GenomesGenomes

Definition Complete set of instructions for making an Complete set of instructions for making an

organismorganism• master blueprints for all enzymes, cellular structures master blueprints for all enzymes, cellular structures

& activities & activities An organism‘s complete set of DNAAn organism‘s complete set of DNA All the DNA contained in the cell of an organismAll the DNA contained in the cell of an organism The collection of DNA that comprises an

organism. Total genetic information carried by a single set Total genetic information carried by a single set

of chromosomes in a haploid nucleusof chromosomes in a haploid nucleus

Genome sequencing chronology

Year

OrganismSignificance

Genome size (bp)

Number of

genes

1977

Bacteriophage fX174

First genome

5,386 11

1981

Human mitochondria

First organelle

16,500 37

1995

Haemophilus influenzae Rd

First free-living organism

1,830,137

~3,500

1996

Saccharomyces cerevisiae

First eukaryote

12,086,000

~6,000

Genome sequencing chronologyYear

OrganismSignificance

Genome size (bp)

Number of

genes

1998

Caenorhab-ditis elegans

First multi-cellular organism

97,000,000~19,00

0

1999

Human chromosome 22

First human chromosome

49,000,000 673

2000

Drosophila melanogaster

First insect

150,000,000

~14,000

2000

Arabidopsis thaliana

First plant genome

150,000,000

~25,000

Genome size

VirusA subcellular parasite with genes of DNA or RNA and which replicates inside the host cell upon which it relies for energy and protein synthesis. In addition, it has an extra-cellular form in which the virus genes are contained inside a protective coat

The Baltimore classification systemBased on genetic contents and replication strategies of viruses. According to the Baltimore classification, viruses are divided into the following seven classes:

1. dsDNA viruses 2. ssDNA viruses 3. dsRNA viruses 4. (+) sense ssRNA viruses (codes directly for protein) 5. (-) sense ssRNA viruses 6. RNA reverse transcribing viruses 7. DNA reverse transcribing viruses

"ds" represents "double strand" and "ss" denotes "single strand".

Plant DNA viruses are rareCauliflower mosaic virusSpherical, kills Cauliflower and Brussel Sprouts

Most plant viruses are small and comprised of ssRNA

Rod shaped, attacks tomato, pepper, beets, turnips, tobacco2,130 identical proteins surround the ssRNA~10,000bp, ~10 genes

Plant Viroids

Plant Viruses

Highly complementary circular ssRNA No protein coat

Smaller than viruses (few hundreds of bases) Smallest known virus is 3.2 kbp in size

RNA does not code for any known protein Some even lack the AUG initiation codon

Replication mechanism is unknown Viroids cannot recognize and infect host cell

Relies on cells being weak or injured Proposed that viroids are "escaped introns"

Viroids are usually transmitted by seed or pollen Infected plants can show distorted growth

The first viroid to be identified was the Potato spindle tuber viroid (PSTVd) Some 33 species have been identified

Plant Viroids

Procaryotic genomes Generally 1 circular chromosome (dsDNA) Usually without introns Relatively high gene density (~2500 genes per

mm of E. coli DNA) Often indigenous plasmids are present

1. Eschericia coli

2. Agrobacterium tumefaciens

Eschericia coli It is a free living, gram negative

bacterium It is a normal resident of the large

intestine in healthy people It grows best with incubation at 37°C

in a culture medium that approximates the nutrient available in the human digestive tract

It is a type of probiotic organism because it crowds out disease causing bacteria.

It also makes vitamin K which humans require to be healthy.

Some strains make people sick. The toxic strains are responsible for about half of all cases of traveler's diarrhea.

Eschericia coli It replicates once every 22 It replicates once every 22

minutes, giving rise to 30 minutes, giving rise to 30 generations and more than 1 generations and more than 1 billion cells in 11 hoursbillion cells in 11 hours

Its growth falls into several Its growth falls into several distinct phases (lag, distinct phases (lag, logaritmic, stationary and logaritmic, stationary and death)death)

The individual cells are The individual cells are invisible to the naked eye, invisible to the naked eye, after plating onto solid after plating onto solid medium, each cell divides to medium, each cell divides to form a visible colony of form a visible colony of identical daughter cells in 12-identical daughter cells in 12-24 hours24 hours

Eschericia coli It provides a relatively simple and

well understood genetic improvement in which to isolate foreign DNA

Its primary genetic complement is contained on a single chromosome which locations and sequences of a large number of its genes are known

The genetic code is nearly universal Under the best circumstances, the

uptake of a specific foreign gene is a relatively rare occurrence and is thus most easily accomplished in a large populations that are reproducing rapidly

Eschericia Coli genome Single chromosome of

approximately 5 million base pairs (5 Mbp)

4288 protein coding genes:• Average ORF 317 amino

acids• Average gene size 1000

bp• Very compact: average

distance between genes 118bp

Contour length of genome: 1.7 mm

It can accept foreign DNA derived from any organism

Some genes are arranged in the plasmid

Agrobacterium tumefaciens

Agrobacterium tumefaciensAgrobacterium tumefaciens Agrobacterium tumefaciensAgrobacterium tumefaciens is a is a

gram-negative soil gram-negative soil phytopathogenphytopathogennon-sporing, motile, rod-shaped bacterium, closely related to Rhizobium which forms nitrogen-fixing nodules on clover and other leguminous plants.

AgrobacteriumAgrobacterium affect most affect most dicotyledonous plants in nature, dicotyledonous plants in nature, resulting in crown gall tumors at resulting in crown gall tumors at the soil-air junction upon tissue the soil-air junction upon tissue woundingwounding

Agrobacterium has the broadest host range of any plant pathogenic bacterium

Agrobacterium tumefaciensAgrobacterium tumefaciens Most of the genes involved in

crown gall disease are not borne on the chromosome of A. tumefaciens but on a large plasmid, termed the Ti (tumour-inducing) plasmid.

It is important to note that only a small part of the plasmid (the T-DNA) enters the plant; the rest of the plasmid remains in the bacterium to serve further roles. When integrated into the plant genome, the genes on the T-DNA code for:production of cytokinins production of indoleacetic acid synthesis and release of novel plant metabolites - the opines and agrocinopines.

Agrobacteria that causes Agrobacteria that causes neoplastic diseases in plantsneoplastic diseases in plants

Agrobacterium rhizogenesAgrobacterium rhizogenes (hairy root (hairy root disease).disease).

AgrobacteriumAgrobacterium rubirubi (cane gall disease) (cane gall disease) AgrobacteriumAgrobacterium tumefacienstumefaciens (crown gall (crown gall

disease)disease) AgrobacteriumAgrobacterium vitisvitis (crown gall of grape (crown gall of grape))

What will What will Agrobacterium Agrobacterium tumefacienstumefaciens affect in plants? affect in plants?

Crown gall disease is not Crown gall disease is not generally fatal, but it will generally fatal, but it will reduce plant vigor and reduce plant vigor and crop yield, and crown crop yield, and crown galls will attract other galls will attract other phytopathogens or pests.phytopathogens or pests.

In some cases, necrosis In some cases, necrosis or apoptosis is observed or apoptosis is observed after after AgrobacteriumAgrobacterium infection.infection.

The discovery of The discovery of AgrobacteriumAgrobacterium

In 1897, Fridiano Cavara identified a In 1897, Fridiano Cavara identified a flagellate, bacilloid bacterium as a casual flagellate, bacilloid bacterium as a casual agent of crown gall of grape.agent of crown gall of grape.

This organism is This organism is Agrobacterium vitisAgrobacterium vitis, , causing the growth of neoplastic tumors causing the growth of neoplastic tumors on the stem and crown of grapevines and on the stem and crown of grapevines and inducing necrotic lesions on grape roots.inducing necrotic lesions on grape roots.

Historical discoveries about Historical discoveries about agrobacteriumagrobacterium

Turn of 20Turn of 20thth century – found causes crown gall century – found causes crown gall diseasedisease

1940’s – crown gall tissue cultured due to 1940’s – crown gall tissue cultured due to hormone autotrophyhormone autotrophy

1970’s – pathogenicity transferred between 1970’s – pathogenicity transferred between bacteria via conjugation – evidence of plasmid bacteria via conjugation – evidence of plasmid involvement involvement

1980’s T-DNA was first engineered to carry useful 1980’s T-DNA was first engineered to carry useful genes into plants using methods that ‘hijacked’ genes into plants using methods that ‘hijacked’ the natural processthe natural process

Evidence for plasmid involvement in Evidence for plasmid involvement in the virulence of agrobacteriumthe virulence of agrobacterium

1. Relationship between virulence and specific plasmids in different agrobacterium strains

2. Loss of virulence with loss of plasmids when grown at high temp (plus restoration of virulence when same plasmids replaced)

3. Virulence transferred when plasmids transferred between virulent and non-virulent strains

4. Stable nature of hormone autotrophy in infected host plant tissues indicated that this was genetically determined and could result from genetic transfers between agrobacterium and its host

5. Fragments of agrobacterium plasmids (T-DNA) were found in the DNA of diseased tissues

6.6. Plants regenerated from diseased tissues were bred to Plants regenerated from diseased tissues were bred to produce offspring which inherited the T-DNA in a Mendelian produce offspring which inherited the T-DNA in a Mendelian manner. manner.

7.7. This indicated that the T-DNA was integrated into nuclear This indicated that the T-DNA was integrated into nuclear DNADNA

Autoradiogram of a Southern blot of DNA extracted from cured crown gall cells probed with T-DNA showing the presence of T-DNA within the plant genome.

Lanes 1 & 2: T-DNA extracted from agrobacterium Ti plasmid Lanes 3, 5 & 6: DNA extracted from gall cellsLane 4: DNA from non-infected plant tissue

Agrobacterium lives in intercellular spaces of the plant

Steps of Agrobacterium-plant cell interaction

1. Cell-cell recognition2. Signal transduction and transcriptional

activation of vir genes3. Conjugal DNA metabolism4. Intercellular transport5. Nuclear import6. T-DNA integration

Agrobacterium tumefaciens Agrobacterium tumefaciens genomegenome

• Genome size (chromosome) is about Genome size (chromosome) is about 6 Mb • A large (~250kbp) plasmid called Tumor-inducing A large (~250kbp) plasmid called Tumor-inducing

(Ti) plasmid)(Ti) plasmid)• Plasmid contains genes responsible for the diseasePlasmid contains genes responsible for the disease• Portion of the Ti plasmid is transferred between Portion of the Ti plasmid is transferred between

bacterial cells and plant cells bacterial cells and plant cells T-DNA (Transfer T-DNA (Transfer DNA)DNA)

• T-DNA integrates stably into plant genomeT-DNA integrates stably into plant genome• Single stranded T-DNA fragment is converted to Single stranded T-DNA fragment is converted to

dsDNA fragment by plant celldsDNA fragment by plant cell Then integrated into plant genomeThen integrated into plant genome 2 x 23bp direct repeats play an important role in 2 x 23bp direct repeats play an important role in

the excision and integration processthe excision and integration process

Agrobacterium tumefaciensAgrobacterium tumefaciens

What is naturally encoded in T-DNA?What is naturally encoded in T-DNA?• Enzymes for auxin and cytokinin synthesisEnzymes for auxin and cytokinin synthesis

Causing hormone imbalance Causing hormone imbalance tumor tumor formation/undifferentiated callusformation/undifferentiated callus

Mutants in enzymes have been characterizedMutants in enzymes have been characterized

• Opine synthesis genes (e.g. octopine or Opine synthesis genes (e.g. octopine or nopaline)nopaline)

Carbon and nitrogen source for Carbon and nitrogen source for A. tumefaciensA. tumefaciens growth growth Insertion genes Insertion genes

• Virulence (vir) genesVirulence (vir) genes• Allow excision and integration into plant genomeAllow excision and integration into plant genome

Plasmids

Naturally Extra chromosomal circular DNAs

They exist separate from the main chromosome They replicate within the host cells Their size vary form ~ 1,000 to 250,000 base pairs They can be divided into two broad groups according to

how tightly their replication in regulated: 1. stringent plasmids (low copy number plasmids: 1-2 plasmids/cell)

only replicate along with the main bacterial chromosome and so exist as single copy, or at most several copies within

the cell 2. Relaxed plasmid (multi copy number plasmids)

replicate autonomously of the main chromosome and have copy numbers

of 10 - 500 per cells

pBR322pBR322

The plasmid pBR322 is one of the most commonly used E.coli cloning vectors. pBR322 is 4361 bp in length and contains: (1) the replicon rep responsible for the replication of

plasmid (source – plasmid pMB1); (2) rop gene coding for the Rop protein, which promotes conversion of the unstable RNA I – RNA II complex to a stable complex and

serves to decrease copy number (source – plasmid pMB1); (3) bla gene, coding for beta-lactamase that confers resistance to ampicillin (source – transposon Tn3); (4) tet gene,

encoding tetracycline resistance protein (source – plasmid pSC101).

Genetic structure of the Ti plasmidGenetic structure of the Ti plasmid

TL TRAux Cyt Opines

Oncogenes

Left Border and Right Border

(Tumor-inducing)

transfer

Ti plasmid of Ti plasmid of A. tumefaciensA. tumefaciens

1. Auxin, cytokinin, opine synthetic genes transferred to plant

2. Plant makes all 3 compounds

3. Auxins and cytokines cause gall formation

4. Opines provide unique carbon/nitrogen source only A. tumefaciens can use!

Saccharomyces cerevisiae NonpathogenicNonpathogenic Rapid growth (generation Rapid growth (generation

time ca. 80 min)time ca. 80 min) Dispersed cellsDispersed cells Ease of replica plating and Ease of replica plating and

mutant isolationmutant isolation Can be grown on defined Can be grown on defined

media giving the media giving the investigator complete investigator complete control over environmental control over environmental parametersparameters

Well-defined genetic systemWell-defined genetic system Highly versatile DNA Highly versatile DNA

transformation systemtransformation system

Saccharomyces cerevisiae Strains have both a stable Strains have both a stable

haploid and diploid statehaploid and diploid state Viable with a large number Viable with a large number

of markers of markers Recessive mutations are Recessive mutations are

conveniently manifested in conveniently manifested in haploid strains and haploid strains and complementation tests can complementation tests can be carried out with diploid be carried out with diploid strainsstrains

The ease of The ease of gene gene disruptions disruptions and single step and single step gene replacements offers an gene replacements offers an outstanding advantage for outstanding advantage for experimentationexperimentation

Saccharomyces cerevisiae Yeast genes can functionally be

expressed when fused to the green fluorescent protein (GFP) thus allowing to localize gene products in the living cell by fluorescence microscopy

The yeast system has also proven an invaluable tool to clone and to maintain large segments of foreign DNA in yeast artificial chromosomes (YACs) being extremely useful for other genome projects and to search for protein-protein interactions using the two-hybrid approach

Transformation can be carried out directly with short single-stranded synthetic oligonucleotides, permitting the convenient productions of numerous altered forms of proteins

Genome of diploid Saccharomyce cerevisiae cell

Characteristic Chromosomes Plasmid MitochondiralRelative amount (%) 85 5 10Number of copies 2 x 1660-100 ~50 (8-130)Size (kbp) 14.000 6,318 70-76

Yeast genome

Yeast plasmid

The yeast genome S. cerevisiae contains a haploid set of 16 well-characterized

chromosomes, ranging in size from 200 to 2,200 kb Total sequence of chromosomal DNA is 12,8 Mb 6,183 ORFs over 100 amino acids long First completely sequenced eukaryote genome Very compact genome:

• Short intergenic regionsShort intergenic regions• Scarcity of intronsScarcity of introns• Lack of repetitive sequencesLack of repetitive sequences

Strong evidence of duplication:• Chromosome segmentsChromosome segments• Single genesSingle genes

RedundancyRedundancy: non-essential genes provide selective : non-essential genes provide selective advantageadvantage

Eucaryotic genomesEucaryotic genomes Located on several chromosomesLocated on several chromosomes

Relatively low gene density (50 genes per Relatively low gene density (50 genes per mm of DNA in humans)mm of DNA in humans)

Carry organellar genomeCarry organellar genome

Plant genomes Plant contains three genomesPlant contains three genomes Genetic information is divided in the chromosome.Genetic information is divided in the chromosome. The size of genomes is species dependentThe size of genomes is species dependent The difference in the size of genome is mainly due to a The difference in the size of genome is mainly due to a

different number of identical sequence of various size different number of identical sequence of various size arranged in sequencearranged in sequence

The gene for ribosomal RNAs occur as repetitive The gene for ribosomal RNAs occur as repetitive sequence and together with the genes for some transfer sequence and together with the genes for some transfer RNAs in several thousand of copiesRNAs in several thousand of copies

Structural genes are present in only a few copies, Structural genes are present in only a few copies, sometimes just single copy. Structural genes encoding sometimes just single copy. Structural genes encoding for structurally and functionally related proteins often for structurally and functionally related proteins often form a gene familyform a gene family

The DNA in the genome is replicated during the The DNA in the genome is replicated during the interphase of mitosisinterphase of mitosis

Arabidopsis thaliana A weed growing at the roadside of A weed growing at the roadside of

central Europecentral Europe It has only 2 x 5 chromosomesIt has only 2 x 5 chromosomes It is just 70 MbpIt is just 70 Mbp It has a life cycle of only 6 weeksIt has a life cycle of only 6 weeks It contains 25,498 structural genes It contains 25,498 structural genes

from 11,000 familiesfrom 11,000 families The structural genes are present in The structural genes are present in

only few copies sometimes just one only few copies sometimes just one proteinprotein

Structural genes encoding for Structural genes encoding for structurally and functionally related structurally and functionally related proteins often form a gene familyproteins often form a gene family

Peculiarities of plant genomes Huge genomes reaching tens of billions of base Huge genomes reaching tens of billions of base

pairspairs Numerous polyploid formsNumerous polyploid forms Abundant (up to 99%) non coding DNA which Abundant (up to 99%) non coding DNA which

seriously hinders sequencing, gene mapping and seriously hinders sequencing, gene mapping and design of genedesign of gene

Poor morphological, genetics, and physical Poor morphological, genetics, and physical mapping of chromosomesmapping of chromosomes

A large number of “small-chromosome” in which A large number of “small-chromosome” in which the chromosome length does not exceed 3 the chromosome length does not exceed 3 μμmm

The number of chromosomes and DNA content in The number of chromosomes and DNA content in many species is still unknownmany species is still unknown

Size of the genome in plants and human

GenomeGenome Arabidopsis Arabidopsis thalianathaliana

Zea maysZea mays Vicia fabaVicia faba HumanHuman

NucleusNucleus 70 Millions70 Millions 3900 3900 MillionsMillions

14500 14500 MillionsMillions

2800 2800 MillionsMillions

PlastidPlastid 0.156 0.156 MillionsMillions

0.136 0.136 MillionsMillions

0.120 0.120 MillionsMillions

MitochondMitochondrionrion

0.370 0.370 MillionsMillions

.570 .570 MillionsMillions

.290 .290 MillionsMillions

.017 .017 MillionsMillions

Organisation of the genome into chromosome

The nuclear genome is organized into chromosomeThe nuclear genome is organized into chromosome Chromosomes consist of essentially one long DNA Chromosomes consist of essentially one long DNA

helix wound around nucleosome helix wound around nucleosome At metaphase, when the genome is relatively At metaphase, when the genome is relatively

inactive, the chromosome are most condensed and inactive, the chromosome are most condensed and therefore most easily observed cytologically, therefore most easily observed cytologically, counted or separatedcounted or separated

Chromosomes provide the means by which the Chromosomes provide the means by which the plant genome constituents are replicated and plant genome constituents are replicated and segregated regularly in mitosis and meiosissegregated regularly in mitosis and meiosis

Large genome segments are defined by their Large genome segments are defined by their conserved order of constituent genesconserved order of constituent genes

Genome compositionGenome composition1.1. HeterochromatinHeterochromatin Darkly staining portions of Darkly staining portions of

chromosomes, believed due to high chromosomes, believed due to high degree of coilingdegree of coiling

Non-genic DNANon-genic DNAa. Centromere a. Centromere ~ “middle” of Chromosomes~ “middle” of Chromosomes spindle attachment sitesspindle attachment sitesb. Telomeresb. Telomeres1. ends of chromosome1. ends of chromosome2. important for the stability of 2. important for the stability of chromosomeschromosomes tipstips..

2. Euchromatin2. Euchromatin Lightly staining portion of Lightly staining portion of

chromosomeschromosomes It represents most of the genomesIt represents most of the genomes It contains most of genesIt contains most of genes..

Ploidy and chromosome numberPloidy and chromosome number

OrganismOrganism PloidyPloidy Chromosome Chromosome numbernumber

CornCorn Diploid (2X)Diploid (2X) 2020

TomatoTomato Diploid (2X)Diploid (2X) 2424

ArabidopsisArabidopsis Diploid (2X)Diploid (2X) 1010

PotatoPotato Tetraploid (4X)Tetraploid (4X) 4848

WheatWheat Hexaploid (6X)Hexaploid (6X) 4242

Organization of Plant GenomeOrganization of Plant Genome Protein coding geneProtein coding gene

PPortion of genome which encodes for most of the transcribed genes (Protein coding genes)

Non coding gene Non coding gene 1. Intron1. Intron

2. 2. Regulatory elements of genes3. Multiple copies of genes, including pseudogenes4. Intergenic sequences5. Interspersed repeats

Organization of Plant GenomeOrganization of Plant GenomeMost plants contain quantities of DNA that greatly

exceed their needs for coding and regulatory functions

Very small percentage of the genome may encode for genes involved in protein production

Based on kinetics: Low-copy-number DNALow-copy-number DNA

DNA sequences DNA sequences encodes for most of the transcribed genes (Protein coding genes)

Medium-copy-number DNA Medium-copy-number DNA DNA sequences that encode ribosomal RNA (Tandemly repeated expressed DNA)

High-copy-number DNAHigh-copy-number DNAIIt is composed of highly repetitive sequences (Repetitious t is composed of highly repetitive sequences (Repetitious DNA)DNA)

Gene classification

coding genesnon-coding genes

Messenger RNA

Proteins

Structural RNA

Structural proteins Enzymes

transfer RNA

ribosomal RNA

otherRNA

Chromosome(simplified)

intergenic region

Protein Coding GenesProtein Coding GenesSegment of DNA which can be transcribed and

translated to amino acid

Transcribed region ≈ Open Reading Transcribed region ≈ Open Reading Frame (ORF)Frame (ORF)• long (usually >100 aa)long (usually >100 aa)• ““known” proteins known” proteins likely likely

Basal signalsBasal signals• Transcription, translationTranscription, translation

Regulatory signalsRegulatory signals

Protein Coding GenesProtein Coding Genes

Protein Coding GenesProtein Coding Genes Plant contains about 10 000 – 30 000 structural genesPlant contains about 10 000 – 30 000 structural genes They are present in only a few copies, sometimes just one They are present in only a few copies, sometimes just one

(single copy gene)(single copy gene) They often form a gene familyThey often form a gene family The transcription of most structural genes is subject to very The transcription of most structural genes is subject to very

complex and specific regulationcomplex and specific regulation The gene for enzymes of metabolism or protein The gene for enzymes of metabolism or protein

biosynthesis which proceed in all cells are transcribed biosynthesis which proceed in all cells are transcribed more oftenmore often

Most of the genes are switched off and are activated only in Most of the genes are switched off and are activated only in certain organ and then often only in certain cellscertain organ and then often only in certain cells

Many genes are only switched on at specific timesMany genes are only switched on at specific times

House keeping gene:

The genes which every cell needs for such basic functions independent of its specialization

What do the genes encode?

Genes for basic cellular functions such as translation, transcription, replication and repair share similarity

among all organisms

Basic functions

Yeast – simplest eukaryote

Worm –programmed development

Fly – complex development

Arabidopsis – plant life cycle

+

Microbes highly specialized

Gene families expand to meet biological needs.

PseudogenesPseudogenes

Nonfunctional copies of genes

Formed by duplication of ancestral gene, or reverse transcription (and integration)

Not expressed due to mutations that produce a stop codon (nonsense or frame-shift) or prevent mRNA processing, or due

to lack of regulatory sequences

Tandemly Repeated DNA Tandemly Repeated DNA

A large number of identical repeated DNA A large number of identical repeated DNA sequencessequences

It spread over the entirely chromosomeIt spread over the entirely chromosome There is variation within species for the number of There is variation within species for the number of

copies in allelic arrayscopies in allelic arrays Variations in the lengths of tandemly repeat units Variations in the lengths of tandemly repeat units

have been used as a sources of molecular markerhave been used as a sources of molecular marker It is divided into:It is divided into:

1. Tandemly repeated expressed DNA1. Tandemly repeated expressed DNA

2. Tandemly repeated non expressed DNA 2. Tandemly repeated non expressed DNA (Repetitious DNA)(Repetitious DNA)

Tandemly Repeated Expressed Tandemly Repeated Expressed Genes Genes

Genes which are duplicated and clustered Genes which are duplicated and clustered at many location of the genomeat many location of the genome

Ribosomal 18S, 58S, 25S and 5S RNA Ribosomal 18S, 58S, 25S and 5S RNA genes are highly reiterated in clusters genes are highly reiterated in clusters and form at sites called nucleolus and form at sites called nucleolus organizers (NOR)organizers (NOR)

They are also observed for tDNA and They are also observed for tDNA and histones histones

Tandemly Repeat non expressed Tandemly Repeat non expressed DNADNA

Simple-sequence DNASimple-sequence DNA Moderately repeated DNA (mobile DNA)Moderately repeated DNA (mobile DNA)

Repetitive sequences which are unable to be expressed but found in

huge amount in the genome

Simple Sequence DNASimple Sequence DNA

Very sort sequences repeated many times in tandem in large clusters

It is also called as satellite DNA

It often lies in heterochromatin especially in in centromeres and telomerescentromeres and telomeres

It is divided into 2 groups:It is divided into 2 groups:

Mini satellite : Variable number tandem repeat (VNTR) Mini satellite : Variable number tandem repeat (VNTR)

Micro satellite : Simple sequence repeat (SSR)Micro satellite : Simple sequence repeat (SSR)

It is used in DNA fingerprinting to identify It is used in DNA fingerprinting to identify individualsindividuals

Tandemly repeated DNATandemly repeated DNA

Microsatellite (SSR: Simple sequence Microsatellite (SSR: Simple sequence repeat)repeat)• Unit size: at most 5 bpUnit size: at most 5 bp• ATATATATATATATATATATAATATATATATATATATTATATATATAT

MinisatelliteMinisatellite• Unit size: up to 25 bpUnit size: up to 25 bp• ATTGCTGTATTGCTGTATTGCTGTATTGCTGTATTGCTGTATTGCTGT

Mobile DNA (Jumping gene)Mobile DNA (Jumping gene)

Move within genomes Most of moderately repeated DNA sequences

found throughout higher eukaryotic genomes Some encode enzymes that catalyze movement 2 types:

a. Transposonb. Retrotransposon

Units of DNA which are predisposed to move to another location, sometimes involving

replication of the unit, with the help of products of genes on the elements or on related element

Transposon DNATransposon DNAInvolves copying of mobile DNA element Involves copying of mobile DNA element

and insertion into new site in genomeand insertion into new site in genome

Molecular parasite: “selfish DNA”Molecular parasite: “selfish DNA” They probably have significant effect on evolution They probably have significant effect on evolution

by facilitating gene duplication, which provides by facilitating gene duplication, which provides the fuel for evolution, and exon shufflingthe fuel for evolution, and exon shuffling

Retrotransposon (retroelement)Retrotransposon (retroelement) Transposon like segment of DNATransposon like segment of DNA Retroviruses lacking the sequence encoding the structural Retroviruses lacking the sequence encoding the structural

envelope proteinenvelope protein Major component of plant genomeMajor component of plant genome Size ranges from 1 to 13 kb in lengthSize ranges from 1 to 13 kb in length Widely distributed over the chromosomes of many plant Widely distributed over the chromosomes of many plant

species genespecies gene

RetrovirusA virus of higher organism whose genome is RNA, but

which can insert a DNA copy its genome into host chromosome

50-80% of plant genomes are Transposable Element

Mobile elements

Plant genome sizes

Small difference in gene number, although rice genome is 3x the size

Predicted Gene numbers

Peter J. Russell, iGenetics: Copyright © Pearson Education, Inc., publishing as Benjamin Cummings.

Eukaryotic cellsEukaryotic cells

Mitochondrial genome (mtDNA)Mitochondrial genome (mtDNA) Number of mitochondria in plants can be between 50-Number of mitochondria in plants can be between 50-

20002000 One mitochondria consists of 1 – 100 genomes (multiple One mitochondria consists of 1 – 100 genomes (multiple

identical circular chromosomes). identical circular chromosomes). They are one large and several smaller They are one large and several smaller

Size ~ 200 kb to 2,500 kb in plantsSize ~ 200 kb to 2,500 kb in plants Mt DNA is replicated before or during mitosisMt DNA is replicated before or during mitosis

Transcription of mtDNA yielded an mRNA which did not Transcription of mtDNA yielded an mRNA which did not contain the correct information for the protein to be contain the correct information for the protein to be

synthesized. synthesized. RNA editing is existed in plant mitochondriaRNA editing is existed in plant mitochondria

Over 95% of mitochondrial proteins are encoded in the Over 95% of mitochondrial proteins are encoded in the nuclear genome.nuclear genome.

Often A+T rich genomesOften A+T rich genomes

Chloroplast genome (ctDNA)Chloroplast genome (ctDNA) Multiple circular molecules, similar to procaryotic Multiple circular molecules, similar to procaryotic

cyanobacteria, although much smaller (0.001-0.1%of the cyanobacteria, although much smaller (0.001-0.1%of the size of nuclear genomes)size of nuclear genomes)

Cells contain many copies of plastids and each plastid Cells contain many copies of plastids and each plastid contains many genome copies contains many genome copies

Size ranges from 120 kb to 160 kbSize ranges from 120 kb to 160 kb Plastid genome has changed very little during evolution. Plastid genome has changed very little during evolution.

Though two plants are very distantly related, their Though two plants are very distantly related, their genomes are rather similar in gene composition and genomes are rather similar in gene composition and arrangementarrangement

Some of plastid genomes contain introns Some of plastid genomes contain introns Many chloroplast proteins are encoded in the nucleus Many chloroplast proteins are encoded in the nucleus

(separate signal sequence)(separate signal sequence)

DNA for chloroplast proteins can be come DNA for chloroplast proteins can be come from the nucleus or chloroplast genomefrom the nucleus or chloroplast genome

Buchannan et al. Fig. 4.4