Reprinted From The Journal of The American Medical AssociationNovember 25, 1968, Vol. 206, pp. 1973-1977

Copyright 1968, by American Medical Association

Lasker Award

Genetic MemoryMarshall Nivenberg, PhD

enetic memory resides in specific molecules ofdeoxyribonucleic acid. The DNA alphabet

consists of four letters, the bases, A, T, G, and C.The sequence of letters in a nucleic acid messagecorresponds to a sequence of the 20 amino acidspecies in protein. Two molecules of DNA interactwith one another by hydrogen bonding betweenbases on opposite chains. As proposed by Watsonand Crick,☂ adenine pairs with thymine, and guaninewith cytosine. Information is retrieved by tran-scribing the DNA message in the form of ribonu-cleic acid and then translating the RNA messageinto protein. Triplets are translated sequentially,from left to right.

The information encoded in a nucleic acid tem-plate enables the reading mechanism to select onefrom manyspecies of molecules, to define the posi-tion of the molecule relative to the previous mole-cule selected, and to define the approximate timeof the event relative to previous events. Hence thenucleic acid functions both as a template for othermolecules and as a biological clock.

Although the genetic information is encoded inthe form of a one-dimensional string, the polypep-tide products fold in a specific manner predeter-mined by the amino acid sequence. In effect, acomplex, three-dimensional object is created byfirst fabricating a linear string of letters that foldsuponitself, in a fairly specific manner. Probably theprinciple of unidimensional sculpturing could beused by man for the construction of certain kindsof objects.

Often, one molecule of messenger RNA (mRNA)contains the information for many molecules ofprotein, so the RNA message mustalso contain in-formation for the initiation and termination of thepolypeptide chain. The translation must be ini-tiated properly since selection of the first word alsophases the translation of subsequent words. Atleast three enzymes are required for the initiationprocess, three additional enzymes for the forma-tion of the peptide bond and movementof the ribo-some along the message, and one or more enzymesfor the termination of protein synthesis. In addi-

From the National Heart Institute, Bethesda, Md.Presented as a 1968 Albert Lasker Basic Research Award

Lecture at the New York University Medical Center. NewYork, Nov 26, 1968.

Reprint requests to National Heart Institute, Bethesda, Md20014.

JAMA, Nov 25, 1968 © Vol 206, No 9

tion, specific enzymes are required for the synthesisand repair of DNA, for the synthesis of mRNA,aminoacyl-transfer RNA (AA-tRNA), and for themodification of tRNA and ribosomal RNA. Theprocess of protein synthesis, illustrated diagram-matically and in highly abbreviated form, is shownin Fig 1.

The chromosome of a relatively primative or-ganism, such as Escherichia coli, consists ofapproximately 3 million base pairs. Sufficient infor-mation is present to determine the sequenceof 1 mil-lion amino acids in protein which is approximatelythe amount required for 3,000 species of protein.The human genomeis 1,000 to 2,000 times largerthan that of E coli, ie, information for the synthesisof 3 to 6 X 10° species of protein could be present.However, multiple copies of essentially the samegene frequently are stored; hence much informationprobably is redundant.The precise number of enzymes required for the

storage, retrieval, and transmission of genetic in-formation has not been determined. Perhaps 200species of protein would suffice. However, as muchas 25% of the total protein synthesized by rapidlygrowing FE coli is utilized for the construction ofnew ribosomes.

The Rate of Reading.♥The average E coli ribo-some can read approximately 1,000 mRNAtripletsper minute. The reading rate therefore is quite slowcompared to a man-made computer, However, pro-tein is synthesized simultaneously at many siteswithin the cell. Escherichia coli with a generationtime of 25 minutes contains approximately 15,000ribosomes per chromosome. Hence, 15 million aminoacids may be incorporated into protein per minuteper chromosome. The RNA message usually is cov-ered by a train of ribosomes; hence one molecule ofmRNA is translated simultaneously at differentsites. A single molecule of mRNA mayserve there-fore as a template for the synthesis of many mole-cules of protein. It seems likely though, that somespecies of mRNAare destroyed earlier than others.

Somegenesare transcribed more frequently thanothers. It is clear that retrieval of genetic informa-tion often is regulated selectively. Some regions ofE coli DNA may be transcribed 1,000 times pergeneration; others may be transcribed only one ortwo times per generation.

Deciphering the Genetic Language.♥The experi-mental approaches that eventually led to the de-ciphering of the genetic code came from the study ofin vitro synthesis of protein. The demonstrationthat mRNAis required for the in vitro synthesis ofprotein and that synthetic polynucleotides suchas poly U serve as templates for the synthesis ofpolyphenylalanine provided a means of exploringmany aspects of the code and the translationprocess.☝ Polynucleotides composed of differentcombinations of bases in random sequence were syn-thesized with the aid of polynucleotide phosphory-lase, discovered by Grunberg-Manago and Ochoa.°Synthetic mRNA preparations then were used to

Genetic Memory♥Nirenberg 1973

SATGCGAATGATCGAATGTCTGTTGTGCGCT...3

aa.JS TACGCTTACTAGCTTACAGACAACACGCGA,..5

2 tORFahy

aaaasm (WETISULE)aisan Panaynn

StS5 a}imeRsDan io aie o

a:AA ACTIVATION

1. The retrieval of genetic information is illustrated ina condensed and diagrammatic form.

direct cell-free protein synthesis. The base contentof the mRNAcan be correlated with the aminoacidcontent of newly synthesized protein. In this man-ner the base compositions of 53 RNA codons wereassigned to amino acids.*☝ It was also found thatthree sequential bases in mRNA correspond to oneamino acid in protein, that AA-tRNA is requiredfor the translation of mRNA,* and that codons forthe same amino acid sometimes require differentspecies of AA-tRNA for their translation.☝ Analysisof the coat protein of mutant strains of tobaccomosaic virus provided evidence that triplets inmRNAare translated in a nonoverlapping fashion,because the replacement of one base by another inmRNA usually results in only one amino acid re-placement in protein.*

Alternate codons for the same amino acid wereshown in most cases to contain two bases in com-mon. Common bases were assumed to occupy thesamebase position of synonym triplets.Base Sequence of Codons.♥Codon base se-

quences were established in several ways: by di-recting in vitro protein synthesis with polyribonu-cleotides containing repeating doublets, triplets, ortetramers of known sequence as described by Kho-rana in the accompanying communication, and bystimulating the binding of aminoacyl-tRNA to rib-osomes with trinucleotides of known sequence.☂Since aminoacyl-tRNA binds to ribosomes prior topeptide bond formation, the process of codon recog-nition can be studied without peptide bond synthesis.A simple method for determining '*C-aminoacy]l-tRNA boundto ribosomes was devised that dependsupontheselective retention of '*C-aminoacyl-tRNAbound to ribosomes by disks of cellulose nitrate;unbound '*C-aminoacyl-tRNAis removed by wash-ing.At the time that the trinucleotide template ap-

proach to codon sequence was devised, most of the64 trinucleotides had not been prepared. Elegant

1974 JAMA, Nov 25, 1968 ® Vol 206, No 9

Table 1.♥The Genetic Code*

UUU UCU UAU UGU

PHE TYR cYsS

uuc ucc UAC uGcc

SER

UUA UCA UAA TERM UGA TERM

LEU

UUG UCG UAG TERM UGG TRP

cuu ccu CAU CGU

HIS

cuc ccc CAC cGCc

LEU PRO ARG

CUA CCA CAA CGA

GLN

CUG CCG CAG CGG

AUU ACU AAU AGU

ASN SER

AUC ILE ACC AAC AGC

THR

AUA ACA AAA AGA

LYS ARG

MET, AUG MET ACG AAG AGG

GUU GCU GAU GGU

ASP

GUC Gcc GAC GGc

VAL ALA GLY

GUA GCA GAA GGA

GLU

MET, GUG GCG GAG GGG

*Nucleotide sequences of RNA codons were determined by stimu-lating binding of E coli AA-tRNA to E coli ribosomes with trinucleotidetemplates. F-Met corresponds to N-formy!-Met-tRNA, the initiator ofprotein synthesis. TERM corresponds to terminator codons.

chemical methods for oligoribonucleotide synthesis,devised by Khorana and his colleagues, are de-scribed in the accompanying communication. Wehave employed enzymatic methodsfor oligoribonu-cleotide synthesis. Leder and co-workers showedthat primer-dependent polynucleotide phosphory-lase, in the presence of a dinucleoside monophos-phate primer and nucleoside diphosphate, catalyzes

the synthesis of oligonucleotides of low chainjength☂®; a similar method was also reported byThach and Doty.☂* Another enzymatic method foroligonucleotide synthesis, reported by Bernfield,'*''☂is based upon the demonstration by Heppelet al☂*that RNase A catalyzes the synthesis of oligonu-cleotides from pyrimidine-2☂,3☂-cyclic phosphatemoieties in the presence of mononucleotideor olig-onucleotide acceptors.The 64 trinucleotides were synthesized and as-

sayed for template specificity in stimulating bind-ing of EF coli aminoacyl-tRNA to ribosomes.☂°☂* Asummary of the code is shown in Table 1. Almostall triplets were found to correspond to aminoacids.In most cases, synonym codons differ only in thebase occupying the third position of the tyriplet.Thus synonym codonsare systematically related toone another. Only four unique patterns of degenera-cy were found, each pattern determined by thebases that occupy the third positions of synonymtriplets. Patterns of alternate third bases are as fol-lows:

() G@) U=C(3) A=G(4) U=CrHA

Genetic Memory♥Nirenberg

A fifth pattern, U = C = A =G, was foundalso,but may be formed by combining two or moresimpler patterns such as [(U =C) + (A =G)] or

[((U =C=A) + (G)}.Codons specifying the initiation of protein syn-

thesis differ in that alternate bases occupythefirstrather than the third position of the codons. Forexample, N-formyl-Met-tRNA responds to AUGand GUG. Three triplets, UAA, UAG, and UGA,serve as terminator codons. Hence the degeneracypattern again is unusual (discussed under Punctua-tion).

One consequence of logical degeneracy is thatmutations resulting from the replacement of onebase pair in DNAby anotheroften do not result inthe replacement of one amino acid by another inprotein. Hence, many mutations are ☜silent.☂? Thecode appears to be arranged so that the effects oferror often are minimized. Amino acid replace-ments in protein that result from an alteration ofone base pertriplet can be derived from Table 1 bymoving horizontally or vertically from the aminoacid in question, but not diagonally.

Punctuation

Codon Positinn.♥Each triplet can occur in threestructural forms: as a 5☂-terminal-, 3'-terminal-, orinternal-codon. Substituents attached to terminal orinternal ribose hydroxyl groups can influence thetemplate properties of codons profoundly. Relativetemplate activities of oligo U preparations, at limit-ing oligonucleotide concentrations, are as follows:p-5'-UpUpU > UpUpU > CH;0-p-5'UpUp >UpUpU-3☂-p > UpUpU-3☂-p-OCH; > UpUpU-2☂,-3☂-cyclic phosphate. Trimers with (2☂-5☂) phospho-diester linkages, (2☂-5')-UpUpU and (2☂-5☂)-ApApA, do not serve as templates for phenylala-nine- or lysine-tRNA, respectively. The relativetemplate efficiencies of oligo A preparations are asfollows: p-5'-ApApA > ApApA > ApApA-3☂-p> ApApA-2☂-p.☝☝

Many enzymeshave been described that catalyzethe transfer of molecules to or from terminal hy-droxyl groups of nucleic acids. It is possible there-fore that modifications of terminal hydroxyl groupssometimesregulate the reading of RNA or DNA.

Initiation.♥-Two species of methionine-tRNA arefound in E coli; one species, Met-tRNA,is convert-ed enzymatically to N-formyl-Met-tRNA,,☂® andfunctions as an initiator of protein synthesis in ex-tracts of EF coli in response to the codons AUG orGUG;the other species, Met-tRNA,,, does not ac-cept formyl groups and responds only to AUG.'*:°

Translation of mRNA is initiated near the 5☂-terminus of the RNA and proceeds three bases ata time toward the 3☂-terminus. Thefirst amino acidto be incorporated into protein is the N-terminalaminoacid; the C-terminal amino acid is the last tobe incorporated.At least three nondialyzable factors are required

for the initiation of protein synthesis.☝**° Howeverthe reactions have not been clarified fully. It seems

JAMA, Nov 25, 1968 ® Vol 206, No 9

probable that one factor, the C protein, is requiredfor the attachment of the 30S ribosomal subunit tothe 5☂-terminus of the nascent chain of mRNAprior to the detachment of the mRNA from theDNAtemplate.☝? Anotherfactoris required for bind-ing of N-formyl-methionyl-tRNA to the 30S ribo-somal subunit in response to AUG or GUG.

Termination.♥Results obtained by Stretton andco-workers☝ and by Garen®* demonstrate that UAA,UAG, and UGAare terminator-codons. Capecchihas reported that a protein, termed therelease fac-tor, is required for terminator-codon dependentrelease of polypeptides from ribosomes.☝°

Terminal events in protein synthesis have recent-ly been studied with trinucleotide codons.☝ Initiatorand terminator trinucleotides sequentially stimu-late N-formyl-methiony]-tRNA binding to ribo-somes and therelease of free N-formyl-methioninefrom the ribosomal-intermediate. The release factorand a terminator trinucleotide is required for thisreaction. The release factor has been fractionatedinto two components; R1, which corresponds to theterminator codons UAA and UAG; and R2, whichcorresponds to UAA and UGA.☝ Thespecificity ofR therefore is related to the codon. These resultssuggest that terminator codons may be recognizedby release factors. However, the mechanism of ter-mination remains to be clarified, and it is certainlypossible that terminator-codons are recognized bycomponents that have not been detected thus far.

Mechanism of Codon Recognition

Cells often contain multiple species of tRNA forthe same aminoacid. Soon after the code was foundto be degenerate, the specificity of separate speciesof tRNA'晳for codons was examined. Randomlyordered poly UG and poly UC preparations aretemplates for different species of Leu-tRNA.☝ Thusalternate codons for the same amino acid some-times are recognized by different species of tRNA.Whenbase sequences of synonym codons were es-tablished, it became abundantly clear that synonymcodons are logically related to one another. Sinceonly a few general degeneracy patterns were found,each pattern was thought to represent a generalmechanism for codon recognition.

Evidence that one molecule of AA-tRNA can re-spond to two kinds of codons was obtained by show-ing that >99% of the available molecules of ☁*C-Phe-tRNA bind to ribosomes in response to polyU, and >65% of the molecules also bind in re-sponse to UUC.*® Hence >65% of the Phe-tRNAmolecules respond both to UUU and UUC.Addi-tional evidence was obtained by fractionating AA-tRNA and determining the responses of the sep-arated fractions of **C-AA-tRNA to trinucleotidecodons.

Results obtained thus far in our laboratory withpurified fractions of AA-tRNA from E coli, yeast,and guinea pig liver are summarized in Fig2. It is clear that one species of tRNA may recog-

Genetic Memory♥Nirenberg 1975

Table 2.♥Alternate Base Pairing晳

tRNA mRNAAnticodon Codon

U AG

c G

A U

G cU

I UcA

Alternate base pairing. The base in a tRNAanticodon shown in the left-hand columnforms antiparallel hydrogen bonds with thebase(s) shown in the right hand column,which usually occupy the third position ofalternate mRNA codons. Relationships are☜wobble☂☂ hydrogen bonds suggested byCrick,30

nize 1, 2 or 3 synonym cod-ons that differ only in the baseoccupying the third position ofthe codon. Five unique patternsof degeneracy were found, eachpattern determined by alternatethird bases of synonym tripletsrecognized by a tRNA species.Patterns of alternate third basesof synonym codonsets are asfol-lows:

(1)(2)(3)(4)(5) A

Gran

CcGCc

G

Crick proposed a mechanism that would enable abase in the tRNA anticodon to pair with alternatebases occupying the third position of synonymmRNA codons.*° By changing positions slightly,that is, by wobbling, bases in the appropriate posi-tion of the tRNA anticodon form alternate pairswith bases occupying the third position of synonymmRNA codons. Antiparallel Watson-Crick hydro-gen bonds form between the first and second basesof the mRNA codon and corresponding bases in thetRNA anticodon and wobble hydrogen bonds formbetween bases occupying the third positions ofsynonym mRNA codons and a corresponding basein the tRNA anticodon as shown in Table2. Hence,U in a tRNA anticodon pairs with A or G in thethird position of synonym mRNA codons; C pairswith G; G pairs with C or U; and I pairs with U,C, or A. Additional evidence supporting this mech-anism of codon recognition stems from the elucida-tion of base sequences of tRNA anticodons. Thedata are fully consistent with wobble base pairing.

In summary, degeneracy patterns for amino acidsobserved with unfractionated AA-tRNA often re-sult from recognition of several codons by a singleSpecies of tRNA and from the presence of multiplespecies of tRNA for the same amino acid thatrespondto different sets of codons.

Universality

Although the results of many studies indicatethat the genetic codeis largely universal, the fidelity

AU

1976 JAMA, Nov 25, 1968 @ Vol 206, No 9

corresponds to MetRelease factors 1and UGA, respecti

2. Responses of purified AA-tRNA fractions to trinucleotide codons. Joined sym-bols adjacent to codons represent synonym codonsrecognized by a purified AA-tRNAfraction from @ E coli, A yeast, and JJ guinea pig liver. The number between sym-bols represents the number of redundant peaks of AA-tRNA found responding tothat set of codons. The open symbols represent ambiguous AA-tRNA responses;MET; corresponds to N-formyl-Met-tRNA, theinitiator of protein synthesis; MET,,

☜tRNA; TERM corresponds to termination of protein synthesis.and 2, rather than RNA, correspond to UAA and UAG, or UAAvely (a signifies uncertain).

of translation can be altered in vivo and in vitroby altering components or conditions required forprotein synthesis. The extent of such alterations wasexamined by studying thefine structure of the codewith tRNAfrom different organisms. Almost identi-cal translations of nucleotide sequences of aminoacids were found with bacterial, amphibian, andmammalian aminoacyl-tRNA. However, E colitRNAdid not respond detectably to certain codons.Therefore aminoacyl-tRNA preparations were frac-tionated by column chromatography and responsesof tRNA fractions to trinucleotide codons weredetermined.** A summary of the results is shownin Fig 2.Many ☜universal☝ species of aminoacyl-tRNA

were found, however seven species of mammaliantRNA were not detected with E coli preparations;conversely, five species of tRNA from E coli werenot found with mammalian preparations. The re-sults also suggest that some organismscontain littleor no aminoacyl-tRNA for certain codons (AUA,AGA,or AGG).The remarkable similarity in codon base se-

quences recognized by bacterial, amphibian, andmammalian AA-tRNA suggests that most, perhapsall, forms of life on this planet use essentially thesame genetic language. The code probably evolvedmore than 5 X 10° years ago.

It is possible that some species-dependent dif-ferences in the codon recognition apparatus serve asregulators of protein synthesis. The possibility thatembryonic differentiation may be dependent uponchanges in codon recognition remains to be ex-plored. At the present time, the biological conse-

Genetic Memory♥Nirenberg

quences of a modifiable translation apparatus arelargely unknown.

Fidelity.♥Since multiple species of tRNA for thesame amino acid often recognize separate sets ofcodons, the synthesis of two proteins with similaramino acid compositions may require different spe-cies of tRNA. Some codons probably occur morefrequently in mRNA than others for the sameamino acid.Most codons probably are translated withlittle

error (0.1% to 0.01%). However, with some codonsthe level of error may be as high as 50%. Therefore,the accuracy of codon translation can vary at least5,000-fold. Errors usually are specific ones, be-cause two out of three bases per codon often aretranslated correctly. The code seems to be ar-ranged so that the consequences of error often areminimized.The biological significance of a flexible, easily

modified codon translation apparatus is not known.One intriguing possibility is that the codon recog-nition apparatus is modified in an orderly, predicta-ble way at certain times during cell growth anddifferentiation and that such modifications selec-tively regulate the kinds and amounts of proteins

synthesized. In accord with this hypothesis, manyfactors have been found that influence the rate andthe accuracy of protein synthesis in vitro. In addi-tion, one may also consider the structural hetero-geneity of components required for protein synthe-sis. For example, it seems probable that tRNAmay be extensively modified by enzymes after thetRNA polynucleotide chain has been synthesized.Since tRNA contains many trace bases, a spectrumof intermediates probably exists for each species oftRNA. Whether such reactions play a role in regu-lating gene expression remains to be determined.Oneintriguing possibility is that infection of a cellby a virus may result in the production of a factorthat modifies tRNA and,in consequence, alters therate of synthesis of mRNAorprotein.

It is clear that the translation apparatus of thecell will accept and follow in robot-like fashion anyinstructions written in the appropriate molecularlanguage. Since the language has been deciphered,the informational properties of the genetic messagecan be defined in terms of molecular structure. Itseems probable that synthetic messages will even-tually be used to program cells and their descen-dants.

References

1. Watson, J.D., and Crick, F.H.C.: Molecular Structure ofNucleic Acids: A Structure for Deoxyribose Nucleic Acid.Nature 171:737-738 (April 25) 1953.

2. Nirenberg, M.W., and Matthaei, J.H.: The Dependence ofCell-Free Protein Synthesis in E coli Upon Naturally Occurringor Synthetic Polyribonucleotides, Proc Nat Acad Sci USA 47:1588-1602 (Oct 15) 1961.

3. Grunberg-Manago, M.: Ortiz, P.J.; and Ochoa, S.: EnzymicSynthesis of Polynucleoctides, Biochim Biophys Acta 20:269-285,1956.

4. Speyer, J.F.. et al: Synthetic Polynucleotides and AminoAcid Code, Cold Spring Harbor Symp Quant Biol 28:559-567, 1963.

5. Nirenberg, M.W., et al: On Coding of Genetic Informatien,Cold Spring Harbor Symp Quant Biol 28:549-557, 1963.

6. Nirenberg, M.W.: Matthaei, J.H.; and Jones, O.W.: An In-termediate in the Biosynthesis of Polyphenylalanine Directedby Synthetic Template RNA, Proc Nat Acad Sci USA 48:104-109 (Jan 15) 1962.

7. Weisblum, B.; Benzer, S.; and Holley, R.W.: A PhysicalBasis for Degeneracy in the Amino Acid Code, Proc Nat AcadSet USA 48:1449-1454 (Aug) 1962.

8. Wittmann, H.G., and Wittmann-Liebold, B.: Tobacco MosaicVirus Mutants and the Genetic Coding Preblem, Cold SpringHarbor Symp Quant Biol 28:589-595, 1963.

9. Nirenberg, M.W., and Leder, P.: RNA Codewords and Pro-tein Synthesis: The Effect of Trinucleotides Upon the Bindingof sRNA to Ribosomes, Science 145:1399-1407 (Sept 25) 1964.10. Leder, P.; Singer, M.F.; and Brimacombe, R.L.C.: Syn-

thesis of Trinucleoside Diphosphates With Polynucleotide Phos-phorylase, Biochemistry 4:1561-1567 (Aug) 1965.

ll. Thach, R.E., and Doty, P.: Enzymatic Synthesis of Tri-and Tetranucleotides of Defined Sequence, Science 148:632-634(April 30) 1965.

12. Bernfield, M.R.: Ribonuclease and OligoribonucleotideSynthesis: I. Synthetic Activity of Bovine Pancreatic Ribo-nuclease Derivatives, J Biol Chem 240:4753-4762 (Dec) 1965.

13. Bernfield, M.: Ribonuclease and Oligoribonucleotide Syn-thesis: II. Synthesis of Oligonucleotides of Specific Sequence,J Biol Chem 241:2014-2023 (May 10) 1966.

14. Heppel, L.A.; Whitfield, P.R.; and Markham, R.: BiochemJ 60:8, 1955.

15. Nirenberg, M. et al: RNA Codewords and Protein Syn-thesis: VII. On the General Nature of the RNA Code, Proce NatAcad Sct USA 53:1161-1168 (May) 1965.16. Sél, D., et al: Studies on Polynucleotides: XLIX. Stimula-tion of the Binding of Aminoacyl-sRNA☂s to Ribosomes byRibotrinucleotides and a Survey of Codon Assignments for 20

JAMA, Nov 25, 1968 © Vol 206, No 9

Amino Acids, Proc Nat Acad Sci USA 54:1378-1385 (Nov) 1965.17. Rottman, F., and Nirenberg, M.: RNA Codons and Pro-

tein Synthesis: XI. Template Activity of Modified RNA CodonsJ Molec Biol 21:555-570 (Nov) 1966.

18. Marcker, K., and Sanger, F-.: N-Formyl-methiony]-S-RNA, J Molec Biol 8:835-840 (June) 1964.

19. Clark, B.F.C., and Marcker, K.A.: The Role of N-Formyl-methionyl-sRNA in Protein Biosynthesis, J Molec Biol 17:394-406 (June) 1966.

20. Kellogg, D.A., et al: RNA Codons and Protein Synthesis:IX. Synonym Codon Recognition by Multiple Species of Valine-,Alanine-, and Methionine-SRNA, Proc Nat Acad Sci USA 55:912-919 (April) 1966.

21. Anderson, J.S., et al: GTP-Stimulated Binding of Initia-tor-tRNA to Ribosomes Directed by /2 Bacteriophage RNA,Nature 216:1072-1076 (Dec 16) 1967.

22. Nomura, M., and Lowry, C.V.: Phage F2 RNA-DirectedBinding of Formylmethionyl-TRNA to Ribosomes and theRole of 30S Ribosomal Subunits in Initiation of Protein Syn-thesis, Proc Nat Acad Sci USA 58:946-953 (Sept) 1967.

23. Iwasaki, K., et al: Translation of the Genetic Message:VII. Role of Initiation Factors in Formation of the Chain Ini-tiation Complex With Escherichia coli Ribosomes, Arch Bio-chem 125:542-547 (May) 1968.

24. Stretton, A.O.W.; Kaplan, S.; and Brenner, S.: NonsenseCodons, Cold Spring Harbor Symp Quant Biol 31:173-179, 1966.

25. Garen, A.: Sense and Nonsense in Genetic Code, Science160:149-159 (April 12) 1968.

26. Capecchi, M.R.: Polypeptide Chain Determination in Vi-tro: Isolation of a Release Factor, Proce Nat Acad Sci USA 58:1144-1159 (Sept) 1967.

27. Caskey, C.T., et al: Sequential Translation of Trinucleo-tide Codons for the Initiation and Termination of Protein Syn-thesis, Science 162:135-138 (Oct 4) 1968.

28. Scolnick, E., et al: Release Factors Differing in Specificityfor Terminator Codons, Proce Nat Acad Sci USA, to bepublished.

29. Bernfield, M.R., and Nirenberg, M.W.: RNA Codewordsand Protein Synthesis: The Nucleotide Sequences of MultipleCodewords for Phenylalanine, Serine, Leucine, and Proline,Science 147:479-484 (Jan 29) 1965.

80. Crick, F.H.C.: Codon♥Anticodon Pairing: The WobbleHypothesis, J Molec Biol 19:548-555 (Aug) 1966.

31. Caskey, C.; Beaudet, A.; and Nirenberg, M.: RNA Codonsand Protein Synthesis: 15. Dissimilar Responses of Mammalianand Bacterial Transfer RNA Fractions to mRNA Codons, JMolec Biol, to be published.

Genetic Memory♥Nirenberg 1977