Plant Breeding 115, 367—370 (1996)@ 1996 Blackwell Wissenschafts-Verlag, BerlinISSN 0179-9541

Genetic diversity of Cannabis sativa germplasm based on RAPD markers

V. FAETI', G . MANDOLINO' and P.

'Istituto Sperimentale per le Colture Industriali, Via di Corticella 133,1-40129 Bologna, Italy; ^Corresponding authorWith 2 figures and 2 tables

Received November 21, 1995/Accepted May 2, 1996Communicated by C. Lorenzoni

AbstractRandom amplified polymorphic DNA (RAPD) markers were generatedfrom 13 cultivars and accessions of Cannabis sativa L. Approximately200 fragments generated by 10 primers of arbitrary sequence were usedto assess the level of DNA variation. Statistical analysis was performedusing the Dice coefficient of similarity and principal coordinate analysis.The grouping of the accessions according to the cluster analysis was ingood agreement with their origin and lines with common ancestorswere grouped together. Principal coordinates 1 and 2 revealed a clearseparation of Itahan and Hungarian germplasm and a third group,including a mixture of genotypes coming from different places; the thirdcoordinate separated the Korean group which is probably the mostdivergent germplasm. Variabihty within the two cultivars 'Carmagnola'and 'Fibranova' was also shown, suggesting good possibilities for long-term selection work. RAPD markers provide a powerful tool for theinvestigation of genetic variation in cultivars/accessions of hemp.

Key words: Cannabis sativa — germplasm — polymorphism —RAPD markers — cluster analysis

The centre of origin of the genus Cannabis is believed to be inCentral Asia and since ancient times, cultivation has taken placein Asia and Europe (Purseglove 1974). The genus is also widelypresent in Africa (Haney and Bazzaz 1970), and in post-Col-umbian times it was introduced into America (Dempsey 1975).Taxa within Cannabis are discriminated in different ways: con-tent of psycho-active components (chemotype classification),length ofthe inductive photoperiod (ecotype classification), andutilization (fibre, drug or seed use).

Italy once had a prestigious tradition in the cultivation andprocessing of this plant. A fruitful breeding and selection pro-gramme was developed in the first half of this century anda few well-known cultivars ('Carmagnola', 'Fibranova', 'CS','Eletta Campana') were bred (Crescini 1952). These varietiescombined high fibre production with a low content of A-9-tetrahydrocannabinol (THC), the main psychoactive com-ponent of hemp, and became the most widely grown cultivarsin Europe. The hectarage of hemp cultivated in Italy reached amaximum in 1940 (86.850 ha); since then the cultivation beganto decline and essentially ceased in 1965. The large-scale cul-tivation of cheaper cotton and the development ofthe syntheticfibre industry caused the hemp areas in Italy, as well as all overthe world, to decrease.

The European Community presently has a need to promotealternatives to those crops produced in excess (like cereals); also,cultivations with limited environmental impact are increasinglydesirable. Hemp is able to satisfy these requirements and itcan provide products (fibre and cellulose) in which the EUis deficient, although there is no agreement about permitting

Cannabis cultivation in different countries and, if cultivationshould be allowed, about tolerable cannabinoid levels.

A project aimed at breeding new varieties, in which a relation-ship between cannabinoid content and easily-scorable plantcharacters would allow an indirect recognition of cultivar/accessions with respect to psychoactive potency, has beenstarted (Casarini 1995). Hemp breeding could take advantageof the wide range of globally available hemp germplasm bycarrying out studies of the accessions available to assess thegenetic variability. The development of molecular techniqueshas greatly enhanced plant genetic studies and the RAPD analy-sis is the approach chosen in this work to detect the geneticvariation in hemp accessions.

Materials and MethodsPlant materials: The cultivars and accessions of Cannabis sativa L. usedin this study are hsted in Table 1. Because hemp is a dioic, and henceobligate outbred species, cultivars and accessions are to be consideredas populations; only two of the cultivars examined are monoic (Table1). The material used included two cultivars traditionally bred in Italy('Carmagnola' and 'Fibranova') and cultivars or accessions obtainedfrom other countries. 'Carmagnola' and 'Fibranova' cultivars andAccession 1 were from germplasm of our Institute: the Hungariancultivars/accessions (with the exception of Accession CAN 17/81) werea gift from Professor I. Bocsa (GATE Agricultural Research Institute,

Table 1: Hemp germplasm analysed for RAPDs

Sample

1-56-10

11-151^2021-2425-2728-3031-3233-3435-3738-4041^24344^54647484950-5152-5354

Cultivar/accession

CarmagnolaCarmagnolaFibranovaFibranovaAccession 1Accession 2Accession 2Accession 3Accession 3BialobrzeskieBenikoAccession CAN 23/91Accession CAN21/86Accession CAN21/86Accession CAN 16/78Accession CAN 16/78Accession CAN 17/81Accession CAN 17/81Accession CAN 19/86Kompolti SargaszariiKompolti Sargaszarii

Origin

ItalyItalyItalyItalyItalyHungaryHungaryHungaryHungaryPolandPolandKoreaRomaniaRomaniaCzechoslovakiaCzechoslovakiaHungaryHungaryItalyHungaryHungary

Sex of plant

FemaleMaleFemaleMaleFemaleFemaleMaleFemaleMaleMonoicMonoicFemaleFemaleMaleFemaleMaleFemaleMaleFemaleMaleFemale

us . Copyright Clearance Center Code Statement: 0179-9541/96/1505-0367 $ 11.50/0

368 FAETI, MANDOLINO and RANALLI'

Kompolt, Hungary); the 'Beniko' and 'Bialobrzeskie' cultivars wereobtained from Professor R. Kozlowski (Institute of Natural Fibres,Poznan, Poland); the other accessions were obtained from the germ-plasm bank of IPK (Institut fiir Pflanzengenetik und Kulturpflanzen-forschung) of Gatersleben, Germany. Except for the 'Carmagnola' and'Fibranova' cultivars, of which seeds were sufficiently available, only afew initial seeds were available for other genotypes. Plants were grownin pots in the greenhouse, and leaf samples were harvested from7-week-old individual plants and stored in the freezer (-70°C) untilDNA extraction. Each DNA preparation consisted of a single indi-vidual plant. Ten plants were used for some of the genotypes (cultivarsor accessions). When the number of available seeds or the low ger-mination levels put constraints on the number of individuals, fewerplants were analysed. However, at least two plants were used in thesecases.

DNA isolation and amplification: Total genomic DNA was isolatedaccording to Taylor and Powell (1985), with minor modifications. Afterthe extraction in CTAB buffer (CTAB 2%, Tris 0.1 M pH 8.0, EDTA20 mM, NaCl 1.4 M, PVP40 1 %), two phenohchloroform and one chloro-form extractions were performed; RNAase digestion was also carriedout (10/ig/ml, 30 min at 37°C). After the final ethanol precipitation,DNA was resuspended in 0.1 x TE buffer (Tris 1 mM pH 8.0, EDTA0.1 mM). The approximate concentration of DNA was estimated bycomparison with intact lambda DNA (25-250 ng) in ethidium-bromidestained agarose gels. The volume was adjusted to obtain a 10ng///l finalconcentration, and 5 /il aliquots were prepared and stocked at -20°Cfor amphfication experiments.

A set of 10 random decamer ohgonucleotides purchased from OperonTechnologies Inc. was used for the amphfication of DNA sequences(Table 2). Prehminary experiments with hemp DNA were performed inorder to check the optimal conditions for stability and reproduction ofthe amphfication results. The reaction mixture was composed of 50 ngof DNA, Taq polymerase (Boehringer Mannheim, Germany) IU inits 1 X buffer, MgClj 2.5 mM, dNTPs 0.125mM each, gelatin 50ng//il(Sigma, St. Louis, MO, USA) and 2.5 pmol of the primers, in a finalvolume of 25 ul. The mixture was overlayed with about 100 pX of mineraloil (Sigma). The thermal cycler used was a PTC-100 from MJ Research,programmed to perform a first denaturing step of 3 min at 94°C, fol-lowed by 35 cycles of 2 min at 94°C, 2 min at 38''C (anneahng), 2 minat 72°C (extension). A final period of extension of 10 min at 72°Cfollowed by coohng at 10 C was used.

For gel electrophoresis, a 15|<1 ahquot of each amphfication productwas run on a 2% agarose gel in TAE (Tris-acetate 40 mM pH 8.2, EDTA1 mM)gel, at 5.6 V cm-' for 1.5 h; the gels were ethidium-bromide stainedand photographed under 305 nm UV light.

Data analysis: The occurrence of a specific band of amplified DNA wasscored as 1 and absence as 0 for all prominent bands within a fingerprint.Therefore, a sequence of 'Os' and ' 1 s' was generated for each primer/genotype to form a data matrix. A hierarchical classification analysiswas performed to determine the aggregation of the plants belonging to

the different accessions into various clusters. In order to carry out thisoperation. Dice's (1945) index of similarity was used:

IN J.Kd{J,K) =

where J and K are two different plants, Njfi is the number of sharedfragments, and Nj and N^ are the total number of fragments of plantsJ and K, respectively. This index was calculated for all pair-wise com-parisons. The cophenetic value matrix was compared with the originalmatrix that was clustered, and the degree of relationship between thetwo matrices (r) was 0.916, showing a very good fit for the clusteranalysis performed. Associations between the accessions were deter-mined by principal coordinate analysis (PCA) and plotted on the firstthree axes (Gower 1966). A dendrogram was constructed using theunweighted pair-group method with arithmetical average (LTPGMA).

Both types of multivariate analysis were performed employing theNTSYS (Numerical Taxonomy System, Applied Biostatistics, NewYork, USA) computer program, version 1.7 (Rohlf 1992).

ResultsOptimization of PCR amplification of DNA from Cannabis sativa

In order to determine how the DNA concentration, MgCljconcentration and annealing temperature could influence thereliability and reproducibility of an amplification pattern, anumber of combinations of the parameters was tested. It wasfound that in the range 10-50 ng of DNA, and for an annealingtemperature from 38°C to 44°C, the reproducibility ofthe bandpattern was evident, if MgCls concentration was kept at 2.5 mM(data not shown). In these conditions, the amplification prod-ucts produced by each primer consisted typically of a patternof 5-13 bands. The size range was almost constantly below 3.5kb, the smallest scorable bands were around 0.3 kb.

The number of amplification products produced by eachprimer varied from five (with 0PA15) to 17 (with OPAl andOPG2). All 10 single primers tested revealed polymorphismranging from 90.0% (with 0PA15) to 100%. In all, 205 ampli-fication products were obtained out of which 201 showed poly-morphism; the remaining products were monomorphic acrossboth the cultivars and accessions (Table 2). Figure 1 shows, asan example, the amplification profile generated by primer OPA8among 10 'Carmagnola' and 10 'Fibranova' plants.

PCA and cluster analysis

Principal coordinates 1, 2 and 3 accounted for 25.5%, 9.4%and 5.6% of the total variation, respectively. On the basis ofthis analysis, the 54 hemp samples examined could be partiallysubdivided into three distinct clusters in two dimensions and afurther subdivision (fourth group) in the third dimension. The

Table 2: Details of randomly selec-ted decamer ohgonucleotides

Primer

OPAOlOPA07OPA08OPA 11OP A 12OPA 15OPA 16OPG02OPG04OPG 14

Oligonucleotidesequence 5' to 3'

CAGGCCCTTCGAAACGGGTGGTGACGTAGGCAATCGCCGTTCGGCGATAGTTCCGAACCCAGCCAGCGAAGGCACTGAGGAGCGTGTCTGGGATGAGACC

Average numberof bands

13.511.08.59.5

10.05.09.0

12.08.08.0

Total bands

10-176-165-125-147-132-84-147-175-114-12

Number ofdifferent patterns

53535253451554514951

Percentage ofmonomorphic

bands

8.33.80.00.00.0

10.00.00.00.00.0

Genetic diversity of Cannabis sativa germplasm 369

Fig. 1: Amplification products gen-erated by primer OPA8 on DNA of10 plants of the cultivar 'Car-magnola' (lanes 1-10) and 10 plantsof the cultivar 'Fibranova' (lanes11-20)

first cluster (I) contained 20 samples (all belonging to 'Car-magnola' and 'Fibranova' cultivars); a second cluster (II) con-tained samples 21 to 34, including the accessions 1, 2, and 3(from Italy and Hungary); the third cluster (III) includedsamples 35 to 40 and 43 to 54 belonging to the 'Bielobrzeskie'and 'Beniko' cultivars (from Poland), accession CAN21/86(from Romania), accession CAN 16/78 (from former Czecho-slovakia), accession CAN 17/81 and thecv. Kompolti Sargaszarii(from Hungary) and accession CAN 19/86 (from Italy). Thefourth cluster (IV) contained samples 41 and 42 belonging toaccession CAN23/91 from Korea.

A dendrogram was constructed based on the similarity matrixusing the UPGMA method (Fig. 2). The phenetic analysis sep-arated the accessions into the same four major groups as PCA,but provided additional information concerning the relation-ships between the accessions, although in many cases only fewplants were available per accession. Within each group, maleand female genotypes tended to form two subgroups proximalto each other, although they did not form perfectly distinctclusters.

DiscussionThis is the first report on C. sativa which deals with the molec-ular basis of genetic diversity using RAPD markers, widely usedin several plant species (Williams et al. 1993). We are aware ofno study of the polymorphism at the DNA level within theFamily Cannabaceae, with the single exception of a study inwhich a limited polymorphism was demonstrated betweencpDNAs of two different species of Humulus {lupulus and japon-icus, Pillay and Kenny 1994). The present study showed thatmost of the cultivars/accessions could be clearly differentiatedby the single-primer RAPD assay. The average number ofbands produced by each primer ranged from 5 to 13; it wasnoted that the RAPD profiles obtained were, in most cases,highly reproducible and easily scorable despite the number ofbands present. The level of polymorphism observed was excep-tionally high: of the 205 total markers scored in the 54 plants,only four (i.e. about 2%) were not informative, monomorphicacross all the individual plants of the cultivars and accessionsstudied. This is definitively an above-average polymorphismlevel, different from that reported in ryegrass (about 10%.Sweeney and Danneberger 1994), but more similar to Pennisetummiliaceum, where 73% ofthe markers were polymorphic (M'Ribu

"0745 0.60 0.75

I I

I I I

Fig. 2: Dendrogram of 54 samples derived from 13 cultivars/accessionsbased on the UPGMA method using the Dice (1945) similarity matrix.The numbers refer to the plants listed in Table 1

and Hilu 1994). Within the 'Carmagnola' and 'Fibranova' poolof plants, however, a total of 35 fragments were monomorphicfrom 177 scored, i.e. about 20%. suggesting a more limitedpolymorphism within a germplasm subjected to selection;'Carmagnola' and 'Fibranova' plants tended to form a single

370 FAETI, MANDOLINO and RANALLI'

cluster, suggesting a possible origin from common plants. Inthe same group of plants, male and female individuals tendedto form two separate clusters (see Fig. 2), with only one excep-tion ofa 'Fibranova' female plant clustering with 'Carmagnola'and 'Fibranova' males. Apparently, the similarities withinfemale and male groups in the dioic cultivars and accessionsare superior to those within the same cultivar; it should bepointed out that the male and female plants were randomlychosen from a field-grown population, and that each of themderived from an individual seed. The phenomenon of clusteringof male and female plants in separate groups has been subjectedto further investigation (manuscript in preparation). In theother groups, however, these sex-specific clusters were not veryevident, but in most cases only a few plants per accession wereavailable. The variability within cultivars/accessions is whatwe might anticipate from a dioic and obligate outbred organism.Since the 1960s, hemp culture has ceased in Italy, and thebreeding activities have been abandoned. The genetic material(especially 'Carmagnola' and 'Fibranova') was merely main-tained and during multiplication no conscious selection tookplace.

Large genetic differences were apparent between accessionsand this approach allowed us to classify the germplasm intogroups refiecting the geographical origin of materials. There isno overlapping between the genotypes and clear-cut dis-crimination is apparently possible, noting, however, that insome cases only a limited number of individuals were examined.The diversity of gene pools due to their geographical origin isconsistent with the findings of de Meijer et al. (1992) with regardto cannabinoid content, and by de Meijer and van Soest (1992)with regard to morphological and physiological traits. Giventhe extremely high level of polymorphism revealed in this study,it is clear that for proper classification of any unknownaccession in the correct group, as high a number of individualplants as possible should be examined; in this study this has notalways been possible but, despite this, the results are consistentwith the different origins of the material tested. The obser-vations in this study, based on RAPD analysis, are also inagreement with agronomic trait scoring, such as time of fiower-ing, stature and the size of leaves recorded in the field (data notreported). Three gene pools have been identified: one is locatedin Italy, another in Hungary and the last outside Europe; afourth group includes a mixture of accessions probably derivedfrom the original European sites and successively spread inPoland, former Czechoslovakia and Romania. This refiects theorigin of the crop believed to be an age-old native of CentralAsia and the subsequent spreading to Mediterranean countries(Italy and Greece) and countries of Eastern and Central Europe(initially Hungary; Schultes 1970).

The RAPD method appears to be an effective approach inresolving genetic variations in Cannabis and in this work it hasshown its utihty in grouping germplasm into geographical races,and possibly even in separating it into groups based on sexphenotype. As there are no breeding barriers within the genusCannabis (Small 1979), prospects for the breeding of improvedcultivars can also be based on the diversity indicated by molec-ular markers not yet utilized in this species.

ReferencesCasarini, B., 1995: Introduzione di marcatori fenotipici e miglioramento

in canapa comune. Agricoltura Ricerca 156, 17—32.Crescini, F., 1952: Piante tessih. In: Genetica Vegetale, 465—490.

REDA, Rome.de Meijer, E. P. M., and L. J. M. van Soest, 1992: The CPRO Cannabis

germplasm collection. Euphytica 62, 201—211., H. J. van der Kamp, and F. A. van Eeuvijk, 1992: Charac-

terisation of Cannabis accessions with regard to cannabinoid contentin relation to other plant characters. Euphytica 62, 187—200.

Dempsey, J. M., 1975: Fiber Crops, 46—89. University of Florida Press,Gamesville, FL.

Dice, J. R., 1945: Measures of the amount of ecologic associationbetween species. Ecology 26, 297—302.

Gower, J. C , 1966: Some distance properties of latent root and vectormethods used in multivariate analysis. Biometrika 53, 325—338.

Haney, A., and F. A. Bazzaz, 1970: Some ecological implications of thedistribution of hemp {Cannabis sativa L.) in the United States ofAmerica. In: C. R. B. Joyce, and S. H. Curry (eds). The Botany andChemistry of Cannabis, 39—49. J. and A. Churchill, London.

M'Ribu, H. K., and K. W. Hilu, 1994: Detection of interspecific andintraspecific variation in Panicum millets through random amplifiedpolymorphic DNA. Theor. Appl. Genet. 88, 412—416.

Pillay, M., and S. T. Kenny, 1994: Chloroplast DNA differencesbetween cultivated hop, Humulus lupulus and the related species H.japonicus. Theor. Appl. Genet. 89, 372—378.

Purseglove, J. W., 1974: Tropical Crops. Dicotyledons, Vol. 1, 40—44.Longman, London.

Rohlf, F. J., 1992: NTSYS-pc. Numerical Taxonomy and MultivariateAnalysis System: Version 1.70. Applied Biostatistics, New York.

Schultes, R. E., 1970: Random thoughts and queries on the botany ofCannabis. In: C. R. B. Joyce, and S. H. Curry (eds). The Botany andChemistry of Cannabis, 49—55. J. and A. Churchill, London.

Small, E., 1979: The species problem in Cannabis. In: Science andSemantics, Vol. 1, 218. Science Corpus, Toronto.

Sweeney, P. M., and T. K. Danneberger, 1994: Random amphfiedpolymorphic DNA in perennial ryegrass: a comparison of bulk sam-ples vs. individuals. Hort Sci. 29, 624—626.

Taylor, B., and A. Powell, 1985: Isolation of plant DNA and RNA.Focus 4, 4—6.

Williams, J. G. K., M. K. Hafeney, J. A. Rafalski, and S. V. Tingey,1993: Genetic analysis using random amplified polymorphic DNAmarkers. Method Enzymol. 218, 704—740.