of methylene blue on photographs was

quantitated using Image Pro Plus 4 software (Media Cybernetics,

Carlsbad, CA). Statistical analyses were performed using the

Bonferroni Multiple Comparison Test. Differences with P values

! 0.05 were considered significant.

Cell Line and Recombinant Adenovirus Vector. LNCaP

prostatic tumor cells, purchased from American Type Culture

Collection (Manassas, VA), were maintained in RPMI

supplemented with 10% fetal bovine serum, 100 units/ml

penicillin, 100 µg/ml streptomycin, and 4 mM glutamine. All

cells were incubated at 370C in a humidified atmosphere of 5%

CO2 in air. Recombinant adenovirus vector Ad-X-gal, which

expresses the X-gal reporter gene under the control of the human

cytomegalovirus immediate-early promoter/enhancer was

provided by Introgen, Inc. (Houston, TX). The titer of Ad-X-gal

was 1.5 x 1011 plaque-forming units per milliliter. All in vitro

experiments were performed in triplicate using a MOI of 10. X-

gal staining was performed by standard protocol (Zhang et al,

2003).

III. ResultsFigure 1 shows the distribution of methylene blue on

histologic examination and the distribution of gadolinium

on MR imaging for a representative prostate from each of

the three injection scheme groups.

The mean volume of the prostates was 22.9 ml ± 7.9

ml. The mean proportion of the prostate to which

methylene blue was distributed was 28.5 ± 3.8% for the 3-

core technique. The 3-core injection scheme left multiple

untreated areas in the lateral horns of the prostate as well

as in the anterior portion of the prostate. The mean

proportion of the prostate to which methylene blue was

distributed was 28.7% ± 3.4 for the 10-core technique and

53.5 ± 4.0% for the 20-core technique. The 20-core

injection technique provided the greatest coverage of

prostatic volume (P < 0.001).

The distribution of methylene blue on photographs

correlated well with the distribution of Gd-DTPA on MR

images. In general, regions of injected material were

observed as hyperintense on the T1-weighted spin-echo

and spoiled gradient-recalled echo images because of the

shortening of the spin-lattice relaxation time (T1) due to

Gd-DTPA. In regions where the concentration of Gd-

DTPA was high, such as the injection site fistulae, signal


511

was sometimes hypointense on the T1-weighted spin-echo

images because of shortening of T2. This effect was rarely

observed on the T1-weighted three-dimensional fast

spoiled gradient-recalled echo images because of the short

echo time. Regions of high Gd-DTPA concentration

appeared hypointense on the T2-weighted and proton-

density-weighted images as well (Figure 2). These

hypointense regions on T2- and T2*-weighted images

correlated well with the distribution of methylene blue

seen on whole-mount examination, but did not

demonstrate the same level of contrast seen in the T1-

weighted images.

Figure 1. Distribution of methylene blue on whole-mount histologic evaluation from each of the three injection schemes. Comparison of

3-core vs. 10-core, p > 0.05; 3-core vs. 20-core, p < 0.001; and 10-core vs. 20-core, p < 0.001.

Figure 2. Appearance of tissue sections

from the same prostate on gross

pathologic examination and on MR

imaging. (a) Distribution of methylene

blue seen on whole-mount examination.

(b) Distribution of Gd-DTPA observed

best on three-dimensional T1-weighted

MR imaging. (c) T1-weighted spin-echo

images show enhancement with regions

of reduced signal intensity corresponding

to large concentrations of Gd. (d)

Proton-density-weighted and (e) T2-

weighted images demonstrate the effect

of shortened T2 values. (f) T2*-weighted

images show additional darkening due to

Gd-DTPA susceptibility.


512

Subsequent studies demonstrated two key points.

First, in the ex-vivo model we determined that for every 5

grams of prostatic tissue, 1 ml of solution should be

injected for best coverage (data not shown). In addition,

LNCaP prostatic tumors cell lines were grown under

standard conditions and treated with various

concentrations of gadolinium combined with 10 MOI of

nonreplicating adenovirus with a cytomegalovirus reporter

and X-gal gene. Standard concentrations of gadolinium

were not toxic to the adenovirus and did not affect gene

transduction rates (data not shown).

IV. DiscussionLocalized prostate cancer is a multifocal disease, and

the inability to deliver a therapeutic solution to the entire

prostate would make intraprostatic injection unlikely to

succeed. Indeed, despite promising preclinical findings

with gene therapy, the reported clinical trials of gene

therapy for prostate cancer have found little or no

therapeutic effect (Harrington et al, 2001; Steiner and

Gingrich, 2001). However initiation of further studies

relying on injection of a therapeutic solution into the

prostate will be pointless until we further study the

distribution of a solution when injected into the prostate.

We have demonstrated that when a standard volume

of solution is injected into a canine prostate ex vivo, a 20-

core injection scheme results in greater coverage of the

prostate than a 3-core or 10-core injection scheme. The 3-

and 10-core injection scheme resulted in a more intense,

localized distribution of the methylene blue, which left

multiple untreated areas in the lateral horns of the prostate

as well as in the anterior portion of the prostate. As

previous research has demonstrated, a significant number

of tumors are found in the lateral horn of the prostate.

Thus, treatment of these areas is of the utmost importance.

Two other very important concepts were discovered

in subsequent studies. When a prostate is evaluated prior

to injection of a solution, we believe a transrectal

sonographic volume study should be performed initially

and that for every 5 grams of prostate, 1 ml of solution

should be injected for best coverage (data no shown). In

addition, in another subsequent study, prostatic epithelium

tumors in vitro were treated with various concentrations of

gadolinium combined with 10 MOI of nonreplicating

adenovirus with a cytomegalovirus reporter and X-gal

gene. Standard concentrations of gadolinium were not

toxic to the adenovirus and did not affect gene

transduction rates (data not shown). Thus, gadolinium can

be used in combination with viral vectors to monitor

vector distribution without affecting gene transfer.

This study has several limitations. First and

foremost, the injections were performed in an ex vivo

setting. In vivo injection with ongoing diffusion and

perfusion may result in an even greater distribution of

injected solution. Second, the canine prostate does not

exactly mimic the human prostate. The canine prostate has

multiple vertical septations, which may affect the

distribution of the injected solution. Finally, on the basis

of a subsequent study in which we determined that 1 ml of

solution should be injected for every 5 grams of prostate

tissue to achieve optimal distribution within the prostate.

In conclusion, the limited therapeutic effects seen in

previous studies when a solution is injected into the

prostate, specifically gene therapy for prostate cancer may

be due in part to inadequate treatment of the entire

prostate. In this pilot study, we demonstrated that a 20-

core injection scheme resulted in wider intraprostatic

distribution of a standard volume of material injected into

canine prostates than did a 3-core or 10-core scheme and

that for every 5 grams of prostatic tissue 1 ml of solution

should be injected. Furthermore, these preliminary results

indicate that MR imaging, particularly T1-weighted three-

dimensional imaging, may be useful as a noninvasive

method for evaluating the distribution of intraprostatic

injections. Finally, subsequent studies should confirm that

1 mL of solution can cover 5 grams of prostatic tissue thus

achieving optimal distribution.

ReferencesBelldegrun A, Tso CL, Zisman A, Naitoh TJ, Said J, Pantuck AJ,

Hinkel A, deKernion J, Figlin R (2001) Interleukin 2 gene

therapy for prostate cancer: phase I clinical trial and basic

biology. Hum Gene Ther 12, 883-892.

Eder JP, Kantoff PW, Bubley GJ (1998) A phase I trial of

recombinant vaccinia virus, PROSTVAC, that expresses

prostate specific antigen (rV-PSA) as a vaccine in men with

advanced prostate cancer. Presented at the annual meeting of

the American Society of Clinical Oncology, Los Angeles,

1998. Available at: http://www.asco.org/ac/1,1003,_12-

002326-00_18-001998-00_19-0013825-00_29-00A,00.asp.

Accessed April 11, 2003.

Gotoh A, Kao C, Ko SC, Hamada K, Liu TJ, Chung LW (1997)

Cytotoxic effects of recombinant adenovirus p53 and cell

cycle regulator genes (p21 and p16) in human prostate

cancers. J Urol 158, 636-641.

Gulley J, Chen AP, Dahut W, Arlen PM, Bastian A, Steinberg

SM, Tsang K, Panicali D, Poole D, Schlom J, Michael

Hamilton J (1998) A phase I study of recombinant vaccinia

virus (RV) that expresses prostate specific antigen (PSA) in

adult patients with adenocarcinoma of the prostate. Presented

at the annual meeting of the American Society of Clinical

Oncology, Los Angeles, 1998. Available at:

http://www.asco.org/ac/1,1003,_12-002326-00_18-001998-

00_19-0013429-00_29-00A,00.asp. Accessed April 11,

2003.

Harrington KJ, Spitzweg C, Bateman AR, Morris JC, Vile RG

(2001) Gene therapy for prostate cancer: current status and

future prospects. J Urol 166, 1220-1233.

Herman JR, Adler HL, Aguilar-Cordova E, Rojas-Martinez A,

Woo S, Timme TL, Wheeler TM, Thompson TC, Scardino

PT (1999) In situ gene therapy for adenocarcinoma of the

prostate: a phase I clinical trial. Hum Gene Ther 10, 1239-

1249.

Issacs WB, Carter BS, Ewing CM (1991) Wild-type p53

suppresses growth of human prostate cancer cells containing

mutant p53 alleles. Cancer Res 51, 4716-4720.

Lu Y, Carraher J, Zhang Y, Armstrong J, Lerner J, Rogers WP,

Steiner MS (1999) Delivery of adenoviral vectors to the

prostate for gene therapy. Cancer Gene Ther 6, 64-72.

Moody DB, Robinson JC, Ewing CM, Lazenby AJ, Issacs WB

(1994) Interleukin-2 transfected prostate cancer cells

generate a local antitumor effect in vivo. Prostate 24, 244-

251.

O’Hara AJ, Howell JM, Taplin RH, Fletcher S, Lloyd F, Kakulas

B, Lochmuller H, Karpati G (2001) The spread of transgene


513

expression at the site of gene construct injection. Muscle

Nerve 24, 488-495.

Pisters LL, Pettaway CA, Hossan E, Evans R, Steiner MS, Wood

CG, Troncoso P, McDonnell TJ, Fenstenmacher MJ,

Logothetis CJ (1999) Intraprostatic AD-p53 gene therapy

followed by radical prostatectomy: feasibility and

preliminary results. Prostate Cancer Prostatic Dis 2,

(S3):S27.

Recombinant DNA Advisory Committee. Office of

Biotechnology Activities. National Institutes of Health.

Clinical Trials in Human Gene Transfer. Available at:

http://www4.od.nih.gov/oba/rac/clinicaltrial.htm. Accessed

April 10, 2003.

Simons JW, Mikhak B, Chang JF, Demarzo AM, Carducci MA,

Lim M, Weber CE, Baccala AA, Goemann MA, Clift SM,

Ando DG, Levitsky HI, Cohen LK, Sanda MG, Mulligan

RC, Partin AW, Carter HB, Piantadosi S, Marshall FF,

Nelson WG (1999) Induction of immunity to prostate cancer

antigens: results of a clinical trial of vaccination with

irradiated autologous prostate tumor cells engineered to

secrete granulocyte-macrophage colony-stimulating factor

using ex vivo gene transfer. Cancer Res 59, 5160-5168.

Steiner MS, Gingrich JR (2001) Gene therapy for prostate

cancer: where are we now? J Urol 164, 1121-1136.

Steiner MS, Zhang Y, Farooq F, Lerner J, Wang Y, Lu Y (2000)

Adenoviral vector containing wild-type p16 suppresses

prostate cancer growth and prolongs survival by inducing

cell senescence. Cancer Gene Ther 7, 360-372.

Vieweg J, RosenthaI FM, Bannerji R, Heston WD, Fair WR,

Gansbacher B, Gilboa E (1994) Immunotherapy of prostate

cancer in the Dunning rat model: use of cytokine gene

modified tumor vaccines. Cancer Res 5, 1760-1765.

Zhang X, Multani AS, Zhou JH, Shay JW, McConkey D, Dong

L, Kim CS, Rosser CJ, Pathak S, Benedict WF (2003)

Adenoviral-mediated Rentinoblastoma 94 Produces Rapid

Telomere Erosion, Chromosomal Crisis, and Caspase-

dependent Apoptosis in Bladder Cancer and Immortalized

Human Urothelial Cells but not in Normal Urothelial Cells.

Cancer Res 63, 760-765.

Charles J. Rosser


514


515


ER stress and the JNK pathway in insulin resistanceReview Article

Hideaki Kaneto*, Yoshihisa Nakatani, and Munehide MatsuhisaDepartment of Internal Medicine and Therapeutics, Osaka University Graduate School of Medicine, 2-2 Yamadaoka,

Suita, Osaka 565-0871, Japan

__________________________________________________________________________________

*Correspondence: Hideaki Kaneto, MD, PhD, Department of Internal Medicine and Therapeutics, Osaka University Graduate School

of Medicine, 2-2 Yamadaoka, Suita, Osaka 565-0871, Japan; Tel. (81-6) 6879-3633; Fax (81-6) 6879-3639; e-mail:

[email protected]

Key words: diabetes JNK pathway, ER stress, insulin resistance

Abbreviations: ! subunit of translation initiation factor 2, (eIF2!); antisense ORP150 expressing adenovirus,(Ad-AS-ORP); c-Jun N-

terminal kinase, (JNK); disappearance rate, (Rd); dominant-negative JNK expressing adenovirus, (Ad-DN-JNK); dominant-negative

type, (DN); endoplasmic reticulum, (ER); fluorescein isothiocyanate, (FITC); GFP expressing control adenovirus, (Ad-GFP); glucose

infusion rate, (GIR); glucose-6-phosphatase, (G6Pase); hepatic glucose production, (HGP); human immunodeficiency virus, (HIV-1);

insulin receptor substrate-1, (IRS-1); intraperitoneal glucose tolerance test, (IPGTT); intraperitoneal insulin tolerance test, (IPITT); islet-

brain-1, (IB-1); JNK-interacting protein-1, (JIP-1); mouse embryo fibroblasts, (MEFs); oxygen-regulated protein 150, (ORP150);

pancreatic ER kinase, (PERK); phosphoenolpyruvate carboxykinase, (PEPCK); protein transduction domains, (PTDs); sense ORP150

expressing adenovirus,(Ad-S-ORP); wild type, (WT); X-box–binding protein–1, (XBP-1)


Accepted: 14 December 2004; electronically published: January 2005

Summary

The endoplasmic reticulum (ER) is an organelle which synthesizes various secretory and membrane proteins. These

proteins are correctly folded and assembled by chaperones in the ER. During stressful conditions such as upon an

increase in the misfolded protein level, the chaperons become overloaded and the ER fails to fold and export newly

synthesized proteins, leading to ER stress. Under diabetic conditions ER stress is induced and the JNK pathway is

subsequently activated, which is involved in the insulin resistance. Increase of ER stress and activation of the JNK

pathway interferes with insulin action. In reverse, reduction of ER stress and suppression of the JNK pathway in

obese diabetic mice markedly improve insulin resistance and ameliorate glucose tolerance. Taken together, increase

of ER stress and subsequent activation of the JNK pathway play a crucial role in the progression of insulin

resistance found in diabetes and thus could be a potential therapeutic target for diabetes.

I. Involvement of ER stress in insulin

resistanceType 2 diabetes is the most prevalent and serious

metabolic disease affecting people all over the world. The

hallmark of the disease is insulin resistance as well as

pancreatic "-cell dysfunction. Under diabetic conditions,

various insulin target tissues such as liver, muscle, and fat

become less responsive or resistance to insulin. This state

is also often linked to other common diseases such as

obesity, hyperlipidemia, hypertension, and atherosclerosis.

The pathophysiology of insulin resistance involves a

complex network of insulin signaling pathways. After

insulin binds to insulin receptor on cell surface, insulin

receptor and its substrates are phosphorylated, which leads

to activation of various insulin signaling pathways. The

endoplasmic reticulum (ER) is an organelle which

synthesizes various secretory and membrane proteins.

These proteins are correctly folded and assembled by

chaperones in the ER. During stressful conditions such as

upon an increase in the misfolded protein level, the

chaperons become overloaded and the ER fails to fold and

export newly synthesized proteins, leading to ER stress

(Aridor et al, 1999; Harding et al, 1999; Ron et al, 2002;

Tirasophon et al, 1998; Wang et al, 1998). Once ER stress

is provoked in the cells, various pathways are activated

(Figure 1). The pancreatic ER kinase (or PKR-like kinase)

(PERK) is an ER transmembrane protein kinase that

phosphorylates the ! subunit of translation initiation factor

2 (eIF2!) in response to ER stress, and eIF2!

phosphorylation leads to reduction of translation and

induction of apoptosis (Shi et al, 1998; Harding et al,

1999; Shi et al, 2003). It is also known that ER stress

activates the c-Jun N-terminal kinase (JNK) pathway,

leading to induction of apoptosis in various cells (Urano et

al, 2000). Furthermore, ER stress is known to trigger X-

Kaneto et al: ER stress and the JNK pathway in insulin resistance

516

box-binding protein-1 (XBP-1) splicing. XBP-1 is a

transcription factor that modulates the ER stress response,

and its spliced form is a key molecule in ER stress

response through transcriptional regulation of various

genes including molecular chaperones (Figure 1)

(Yoshida et al, 2001; Iwawaki et al, 2003). It was

previously reported that ER stress is involved in pancreatic

"-cell apoptosis (Figure 2) (Inoue et al, 1998, Harding et

al, 2001, 2002; Oyadomari et al, 2001, 2002). Oxygen-

regulated protein 150 (ORP150), a molecular chaperone

found in the ER, has been shown to protect cells from ER

stress (Kuwabara et al, 1996; Tamatani et al, 2001). We

recently reported that ORP150 overexpression markedly

improved insulin resistance and ameliorated glucose

tolerance in diabetic animals, indicating that ER stress

plays a crucial role in insulin resistance (Figure 2)

(Nakatani et al, 2004).

To examine whether ER stress is increased in the

liver under diabetic conditions, we evaluated the ER stress

level in the livers of 10 week-old obese diabetic

C57BL/KsJ-db/db mice. Expression levels of KDEL and

Bip, both of which are ER stress markers, were much

higher in the obese diabetic mice compared to 10 week-old

non-diabetic C57BL6 mice, indicating that ER stress is

actually increased under diabetic conditions (Figure 2)

(Nakatani et al, 2004). It was also reported that expression

levels of several ER stress markers are increased in dietary

(high-fat diet-induced) and genetic (ob/ob) models of

obesity. PERK and eIF2! phosphorylation was increased

in the liver of obese mice compared with lean controls.

Furthermore, it was recently reported that increase of free

fatty acids, one of the contributory mechanisms for insulin

resistance in obesity and type 2 diabetes, causes pancreatic

"-cell apoptosis via ER stress (Kharroubi et al, 2004).

Taken together, ER stress is induced in various tissues

under diabetic conditions.

Consistent with earlier observations (Hirosumi et al,

2002), total JNK activity was also dramatically elevated in

the obese mice (Ozcan et al, 2004). It was reported that

when Fao liver cells were treated with tunicamycin or

thapsigargin, agents commonly used to induce ER stress,

insulin-stimulated tyrosine phosphorylation of insulin

receptor substrate 1 (IRS-1) was significantly decreased.

IRS-1 is a substrate for insulin receptor tyrosine kinase,

and serine phosphorylation of IRS-1, particularly mediated

by JNK, reduces insulin receptor signaling. Indeed,

pretreatment of Fao cells with tunicamycin produced a

significant increase in serine phosphorylation of IRS-1.

Tunicamycin pretreatment also suppressed insulin-induced

Akt phosphorylation (Figure 3) (Ozcan et al, 2004).

Furthermore, inhibition of JNK activity with the synthetic

inhibitor, SP600125, reversed the ER stress-induced serine

phosphorylation of IRS-1. Pretreatment of Fao cells with a

highly specific inhibitory peptide derived from the JNK-

binding protein, JIP, also completely preserved insulin

receptor signaling in cells exposed to tunicamycin. Similar

results were obtained with the synthetic JNK inhibitor,

SP600125. These results indicate that ER stress promotes a

JNK-dependent serine phosphorylation of IRS-1, which in

turn inhibits insulin receptor signaling (Figure 3) (Ozcan

et al, 2004).

Figure 1. ER stress signaling. Once ER stress is induced in the cells, various pathways are activated. Induction of ER stress leads to

eIF2! phosphorylation, JNK activation and XBP-1 splicing


517

Figure 2. Role of ER stress in diabetes. ER stress is induced under diabetes conditions, which is involved in insulin resistance and

pancreatic "-cell apoptosis.

Figure 3. ER stress and the JNK pathway in insulin resistance. The JNK pathway is activated under diabetic cinditions, which increases

insulin resistance and worsens glucose tolerance

To examine a role of ER stress in insulin resistance

in vivo, we prepared sense ORP150 expressing adenovirus

(Ad-S-ORP), and a GFP expressing control adenovirus

(Ad-GFP), and delivered each adenovirus to 8 week-old

C57BL/KsJ-db/db obese diabetic mice from the cervical

vein. We confirmed an increase in ORP150 expression in

the liver upon adenovirus injection, but not in other tissues

such as muscle and adipose tissue. In addition, expression

levels of KDEL and Bip in Ad-S-ORP-treated mice were

lower compared to those in Ad-GFP treated db/db mice,

indicating that ORP150 is actually acting to decrease ER

stress in the liver. There was no difference in body weight

and food intake between Ad-S-ORP-treated- and Ad-GFP-

treated-db/db mice. When C57BL/KsJ-db/db mice were

treated with Ad-S-ORP, nonfasting blood glucose levels

were markedly reduced, whereas no such effects were

observed in Ad-GFP-treated mice. Fasting blood glucose

concentrations were also significantly lower in Ad-S-

ORP-treated mice compared to Ad-GFP-treated mice. To

examine the effects of ORP150 overexpression in the liver

on insulin resistance, we performed the intraperitoneal

insulin tolerance test (IPITT). The hypoglycemic response

to insulin was larger in Ad-S-ORP-treated C57BL/KsJ-

db/db mice compared to Ad-GFP-treated mice. To

investigate this point further, we performed the

euglycemic hyperinsulinemic clamp test. The GIR of Ad-


518

S-ORP-treated mice were significantly higher compared to

Ad-GFP-treated mice, indicating that ORP150

overexpression in the liver reduces insulin resistance and

thus ameliorates glucose tolerance in C57BL/KsJ-db/db

mice. We also evaluated endogenous hepatic glucose

production (HGP) in Ad-S-ORP-treated mice using tracer

methods. HGP was significantly lower in Ad-S-ORP-

treated mice compared to Ad-GFP-treated mice. These

results indicate that the reduction of insulin resistance and

amelioration of glucose tolerance by Ad-S-ORP

overexpression are mainly due to the suppression of HGP

(Figure 3) (Nakatani et al, 2004).

Similarly, to examine the effects of antisense

ORP150 expression in the liver on insulin sensitivity and

glucose tolerance in non-diabetic animals, we prepared an

antisense ORP150 expressing adenovirus (Ad-AS-ORP)

and delivered each adenovirus to 8 week-old C57BL6

mice. The intraperitoneal glucose tolerance test (IPGTT)

revealed that glucose tolerance is markedly worsened upon

antisense ORP150 expression. Furthermore, in the

euglycemic hyperinsulinemic clamp study, glucose

infusion rate (GIR) of Ad-AS-ORP-treated C57BL6 mice

were significantly lower compared to Ad-GFP-treated

mice, indicating that ER stress in the liver reduces insulin

sensitivity in C57BL6 mice. Furthermore, we evaluated

HGP in Ad-AS-ORP-treated mice using tracer methods.

HGP in Ad-AS-ORP-treated mice was significantly

greater compared to Ad-GFP-treated mice. These results

indicate that antisense ORP150 expression decreases

insulin sensitivity at least in part by increasing HGP in

non-diabetic mice (Nakatani et al, 2004).

To examine the molecular mechanisms involved in

the alteration of insulin action by ER stress in our

experiments, we evaluated the phosphorylation state of

IRS-1 and Akt in the liver, which are key molecules for

insulin signaling. IRS-1 tyrosine phosphorylation was

markedly increased in Ad-S-ORP-treated C57BL/KsJ-

db/db mice compared to Ad-GFP-treated mice.

Concomitantly, an increase in Akt serine 473

phosphorylation was observed in Ad-S-ORP-treated

C57BL/KsJ-db/db mice compared to Ad-GFP-treated mice

(Figure 3). We next examined the expression levels of the

key gluconeogenic enzymes phosphoenolpyruvate

carboxykinase (PEPCK) and glucose-6-phosphatase

(G6Pase), both of which are known to be regulated by

insulin signaling. Both the expression of PEPCK and

G6Pase was markedly decreased by Ad-S-ORP treatment

in C57BL/KsJ-db/db mice. These results indicate that

reduction of ER stress enhances insulin signaling which

leads to a decrease in gluconeogenesis and amelioration of

glucose tolerance (Nakatani et al, 2004). Taken together,

sense ORP150 overexpression decreased insulin resistance

and markedly improved glycemic control in diabetic

model animals, and in contrast antisense ORP150

expression induced insulin resistance in nondiabetic

control mice, indicating that ER stress plays a crucial role

in the insulin resistance found in diabetes (Figures 2, 3).

Furthermore, it was reported that mice deficient in

XBP-1, a transcription factor that modulates the ER stress

response, develop insulin resistance. The spliced form of

XBP-1 is a key molecule in ER stress response through

transcriptional regulation of various genes including

molecular chaperones (Figure 1). In mouse embryo

fibroblasts (MEFs) derived from XBP-1–/– mice,

tunicamycin treatment resulted in increase of PERK

phosphorylation. In these cells, there was also a rapid and

robust activation of JNK in response to ER stress. When

spliced XBP-1 expression was induced, there was a

dramatic reduction in both PERK phosphorylation and

JNK activation after tunicamycin treatment, indicating that

XBP-1–/– cells are prone to ER stress. Thus, it is likely that

alteration in the levels of spliced XBP-1 protein results in

alteration in the ER stress responses. Furthermore,

tunicamycin-induced IRS-1 serine phosphorylation was

significantly reduced in fibroblasts exogenously

expressing spliced XBP-1. The extent of IRS-1 tyrosine

phosphorylation was significantly higher in cells

overexpressing spliced XBP-1. In contrast, IRS-1 serine

phosphorylation was strongly induced in XBP-1–/– MEFs

compared with XBP-1+/+ controls even at low doses of

tunicamycin treatment. After insulin stimulation, the

amount of IRS-1 tyrosine phosphorylation was

significantly decreased in tunicamycin-treated XBP-1–/–

cells compared with tunicamycin-treated wild-type

controls (Ozcan et al, 2004).

Since complete XBP-1 deficiency results in

embryonic lethality, BALB/c-XBP-1+/– mice with a null

mutation in one XBP-1 allele were used in order to

investigate the role of XBP-1 in insulin resistance and

diabetes in vivo. XBP-1+/– mice treated with high fat diet

developed continuous and progressive hyperinsulinemia.

Blood glucose levels were also increased in the XBP-1+/–

mice treated with high fat diet. During insulin tolerance

test, the hypoglycemic response to insulin was also

significantly lower in XBP-1+/– mice compared with XBP-

1+/+ littermates (Ozcan et al, 2004). PERK phosphorylation

was increased in the liver of obese XBP-1+/– mice

compared with wild-type controls treated with high fat

diet. There was also a significant increase in JNK activity

in XBP-1+/– mice compared with wild type controls.

Consistently, Ser307 phosphorylation of IRS-1 was

increased in XBP-1+/– mice compared with wild-type

controls. There was no detectable difference in any of the

insulin receptor signaling components in liver and adipose

tissues between genotypes taking regular diet. However,

after treatment with high fat diet, major components of

insulin receptor signaling in the liver, including IRS-1

tyrosine- and Akt serine-phosphorylation, were decreased

in XBP-1+/– mice compared with wild type controls. A

similar suppression of insulin receptor signaling was also

evident in the adipose tissues of XBP-1+/– mice compared

with XBP-1+/+ mice (Ozcan et al, 2004). Taken together,

induction of ER stress or reduction in the compensatory

capacity through down-regulation of XBP-1 leads to

suppression of insulin receptor signaling in intact cells via

IRE-1!-dependent activation of the JNK pathway.

Experiments with mouse models also yielded data

consistent with the link between ER stress and systemic

insulin action. Deletion of an XBP-1 allele in mice leads to

enhanced ER stress, activation of the JNK pathway,

reduced insulin receptor signaling, systemic insulin

resistance, and type 2 diabetes. Therefore, ER stress is


519

involved in progression of insulin resistance and thus

could be a potential therapeutic target for diabetes

(Figures 2, 3).

II. Involvement of the JNK pathway in

insulin resistanceThe JNK pathway (Hibi et al, 1993; Derijard et al,

1994; Davis et al, 2000; Chang et al, 2001) is known to be

activated by ER stress (Urano et al, 2000) and thus is

possibly involved in the progression of insulin resistance.

We have recently examined the effects of modulation of

the JNK pathway in the liver on insulin resistance and

glucose tolerance (Nakatani et al, 2004). Overexpression

of dominant-negative type (DN) JNK in the liver of obese

diabetic mice dramatically improved insulin resistance and

markedly decreased blood glucose levels. When

C57BL/KsJ-db/db mice were treated with Ad-DN-JNK,

nonfasting blood glucose levels were markedly reduced,

whereas no such effect was observed in Ad-GFP-treated

mice. IPITT, the hypoglycemic response to insulin was

larger in Ad-DN-JNK-treated C57BL/KsJ-db/db mice

compared to Ad-GFP-treated mice. To investigate this

point further, we performed the euglycemic

hyperinsulinemic clamp test. GIR in Ad-DN-JNK-treated

mice was higher than that in Ad-GFP-treated mice,

indicating that suppression of the JNK pathway in the liver

reduces insulin resistance and thus ameliorates glucose

tolerance in C57BL/KsJ-db/db mice. Furthermore, HGP

was significantly lower in Ad-DN-JNK-treated mice. In

contrast, there was no difference in the glucose

disappearance rate (Rd) between these two groups. These

results indicate that reduction of insulin resistance and

amelioration of glucose tolerance by DN-JNK

overexpression are mainly due to suppression of HGP

(Figure 3) (Nakatani et al, 2004).

It has been reported that serine phosphorylation of

IRS-1 inhibits insulin-stimulated tyrosine phosphorylation

of IRS-1, leading to an increase in insulin resistance

(Aguirre et al, 2000). IRS-1 serine 307 phosphorylation

was markedly decreased in Ad-DN-JNK-treated mice. We

also found an increase in IRS-1 tyrosine phosphorylation

in Ad-DN-JNK-treated mice compared to control mice.

Reduction of Akt serine 473 phosphorylation was

observed in Ad-DN-JNK-treated C57BL/KsJ-db/db mice

(Nakatani et al. 2004). Therefore, an increase in IRS-1

serine phosphorylation may be closely associated with the

development of insulin resistance induced by JNK

overexpression (Figure 3). Next, we examined the

expression levels of the key gluconeogenic enzymes,

PEPCK and glucose-6-phosphatase (G6Pase), both of

which are known to be regulated by insulin signaling.

Expression levels of both enzymes were markedly

decreased by Ad-DN-JNK treatment in C57BL/KsJ-db/db

mice (Nakatani et al, 2004). These results indicate that

suppression of the JNK pathway enhances insulin

signaling which leads to a decrease in gluconeogenesis

and amelioration of glucose tolerance. Similar effects were

observed in high-fat / high-sucrose diet-induced diabetic

mice. Conversely, expression of wild type JNK in the liver

of normal mice decreased insulin sensitivity. Taken

together, these findings suggest that suppression of the

JNK pathway in the liver exerts greatly beneficial effects

on insulin resistance status and glucose tolerance in both

genetic and dietary models of diabetes (Figure 3)

(Nakatani et al, 2004).

It has been also reported recently that JNK activity is

abnormally elevated in the liver, muscle and adipose

tissues in obese type 2 diabetic mouse models and that

insulin resistance is substantially reduced in mice

homozygous for a targeted mutation in the JNK1 gene

(JNK-KO mice) (Hirosumi et al, 2002). When the JNK-

KO mice were placed on a high-fat / high-caloric diet,

obese wild type mice developed mild hyperglycemia

compared to lean wild type control mice. In contrast,

blood glucose levels in obese JNK-KO mice was

significantly lower compared to those in obese wild type

mice. In addition, serum insulin levels in obese JNK-KO

mice were significantly lower compared to those in obese

wild type mice. IPITT showed that hypoglycemic response

to insulin in obese wild type mice was lower compared to

that in obese JNK-KO mice. Also, IPGTT revealed a

higher degree of hyperglycemia in obese wild type mice

than in obese JNK-KO mice (Hirosumi et al, 2002). These

results indicate that the JNK-KO mice are protected from

the development of dietary obesity-induced insulin

resistance. Furthermore, targeted mutations in JNK were

introduced in genetically obese mice (ob/ob). Blood

glucose levels in ob/ob-JNK-KO mice were lower

compared to those in ob/ob wild type mice, and the ob/ob

wild type mice displayed a severe and progressive

hyperinsulinemia. Thus, JNK deficiency can provide

partial resistance against obesity, hyperglycemia and

hyperinsulinemia in both genetic and dietary models of

diabetes. Taken together, obese type 2 diabetes is

associated with activation of the JNK pathway, and the

absence of JNK results in substantial protection from

obesity-induced insulin resistance. These results strongly

suggest that activation of the JNK pathway plays a crucial

role in progression of insulin resistance found in type 2

diabetes (Figure 3).

Furthermore, activation of the JNK pathway is

involved in pancreatic "-cell dysfunction as well as insulin

resistance. Indeed, it was reported that activation of the

JNK pathway leads to reduction of insulin gene expression

and that suppression of the JNK pathway can protect "-

cells from oxidative stress and some of the toxic effects of

hyperglycemia (Kaneto et al, 2002; Kawamori et al, 2003).

When isolated rat islets were exposed to oxidative stress,

JNK, p38 MAPK, and PKC pathways were activated,

preceding the decrease of insulin gene expression.

Adenovirus-mediated overexpression of DN-JNK, but not

the p38 MAPK inhibitor SB203580 nor the PKC inhibitor

GF109203X, protected insulin gene expression and

secretion from oxidative stress. Moreover, wild type (WT)

JNK overexpression suppressed both insulin gene

expression and secretion (Kaneto et al, 2002). These

results were correlated with changes in the binding of the

important transcription factor PDX-1 to the insulin

promoter; adenoviral overexpression of DN-JNK

preserved PDX-1 DNA binding activity in the face of

oxidative stress, while WT-JNK overexpression decreased


520

PDX-1 DNA binding activity. Thus, it is likely that JNK-

mediated suppression of PDX-1 DNA binding activity

accounts for some of the suppression of insulin gene

transcription and of "-cell function, which fits with the

phenomenon that PDX-1 expression DNA binding activity

is decreased in association with reduction of insulin gene

transcription after chronic exposure to a high glucose

concentration. Thus, it is likely that activation of JNK

pathway leads to decreased PDX-1 activity and subsequent

suppression of insulin gene transcription in the diabetic

state (Kaneto et al, 2002).

To examine whether DN-JNK can protect "-cells

from the toxic effects of hyperglycemia and to explore the

potential therapeutic application for islet transplantation,

we performed islet transplantation into diabetic mice.

Isolated rat islets were infected with Ad-DN-JNK or Ad-

GFP and cultured for 2 days; then 500 islets were

transplantated under kidney capsules of STZ-induced

diabetic Swiss nude mice. Blood glucose levels were not

sufficiently decreased by transplantation of islets infected

with Ad-GFP, which was probably due to toxic effects of

hyperglycemia upon a marginal islet number, but were

markedly decreased by Ad-DN-JNK. Four weeks after

transplantation of islets infected with Ad-GFP, insulin

mRNA levels in islet grafts were clearly decreased

compared with those before transplantation, but relatively

preserved by DN-JNK overexpression (Kaneto et al,

2002). These results suggest that DN-JNK can protect "-

cells from some of the toxic effects of hyperglycemia

during this transplant period, providing new insights into

the mechanism through which oxidative stress suppresses

insulin gene transcription in "-cells.

III. The JNK pathway as a therapeutic

target for diabetesProtein transduction domains (PTDs) such as the

small PTD from the TAT protein of human

immunodeficiency virus (HIV-1), the VP22 protein of

Herpes simplex virus, and the third !-helix of the

homeodomain of Antennapedia, a Drosophila transcription

factor, are known to allow various proteins and peptides to

be efficiently delivered into cells through the plasma

membrane, and thus there has been increasing interest in

their potential usefulness for the delivery of bioactive

proteins and peptides into cells (Elliott et al, 1997; Frankel

et al, 1988; Nagahara et al, 1998; Schwarze et al, 1999;

Rothbard et al, 2000;Noguchi et al, 2003, 2004). We have

recently evaluated the potential usefulness of a JNK

inhibitory peptide in the treatment of type 2 diabetes and

found that the cell permeable JNK inhibitory peptide

(amino acid sequence: GRK KRR QRR RPP RPK RPT

TLN LFP QVP RSQ DT) is very effective. This peptide is

derived from the JNK binding domain of JNK-interacting

protein-1 (JIP-1), also known as islet-brain-1 (IB-1), and

has been reported to function as a dominant inhibitor of

the JNK pathway (Bonny et al, 2001). To convert the

minimal JNK-binding domain into a bioactive cell-

permeable compound, a 20-amino acid sequence derived

from the JNK-binding domain of JIP-1 (RPK RPT TLN

LFP QVP RSQ DT) was covalently linked to a 10-amino

acid carrier peptide derived from the HIV-TAT sequence

(GRK KRR QRR R); then to monitor peptide delivery,

this JIP-1-HIV-TAT peptide was further conjugated with

fluorescein isothiocyanate (FITC). First, to examine the

effectiveness of the JNK inhibitory peptide in vivo,

C57BL/KsJ-db/db obese diabetic mice were injected

intraperitoneally with the JIP-1-HIV-TAT-FITC peptide.

The FITC-conjugated peptide showed fluorescence signals

in insulin target organs (liver, fat, muscle) and in insulin

secreting tissue (pancreatic islets). Next, we examined

whether the JNK pathway is inhibited after the treatment

with JIP-1-HIV-TAT-FITC. In various tissues (liver, fat,

and muscle), the JNK activity was actually suppressed by

JIP-1-HIV-TAT-FITC in a dose-dependent manner

(Kaneto et al, 2004).

To investigate whether suppression of the JNK

pathway exerts beneficial effects on diabetes, we treated

C57BL/KsJ-db/db mice with the intraperitoneal injection

of the JNK inhibitory peptide, JIP-1-HIV-TAT-FITC.

There was no difference in body weight and food intake

between the JIP-1-HIV-TAT-FITC-treated and untreated

mice. Glucose tolerance test performed showed that

glucose tolerance in JIP-1-HIV-TAT-FITC-treated mice

was significantly ameliorated compared to untreated or the

scramble peptide-treated mice. These data indicate that the

JNK pathway is involved in the exacerbation of diabetes

and that suppression of the JNK pathway could be a

therapeutic target for diabetes (Kaneto et al, 2004). To

investigate the possible effects of the JNK inhibitory

peptide on insulin action, we performed insulin tolerance

test. Reduction of blood glucose levels in response to

injected insulin was much larger in JIP-HIV-TAT-FITC-

treated mice compared to untreated mice, indicating that

the peptide treatment improves the insulin sensitivity. To

further investigate the effect of the peptide on insulin

resistance, we performed the euglycemic hyperinsulinemic

clamp test. The steady-state GIR in JIP-1-HIV-TAT-

FITC-treated mice was significantly higher than that in

untreated mice, indicating that JIP-1-HIV-TAT-FITC

reduces insulin resistance in C57BL/KsJ-db/db mice

(Kaneto et al, 2004). Furthermore, we evaluated

endogenous HGP and glucose Rd in the JNK inhibitory

peptide-treated mice. It is noted that Rd reflects glucose

utilization in the peripheral tissues. HGP in JIP-1-HIV-

TAT-FITC-treated mice was significantly lower than that

in untreated mice. In addition, Rd in JIP-1-HIV-TAT-

FITC-treated mice was significantly higher than that in

untreated mice (Kaneto et al, 2004). These results indicate

that JIP-1-HIV-TAT-FITC treatment reduces insulin

resistance through decreasing HGP and increasing Rd.

These data provide strong evidence that JNK is indeed a

crucial component of the biochemical pathway responsible

for insulin resistance in vivo. Furthermore, IRS-1 serine

307 phosphorylation was decreased in JIP-1-HIV-TAT-

FITC-treated mice compared to control mice. We also

found the increase of IRS-1 tyrosine phosphorylation in

the peptide-treated mice compared to control mice.

Concomitantly, increase of Akt serine 473 and threonine

308 phosphorylation both of which are known to be

important for activation of the Akt pathway was observed

in JIP-1-HIV-TAT-FITC-treated mice (Kaneto et al,


521

2004). In addition, to examine the effect of JIP-1-HIV-

TAT-FITC treatment on insulin biosynthesis, we measured

insulin mRNA level and content in pancreata of

C57BL/KsJ-db/db mice which had been treated with the

peptide. Insulin mRNA level and insulin content were

significantly higher in the peptide-treated mice. Thus, we

assume that the JNK inhibitory peptide exerted some

beneficial effects on the pancreatic islets (Kaneto et al,

2004). Taken together, the cell-permeable JNK inhibitory

peptide, JIP-1-HIV-TAT-FITC, improves insulin

resistance and ameliorates glucose intolerance, indicating

the critical involvement of the JNK pathway in diabetes

and the usefulness of the cell-permeable JNK inhibitory

peptide as a novel therapeutic agent for diabetes.

IV. ConclusionUnder diabetic conditions ER stress is induced and

the JNK pathway is subsequently activated, which is

involved in the insulin resistance. Increase of ER stress

and activation of the JNK pathway interfere with insulin

action. In reverse, reduction of ER stress and suppression

of the JNK pathway in obese diabetic mice markedly

improve insulin resistance and ameliorate glucose

tolerance. Taken together, increase of ER stress and

subsequent activation of the JNK pathway play a crucial

role in the progression of insulin resistance found in

diabetes and thus could be a potential therapeutic target for

diabetes.

ReferencesAguirre V, Davis R and White MF (2000) The c-Jun NH2-

terminal kinase promotes insulin resistance during

association with insulin receptor substrate-1 and

phosphorylation of Ser307. J Biol Chem 275, 9047-9054.

Aridor M and Balch WE (1999) Integration of endoplasmic

reticulum signaling in health and disease. Nature Med 5,

745-751.

Bonny C, Oberson A, Negri S, Sause C and Schorderet DF

(2001) Cell-permeable peptide inhibitors of JNK: novel

blockers of "-cell death. Diabetes 50, 77-82.

Chang L and Karin M (2001) Mammalian MAP kinase signalling

cascades. Nature 410, 37-40.

Davis RJ (2000) Signal transduction by the JNK group of MAP

kinases. Cell 103, 239-252.

Derijard B, Hibi M, Wu IH, Barrett T, Su B, Deng T, Karin M

and Davis RJ (1994) JNK1: a protein kianse stimulated by

UV light and Ha-Ras that binds and phosphorylates the c-Jun

activation domain. Cell 76, 1025-1037.

Elliott G and O’Hare P (1997) Intracellular trafficking and

protein delivery by a herpesvirus structure protein. Cell 88,

223-233.

Frankel AD and Pabo CO (1988) Cellular uptake of the tat

protein from human immunodeficiency virus. Cell 55, 1189-

1193.

Harding HP and Ron D (2002) Endoplasmic reticulum stress and

the development of diabetes: a review. Diabetes 51, S455-

461.

Harding HP, Zeng H, Zhang Y, Jungries R, Chung P, Plesken H,

Sabatini DD and Ron D (2001) Diabetes mellitus and

exocrine pancreatic dysfunction in perk-/- mice reveals a role

for translational control in secretory cell survival. Mol Cell

7, 1153-1163.

Harding HP, Zhang Y and Ron D (1999) Protein translation and

folding are coupled by an endoplasmic-reticulum-resident

kinase. Nature 397, 271-274.

Hibi M, Lin A and Karin M (1993) Identification of an

oncoprotein- and UV-responsive protein kinase that binds

and potentiates the c-Jun activation domain. Genes Dev 7,

2135-2148.

Hirosumi J, Tuncman G, Chang L, Karin M and Hotamisligil GS

(2002) A central role for JNK in obesity and insulin

resistance. Nature 420, 333-336.

Inoue H, Tanizawa Y, Wasson J, Behn P, Kalidas K, Bernal-

Mizrachi E, Mueckler M, Marshall H, Donis-Keller H, Crock

P, Rogers D, Mikuni M, Kumashiro H, Higashi K, Sobue G,

Oka Y and Permutt MA (1998) A gene encoding a

transmembrane protein is mutated in patients with diabetes

mellitus and optic atrophy (Wolfram syndrome). Nature

Genet 20, 143-148.

Iwawaki T, Akai R, Kohno K, Miura M (2004) A transgenic

mouse model for monitoring endoplasmic reticulum stress.

Nature Med 10, 98-102

Kaneto H, Nakatani Y, Miyatsuka T, Kawamori D, Matsuoka T,

Matsuhisa M, Kajimoto Y, Ichijo H, Yamasaki Y and Hori

M (2004) Possible novel therapy for diabetes with cell-

permeable JNK inhibitory peptide. Nature Med 10, 1128-

1132.

Kaneto H, Xu G, Fujii N, Kim S, Bonner-Weir S and Weir GC

(2002) Involvement of c-Jun N-terminal kinase in oxidative

stress-mediated suppression of insulin gene expression. J

Biol Chem 277, 30010-30018.

Kawamori D, Kajimoto Y, Kaneto H, Umayahara Y, Fujitani Y,

Miyatsuka T, Watada H, Leibiger IB, Yamasaki Y and Hori

M (2003) Oxidative stress induces nucleo-cytoplasmic

translocation of pancreatic transcription factor PDX-1

through activation of c-Jun N-terminal kinase. Diabetes 52,

2896-2904.

Kharroubi I, Ladriere L, Cardozo AK, Dogusan Z, Cnop M,

Eizirik DL (2004) Free fatty acids and cytokines induce

pancreatic "-cell apoptosis by different mechanisms: role of

nuclear factor-#B and endoplasmic reticulum stress.

Endocrinology. 145, 5087-96.

Kuwabara K, Matsumoto M, Ikeda J, Hori O, Ogawa S, Maeda

Y, Kitagawa K, Imuta N, Kinoshita T, Stern DM, Yanagi H

and Kamada T (1996) Purification and characterization of a

novel stress protein, the 150-kDa oxygen-regulated protein

(ORP150), from cultured rat astrocytes and its expression in

ischemic mouse brain. J Biol Chem 271, 5025-5032.

Nagahara H, Vocero-Akbani AM, Snyder EL, Ho A, Latham

D.G, Lissy NA, Becker-Hapak M, Ezhevsky SA and Dowdy

SF (1998) Transduction of full-length TAT fusion proteins

into mammalian cells:TAT-p-27Kip1 induces cell migration.

Nature Med 4, 1449-1452.

Nakatani Y, Kaneto H, Kawamori D, Hatazaki M, Miyatsuka T,

Matsuoka T, Kajimoto Y, Matsuhisa M, Yamasaki Y and

Hori M (2004) Modulation of the JNK pathway in liver

affects insulin resistance status. J Biol Chem 279, 45803-

45809.

Nakatani Y, Kaneto H, Kawamori D, Yoshiuchi K, Hatazaki M,

Matsuoka T, Ozawa K, Ogawa T, Hori M, Yamasaki Y and

Matsuhisa M (2004) Involvement of ER stress in insulin

resistance and diabetes. J Biol Chem (in press).

Noguchi H, Kaneto H, Weir GC and Bonner-Weir S (2003)

PDX-1 protein containing its own Antennapedia-like protein

transduction domain can transduce pancreatic duct and islet

cells. Diabetes 52, 1732-1737.

Noguchi H, Matsushita M, Okitsu T, Moriwaki A, Tomizawa K,

Kang S, Li ST, Kobayashi N, Matsumoto S, Tanaka K,

Tanaka N and Matsui H (2004) A new cell-permeable


522

peptide allows successful allogeneic islet transplantation in

mice. Nature Med 10. 305-309.

Oyadomari S, Koizumi A, Takeda K, Gotoh T, Akira S, Araki E

and Mori M (2002) Targeted disruption of the Chop gene

delays endoplasmic reticulum stress-mediated diabetes. J

Clin Invest 109, 525-532.

Oyadomari S, Takeda K, Takiguchi M, Gotoh T, Matsumoto M,

Wada I, Akira S, Araki E and Mori M (2001) Nitric oxide-

induced apoptosis in pancreatic beta cells is mediated by the

endoplasmic reticulum stress pathway. Proc Natl Acad Sci

USA 98, 10845-10850.

Ozcan U, Cao Q, Yilmaz E, Lee AH, Iwakoshi NN, Ozdelen E,

Tuncman G, Gorgun C, Glimcher LH and Hotamisligil GS

(2004) Endoplasmic reticulum stress links obesity, insulin

action and type 2 diabetes. Science 306: 457-461.

Ron D (2002) Translational control in the endoplasmic reticulum

stress response. J Clin Invest 110, 1383-1388.

Rothbard JB, Garlington S, Lin Q, Kirschberg T, Kreider E,

McGrane PL, Wender PA and Khavari PA (2000)

Conjugation of arginine oligomers to cyclosporin A

facilitates topical delivery and inhibition of inflammation.

Nature Med 6, 1253-1257.

Schwarze SR, Ho A, Vocero-Akbani AM and Dowdy SF (1999)

In vivo protein transduction: delivery of a biologically active

protein into the mouse. Science 285, 1569-1572.

Shi Y, Taylor SI, Tan S.-L and Sonenberg N (2003) When

Translation Meets Metabolism: Multiple Links to Diabetes.

Endocr Rev 24, 91-101.

Shi Y, Vattem KM, Sood R, An J, Liang J, Stramm L and Wek

RC (1998) Identification and Characterization of Pancreatic

Eukaryotic Initiation Factor 2!-Subunit Kinase, PEK,

Involved in Translational Control. Mol Cell Biol 18, 7499-

7509.

Tamatani M, Matsuyama T, Yamaguchi A, Mitsuda N,

Tsukamoto Y, Taniguchi M, Che YH, Ozawa K, Hori O,

Nishimura H, Yamashita A, Okabe M, Yanagi H, Stern DM,

Ogawa S and Tohyama M (2001) ORP150 protects against

hypoxia/ischemia-induced neuronal death. Nature Med 7,

317-323.

Tirasophon W, Welihinda AA and Kaufman RJ (1998) A stress

response pathway from the endoplasmic reticulum to the

nucleus requires a novel bifunctional protein

kinase/endoribonuclease (Ire1p) in mammalian cells. Genes

Dev 12, 1812-1824.

Urano F, Wang X, Bertolotti A, Zhang Y, Chung P, Harding HP

and Ron D (2000) Coupling of Stress in the ER to Activation

of JNK Protein Kinases by Transmembrane Protein Kinase

IRE1. Science 287, 664-666.

Wang XZ, Harding HP, Zhang Y, Jolicoeur EM, Kuroda M and

Ron D (1998) Cloning of mammalian Ire1 reveals diversity

in the ER stress responses. EMBO J 17, 5708-5717.

Yoshida H, Matsui T, Yamamoto A, Okada T, Mori K (2001)

XBP1 mRNA is induced by ATF6 and spliced by IRE1 in

response to ER stress to produce a highly active transcription

factor. Cell 107, 881-91.

Hideaki Kaneto


523


Molecular insight into human heparanase and

tumour progressionReview Article

Erich Rajkovic, Angelika Rek, Elmar Krieger and Andreas J Kungl*Institute of Pharmaceutical Sciences, Proteinchemistry- and Biophysics-Group, Karl-Franzens-University of Graz

__________________________________________________________________________________

*Correspondence: Andreas J Kungl, PhD, Institute of Pharmaceutical Sciences, Proteinchemistry- and Biophyiscs-Group,

Universitaetsplatz 1, A-8010 Graz, Austria; Tel: + 43 316 380 5373; Fax: + 43 316 382 541; Email: [email protected]

Key words: human heparanase, angiogenesis, tumour progression, metastasis, angiogenic factors, molecular modeling

Abbreviations: basic fibroblast growth factor, (bFGF); chinese hamster ovary, (CHO); complex extracellular matrix, (ECM);

connective-tissue-activating peptide III, (CTAP III); endothelial cells, (ECs); glycosaminoglycan, (GAG); heparan sulfate proteoglycans,

(HSPGs); heparan sulfate, (HS); human heparanase 1, (Hpa 1); human heparanase 2, (Hpa2); matrix metalloproteinase, (MMP); platelet-

derived growth factor, (PDGF); transforming growth factor-!, (TGF-!); tumour necrosis factor-", (TNF-"); vascular endothelial growth

factor, (VEGF)

Received: 13 December 2004; Accepted: 10 January 2005; electronically published: January 2005

Summary

The human heparanase is a key enzyme in tumour vascularisation and metastasis. Here we review the current

molecular knowledge on this protein and present a model of its active domain.

I. IntroductionA. Angiogenesis-A key event in tumour

progression from its cellular aspectsAngiogenesis or neovascularization is denoted as the

process of the formation of new capillaries and vessels

from preexisting blood vessels during the development as

well as during the maintenance of all organ systems. This

is in clear contrast to arteriogenesis or vasculogenesis,

which is characterised by the assembly of new vessels

from endothelial precursor cells. On the one hand

angiogenesis is known to occur in selected physiological

processes during the development of the vasculature, e.g.

ovulation or wound healing, but on the other hand it also

plays a significant role in pathophysiology, for example by

mediating the vascularization of tumours. In both cases it

is a very tightly regulated and complex cascade of multiple

interrelating processes involving endothelial cell activation

and migration, proliferation, extracellular proteolysis,

multicellular organisation and differentiation including

final branching and stabilisation (Nicosia and Madri,

1987; Buschmann and Schaper, 1999; Jain 1999). A

delicate balance between positive angiogenic stimuli and

endogenous inhibitors (Folkman, 1995) has to exist since

observations of new ("de novo") blood vessel formation

initiated in vivo by a local application of an exogenous

angiogenesis factor, showed abnormal rapid involution

due to the discontinuation of the angiogenic stimulus

(interruption of the exogenous factor) (Liotta et al, 1991;

Benett and Stetler-Stevenson, 2001). Thus, the angiogenic

response associated with many pathological phenomena

(e.g. cancer metastasis, Kaposi`s sarcoma, rheumatoid

arthritis, psoriasis) probably involves both the continuous

release of potent angiogenic signals, as well as down-

regulation or even the removal of natural antiangiogenic

effectors.

Angiogenesis takes place in a structurally

heterogenous and complex extracellular matrix (ECM)

environment and is therefore strongly influenced by the

ECM organisation and composition. Remodelling of the

extracellular matrix in terms of modulating endothelial and

vascular cell behaviours (Kalluri, 2003) is a major

prerequisite for the growth (formation) of new blood

vessels. This involves an initial breakdown of the

subendothelial basement membrane, an amorphous, dense,

sheet-like structure, which is 50 to 100 nm thick (Kalluri,

2003), as well as the turn over of the intercellular matrix

components during new vessel outgrowth. These

modifications, which obviously necessitate a finely

controlled interplay of proteinases and proteinase

inhibitors, remove physical barriers (e.g. basement

membrane, ECM macromolecules) and prepare states that

may stimulate endothelial cell migration (Iozzo and San

Antonio, 2001; Cleaver and Melton, 2003) (Figure 1).

The series of tissue-cell-matrix interactions of all

invasive cell types is generally divided into three phases

(Stetler-Stevenson, 1993): (i) modification of cell-cell

contacts and establishing new cell-matrix contacts

(Sasisekharan et al, 2002; Sanderson, 2001); (ii)

proteolytic modification of the ECM that removes barriers,

Rajkovic et al: Molecular insight into human heparanase and tumour progression

524

restructures cell-matrix contacts, and prepares the matrix

to facilitate cell movement (Sharma et al, 1998; Iozzo and

San Antonio, 2001); (iii) migration of the invasive cell

through the proteolysed matrix to establish new matrix

contacts (Carmeliet and Jain, 2000). This cycle is repeated

until the new blood vessel is fully developed (Seftor et al,

1992; Ray and Stetler-Stevenson, 1994).

B. Proteoglycans-Bridging

macromolecules in cell-cell communication

and cell-growthThe enormous heterogeneity of the extracellular

matrix is probably one of its most important properties and

therefore responsible for its functional diversity in

relationship to angiogenesis (Mecham, 1998). Some

components are designed to be rigid (e.g. collagens),

others elastic (e.g. elastin); some wet, others sticky. These

diverse modular designs impart diverse roles, yet allow for

highly specialized functions. Beside collagen-proteins,

which are designed to provide structure and resilience to

tissues, and the microfibrillar proteins like elastin and

fibrillin, that ensure the structural integrity and function of

tissues in which reversible extensibility or deformability

are crucial, proteoglycans complete the complexity of the

ECM.

Proteoglycans - found in most mammalian cells and

tissues - are composed of glycosaminoglycan (GAG)

chains covalently linked to a core protein. While the

protein part determines the localisation of the proteoglycan

in the cell membrane or in the ECM, the GAG component

mediates the broad functional interactions with a great

variety of ligands (Guimond et al, 1993; Walker and

Gallagher, 1996).

GAGs are complex, linear polysaccharides consisting

of a disaccharide repeat unit of glucosamine linked to

either an iduronic or a glucuronic acid. Further

modification of the individual backbone introduces

additional structural complexity. The variations can occur

at the 2-O position of the uronic acid and the 6-O and 3-O

positions of the glucosamine. The N-position can either be

sulphated or acetylated but can also stay unmodified

(Sasisekharan et al, 2002).

The polysaccharide chains are flexible in a certain

way, but cannot fold up into the compact globular

structures that polypeptide chains typically form.

Moreover, they are highly negatively charged and strongly

hydrophilic. Thus GAGs tend to adopt extended

conformations that occupy a huge volume and enable cell-

cell-interactions over extensive regions inside of tissues.

On the basis of their structural composition GAG

chains are classified into different groups, i.e. heparan

sulfate (HS)/heparin, keratan sulfate, chondroitin sulfate

and some more (Esko and Lindahl, 2001). Most important

for angiogenesis are heparan sulfate proteoglycans

(HSPGs) as they are predominantly found on cell surfaces

and in the ECM. Particular sulfation patterns in their GAG


525

Figure 1. A rough scheme of angiogenesis (I) and tumour metastasis (II)

(I) (A) Most tumours start growing as nodules provided with nutrients by diffusion processes until they reach a steady-state size of

proliferating and apoptosing cells. Massive tumour growth however necessitates the process of angiogenesis. In the first steps, pericytes

detach from the vessel, the blood vessel dilates to a limited extent (B) before the basement membrane and the extracellular matrix

undergo degradative and structural changes as a result of the release of matrix metalloproteinases (MMPs) and growth factors. The

growth factors, for example vascular endothelial growth factor (VEGF), basic fibroblast growth factor (bFGF), and platelet-derived

growth factor (PDGF) are released from the basement membrane, but also produced by tumour cells, fibroblasts and immune cells. This

induces the endothelial cells to emigrate into the intercellular space towards the angiogenic stimuli triggered by the tumour-nodule. (C)

The endothelial cells proliferate and start forming the sprout into a new blood vessel, which is guided and supported by pericyte-cells. At

the same time new intermediate basement membranes are built up. (D) Finally, the endothelial cells adhere tightly to each other to

strengthen the new lumen, the intermediate basement membrane matures and pericytes attach again to the blood vessel (not shown in the

picture). Thus the new blood vessel is in working order and is integrated in the circulatory system by flooding. The blood-vessel

formation will continue as long as the tumour grows and the hypoxic and necrotic areas of the tumour are provided with essential

nutrients and oxygen.

(II) (E) The metastasis of tumour cells starts with the destruction of heparan sulfate rich basement membrane by the release of

heparanase into the microenvironment of the tumour. This is the prerequisite for the tumour cells for invading the underlying extra

cellular space towards the endothelial cells. The extracellular matrix is degraded and heparan sulfate chains are presented on cell

surfaces. The resulting fragments of the heparan sulfate chains activate growth and motility factors in the surrounding area of the

tumour. (F) Prior to "invasion", the entry of tumour cells in the blood vessel, the basement membrane has to be fully disrupted and in

addition the tight junctions between the endothelial cells have to be loosened. (G) Finally the tumour cells pass into the blood vessel and

are transported by the blood-system through the whole organism.

chains allow interactions with a series of bioactive

molecules, such as growth factors, chemokines,

morphogenes, lipoproteins and enzymes. These

interactions are mainly driven by electrostatic forces of the

HS-sulfate groups with the basic amino acids, like lysine,

arginine or histidine of the protein counterpart. Van-der-

Waals- and hydrophobic forces may also affect the process

of ligand binding to a significant extent (Thompson et al,

1994).

Among the signalling molecules which influence

normal and pathologic processes like tissue repair, neurite

outgrowth, inflammation and autoimmunity, there are

growth factors including fibroblast growth factor 1 and 2

(FGF1 and 2), vascular endothelial growth factor (VEGF),

transforming growth factor-! (TGF-!) and other factors,

which have not been identified yet (Sasisekharan and

Venkataraman, 2000; Turnbull et al, 2001), that are

important for tumour development and angiogenesis.


526

Binding to HS can modulate a tethered molecule's

biological activity or protect it from proteolytic cleavage

and inactivation. Due to the multifaceted roles of HSPGs

in cell physiology, their cleavage is likely to alter the

integrity and functional state of tissues and to provide a

mechanism by which cells can respond rapidly to changes

in the extracellular environment. It is a fact that cancer

cells, as part of the transformation process, do not only

alter their HSPGs profile, including differential expression

of particular proteoglycan protein-core sequences, as well

as alter the heparan sulfate glycosaminoglycan fine

structure of given proteoglycans, but also change their

protein expression levels. Thus higher amounts of

angiogenic differentiation and development factors

(Burnfield et al, 1999; Tumova et al, 2000; Esko and

Lindahl, 2001) are available and increased enzymatic

degradation of such HSPGs plays a crucial role at the

beginning stages of angiogenesis.

Invading cells, particularly metastatic tumour cells

and leukocytes, traverse ECM barriers and basement

membranes by liberating masses of degradative enzymes.

A large number of proteases (e.g. matrix

metalloproteinases, serine, cysteine and aspartatic protease

families) have been described that can disassemble the

extracellular matrix (Vlodavsky et al, 1999; Parish et al,

2001). However, for efficient degradation of the

extracellular environment, a cooperative action of

proteases and HSPG cleaving enzymes is indispensable.

The crucial enzyme for HS degradation is the human

heparanase.

II. Human heparanase–Molecular

biology and structureA. Genetic organisation of the human

heparanaseThe cloning of only one single human heparanase

cDNA sequence was independently published by several

groups, resulting in an identical sequence being obtained

from a human placental cDNA library and a human T- cell

lymphoma cell line (Hulett et al, 1999; Kussie et al, 1999;

Toyoshima and Nakajima, 1999; Vlodavsky et al, 1999).

The human gene of the heparanase-enzyme is located on

the chromosome 4q21.3, contains 50 kilo base pairs and

encircles 14 exons and 13 introns. As a consequence of

alternative splicing the gene-information may either be

translated as 2,0 kb or as 4,4 kb mRNA (Hulett et al,

1999). While the 50 kb species contains 14 exons and 13

introns, the 1,7 kb form is created with the first and

fourteenth exon remaining untranslated. Nonetheless both

transcripts contain the same open reading frame,

producing the single heparanase enzyme, which is also

abbreviated as Hpa1 (Dong et al, 2000; Parish et al, 2001).

Early, rather controversial, developments determined

heparanase activity for several proteins ranging from 8

kDa, over 50 kDa up to 134 kDa in molecular mass (Oosta

et al, 1982; Freeman and Parish, 1998). There have also

been claims that the enzyme is a heat shock protein

(Graham et al, 1994) or might even be related to the CXC

chemokine, !-thromboglobuline, also known as

connective-tissue-activating peptide III (CTAP III)

(Hoogewerf et al, 1995). Further findings of a full length

rat heparanase cDNA and a partial mouse heparanase

(Miao et al 2002) cDNA sequence in combination with

reported amino acid sequences in rat and chicken

(Goldshmidt et al 2001; Podyma-Inoue et al, 2002; Kizaki

et al, 2003) indicate that all these proteins are highly

conserved, as confirmed by 80 % identity in the amino

acid sequence between the human and murine protein and

nearly 93 % identity between mouse and rat sequences

(Hulett et al, 1999). The 214 amino acids encoding cDNA

fragment of bovine heparanase is to 82 % identical with

the human heparanase. Only recently a human cDNA

fragment encoding a novel human protein, namely human

heparanase 2 (Hpa 2), with significant homology to

heparanase was cloned (McKenzie et al, 2000). However,

differences in expression profiles, predicted cellular

locations and tissue distributions suggest that human

heparanase 1 (Hpa 1) and Hpa2 may somehow be related

but clearly exhibit distinct biological functions and

represent members of two dissimilar mammalian

heparanase families (McKenzie et al, 2000). In addition,

some more heparanases (C1A, C1B, C2A, C2B) of

different molecular weights have been partially purified

from chinese hamster ovary cells (CHO cells) and have

been preliminarily characterised (Bame et al 1998; Bame,

2001).

Despite the existence of several heparanases the

hypothesis of multiple enzymes with similar biological

function has never really been established. More likely is

the assumption of the Hpa1 enzyme being unique and

being the only transcript used by invading cells to degrade

heparan sulfate proteoglycans. In summary, its molecular

characteristics are described as follows.

The complete human heparanase cDNA contains

1629 bp and encircles an open reading frame that encodes

a polypeptide of 543 amino acids with a calculated

molecular weight of 61,2 kDa which appears as a ~65 kDa

band in the SDS-PAGE analysis.

B. Protein function of the human

heparanaseDiscussing the features of the heparanase at protein

level will give insights into the specific mechanism of its

biological function. The hydropathic profile (Vlodavsky et

al, 1998) of the heparanase protein indicates a

hydrophobic region at the N-terminus (Met1 to Ala35)

which is assumed to function as signal peptide for

secretion. Conversely, the chicken heparanase signal

peptide which spans 19 amino acids and which shows only

39 % homology (Goldshmidt et al, 2001) to the human

analogue, ensures that the chicken enzyme is readily

secreted. These findings suggest that human heparanase is

primarily localised in perinuclear acidic endosomal and

lysosomal cellular granules before it is secreted/

translocated to the extracellular space (Mollinedo et al,

1997; Bame, 2001; Goldshmidt et al, 2001). The C-

terminus is a highly conserved and hydrophobic stretch

ranging from Pro515 to Ile543. One could argue that this part

defines the putative transmembrane domain or a GPI

anchor which could be responsible for the enzyme's

retention on the cell surfaces (Bartlett et al, 1995; Hulett et


527

al, 1999; Parish et al, 2001). Further prediction of a

hydrophilic region between the amino acids 110 and 170

indicates that this fragment is exposed at the protein's

surface and therefore accessible for proteases (Vlodavsky

et al, 1999).

The active form of the human heparanase has long

been thought to be a 50 kDa polypeptide, isolated and

purified from various tissues. However, several attempts to

obtain heparanase activity after expression of the 50 kDa

subunit in insect cells as well as in mammalian systems

(Vlodavsky et al, 1999; McKenzie et al, 2003) failed,

suggesting that the N-terminal part including an 8 kDa

fragment is important for enzymatic activity. More likely

is that the isolated 50 kDa fragment represents a processed

form of the native, full-length 65 kDa heparanase

(Freeman and Parish, 1998; Toyoshima and Nakajima,

1999) as it always appears together with the 8 kDa peptide

when analysing the purified enzyme on a SDS-PAGE gel.

This observation supports the hypothesis that the 65 kDa

full length protein represents the immature, inactive

enzyme, which is subsequently called pro-heparanase

(Gln36 to Ile543) originating from a pre-pro-form (Met1 to

Ile543) after removal of the putative signal peptide (Met1 to

Ala35) (Figure 2). This pro-form undergoes further

proteolytic processing which is likely occur within the

hydrophilic region at two potential cleavage sites, Glu109 to

Ser110 and Gln157 to Lys158, yielding an 8 kDa polypeptide

at the N-terminus and a 50 kDa polypeptide at the C-

terminus. Subsequent complexation of the two obtained

subunits finally forms the active, mature heparanase

protein and an intervening 6 kDa linker peptide (Ser110 to

Gln157) (Fairbanks et al, 1999; Parish et al, 2001;

Vlodavsky et al, 2001; Levy-Adam et al, 2003; Nardella et

al, 2004). Additionally, the region Glu288 – Lys417 in the 50

kDa large fragment is believed to facilitate the physical

association to the 8 kDa subunit (Levy-Adam et al, 2003).

Assumptions that the active heparanase enzyme is a

noncovalently linked heterodimer were confirmed by

several cloning- and expression attempts in mammalian

systems and insect cells showing that neither the 8 kDa

nor the 50 kDa fragment on their own were able to digest

substrate (Vlodavsky et al, 1999; McKenzie et al, 2003).

Additional attempts to obtain active protein by

reconstituting the small and large units after expressing

them separately failed, proposing that active folding needs

Figure 2 . The processing of the human heparanase. A scheme of the predicted domain structure of the human heparanase and the

processing procedure towards the active form of the enzyme: the non covalent association of the 8 kDa and 50 kDa subunit after the

processing of an intervening 6 kDa propeptide. The pre-proheparanase is believed to be translated, first, and is subsequently processed

by removal of the propeptide (from amino acid 110 to 157) and by the removal of the signal peptide at the N-terminus of the protein

from the residue 1 to 35. Final cleavage results in the 8 kDa subunit from Gln36 to Glu109 and the 50 kDa subunit from Lys158 to Ile543.

The six putative N-linked glycosylation sites (N 162, N 178, N 200, N 217, N 238, N 459) are located on the large subunit, from which

five cluster in the first 80 amino acids, and the putative catalytic proton donor on Glu225 and proton acceptor on Glu343.


528

a cellular environment. In contrast co-expressed 8 kDa and

50 kDa polypeptides showed high levels of activity. Also

notable is the fact that insect expression of the

unprocessed 65 kDa precursor form produced little or no

active enzyme, respectively, concluding that the

mammalian cell facilities are needed to process the human

heparanase to its active heterodimer (McKenzie et al,

2003). The involvement of one or even several proteases

for this activation-degradation process is highly likely but

yet not confirmed as so far they have not been isolated.

Deglycosylation of the sugar-residues attached to the six

putative N-glycosylation sites, five of which cluster within

the first 80 amino acids of the 50 kDa mature protein, had

no detectable effect on the enzymatic activity (Vlodavsky

et al, 1999). Nevertheless they seem to be responsible for

proper translocation and secretion of the enzyme (Simizu

et al, 2004).

C. Regulation of the human heparanase

expressionDue to the fact that inadvertent cleavage and

modeling of heparan sulfate causes potential tissue

damage, it is obvious that the expression of the heparanase

enzyme has to be tightly regulated. However, very little is

known about factors influencing its expression and activity

in normal and in malignant cells. Inflammatory cytokines,

endothelial cells, leukocytes, tumour necrosis factor "

(TNF ") are known to enhance the expression-levels

(Bartlett et al, 1995; Parish et al, 1998). Latest

experiments showed effects of fatty acids, especially oleic

acid on the activation of the Sp1 binding site, which is

located 192 to 201 bp upstream from the initial ATG

codon (Cheng et al, 2004) of the heparanase coding

sequence. In the context of breast cancer, putative estrogen

response elements in the regulatory sequence of the

heparanase gene were identified. Estrogen- induced

mRNA transcription could be demonstrated in estrogen-

receptor positive, but not in estrogen-receptor negative

breast cancer cells, confirming this finding (Elkin et al,

2003).

D. Putative substrate recognition sites for

the human heparanaseCharacterising the heparanase interaction with its

natural glycosaminoglycan substrates, the human

heparanase, which constitutes a !-endoglucuronidase,

cleaves glycosidic bonds with a hydrolase mechanism and

is thus distinct from bacterial heparinases which

depolymerise heparin and heparan sulfate by eliminative

cleavage generating unsaturated bonds. Secondary

structure predictions suggest that the heparanase enzyme

consists of a ("/!)8-TIM-barrel architecture. This fold is

frequently observed in glycosylases and is also proposed

for this protein. As the 50 kDa subunit on its own forms 6

"/! units, the missing structural elements have to be

completed by the 8 kDa polypeptide, showing a predicted

secondary structure of a !/"/! element (Nardella et al,

2004), thereby generating the native fold. The heparanase

exhibits the common catalytic mechanism typical for the

family of glycosylhydrolases, involving two conserved

amino acid residues, the putative proton donor Glu225 and

the putative proton acceptor (nucleophile) Glu343.

Conserved basic residues are found in proximity to the

proposed catalytic proton donor (KK residues 231 and

232) and nucleophile (KK residues 337 and 338)

responsible for additional, adhesive interactions with

GAGs, i.e. HS (Hulett et al, 2000).

The heparan sulfate glycosaminoglycans are cleaved

by the enzyme at only a few sites, creating fragments of 10

to 20 sugar units. This observation confirms the thesis that

the heparanase enzyme recognizes particular and quite rare

heparan sulfate motifs (Freeman and Parish, 1998; Pikas et

al, 1998). On the one hand, it has been shown that a 6-O-

sulfate group on a glucosamine residue, located two

monosaccharide units away from the cleavage site at its

non-reducing end, and a 2-sulfated glucosamine-structure

on the reducing side are essential for substrate recognition

(Figure 3). Substrate cleavage, on the other hand, was

found to require a hexuronic carboxyl group (Bai et al,

1997; Vlodavsky and Friedmann, 2001; Okada et al, 2002)

and heparan sulfate comprising unsubstituted glucosamine

residues is not processed (Parish et al, 1999; Dempsey et

al, 2000). Structurally related heparin, however, has a high

inhibitory effect on the enzyme's activity (Bar-Ner et al,

1987; Vlodavsky et al, 1994) due to the predominant

existence of the [IdoUA(2-OSO3)-GlcNSO3(6-OSO3)-]n

repeat structure. In contrast to the proposed endolytic

cleavage mechanism, it has recently been postulated that

human heparanase can also cleave defined oligosaccharide

structures in an exolytic action (Gong et al, 2003). Thus

the precise localisation of sulfation patterns and the

sequences of heparan sulfate residues required for

recognition as well as for subsequent cleavage are yet

uncertain.

IV. Human heparanase – Involvement

in physiological and patho-physiological

processes and its inhibitionA. PhysiologyMost studies particularly underline the involvement

of the heparanase enzyme in pathophysiology with a

strong leaning towards cancer. Although only little is

known about the enzyme`s contribution to normal cell and

tissue function it is strongly suggested that the heparanase

plays a crucial role in embryo implantation, which

involves invasive cell immigration and interaction

between HS-binding proteins (i.e. growth factors) and

heparan sulfate proteoglycans in order to ensure normal

development (Selleck, 1999; Dempsey et al, 2000; Reiland

et al, 2004). In many facets the embryonic cell migration,

proliferation and differentiation is similar to its

involvement in tumour metastasis, angiogenesis and

inflammation. There have been lines of transgenic mice

generated which ubiquitously overexpress the human

heparanase (Zcharia et al, 2004). Biochemical analysis of

isolated heparan sulfate oligosaccharides of transgenic

mice revealed a decrease in the size of the HS chains

compared to HS from control mice. This is interpreted as

an enhanced heparanase cleavage activity in almost every

tissue (Zcharia et al, 2004).


529

Figure 3. Substrate of the human heparanase

(A) The lower part of this figure encircles schematically the localisation and role of heparan sulfate proteoglycans in vascularisation and

metastasis. HSPGs are predominantly found on cell surfaces and everywhere in the extracellular-matrix. With their core-proteins they

are anchored in the cell membrane. The number and composition of the covalently linked heparan sulfate chains varies enormously

depending on the tissue and cell functions, respectively, and the state of cell differentiation - different heparan sulfate expression

patterns. Particular the sulfation patterns in the carbohydrate-chains allow interactions with a series of bioactive molecules (e.g. growth

factors). Heparanase secreted by the surrounding tumour cells is responsible for the degradation of this heparan sulfate chains and for the

release of tethered molecules by cleaving at certain sites. (B) The upper part of this figure summerizes the structural characteristics of the

minimal human heparanase cleavage site, known so far. It is composed of the trisaccharide sequence between the brackets and occurs

quite rarely in HS chains. The arrow indicates the glucuronidic bond cleaved by the heparanase. Highly sulfated structures seem to be

essential for the enzymes activity. The N-sulfation on the reducing side, the 6-O-sulfation of the glucosamine on the non reducing side,

both indicated in green, and the carboxy-group (hold in red font) on the glucuronic-acid seem to be essential for the enzyme's activity.

The additional 2-N-sulfate group on the nonreducing GlcN and the 6-O-sulfate group on the reducing GlcN both have a promoting effect

on the heparanase activity (magenta colored). The function of the 3-O-sulfate group in blue remains controversial. In principle it is

thought to inhibit the enzyme, but it may also have a promoting effect due to its negative charge.


530

Although the mice appeared normal, fertile, and exhibited

a normal life span, pregnant transgenic mice had a

significant increase in the number of implanted embryos

compared with control mice. There also was a higher

miscarriage and embryonic lethality confirming the

necessity of normal HS structures during embrionic

growth and morphogenesis (Lin et al, 2000; Zcharia et al,

2004). Because of less intact HS, thereby also affecting the

basement membrane structure, the kidney function was

insufficient. Elevated levels of proteins were found in the

urine, indicating that heparanase is able to disrupt the

filtration barrier as well as to have an impact on the

reabsorption function of the kidneys (Weinstein et al,

1992; Levidiotis et al, 2001; Katz et al, 2002; Zcharia et

al, 2004). The mammary glands of virgin transgenic mice

showed similar development and maturation to the ones of

normal mice at day 12 of pregnancy. An even more

pronounced development was observed when those

transgenic mice became pregnant, most probably due to

heparanase-induced overbranching, hyperplasia and

widening of ducts (Zcharia et al, 2004). Furthermore, the

heparanase overexpressing mice showed accelerated hair

growth by enhancing the vascularization and maturation of

the hair follicle (Yano et al, 2001; Zcharia et al, 2004).

Upon aging the expression levels of the heparanase

become negligibly low. In an adult organism the enzyme

only appears during wound repair (Vlodavsky and

Friedmann, 2001), fracture repair (Saijo et al, 2003), tissue

regeneration (Dempsey et al, 2000), and immune

surveillance (Zcharia et al, 2001). In addition, following

vascular injury, it is believed that heparanase, probably

secreted from infiltrating and extravasating leukocytes,

degrades heparan sulfate to induce smooth muscle cell

proliferation, which is normally inhibited by the intact HS

chains (Campbell et al, 1992; Francis et al 2003).

B. PathophysiologyWith regard to the specific structural interaction of

HSPGs with various extracellular matrix and basement

membrane macromolecules, they play a key role in self-

assembly, modeling and insolubility of ECM components,

as well as cell adhesion, harvesting and locomotion

(Kjellen and Lindahl, 1991; Iozzo, 1998; Vlodavsky et al

1999). Cleavage of the HS sidechains by HS-degrading

enzymes, such as heparanase, therefore results in

disassembly of the extracellular matrix and in the

permeability of the underlying basement membranes,

occurring as a crucial triggering process in the

extravasation of blood borne cells (Parish et al, 1987;

Vlodavsky et al, 1992, 1994; Nakajima et al, 1988; Parish

et al, 1999). Immunohistochemical investigations revealed

that the heparanase enzyme appeared primarily in

neutrophils, macrophages, platelets, keratinocytes,

capillary endothelium and neurons, but very seldom in

normal epithelia. While the expression levels of the

enzyme in normal tissues are very low and its incidence is

restricted to the placenta and to lymphoid organs, elevated

levels of heparanase were observed in tumour bearing

animals and cancer patients suffering for example from

bladder cancer (Gohji et al, 2001), colon cancer

(Friedmann et al, 2000), gastric cancer (Tang et al, 2002),

breast cancer (Maxhimer et al, 2002), oral cancer,

oesophageal cancer (Ikuta et al, 2001), pancreatic cancer

(Koliopanos et al, 2001; Kim et al, 2002; Rohloff et al,

2002), brain cancer (Marchetti et al, 2001), endometrial

cancer (Watanabe et al, 2003) and acute myeloid leukemia

(Bitan et al, 2002; Vlodavsky et al, 2002; Sanderson et al,

2004). Moreover, the expression of the human heparanase

correlates with the metastatic potential of human tumour

cells. Since this is also the case for other extracellular

matrix degrading enzymes, i.e. for the group of matrix

metalloproteinases (MMPs) - the feature of inducing

angiogenesis in addition to the initiation of cell invasion

becomes more obvious (Hulett et al, 1999; Parish et al,

2001; Goldshmidt et al, 2002; Takaoka et al, 2003;

Watanabe et al, 2003). Together with the degradation of

ECM components (collagens, laminins, fibronectin,

vitronectin etc) a continuous cleavage of heparan sulfate

proteoglycans by the human heparanase is fulfilled. This

process increases the bioavailability and activity of growth

factors and other bioactive molecules, which have been

tethered and inactivated by binding to heparan sulfate

structures, and promotes the migration and proliferation of

endothelial cells (ECs) to form vascular sprouts.

Heparanase has also been implicated in the degradation of

subendothelial basement membrane by leucocytes

(Naparstek et al, 1984; Parish et al, 2001). During chronic

inflammation leukocytes enter and accumulate in

inflammatory areas by the continous extravasation through

the blood vessel wall. Several in vitro studies have

confirmed this assumption (Vlodavsky et al, 1992; Bartlett

et al, 1995; Parish et al, 1998; Hulett et al, 1999). Both

tumour masses and inflammatory sites provide the acidic

environment which human heparanase requires for

degradation of heparan sulfate structures. The enzyme has

its maximal endoglycosidase activity between pH 5,0 and

6,0 (more precisely from pH 5,6 to 5,8) and is inactivated

at pH greater than 8,0. Under physiological conditions (pH

7,4) heparanase binds heparan sulfate but does not degrade

its substrate. This is in accordance with the findings that

inactive recombinant heparanase enzyme still binds to HS

molecules without subsequent degradation and therefore

enables the adhesion of cells (Goldshmidt et al, 2003).

C. InhibitionThe knowledge of heparanase biological function

collected so far, is sufficient for its consideration as a

promising target for cancer therapy. Great efforts are being

made in order to develop a potent inhibitor, and sulfated

polysaccharides, like heparin, dextran sulfate, xylan

sulfate, fucoidan, carageenan-gamma and laminaran

sulfate, which have primarily anticoagulant activity, are

already known to be effective inhibitors of tumour

metastasis. Their inhibitory effect in experimental

metastasis is more related to their ability to inhibit the

heparanase enzyme than to their anticoagulant properties

(Parish et al, 1987; Nakajima et al, 1988; Vlodavsky et al,

1994; Miao et al, 1999; Parish et al, 1999).

In addition, other polyanionic molecules, such as

phosphomannopentaose sulfate (PI-88) and maltohexaose

sulfate, have proven to be as potent as heparin concerning

the inhibition of heparanase activity (IC50 ~ 1 – 2 µg/ml),


531

confirming the assumption that the oligosaccharide chain

length and the degree of sulfation are more important than

sugar composition and type of linkage (N- or O-sulfated)

(Vlodavsky et al, 1994, 2001; Lapierre et al, 1996; Parish

et al, 1999). PI-88 has successfully passed through the

preclinical studies as its application confirmed the

inhibition of tumour growth and tumour angiogenesis. It is

currently being tested on cancer patients in a Phase II

clinical trial (Parish et al 1999).

Furthermore, in a parallel study, by screening 10000

culture broths of microorganisms (actinomycetes, fungi

and bacteria), a specific actinomycete-strain (RK99-A234)

emerged for the reason of compensating heparanase

enzyme activity. The responsible neutralizing interaction

partner was identified as RK-682 (IC50 ~ 17µM), already

known to inhibit protein tyrosine phosphatases

(Hamaguchi et al, 1995; Ishida et al, 2004). Using RK-682

as a lead compound structure a more selective heparanase

inhibitor was designed, namely 4-Benzyl-RK-682 (Ishida

et al, 2004).

Finally, Suramin (IC50 < 10µM in vitro), a

polysulfonated naphthylurea, and Trachyspic acid (IC50 ~

50µM), isolated from Talaromyces trachyspermus, have to

be mentioned in order to complete the short enumeration

of potent heparanase inhibitors known so far. The

inhibitory mechanisms of both are as yet unknown,

although the structure of Trachyspic acid is similar to 4-

Benzyl-RK-682 concluding that both of the substances

bind and block as mimic substrates the heparanase's

cleavage site (Nakajima et al, 1991; Shiozawa et al, 1995;

Hirai et al, 2002).

IV. Biophysical remarks and

conclusionsA. Development of heparanase activity

assays described in the literatureAlthough the human heparanase and its role in

regulating proteoglycan function in angiogenesis have

been known for many years, the enzyme as a potential

pharmaceutical target has not yet received as much

attention as other angiogenetic factors, like for example

FGF and VEGF. The main starting point for interfering in

non physiological angiogenic processes has so far been the

synthesis of specific heparan sulfate glycosaminoglycan

sequences with high affinity for growth factor binding,

thereby silencing downstream signalling in angiogenesis.

One reason for the lack of interest in designing a

heparanase inhibitor is mainly determined by initial major

difficulties in the establishment of an assay that could

easily monitor enzyme activity by following the

degradation of its HS substrate, unlike bacterial lyases

which cleave HS- or heparin chains by an elimination

mechanism, a reaction that can be detected

spectroscopically as unsaturated products are generated

(Linhardt et al, 1986). The human as well as the

mammalian heparanases in general constitute hydrolases

cleaving without double bond formation. Thus more

sophisticated assays for activity determination had to be

developed in order to facilitate heparanase purification

from tissues for subsequent protein characterisation.

Besides, the definition of the heparanase specific substrate

turned out to be difficult, because most of the HS

molecules purified from diverse tissues have already been

cleaved and the unprocessed oligosaccharide chain could

not be reconstructed. In some cases heparin has been used,

but because it is highly modified, it does not fullfill the

domain structure of heparan sulfate (Oosta et al, 1982;

Lyon and Gallagher, 1998). Despite difficulties in the

beginning, major progress in the development of different

heparanase activity assays could be reported in the last few

years.

Radioactive- (35S) and fluorescence- (FITC) labeled

HS substrates were used to detect the size-shift of the

degraded glycosaminoglycan to smaller fragments upon

incubation with active heparanase. The thus obtained

cleavage products were finally analysed by gel filtration

chromatography (Toyoshima and Nakajima, 1999;

Vlodavsky et al, 1999). These assays are highly sensitive

but not suitable for screening large amounts of substrate

samples. In addition the handling of the single separated

steps of the reaction procedure as well as the detection

were quite laborious but nevertheless were accepted.

When it came to attempts to searching for an inhibitor,

however, a simple and efficient heparanase assay method

became absolutely indispensable in order to guarantee a

promising high throughput analysis. This approach

became possible by forming polyacrylamide tablets

containing defined amounts of HS stained with Alcian

blue. The colour density of the tablets correlates with the

HS concentration and is quantified. After adding active

heparanase, degraded fragments are excluded out of the

tablets which results in a decrease of the colour density, a

process which can easily be visually detected (Ishida et al,

2004). Another assay method is described on the principle

of ultrafiltration. Based on limited cleavage sites of HS

chains, the degradation of radioactively labeled

glycosaminoglycans with approximately 30 kDa molecular

size results in products ranging from 7 to 10 kDa is

exploited. A subsequent separation of the cleaved

fragments is performed by using a special molecular

weight cutoff, which exhibits minimal permeability to the

undigested HS, while permitting maximum permeability to

the digested products which can then be detected by

radioactive scintillation counting (Nakajima et al, 1988;

Tsuchida et al 2004).

Several reasons retarded the research progress for the

human heparanase, among which the already well

characterised growth factors with a great potential for

interference in angiogenesis and the lack of a powerful

enzymatic assay played a decisive role. In addition, the

protein is not very abundant in vivo and therefore getting

enough material to purify adequate amounts of enzyme for

characterisation is still a challenge. Beside the very small

amounts of protein, another difficulty is related to the

unstable nature of the heparanase. Several attempts to

purify human heparanase or heparanase subunits from

diverse tissues to homogeneity resulted in the loss of

enzymatic activity. The cloning of the full length cDNA

and of the two subunits in diverse expression systems

(mammalian cells or insect cells) is reported by various

groups (Hulett et al, 1999; Vlodavsky et al, 1999; Elkin et


532

al, 2001; Nardella et al, 2004) and delivers sufficient

amounts of active heparanase but exact details concerning

the nature of the active complex, formed by the respective

subunits after posttranslational processing are so far

unknown.

B. Novel aspects in the molecular

characterisation of the human heparanaseThe design of specific inhibitors seems to make only

slow progress. With the exception of PI-88 which is

currently being tested in phase II clinical trials in

Australia, there are no other heparanase inhibitors in

clinical studies to our knowledge. Furthermore, a

multitude of existing inhibiting molecules, like suramin,

are not suitable for in vivo experiments because of severe

side effects and toxicity (Parish et al, 2001). Added to this,

the mechanisms of inhibition are yet unknown or cannot

precisely be correlated with heparanase action, as for

example PI-88 also shows high binding affinities to

growth factors, like FGF-1, FGF-2 and VEGF (Cochran et

al, 2003).

In the literature, no paper describes a structure based

design of heparanase inhibitors and the protein itself

remains a structurally uncharacterised enzyme. In addition

nearly no published article investigates the structure of

human heparanase or its biophysical properties.

Encouraged by this gap in heparanase characterisation and

in order to provide information for structure based drug

design, a method which has been successfully applied for

other proteins, we decided to produce this enzyme in our

labs using a different cloning strategy to that reported so

far. We cloned the respective subunits, 8 kDa and the 50

kDa, known to form the active heterodimer, separately.

Rather laborious efforts were made to purify the two

fragments after several purification attempts had failed.

But finally, the activity of the enzyme could be tested, as

mentioned above, by analysing degraded FITC labeled

heparan sulfate. Neither the 8 kDa fragment nor the 50

kDa polypeptide on their own showed cleavage activity

when being incubated with HS. But the reconstitution of

both subunits in crude lysates led to an active recombinant

human heparanase, which can now be exactly

characterised with regard to its biophysical properties.

For the further development of structure and

substrate specific inhibitors it is absolutely essential to

resolve the 3 dimensional structure of the active

heterodimer with and without ligands. As this project may

turn out to be time consuming regarding the size and the

difficult handling of the protein we will further support

this aim of structure determination by performing

biophysical techniques to study the molecular properties of

the human heparanase.

In addition we have performed a more theoretical

approach to mimic the possible structure of the human

heparanase in vivo, namely the molecular modeling.

BLAST (NCBI tools) searches with the full length amino

acid sequence of the human protein resulted in a few

significant sequences. The mouse-, rat- and chicken-

heparanase show high similarity to the human sequence.

Less similar to the query are two putative proteins from

Arabidopsis thaliana, with as yet unknown functions.

Some further proteins of glycosyl hydrolases from bacteria

have been found, but these similarities seem to be rather

unreliable.

Although secondary predictions (Hulett et al, 2000;

Nardella et al, 2004; and our findings) result in an

alternating "/! series, similar to the ("/!) TIM barrel

protein fold, “swiss-model”, or “SDSC1” - programmes on

the expasy homepage for protein structure homology

modeling - and some others could not design a three

dimensional structure of the human protein (“sorry, no

suitable template for modeling could be found”).

With the knowledge of the identified active residues

(E225 and E343) and putative basic amino acids near to these

sites we started to calculate a possible structure for the

human heparanase (Figure 4).

Figure 4. Molecular Model of the

human heparanase

Molecular modeling of the 50 kDa

subunit of the human heparanase

(amino acid residue 158 to 514)

without its putative transmembrane

domain. Functionally important

amino acids are indicated in green:

the two acitve sites Glu225 and Glu343,

positive loaded amino acids near to

the proton donor and acceptor, that

can bind heparan sulfate, Lys231,

Lys232 and Lys337, Lys338. Sectors of

basic amino acid residues from

Gln157 to Asn162 and Pro271 to Met278

may also interact in the substrate

binding towards the enzymatic active

site.


533

The model should facilitate and illustrate - together

with the biophysical characterisation - investigations on

intramolecular and molecular effects and interactions of

the human heparanase with its surrounding environment.

C. Future perspectivesEven if the three dimensional structure of the protein

heterodimer is established in the near future by X-ray

diffraction or NMR-methods, the biophysical techniques

particularly allow studying exactly the dynamics and

conformational effects of the human heparanase in context

with ligands. With the resulting findings it would be

possible to understand better the affinities and activities of

this enzyme in its immediate environment, to search for

natural compounds which inhibit more efficiently and to

design a specific, competitive heparanase-action-inhibitor

to establish a new promising cancer therapy.

AcknowledgmentsThis work was supported by OENB

Jubiläumsfondsprojekt No 10855 and by the Austrian

Science Fund project No P15969.

ReferencesBai X, Bame KJ, Habuchi H, Kimata K, and Esko JD (1997)

Turnover of heparan sulfate depends on 2-O-sulfation of

uronic acids. J Biol Chem 272, 23172-23179.

Baldwin GS, Curtain CC, and Sawyer WH (2001) Selective,

high-affinity binding of ferric ions by glycine-extended

gastrin(17). Biochemistry 40, 10741-10746.

Bame KJ (2001) Heparanases: endoglycosidases that degrade

heparan sulfate proteoglycans. Glycobiology 11, 91R-98R.

Bame KJ, Hassall A, Sanderson C, Venkatesan I, and Sun C

(1998) Partial purification of heparanase activities in chinese

hamster ovary cells: evidence for multiple intracellular

heparanases. Biochem J 336, 191-200.

Bar-Ner M, Eldor A, Wasserman L, Matzner Y, Cohen IR, Fuks

Z, and Vlodavsky I (1987) Inhibition of heparanase-mediated

degradation of extracellular matrix heparan sulfate by non-

anitcoagulant heparin species. Blood 70, 551-557.

Bartlett MR, Cowden WB, and Parish CR (1995) Differential

effects of the anti-inflammatory compounds heparin,

mannose-6-phosphate, and castanospermine on degradation

of the vascular basement membrane by leukocytes,

endothelial cells, and platelets. J Leukoc Biol 57, 207-213.

Bartlett MR, Underwood PA, and Parish CR (1995) Comparative

analysis of the ability of leucocytes, endothelial cells and

platelets to degrade the subendothelial basement membrane:

evidence for cytokine dependence and detection of a novel

sulfatase. Immunol Cell Biol 73, 113-124.

Baud S, Margeat E, Lumbroso S, Paris F, Sultan C, Royer C and

Poujol N (2002) Equilibrium binding assays reveal the

elevated stoichiometry and salt dependence of the interaction

between full-length human sex-determining region on the Y

chromosome (SRY) and DNA. J Biol Chem 277, 18404-

18410.

Bennet TA and Stetler-Stevenson WG (2001) Matrix

metalloproteinases (matrixins) and their inhibitors (TIMPs)

in angiogenesis. In: Tumor Angiogenesis and

Microcirculation. Ed by Emile E Voest and Patricia A

D`Amore. Marcel Dekker Inc. New York 2001, 29-58.

Bernfield M, Gotte M, Park PW, Reizes O, Fitzgerald ML,

Lincecum J, and Zako M (1999) Functions of cell surface

heparan sulfate proteoglycnas. Annu Rev Biochem 68, 729-

777.

Bitan M, Polliack A, Zecchina G, Nagler A, Friedmann Y,

Nadav L, Deutsch V, Pecker I, Eldor A, Vlodavsky I, Katz

BZ (2002) Heparanase expression in human leukemias is

restricted to acute myeloid leukemias. Exp Hematol 30, 34-

41

Buschmann I and Schaper W (1999) Arteriogenesis versus

Angiogenesis: Two mechanisms of vessel growth. News

Physiol Sci 14, 121-125.

Campbell JH, Rennick RE, Kalevitch SG, and Campbell GR

(1992) Heparan sulfate-degrading enzymes induce

modulation of smooth muscle phenotype. Exp Cell Res 200,

156-167.

Carmeliet P and Jain RK (2000) Angiogenesis in cancer and

other diseases. Nature 407, 249-257.

Chen G, Wang D, Vikramadithyan R, Yagyu H, Saxena U,

Pillarisetti S, and Goldberg IJ (2004) Inflammatory cytokines

and fatty acids regulate endothelial cell heparanase

expression. Biochemistry 43, 4971-4977.

Chen XP, Liu YB, Rui J, Peng SY, Peng CH, Zhou ZY, Shi LH,

Shen HW, and Xu B (2004) Heparanase mRNA expression

and point mutation in hepatocellular carcinoma. World J

Gastroenterol 10, 2795-2799.

Cleaver O and Melton DA (2003) Endothelial signaling during

development. Nat Med 9, 661-668.

Cochran S, Li C, Fairweather JK, Kett WC, Coombe DR, and

Ferro V (2003) Probing the interaction of

phosphosulfomannans with angiogenic growth factors by

surface plasmon resonance. J Med Chem 46, 4601-4608.

Dempsey LA, Brunn GJ, and Platt JL (2000) Heparanase, a

potential regulator of cell-matrix interactions. Trends

Biochem Sci 25, 349-351.

Dong J, Kukula AK, Toyoshima M, and Nakajima M (2000)

Genomic organization and chromosome localization of the

newly identified human heparanase gene. Gene 253, 171-

178.

Elkin M, Cohen I, Zcharia E, Orgel A, Guatta-Rangini Z, Peretz

T, Vlodavsky I, and Kleinman HK (2003) Regulation of

heparanase gene expression by estrogen in breast cancer.

Cancer Res 63, 8821-8826.

Elkin M, Ilan N, Ishai-Michaeli R, Friedmann Y, Papo O, Pecker

I, and Vlodavsky I (2001) Heparanase as mediator of

angiogenesis: mode of action. FASEB J 15, 1661-1663.

Esko JD and Lindahl U (2001) Molecular diversity of heparan

sulfate. J Clin Invest 108, 169-173.

Fairbanks MB, Mildner AM, Leone JW, Cavey GS, Mathews

WR, Drong RF, Slightom JL, Bienkowski MJ, Smith CW,

Bannow CA, and Heinrikson RL (1999) Processing of the

human heparanase precursor and evidence that the active

enzyme is a heterodimer. J Biol Chem 274, 29587-29590.

Falsone SF, Kurkela R, Charandini G, Vihko P, and Kungl AJ

(2001) Ligand affinity, homodimerization, and ligand-

induced secondary structural change of the human vitamin D

receptor. Biochem Biophys Res Commun 285, 1180-1185.

Falsone SF, Weichel M, Crameri R, Breitenbach M, and Kungl

AJ (2002) Unfolding and double-stranded DNA binding of

the cold shock protein homologue Cla h 8 from

Cladosporium herbarum. J Biol Chem 277, 16512-16516.

Folkman J (1995) Angiogenesis in cancer, vascular, rheumatoid

and other disease. Nat Med 1, 27-31.

Francis DJ, Parish CR, McGarry M, Santiago FS, Lowe HC,

Brown KJ, Bingley JA, Hayward IP, Cowden WB, Campbell


534

JH, Campbell GR, Chesterman CN, and Khachigian LM

(2003) Blockade of vascular smooth muscle cell proliferation

and intimal thickening after balloon injury by the sulfated

oligosaccharide PI-88. Phosphomannopentaose sulfate

directly binds FGF-2, blocks cellular signaling, and inhibits

proliferation. Circ Res 92, e70-e77.

Freeman C and Parish CR (1998) Human platelet heparanase:

purification, characterization and catalytic activity. Biochem

J 330, 1341-1350.

Friedmann Y, Vlodavsky I, Aingorn H, Aviv A, Peretz T, Pecker

I, and Pappo O (2000) Expression of heparanase in normal,

dysplastic, and neoplastic human colonic mucosa and stroma.

Evidence for its role in colonic tumorigenesis. Am J Pathol

157, 1167-1175.

Goger B, Halden Y, Rek A, Mösl R, Pye D, Gallagher J, and

Kungl AJ (2002) Different affinities of glycosaminoglycan

oligosaccharides for monomeric and dimeric interleukin-8: A

model for chemokine regulation at inflammatory sites.

Biochemistry 41, 1640-1646.

Gohji K, Okamoto M, Kitazawa S, Toyoshima M, Dong J,

Kasuoka Y, and Nakajima M (2001) Heparanase protein and

gene expression in bladder cancer. J Urol 166, 1286-1290.

Goldshmidt O, Zcharia E, Abramovitch R, Metzger S, Aingorn

H, Friedmann Y, Schirrmacher V, Mitrani E, and Vlodavsky

I (2002) Cell surface expression and secretion of heparanase

markedly promote tumor angiogenesis and metastasis. Proc

Natl Acad Sci 99, 10031-10036.

Goldshmidt O, Zcharia E, Aingorn H, Guatta-Rangini Z, Atzmon

R, Michal I, Pecker I, Mitrani E, and Vlodavsky I (2001)

Expression pattern and secretion of human and chicken

heparanase are determined by their signal peptide sequence.

J Biol Chem 276, 29178-29187.

Goldshmidt O, Zcharia Y, Cohen M, Aingorn H, Cohen I, Nadav

L, Katz BZ, Geiger B, and Vlodavsky I (2003) Heparanase

mediates cell adhesion independent of its enzymatic activity.

FASEB J 17, 1015-1025.

Gong F, Jemth P, Escobar Galvis ML, Vlodavsky I, Horner A,

Lindahl U, and Li JP (2003) Processing of macromolecular

heparin by heparanase. J Biol Chem 278, 35152-35158.

Graham LD (1994) Tumor rejection antigens of the hsp90 family

(GP96) closely resemble tumour-associated heparanase

enzymes. Biochem J 301, 917-918.

Guimond S, Maccarana M, Olwin BB, Lindahl U, and Rapraeger

AC (1993) Activating and inhibitory heparin sequences for

FGF-2 (basic FGF). Distinct requirements for FGF-1, FGF-2,

and FGF-4. J Biol Chem 268, 23906-23914.

Hamaguchi T, Sudo T, and Osada H (1995) RK-682, a potent

inhibitor of tyrosine phosphatase, arrested the mammalian

cell cycle progression of G1phase. FEBS Lett 372, 54-58.

Harley MJ, Toptygin D, Troxler T, and Schildbach JF (2002)

R150A mutant of F TraI relaxase domain: reduced affinity

and specificity for single-stranded DNA and altered

fluorescence anisotropy of a bound labeled oligonucleotide.


Hirai K, Ooi H, Esumi T, Iwabuchi Y, and Hatakeyama S (2003)

Total synthesis of (+/-)-trachyspic acid and determination of

the relative configuration. Org lett 5, 857-859.

Hoogewerf AJ, Leone JW, Reardon IM, Howe WJ, Asa D,

Heinrikson RL and Ledbetter SR (1995) CXC chemokines

connective tissue activating peptide-III and neutrophil

activating peptide-2 are heparin/heparan sulfate-degrading

enzymes. J Biol Chem 270, 3268-3277.

Hulett MD, Freeman C, Hamdorf BJ, Baker RT, Harris MJ, and

Parish CR (1999) Cloning of mammalian heparanase, an

important enzyme in tumor invasion and metastasis. Nat

Med 5, 803-809.

Hulett MD, Hornby JR, Ohms SJ, Zuegg J, Freeman C, Gready

JE, and Parish CR (2000) Identification of active-site

residues of the pro-metastatic endoglycosidase heparanase.


Ikeguchi M, Hirooka Y, and Kaibara N (2003) Heparanase gene

expression and its correlation with spontaneous apoptosis in

hepatocytes of cirrhotic liver and carcinoma. Eur J Cancer

39, 86-90.

Ikuta M, Podyma KA, Maruyama K, Enomoto S, and

Yanagishita M (2001) Expression of heparanase in oral

cancer cell lines and oral cancer tissues. Oral Oncol 37, 177-

184.

Iozzo RV (1998) Matrix proteoglycans: from molecular design to

cellular function. Annu Rev Biochem 67, 609-652.

Iozzo RV and San Antonio JD (2001) Heparan sulfate

proteoglycans: heavy hitters in the angiogenesis arena. J


Ishida K, Teruya T, Simizu S, and Osada H (2004) Exploitation

of heparanase inhibitors from microbial metabolites using an

efficient visual screening system. J Antiobiot 57, 136-142.

Jain RK (2003) Molecular regulation of vessel maturation. Nat

Med 9, 685-693.

Kalluri R (2003) Basement membranes: structure, assembly and

role in tumour angiogenesis. Nat Rev Cancer 3, 422-433.

Katz A, Van-Dijk DJ, Aingorn H, Erman A, Davies M, Darmon

D, Hurvitz H, and Vlodavsky I (2002) Involvement of human

heparanase in the pathogenesis of diabetic nephropathy. Isr

Med Assoc J 4, 996-1002.

Kelly SM and Price NC (1997) The application of circular

dichroism to studies of protein folding and unfolding.

Biochim Biophys Acta 1338, 161-185.

Kelly T, Miao HQ, Yang Y, Navarro E, Kussie P, Huang Y,

MacLeod V, Casciano J, Joseph L, Zhan F, Zangari M,

Barlogie B, Shaughnessy J, and Sanderson RD (2003) High

heparanase activity in multiple myeloma is associated with

elevated microvessel density. Cancer Res 63, 8749-8756.

Kim AW, Xu X, Hollinger EF, Gattuso P, Godellas CV, and

Prinz RA (2002) Human heparanse-1 gene expression in

pancreatic andenocarcinoma. J Gastrointest Surg 6, 167-

172.

Kizaki K, Yamada O, Nakano H, Takahashi T, Yamauchi N,

Imai K, and Hashizume K (2003) Cloning and localization of

heparanase in bovine placenta. Placenta 24, 424-430.

Kjellen L and Lindahl U (1991) Proteoglycans: structures and

interactions. Annu Rev Biochem 60, 443-475.

Koliopanos A, Friess H, Kleeff J, Shi X, Liao Q, Pecker I,

Vlodavsky I, Zimmermann A, and Buchler MW (2001)

Heparanase expression in primary and metastatic pancreatic

cancer. Cancer Res 61, 4655-4659.

Kristl S, Zhao S, Knappe B, Sommerville RL, and Kungl AJ

(2000) The influence of ATP on binding of aromatic amino

acids to the ligand response domain of the tyrosine repressor

of Haemophilus influenzae. FEBS Lett 467, 87-90.

Kussie PH, Hulmes JD, Ludwig DL, Patel S, Navarro EC,

Seddon AP, Giorgio NA, and Bohlen P (1999) Cloning and

functional expression of a human heparanase gene. Biochem

Biophys Res Comm 261, 183-187.

Lapierre F, Holme K, Lam L, Tressler RJ, Storm N, Wee J, Stack

RJ, Castellot J, and Tyrrell DJ (1996) Chemical

modifications of heparin that diminish its anticoagulant but

preserve its heparanase-inhibitory, angiostatic, anti-tumor

and anit-metastatic properties. Glycobiology 6, 355-366.


535

LeTilly V and Royer CA (1993) Fluorescence anisotropy assays

implicate protein-protein interactions in regulating trp

repressor DNA binding. Biochemistry 32, 7753-7758.

Levidiotis V, Kanellis J, Ierino FL, and Power DA (2001)

Increased expression of heparanase in puromycin

aminonucleoside nephrosis. Kidney Int 60, 1287-1296.

Levy-Adam F, Miao HQ, Heinrikson RL, Vlodavsky I, and Ilan

N (2003) Heterodimer formation is essential for heparanase

enzymatic activity. Biochem Biophys Res Commun 308,

885-891.

Lin X, Wei G, Shi Z, Dryer L, Esko JD, Wells DE, and Matzuk

MM (2000) Disruption of gastrulation and heparan sulfate

biosynthesis in EXT1-deficient mice. Dev Biol 224, 299-311.

Linhardt RJ, Galliher PM, and Cooney CL (1986) Polysaccharide

lyases. Appl Biochem Biotechnol 12, 135-176.

Liotta LA, Steeg PS, and Stetler-Stevenson WG (1991) Cancer

metastasis and angiogenesis: an imbalance of positive and

negative regulation. Cell 64, 327-336.

Lopez MM, Yutani K, and Makhatadze GI (2001) Interactions of

the cold shock protein CspB from Bacillus subtilis with

single-stranded DNA. Importance of the T base content and

position within the template. J Biol Chem 276, 15511-

15518.

Lusti-Narasimhan M, Chollet A, Power CA, Allet B, Proudfoot

AE, and Well TN (1996) A molecular switch of chemokine

receptor selectivity. Chemical modification of the

interleukin-8 Leu25 –> Cys mutant. J Biol Chem 271, 3148-

3153.

Lyon M and Gallagher JT (1998) Bio-specific sequences and

domains in heparan sulphate and the regulation of cell

growth and adhesion. Matrix Biol 17, 485-493.

Manavalan P and Johnson WC Jr (1987) Variable selction

method improves the prediction of protein secondary

structure from circular dichroism spectra. Anal Biochem

167, 76-85.

Marchetti D and Nicolson GL (2001) Human heparanse: a

molecular determinant of brain metastasis. Adv Enzyme

Regul 41, 343-359.

Maxhimer JB, Quiros RM, Stewart R, Dowlatshahi K, Gattuso P,

Fan M, Prinz RA, and Xu X (2002) Heparanase-1 expression

is associated with metastatic potential of breast cancer.

Surgery 132, 326-333.

McKenzie E, Tyson K, Stamps A, Smith P, Turner P, Barry R,

Hircock M, Patel S, Barry E, Stubberfield C, Terrett J, and

Page M (2000) Cloning and expression profiling of Hpa2, a

novel mammalian heparanase family member. Biochem

Biophys Res Commun 276, 1170-1177.

McKenzie E, Young K, Hircock M, Bennett J, Bhaman M, Felix

R, Turner P, Stamps A, McMillan D, Saville G, Ng S, Mason

S, Snell D, Schofield D, Gong H, Townsend R, Gallagher JT,

Page M, Parekh R, and Stubberfield C (2003) Biochemical

characterization of the active heterodimer form of human

heparanase (Hpa1) protein expressed in insect cells.

Biochem J 373, 423-435.

Mecham RP (1998) Overview of extracellular matrix. Current

Protocols in Cell Biology. John Wiley & Sons, Inc, 10.1.1-

10.1.14.

Miao HQ, Elkin M, Aingorn E, Ishai-Michaeli R, Stein CA, and

Vlodavsky I (1999) Inhibition of heparanase activity and

tumor metastasis by laminarin sulfate and synthetic

phosphorothioate oligodeoxynucleotides. Int J Cancer 83,

424-431.

Miao HQ, Navarro E, Patel S, Sargent D, Koo H, Wan H, Plata

A, Zhou Q, Ludwig D, Bohlen P, and Kussie P (2002)

Cloning, expression, and purification of mouse heparanase.

Protein Expr Purif 26, 425-431.

Mikami S, Ohashi K, Usui Y, Nemoto T, Katsube K, Yanagishita

M, Nakajima M, Nakamura K, and Koike M (2001) Loss of

syndecan-1 and increased expression of heparanase in

invasive esophageal carcinomas. Jpn J Cancer Res 92,

1062-1073.

Mollinedo F, Najajima M, Llorens A, Barbosa E, Callejo S,

Gajate C, and Fabra A (1997) Major co-localization of the

extracellular-matrix degradative enzymes heparanase and

gelatinase in tertiary granules of human neutrophils.

Biochem J 327, 917-923.

Nakajima M, DeChavigny A, Johnson CE, Hamada J, Stein CA,

and Nicolson GL (1991) Suramin. A potent inhibitor of

melanoma heparanase and invasion. J Biol Chem 266, 9661-

9666.

Nakajima M, Irimura T, and Nicolson GL (1988) Heparanases

and tumor metastasis. J Cell Biochem 36, 157-167.

Naparstek Y, Cohen IR, Fuks Z, and Vlodavsky I (1984)

Activated T lymphocytes produce a matrix-degrading

heparan sulphate endoglycosidase. Nature 310, 241-244.

Nardella C, Lahm A, Pallaoro M, Brunetti M, Vannini A, and

Steinkuhler C (2004) Mechanism of activation of human

heparanase investigated by protein engineering.


Nicosia RF and Madri JA (1987) The microvascular extracellular

matrix. Developmental changes during angiogenesis in the

aortic ringplasma clot model. Am J Pathol 128, 78-90.

Nikov GN, Eshete M, Rajnarayanan RV, and Alworth WL

(2001) Interactions of synthetic estrogens with human

estrogen receptor. J Endocrinol 170, 137-145.

Okada Y, Yamada S, Toyoshima M, Dong J, Nakajima M, and

Sugahara K (2002) Structural recognition by recombinant

human heparanase that plays critical roles in tumor

metastasis. Hierarchical sulfate groups with differential

effects and the essential target disulfated trisaccharide

sequence. J Biol Chem 277, 42488-42495.

Oosta GM, Favreau LV, Beeler DL, and Rosenberg RD (1982)

Purification and properties of human platelet heparitinase. J

Biol Chem 257, 11249-11255.

Parish CR, Coombe DR, Jakobsen KB, Bennett FA, and

Underwood PA (1987) Evidence that sulphated

polysaccharides inhibit tumour metastasis by blocking

tumour-cell-derived heparanases. Int J Cancer 40, 511-518.

Parish CR, Freeman C, and Hulett MD (2001) Heparanase: a key

enzyme involved in cell invasion. Biochim Biophys Acta

1471, M99-M108.

Parish CR, Freeman C, Brown KJ, Francis DJ, and Cowden WB

(1999) Identification of sulfated oligosaccharide-based

inhibitors of tumor growth and metastasis using novel in

vitro assays for angiogenesis and heparanase activity.

Cancer Res 59, 3433-3441.

Parish CR, Hindmarsh EJ, Bartlett MR, Staykova MA, Cowden

WB, and Willenborg DO (1998) Treatment of central

nervous system inflammation with inhibitors of basement

membrane degradation. Immunol Cell Biol 76, 104-113.

Parker GJ, Law TL, Lenoch FJ, and Bolger RE (2000)

Development of high throughput screening assays using

fluorescence polarization: nuclear receptor-ligand-binding

and kinase/phosphatase assays. J Biomol Screen 5, 77-88.

Perczel A, Park K, and Fasman GD (1992) Analysis of the

circular dichroism spectrum of proteins using convex

constraint algorithm: a practical guide. Anal Biochem 203;

83-93.


536

Pikas DS, Li JP, Vlodavsky I, and Lindahl U (1998) Substrate

specificity of heparanases from human hepatoma and

platelets. J Biol Chem 273, 18770-18777.

Podyma-Inoue KA, Yokote H, Sakaguchi K, Ikuta M, and

Yanagishita M (2002) Characterization of heparanase from a

rat parathyroid cell line. J Biol Chem 277, 32459-32465.

Ray JM and Stetler-Stevenson WG (1994) The role of matrix

metalloproteinases and their inhibitors in tumor invasion,

metastasis and angiogensis. Eur Respir J 7, 2062-2072.

Reiland J, Sanderson RD, Waguespack M, Barker SA, Long R,

Carson DD, and Marchetti D (2004) Heparanase degrades

syndecan-1 and perlecan heparan sulfate: functional

implications for tumor cell invasion. J Biol Chem 279,

8047-8055.

Rek A, Geretti E, Goger B, and Kungl A (2002) The biophysics

of chemokine/glycosaminoglycan interactions. Res Devel

Biophys Biochem 2, 319-340.

Rohloff J, Zinke J, Schoppmeyer K, Tannapfel A, Witzigmann

H, Mossner J, Wittekind C, and Caca K (2002) Heparanase

expression is a prognostic indicator for postoperative

survival in pancreatic adenocarcinoma. Br J Cancer 86,

1270-1275.

Saijo M, Kitazawa R, Nakajima M, Kurosaka M, Maeda S, and

Kitazawa S (2003) Heparanase mRNA expression during

fracture repair in mice. Histochem Cell Biol 120, 493-503.

Sanderson RD (2001) Heparan sulfate proteoglycans in invasion

and metastasis. Semin Cell Dev Biol 12, 89-98.

Sanderson RD, Yang Y, Suva LJ, Kelly T (2004) Heparan

sulfate proteoglycans and heparanase--partners in osteolytic

tumor growth and metastasis. Matrix Biol 23, 341-52

Sasisekharan R and Venkataraman G (2000) Heparin and

heparan sulfate: biosynthesis, structure and function. Curr

Opin Chem Biol 4, 626-631.

Sasisekharan R, Shriver Z, Venkataraman G, and Narayanasami

U (2002) Roles of heparan-sulphate glycosaminoglycans in

cancer. Nat Rev Cancer 2, 521-528.

Seftor RE, Seftor EA, Gehlsen KR, Stetler-Stevenson WG,

Brown PD, Ruoslahti E, and Hendrix MJ (1992) Role of the

" v ! 3 integrin in human melanoma cell invasion. Proc Natl

Acad Sci USA 89, 1557-1561.

Selleck SB (1999) Overgrowth syndromes and the regulation of

signaling complexes by proteoglycans. Am J Hum Genet

64, 372-377.

Sharma B, Handler M, Eichstetter I, Whitelock JM, Nugent MA,

and Iozzo RV (1998) Antisense targeting of perlecan blocks

tumor growth and angiogenesis in vivo. J Clin Invest 102,

1599-1608.

Shiozawa H, Takahashi M, Takatsu T, Kinoshita T, Tanzawa K,

Hosoya T, Furuya K, Takahashi S, Furihata K, and Seto H

(1995) Trachyspic acid, a new metabolite produced by

Talaromyces trachyspermus, that inhibits tumor cell

heparanase: taxonomy of the producing strain, fermentation,

isolation, structural elucidation, and biological activity. J

Antibiot (Tokyo) 48, 357-362.

Simizu S, Ishida K, Wierzba M, and Osada H (2004) Secretion of

heparanase protein is regulated by glycosylation in human

tumor cell lines. J Biol Chem 279, 2697-2703.

Simizu S, Ishida K, Wierzba MK, Sato TA, and Osada H (2003)

Expression of heparanase in human tumor cell lines and

human head and neck tumors. Cancer Lett 193, 83-89.

Sreerama N and Woody RW (1994) Protein secondary structure

form circular dichorism spectroscopy. Combining variable

selection principle and cluster analysis with neural network,

ridge regression and self-consistent methods. J Mol Biol

242, 497-507.

Stetler-Stevenson WG, Liotta LA, and Kleiner DE Jr (1993)

Extracellular Matrix 6: role of matrix metalloproteinases in

tumor invasion and metastasis. FASEB J 7, 1434-1441.

Takaoka M, Naomoto Y, Ohkawa T, Uetsuka H, Shirakawa Y,

Uno T, Fujiwara T, Gunduz M, Nagatsuka H, Nakajjima M,

Tanaka N, and Haisa M (2003) Heparanase expression

correlates with invasion and poor prognosis in gastric

cancers. Lab Invest 83, 613-622.

Tang W, Nakamura Y, Tsujimoto M, Sato M, Wang X,

Kurozumi K, Nakahara M, Nakao K, Nakamura M, Mori I,

and Kakudo K (2002) Heparanase: a key enzyme in invasion

and metastasis of gastric carcinoma. Mod Pathol 15, 593-

598.

Thompson LD, Pantoliano MW, and Springer BA (1994)

Energetic characterization of the basic fibroblast growth

factor-heparin interaction: identification of the heparin

binding domain. Biochemistry 33, 3831-3840.

Toyoshima M and Nakajima M (1999) Human heparanase.

Purification, characterization, cloning, and expression. J Biol

Chem 274, 24153- 24160.

Tsuchida S, Podyma-Inoue KA and Yanagishita M (2004)

Ultrafiltration-based assay for heparanase activity. Anal

Biochem 331, 147-152.

Tudan C, Willick GE, Chahal S, Arab L, Law P, Salari H, and

Merzouk A (2002) C-terminal cyclization of an SDF-1 small

peptide analogue dramatically increases receptor affinity and

activation of the CXCR4 receptor. J Med Chem 45, 2024-

2031.

Tumova S, Woods A, and Couchmann JR (2000) Heparan sulfate

proteoglycans on the cell surface: versatile coordinators of

cellular functions. Int J Biochem Cell Biol 32, 269-288.

Turnbull J, Powell A, and Guimond S (2001) Heparan sulfate:

decoding a dynamic multifunctional cell regulator. Trends

Cell Biol 11, 75-82.

Vlodavsky I and Friedmann Y (2001) Molecular properties and

involvement of heparanase in cancer metastasis and

angiogenesis. J Clin Invest 108, 341-347.

Vlodavsky I, Eldor A, Haimovitz-Friedman A, Matzner Y, Ishai-

Michaeli R, Lider O, Naparstek Y, Cohen IR, and Fuks Z

(1992) Expression of heparanase by platelets and circulating

cells of the immune systeme: possible involvement in

diapedesis and extravasation. Invasion Metastasis 12, 112-

127.

Vlodavsky I, Friedmann Y, Elkin M, Aingorn H, Atzmon R,

Ishai-Michaeli R, Bitan M, Pappo O, Peretz T, Michal L,

Spector L, and Pecker I (1999) Mammalian heparanase: gene

cloning, expression and function in tumor progression and

metastasis. Nature Medicine 5, 793-802.

Vlodavsky I, Goldshmidt O, Zcharia E, Atzmon R, Rangini-

Guatta Z, Elkin M, Peretz T, and Friedmann Y (2002)

Mammalian heparanase: involvement in cancer metastasis,

angiogenesis and normal development. Semin Cancer Biol

12, 121-129.

Vlodavsky I, Goldshmidt O, Zcharia E, Metzger S, Chajek-Shaul

T, Atzmon R, Guatta-Rangini Z, and Friedmann Y (2001)

Molecular properties and involvement of heparanase in

cancer progression and normal development. Biochimie 83,

831-839.

Vlodavsky I, Moshen M, Lider O, Svahn CM, Ekre HP, Vigoda

M, Ishai-Michaeli R, and Peretz T (1994) Inhibition of tumor

metastasis by heparanase inhibiting species of heparin.

Invasion Metastasis 14, 290-302.

Walker A and Gallagher JT (1996) Structural domains of

heparan sulphate for specific recognition of the C-terminal


537

heparin-binding domain of human plasma fibronectin

(HEPII). Biochem J 317, 871-877.

Watanabe M, Aoki Y, Kase H, and Tanaka K (2003) Heparanase

expression and angiogenesis in endometrial cancer. Gynecol

Obstet Invest 56, 77-82.

Weinstein T, Cameron R, Katz A, and Silverman M (1992) Rat

glomerular epithelial cells in culture express characteristics

of parietal, not visceral, epithelium. J Am Soc Nephrol 3,

1279-1287.

Yang YJ, Zhang YL, Li X, Dan HL, Lai ZS, Wang JD, Wang

QY, Cui HH, Sun Y, and Wang YD (2003) Contribution of

eIF-4E inhibition to the expression and activity of heparanase

in human colon adenocarcinoma cell line: LS-174T. World J

Gastroenterol 9, 1707-1712.

Yano K, Brown LF, and Detmar M (2001) Control of hair

growth and follicle size by VEGF-mediated angiogenesis. J


Zcharia E, Metzger S, Chajek-Shaul T, Aingorn H, Elkin M,

Friedmann Y, Weinstein T, Li JP, Lindahl U, and Vlodavsky

I (2004) Transgenic expression of mammalian heparanase

uncovers physiological functions of heparan sulfate in tissue

morphogenesis, vascularization, and feeding behavior.

FASEB J 18, 252-263.

Zcharia E, Metzger S, Chajek-Shaul T, Friedmann Y, Pappo O,

Aviv A, Elkin M, Pecker I, Peretz T, and Vlodavsky I (2001)

Molecular properties and involvement of heparanase in

cancer progression and mammary gland morphogenesis. J

Mammary Gland Biol Neoplasia 6, 311-322.

Zetser A, Bashenko Y, Miao HQ, Vlodavsky I, and Ilan N (2003)

Heparanase affects adhesive and tumorigenic potential of

human glioma cells. Cancer Res 63, 7733-7741.


538


539


Two dimensional gel electrophoresis analyses of

human plasma proteins. Association of retinol

binding protein and transthyretin expression with

breast cancerResearch Article

Karim Chahed1,2, Bechr Hamrita1, Hafedh Mejdoub3, Sami Remadi1,4, Anouar

Chaïeb5 and Lotfi Chouchane1,*1Laboratoire d’Immuno-Oncologie Moléculaire, Faculté de Médecine de Monastir, Tunisia2Institut supérieur de Biotechnologie de Monastir, Tunisia3Faculté des Sciences de Sfax, Tunisia4Laboratoire Cytopath, Sousse, Tunisia5Service d’Obstétrique et des maladies féminines, Hôpital Universitaire Farhat Hached, Sousse Tunisia.

__________________________________________________________________________________*Correspondence: Prof. Lotfi Chouchane, Laboratoire d’Immuno-oncologie Moléculaire, Faculté de Médecine de Monastir, 5019

Monastir, Tunisie; Tel: 216-73-462-200; Fax: 216-73-460-737; e-mail: [email protected]

Key words: Two dimensional gel electrophoresis. Breast cancer. Acute phase proteins.

Abbreviations: carcinoembryonic antigen, (CEA); cellular retinol, (CRBP); isoelectrofocalisation, (IEF); National Center for

Biotechnology Information, (NCBI); prostate specific antigen, (PSA); retinoic acid, (RA); retinol binding protein, (RBP); Serum

amyloid P, (SAP); transthyretin, (TTR)

This work was supported by le Ministère de la Recherche Scientifique et de Technologie, le Ministère de l’Enseignement

Supérieur and le Ministère de la Santé Publique de la République Tunisienne.

Received: 10 December 2004; Revised: 11 January 2005

Accepted: 17 January 2005; electronically published: March 2005

Summary

The identification of markers for either early diagnosis, treatment response or for survival of breast cancer is of

critical importance. The plasma carries an archive of important histological information whose determination may

help to improve early disease detection. Using two dimensional gel electrophoresis and protein sequencing we

investigated the changes in protein expression profiles derived from analysis of plasma from healthy Tunisian

women and patients with breast carcinoma. We have found an association between retinol binding protein,

transthyretin expression and breast cancer. The levels of acute phase proteins known to accompany both acute and

chronic inflammatory disorders comprising haptoglobin, serum amyloid P, apolipoprotein A1, !1-antitrypsin and

!1-acidic glycoprotein were also intimately associated with this neoplastic disease.

I. IntroductionBreast cancer is the most frequent malignancy among

women representing a major health problem in many

countries. Considering the cellular complexity and the

dynamic structures of mammary tumors breast cancer is

mainly classified according to the cellular origin of the

cancer cells and on the evolution of the disease

(Hondermarck, 2003). Current methods used to detect

breast tumors are based on mammography. It is a widely

used and clinically screening method that is effective in

detecting early stage breast cancer before clinical

symptoms appear (Brenner, 2002). However, since a

tumor should be at least a few millimeters in size, it is

already late when breast cancer is detected. So, there is a

considerable need for the identification of useful

pathological markers that can help not only in early

detection but also for typing and treatment.

It is well established that changes that occur in

disease versus normal tissues at either the gene (genomic)

or protein (proteomic) level are regarded as an appropriate

way to identify markers of pathologies that could be

correlated with drug response and patient survival.

Chahed et al: Association of retinol binding protein and transthyretin expression with breast cancer

540

Proteomics with the recent advances in mass spectrometry

has brought with it the hope of discovering novel

biomarkers that could be used to diagnose diseases.

Probably, the most widely used proteomic technology is

the identification of alterations in protein expression

between two samples through comparative 2-DE (Conrads

et al, 2003). In such investigation a biomarker is defined

as a protein having more or less intensity on one gel

compared with the other and should be particularly

associated with the disease.

The search for biomarkers and specific alterations

using proteomic methods largely focus upon plasma or

serum (Anderson and Anderson, 1977; Hoogland et al,

1999). These biological fluids are clinically relevant since

they could be obtained in sufficient quantities from

patients. It is well known that during necrosis and

apoptosis content of cells could be released into the

plasma. In addition, plasma may contain proteins or

peptides that are aberrantly shed or secreted from cells in

response to a disease (Adkins et al, 2002). It might be

expected that the presence of a disease could be

determined by measuring the altered presence or

abundance of the constituant molecular species and

reinforces the benefits of using a 2-DE approach for

identifying biomarkers for disease states (Wrotnowski,

1998).

Blood plasma like cells contains many high abundant

proteins. The major constituents include albumine,

haptoglobin, immunoglobulins, transferrin, lipoproteins,

fibrinogene B and fibrinogene ". Other very low abundant

proteins are commonly present in plasma (Wrotnowski,

1998; Anderson and Anderson, 2002). They represent the

low molecular weight plasma proteome and could be

generated from larger proteins by proteolysis within the

circulatory system or in the environment of the tumors.

Searching for human plasma alterations using 2-DE

with regard to neoplastic disease has been extensively

investigated. As early as 1974, 2-DE was carried to look

for differences between protein patterns of individuals

suffering cancer (Wright, 1974). Since, several markers

were characterized and are currently used for diagnosis.

As an example, increased levels of molecular markers

such as prostate specific antigen (PSA) and CA 125 are

now routinely used for the detection of cancer in the

prostate and ovary respectively (Charrier et al, 2001;

Petricoin et al, 2002). Other markers are effective for

diagnosing primary or advanced neoplastic diseases. The

carcinoembryonic antigen (CEA) is used for detecting

colorectal cancer, Her2/neu, CA 15-3 and CA 27-29 for

advanced breast cancer (Diamandis, 1996; Buzdor and

Hortobagy, 1999). Kallikreins, a family of secreted serine

proteases were highly associated with ovarian carcinoma

as well as with breast and prostate cancers (Yousef and

Diamandis, 2001).

The plasma carries an archive of important

histological information whose determination could help

to improve early disease detection. In the present study, by

using 2-DE investigations of human plasma proteins we

have found an association between the levels of retinol

binding protein (RBP), transthyretin (TTR) and breast

carcinoma among Tunisian women.

II. Materials and methodsA. Patients and controlsPlasma samples were collected from six untreated patients

diagnosed with infiltrating breast ductal carcinoma. Control

subjects (16) were healthy blood donors having no evidence of

any personal or family history of cancer (or other serious illness).

Controls and patients were selected from the same population

living in the middle coast of Tunisia. All the samples were

collected with informed consent according to protocols approved

by the institutional review boards of the respective hospitals.

Plasma samples were stored at -80°C before analysis.

B. Two dimensional gel electrophoresis and

evaluation of 2D data

1. Isoelectrofocalisation of proteins (first

dimension) and SDS-PAGETo the plasma, four volumes of cold acetone (-20°C) were

added and the solution was incubated for 1 Hour at -20°C. The

pellet was washed with cold acetone (80%), dried under partial

vacuum and solubilised in 7.0 M urea, 2.0 M Thiourea, 4% (w/v)

CHAPS, 0,5% w/v DTT and 2% ampholytes (1 part pH 3/10, 1

part pH 5/7, 2parts pH 6/8). Acetone precipitation led to a better

resolution of abundant plasma proteins, but there has been

significant loss in lower molecular weight proteins. Protein

contents were determined according to the procedure described

by Bradford (Bradford, 1976) and modified by Ramagli and

Rodriguez (Ramagli and Rodriguez, 1985). Bovine serum

albumin (Fraction V, Sigma) was used as a standard. Analytical

2D-PAGE was carried out in a Bio-Rad system (Miniprotean II).

Equal amounts of proteins issued from control or breast cancer

samples were subjected simultaneously to isoelectrofocalisation

(IEF) and SDS-PAGE analysis. Extraction of proteins,

solubilisation, IEF, SDS-PAGE and staining were carried under

very similar conditions for the different samples. Each

experiment was repeated for at least three times. Focused strips

were equilibrated in SDS equilibration buffer and were then

loaded onto SDS gel slabs for separation in the second dimension

(Laemmli, 1970).

2. Gel stainingAfter separation in SDS-PAGE gels, the proteins were

visualised by a sensitive colloidal coomassie G-250 stain

(Neuhoff et al, 1985). The dye solution contained 17% (w/v)

ammonium sulfate, 3% (v/v) phosphoric acid, 0,1% (w/v)

coomassie G250 and 34% (v/v) methanol. The staining solution

was changed once after 12 hours staining and the gel slabs

subjected to a 24 hours cycle for increasing dye deposition on

low abundance proteins. The detection was then increased by

placing the gel into 1% v/v acetic acid for producing a better

contrast between spots and gel. Silver staining was done

according to Oakley et al, (1980). All coomassie and

silver–stained gels were scanned into adobe photoshop 6.0.

Alterations in protein levels defined as clear differences in size

and/or density of the protein spot on the gel were confirmed

through differential analyses using melanie 3.0 software tools.

Comparison of the 2D patterns with published human plasma

protein 2D-PAGEs of the Swiss-2DPAGE database (Sanchez et

al, 1995) allowed characterization of the indicated plasma

proteins.

3. N-terminal amino acid sequencingAs the experimental and theoretical positions of a protein

may differ significantly, the identity of proteins of interest was

confirmed by sequencing. Plasma proteins (500 µg) were


541

fractionated on 12 cm IEF rod gels (1.5 mm diameter) at 300

volts for 1 hour, 450 volts for 2 hours and 650 volts for 15 hours.

SDS-PAGE was performed under constant current intensity (35

mA/gel). Following electrophoresis, proteins were electroblotted

on Immobilon P using a semi-dry blotter system (Millipore) and

stained with coomassie blue according to the manufacturer’s

instructions. Spots on Immobilon membranes, corresponding to

polypeptides of interest were collected ans subjected to Edman

degradation using an applied biosystem modele (Procise). Amino

acid sequence analysis and data base search were performed at

the National Center for Biotechnology Information (NCBI) and

comparison with the Swiss Prot data bases.

III. Results and DiscussionPlasma proteomic analysis of six malignant breast

cancer samples and 16 samples from human healthy

donors were compared by high resolution two dimensional

gel electrophoresis. Several proteins were up-regulated in

all of the breast cancer samples compared to that of

healthy controls. The majority of the protein

identifications appeared to represent differences in overall

abundance. 2-DE investigations showed elevated levels of

acute phase proteins such as haptoglobin (#-chain), serum

amyloid P, !1-antitrypsin, !1-antichymotrypsin and !1-

acidic glycoprotein in plasma from patients diagnosed

with breast cancer (Figure 1). Two other proteins, highly

elevated in cancer plasma, were identified as RBP and

TTR.

The first group of proteins designed as positive acute

phase proteins is known to accompany both acute and

chronic inflammatory disorders (Doherty et al, 1998).

During tumoral growth, acute phase proteins have also

been described to accumulate at high levels and could be

used to distinguish tumor type and prognosis (Negishi et

al, 1987; Schmid et al, 1995; Alaiya et al, 2000). This is

well described for prostate cancer where the association of

antichymotrypsin and PSA is well investigated to help in

the differential diagnosis of prostate cancer from benign

prostate hyperplasia (Charrier et al, 2001). In a recent

study, Cho W C et al, (2004) identified serum amyloid A

as a serum biomarker that could be useful in the diagnosis

of relapse in nasopharyngeal cancer.

As our investigation, several studies have examined

aspects of the acute phase response in which many high

abundant plasma proteins increase or decrease following a

range of inflammatory insults or cancer (Bini et al, 1992).

In acute inflammatory responses and in rheumatoid

arthritis, differences in the levels of 19 acute phase

proteins were reported to be affected. These studies, based

on quantitative serum analysis, showed that high abundant

acute phase–related proteins could be good prognostic

markers of inflammation (Doherty et al, 1998). Gianazza

and co-workers (Miller et al, 1999, Eberini et al, 2000)

identified, using 2-DE, 34 proteins with human

homologues showing changes in protein abundance and

were associated with inflammatory diseases. Several other

2-DE studies have examined aspects of the acute phase

response following an inflammatory insult. Changes in

haptoglobin levels were reported in duchenne muscular

dystrophy (John and Purdom, 1989), human gonadotropin

isoforms in patients with trophoblastic tumors (Hoemann

et al, 1993) and ApoA-1 during parturition (Del Piore et

al, 1991) and heart disease (Cassler et al, 1992). The levels

of other acute phase proteins such as serum amyloid A

were altered after a severe head injury (Choukaite et al,

1989) or viral infections (Bini et al, 1996). By comparative

proteome analysis, Vejda et al (2002) found elevated

levels of degradation products of antiplasmin and laminin

"-chain in cancer samples. They also found significantly

elevated levels of the acute phase proteins !1-acidic

glycoprotein, !1-antitrypsin, !1-antichymotrypsin and

haptoglobin. The !1-antitrypsin and laminin "-chain were

described as being anti-apoptotic factors (Yoshida et al,

2001; Vejda et al, 2002). Kuhajda et al, (1989) reported

that haptoglobins could be associated with phenotypically

aggressive neoplasia and serve as mediators of some

malignant processes in breast cancer. They were also

found to stimulate collagen synthesis in fibroblasts from

cancerous body fluids (Viellard et al, 1974). Detection and

quantification of haptoglobins could also be a useful

diagnostic procedure in cancer. A recent study of

haptoglobin polymorphism in breast cancer patients

demonstrates that haptoglobin 1 and 2 alleles were over-

represented in patients with familial and non familial

breast cancer respectively (Awadallah and Atoum, 2004).

Other studies provided evidence that the haptoglobin !

subunit is specifically increased in sera of ovarian cancer

patients. It has been postulated that Hp! might affect the

immune response as a potent immunosuppressant (Bini et

al, 2003). The study we carried out showed an increase in

the levels of haptoglobin (# chain) in all breast cancer

samples (Figure 1). However, we were unable to draw

conclusions concerning !1 and !2 chains because of the

genetic polymorphism associated with the corresponding

gene. In the case of two other protein family members, !1-

acidic glycoprotein and !1-antitrypsin, showing elevated

levels in our breast cancer samples, a direct anti-apoptotic

mode of action has been demonstrated on tumor necrosis

factor-induced apoptosis of hepatocytes (Van Molle et al,

1997). The increase in the levels of protease inhibitors in

plasma such as !1-antitrypsin and !1-antichymotrypsin

could be related to the high proteolytic activity mediated

by proteases such as plasmin in cancer samples (Anderson

et al, 1993; Vejda et al, 2002). These two related

glycoprotein protease inhibitors, present in plasma could

also neutralize proteases released by leucocytes in

response to trauma and inflammatory stimuli (Bergman et

al, 1993). Serum amyloid P (SAP), a plasma glycoprotein,

shows also a slight increase in breast cancer samples

(Figure 1). This pentraxin protein has been shown to bind

chromatin in apoptotic and necrotic cells, thus preventing

antinuclear auto-immunity (Bickerstaff et al, 1990). The

SAP protein recognizes ligands from necrotic cells, binds

to late apoptotic cells and is involved in their phagocytosis

by human monocyte derived macrophages (Familian et al,

2001; Bijl et al, 2002).

A second set of proteins designed as negative acute

phase proteins comprising TTR and retinol binding protein

(RBP) displayed interestingly increased intensities in all

the breast cancer samples (Figure 1). A lower amount of

RBP and TTR was found in all control samples regardless

to the age. This result suggests that the association


542

Figure 1. Two dimensional gel electrophoresis analyses of plasma proteins derived from (A) a healthy donor and (B) a breast cancer

patient. Partial 2-DE images from a control gel (A) and from a breast cancer sample (B) are shown. Abr: STF: serotransferrin ; ALB:

albumin ; ACT: anti-chymotrypsin ; ATR: anti-trypsin ; AGP: acidic glycoprotein ; Hp: haptoglobin ; Fb: fibrinogen beta chain ; ApoAI:

apoAI lipoprotein ; SAP: serum amyloid P ; RBP: retinol binding protein.

between RBP and TTR expression in plasma and breast

cancer is unlikely to be related to the age.

Further characterization of the RBP and TTR spots

was performed by protein sequencing. The two spots were

electroblotted on immobilon P and subjected to N-terminal

amino acid sequence analyses. The deduced sequences

(RBP:1ERDCRVSSFRVKENFDKARF20;TTR:1GPTGTGE

SKCPLMVKVLDAV20) were compared with the Swiss

Prot data bases and found to correspond, respectively, to

retinol binding protein and transthyretin.

The high levels of RBP and TTR found in plasma of

Tunisian patients with breast cancer as revealed by 2D-

PAGE were not reported for other populations (Mehta et

al, 1987; Basu et al, 1988;1989; Russell et al, 1988; Vejda

et al, 2002). This may be attributable to differences in

study design, to the analyzed populations, as well as to the

presence of different confounding factors.

The retinol binding protein is a member of the

lipocalins family and has been used as a marker of

diseases associated with inflammation and cancer (Xu and

Venge, 2000). It is synthesized predominantly by the liver

and is the principal carrier of all-trans retinol (vitamin A)

in the blood stream (Goodman, 1984). Transthyretin acts

as a transport protein for thyroxin T4 and is the primary


543

indirect carrier of vitamin A through its interaction with

retinol binding protein. It is well established that the

metabolism of RBP and TTR is highly associated with that

of vitamin A (Rosales et al, 2000). In the blood, the

retinol/ RBP complex further binds to transthyretin at a

ratio of 1:1:1 and is then transported to the target cells.

Retinol is then metabolized to its active form, retinoic acid

(RA), which is an important transcription modulator that

acts in the regulation of proliferation and differenciation of

many cell types (Blomhoff, 1994). Retinoids act also as

cancer chemopreventive and chemotherapeutic agents

(Honk and Sporn, 1997). They were also reported to

inhibit the growth of several breast cancer cell lines (Chen

et al, 1997). The action of retinol and RA is mediated by

their binding to cellular retinol (CRBP) and retinoic acid

binding proteins (CRABPI and CRABPII) and through

two different families of nuclear RA receptors. The latters

behave as ligand-activated–trans-acting transcription

factors that can regulate the expression of several retinoid-

responsive genes and hence alters the growth of normal

and cancer cells (Mangelsdorf et al, 1994).

Recent studies indicate that the metabolism of retinol

to retinoids is greatly reduced in several human carcinoma

cell lines and tumor specimens (Guo and Gudas, 1998;

Guo et al, 2000, 2001). Carcinoma cells from the breast

showed a decrease in their ability to esterify retinol to

retinyl esters (Chen et al, 1997). It has been suggested that

this could lead to an inappropriate growth and to the loss

of normal differenciation processes (Mira-Y-Lopez et al,

2000). Another frequent event in a subset of human breast

cancers is the loss of CRBP expression. This protein is

postulated to regulate the formation of retinyl esters and

the synthesis of retinoic acid (Ong et al, 1994). It was

suggested that CRBP down regulation occurs through

DNA hypermethylation in human breast cancer and

contributes to breast tumor progression (Arapshian et al,

2004). The decrease in the levels of CRBP leads to a

restriction of the effects of intracellular vitamin A levels

on breast cells (Kuppumbatti et al, 2000; Arapshian et al,

2004). Furthermore, it has been shown that increasing the

levels of CRABPII, an intracellular lipid-binding protein

that associates with retinoic acid, in mammary carcinoma

cells (MCF7) strongly enhances their sensitivity to retinoic

acid-induced growth inhibition (Budhu and Noy, 2002).

These data provide the evidence that increasing the

intracellular levels of retinyl esters in malignant cells

could be a good approach to treat patients with breast

cancer. The increase in the plasma levels of RBP and TTR

could thus be linked to the lack of sufficient internal

retinyl ester stores necessary to regulate retinoid

responsive genes in malignant cells.

In conclusion, the present study showing the high

production of RBP and TTR in plasma of patients with

breast cancer suggests that overproduction of these

proteins could correlate with a decrease of retinyl esters in

tumor cells.

AcknowledgmentsThis work was supported by le Ministère de la

Recherche Scientifique et de Technologie, le Ministère de

l’Enseignement Supérieur and le Ministère de la Santé

Publique de la République Tunisienne.

ReferencesAdkins JN, Varnum SM, Auberry KJ, Moore RJ, Angell NH,

Smith RD, Springer DL and Pounds JG (2002) Toward a

human blood serum proteome: Analysis by multidimensional

separation coupled with mass spectrometry. Mol Cell

Proteomics 1, 917-955.

Alaiya AA, Franzen B, Hagman A, Slitversward C, Moberger B,

Linder S and Aner G (2000) Classification of human ovarian

tumors using multivariate data analysis of polypeptide

expression patterns. Int JCancer 86, 731-736.

Anderson C, Gelin J, Iresjo BM and Lundholm K (1993) Acute

phase proteins in response to tumor growth. J Surg Res 55,

807-814.

Anderson L and Anderson N.G (1977) High resolution two-

dimensional gel electrophoresis of human plasma proteins.

Proc Natl Acad Sci USA 74, 5421-5425.

Anderson NL and Anderson NG (2002) The human plasma

proteome. Mol Cell Proteomics, 845-867.

Arapshian A, Bertran S, Kuppumbatti YS, Nakajo S and Lopez

RM (2004) Epigenetic CRBP down regulation appears to be

an evolutionarily conserved (human and mouse) and

oncogene specific phenomenon in breast cancer. Molecular

Cancer, 3-13.

Awadallah SM and Atoum MF (2004) Haptoglobin

polymorphism in breast cancer patients from jordan. Clin

Chim Acta 341, 17-21.

Basu TK and Sasmal P (1988) Plasma vitamin A, retinol-binding

protein, and prealbumin in postoperative breast cancer

patients. Int J Vitam Nutr Res 58 , 281-3.

Basu TK, Hill GB, Ng D, Abdi E and Temple N (1989) Serum

vitamins A and E, beta-carotene, and selenium in patients

with breast cancer. J Am Coll Nutr 8, 524-529.

Bergman D, Kadner SS, Cruz MR, Esterman AL, Tahery MM,

young BK and Finlay TH (1993) Synthesis of !1-

antichymotrypsin and !1-antitrypsin by human trophoblast.

Pediatr Res 34, 312-7.

Bickerstaff MC, Botto M, Hutchinson WL, Herbert J, Tennent

GA, Bybee A, Mitchell DA, Cook HT, Butler PJ, Walport

MJ and Pepys MB, (1990) Serum amyloid P component

controls chromatin degradation and prevents antinuclear

autoimmunity. Nat Med 5, 694-697.

Bijl M, Horst G, Bootsma H, Limburg PC and Kallenberg CGM

(2002) Serum amyloid P component (SAP) binds to late

apoptotic cells and mediates their phagocytosis by

macrophages. Arthritis Res 4, 8.

Bini L, Magi B, Cellesi C, Rossolini A and Pallini V (1992) Two

dimensional electrophoresis analysis of human serum

proteins during the acute-phase response. Electrophoresis

13, 743-746.

Bini L, Nagi B, Marzocchi B, Celiesi C, Berti B, Raggiaschi R,

Rossolini A and Pallini V (1996) Two dimensional

electrophoretic patterns of acute-phase human serum proteins

in the course of bacterial and viral diseases. Electrophoresis

17, 612-616.

Bini Ye, Cramer DW, Skates SJ, Gygi SP, Pratomo V, Fu LF,

Horick NK, Licklider LJ, Schorge JO, Berkowitz RS and

Mok SC (2003) Haptoglobin !-subunit as potential

biomarker in ovarian cancer. Clinical Cancer Res 9, 2904-

2911.

Blomhoff R, (1994) Overview of vitamin A metabolism and

function, in Blomhoff R (Ed)-Vitamin A in health and

disease, Marcel Dekker, New York, 1-35.


544

Bradford M (1976) A rapid and sensitive method for the

quantification of microgram quantities of protein utilizing the

principle of protein dye binding. Anal Biochem 72, 248-254.

Brenner DJ, Sawant SG, Hande MB, Miller RC, Elliston CD, Fu

Z, Randers-pehrson G and Marino SA (2002) Routine

screening mammography: how important is the radiation-risk

of the benefit-risk equation?. Int J radia Biol 78, 1065-1067.

Budhu AS and Noy N (2002) Direct channeling of retinoic acid

between cellular retinoic acid-binding protein II and retinoic

acid receptor sensitizes mammary carcinoma cells to retinoic

acid-induced growth arrest. Mol Cell Biol 22, 2632-2641.

Buzdor AU and Hortobagy CN (1999) Breast cancer: in Pinedo

HM, Londo DL, Chabner BA eds- Cancer chemotherapy and

biological response modifiers. Annual 18, Amsterdam.

Elsevier-Sciences B V, 435-69.

Cassler AB, Johansen JJ and Kendrick NC (1992) Two

dimensional gel analysis of serum apolipoprotein A-1

isoforms. Preliminary analysis suggests altered ratios in

individuals with heart disease. Appl Theor Electrophoresis

3, 41-46.

Charrier JP, Tournel C, Michel C, Comby S, Reynaud CJ,

Passagot J, Alban PD, Chauvard D and Jolivet M (2001)

Differential diagnosis of prostate cancer and benign prostate

hyperplasia using two dimensional electrophoresis.

Electrophoresis 22, 1861-1866.

Chen AC, Guo X, Derguini F and Gudas LJ (1997) Human

breast cancer cells and normal mammary epithelial cells:

retinol metabolism and growth inhibition by the retinol

metabolite 4-oxoretinol. Cancer Res 57, 4642-4651.

Cho WC, Yi PC, Yip V, Thulasiraman V, Ngan RK, Yip TT, Lan

WH, Au JS, Law SC, Cheng WW, Nja VW and Lim CK

(2004) Identification of serum amyloid A protein as a

potentially useful bio-marker to monitor relapse of

nasopharyngeal cancer by serum proteomic profiling. Clin

Cancer Res 10, 45-52.

Choukaite A, Visvikis S, Steihmetz J, Calteau MM, Kabbaj O,

Ferard G, Melais R and Siest G (1989) Two dimensional

electrophoresis of plasma proteins and high density

lipoproteins during inflammation. Electrophoresis 10, 781-

784.

Conrads TP, Zhou M, Petricoin EF, Liotta L and Veenstra TD

(2003) Cancer diagnosis using proteomic patterns. Expert

Rev Mol Diagn 3, 411-420.

Del Piore G, Chatterton R, Lee C, Silver R, Berg L and Lee MJ

(1991) Comparison of mononuclear cell proteins and plasma

proteins before and during parturition by two dimensional

electrophoresis. J Perinat Med 19, 373-377.

Diamandis EP (1996) Prognostic markers in breast cancer. Clin

Lab News 22, 235-9.

Doherty NS, Lillman BI, Reilly K, Swindell AC, Buss JM and

Anderson NI (1998) Analysis of changes in acute-phase

plasma proteins in an acute inflammatory response and in

rheumatoid arthritis using two dimensional gel

electrophoresis. Electrophoresis 19, 355-363.

Eberini I, Agnallo D, Miller I, Villa P, Fratelli M, Ghezzi P,

Gemeiner M, Chau J, Aebersold R and Gianazza E (2000)

Protein of rat serum V: Adjuvant arthritis and its modulation

by non steroidal anti-inflammatory drugs. Electrophoresis

21, 2170-2179.

Familian A, Zwart B, Huisman HG, Rensink I, Roem D, Hordijk

PL, Aarden LA and Harck CE (2001) Chromatin-

independent binding of serum amyloid P Component to

apoptotic cells. J Immunol 167, 647-654.

Goodman DS, (1984) In th retinoids (Sporn MB, Roberts AB and

Goodman DS eds). Academic Press, New York 2, 41-88.

Guo X and Gudas LJ (1998) Metabolism of all-trans retinol in

normal human cell strains and squamous cell carcinoma

(SCC) lines from the oral cavitiy and skin: reduced

esterification of retinol in SCC lines. Cancer Res 58, 166-

176.

Guo X, Nanus DM, Ruiz A, Rando RR, Lorraine DB and Gudas

LJ (2001) Reduced levels of retinyl esters and vitamin A in

human renal cancers. Cancer Res 61, 2774-2781.

Guo X, Ruiz A, Rando RR, Bok D and Gudas LJ (2000)

Esterification of all-trans-retinol in normal human epithelial

cell strains and carcinoma lines from the oral cavity, skin and

breast: reduced expression of lecithin retinol acyltransferase

(LRAT) in the carcinoma lines. Carcinogenesis (Lond) 21,

1925-1933.

Hoemann R, Spoetti C, Crossmann M, Saller B and Mann K

(1993) Molecular heterogeneity of human chorionic

gonadotropin in serum and urine from patients with

trophoblastic tumors. Clin Investig 71, 953-960.

Hondermarck H (2003) Breast cancer: when proteomics

challenges biological complexity. Mol Cell Proteomics,

281-291.

Honk WK and Sporn MB (1997) Recent advances in

chemoprevention of cancer. Science 278, 1073-1077.

Hoogland C, Sanchez JC, Tonella L, Bairoch A, Hochstrasser OF

and Appel RD (1999) The Swiss 2D-PAGE database: what

has changed during the last year. Nucl Acid Res 27, 289-

291.

John H and Purdom IF (1989) Elevated plasma levels of

haptoglobin in duchenne muscular dystrophy: electrophoretic

variants in patients with a severe form of the disease.


Kuhajda FP, Katumuluwa AI and Pasternack GR (1989)

Expression of haptoglobin-related protein and it’s potential

rôle as a tumor antigen. Proc Natl Acad Sci USA 86, 1188-

1192.

Kuppumbatti YS, Bleiweiss IJ, Mandeli JP, Waxman S and

Lopez RMY (2000) Cellular retinol-binding protein

expression and breast cancer. J Natl Cancer Inst 92, 475-

480.

Laemmli UK (1970) Cleavage of structural proteins during the

assembly of the head of bacteriophage T4. Nature 227, 680-

685.

Mangelsdorf DJ, Umesono K and Evans RM (1994) The

retinoids receptors, sporn MB, Roberts AB, Goodman DS

eds. The retinoids: Biology, chemistry and medicine, Raven

Press, 319-350.

Mehta RR, Hart G, Beattie CW and Das Gupta TK (1987)

Significance of plasma retinol binding protein levels in

recurrence of breast tumors in women. Oncology 44 (6) 350-

5

Miller I, Haynes P, Eberini I, Gemeiner M, Aebersold R and

Gianazza E (1999) Proteins of rat serum. III.Gender-related

differences in protein concentration under base line

conditions and upon experimental inflammation as evaluated

by two dimensional electrophoresis. Electrophoresis 20,

836-845.

Mira-Y-Lopez R, Zheng WL, Kuppumbatti YS, Rexer B, Jing Y,

Ong DE (2000) Retinol conversion to retinoic acid is

impaired in breast cancer cell lines relative to normal cells. J

Cell Physiol 185, 302-9.

Negishi Y, Furukawa T, Oka T, Sakamodo M, Hirata T, Okabe

K, Matayoshi K, Akiya K and Soma H (1987) Clinical use of

CA125 and its combination assay with other tumor markers

in patients with ovarian carcinoma. Gynecol Obstet Investig

23, 200-207.

Neuhoff V, Stamm R and Elbl H (1985) Clear background and

highly sensitive protein staining with coomassie blue dyes in

polyacrylamide gels: a systematic analysis. Electrophoresis

6, 427-448.


545

Oakley BR, Kirsch DR and Morris NR (1980) A simplified ultra-

sensitive silver stain for detecting proteins in polyacrylamide

gels. Anal Biochem 105, 361-363.

Ong DE, Newcomer ME and Chytil F (1994) Cellular retinoid-

binding proteins, Sporn MB, Roberts AB, Goodman DS eds.

The retinoids: Biology, chemistry and medicine, Raven

Press, 283-317.

Petricoin LI, Ardekani AM, Hitt BA, Levine PJ, Fusaro VA,

Steinberg SM, Mills GB, Simone C, Fishman DA, Kohn EC

and Liotta LA (2002) Use of proteomic patterns in serum to

identify ovarian cancer. Lancet 359, 572-577.

Ramagli LS and Rodriguez LU (1985) Quantitation of

microgram amounts of proteins in two-dimensional

polyacrylamide gel electrophoresis sample buffer.


Rosales JF, Topping JD, Smith JE, Shankar AH and Ross C

(2000) Relation of serum retinol to acute phase proteins and

malarial morbidity in papua new guinea children. Am J Clin

Nutr 71, 1582-8.

Russell MJ, Thomas BS and Bulbrook RD (1988) A prospective

study of the relationship between serum vitamins A and E

and risk of breast cancer. Br J Cancer 57, 213-5.

Sanchez JC, Appel RD, Golaz O, Pasquali C, Ravier F, Bairoch

A and Hochstrasser DF (1995) inside swiss 2D-PAGE data

base. Electrophoresis 16, 1131-1151.

Schmid HR, Schmiller D, Blum P, Miller M and Vonderschmill

D (1995) Lung tumor cells. A multivariate approach to cell

classification using two dimensional protein paterns.


Van Molle W, Libert C, Fiers W and Brouckaert P (1997) !1-

antitrypsin inhibit TNF-induced but not anti-Fas induced

apoptosis of hepatocytes in mice. J Immunol 159, 3555-

3564.

Vejda S, Posovszky C, Zelzer S, Peter B, Bayer E, Gelbmann D,

Hermann RS and Gerner C (2002) Plasma from cancer

patients featuring a characteristic protein composition

mediated protection against apoptosis. Mol Cell Proteomics,

387-393.

Viellard A, Lonbart C, Borel JP and Jayle MF (1974) In-vitro

influence of haptoglobin and its complex with hemoglobin

on the biosynthesis of collagen. Pathol Biol 22, 741-742.

Wright GL (1974) Two dimensional acrylamide gel

electrophoresis of cancer patient serum proteins. Ann Lab

Sci 4, 281-293.

Wrotnowski C (1998) the future of plasma proteins. Genet Engl

News, 18 14.

Xu S and Venge P (2000) Lipocalins as biochemical markers of

disease. Biochim Biophys Acta 1482, 298-307.

Yoshida Y, Hosokawa K, Dantes A, Kotsuji F, Kleinman HK

and Amsterdam (2001) A Role of laminin in ovarian cancer

tumor growth and metastasis via regulation of mdm2 and

Bcl2 expression. Int J Oncol. 18, 913-921.

Yousef GM and Diamandis FP (2001) The new human tissue

kallikrein gene family: structure, function and association to

disease. Endocr Rev 22, 148-204.


546

gene therapy & molecular biology volume 8 issue b

Documents

usa tel

usa ghosh

usa georgiev

usa barranger

usa crouzet

usa getzenberg

usa davie

usa caiafa