SHORT REPORT

Germline mutations and polymorphisms in the NFKBIA gene in

Hodgkin lymphoma

Julie Osborne1, Annette Lake1, Freda E. Alexander2, G. Malcolm Taylor3 and Ruth F. Jarrett1*

1LRF Virus Centre, Institute of Comparative Medicine, University of Glasgow, Glasgow, United Kingdom2Department of Public Health Sciences, University of Edinburgh Medical School, Edinburgh, United Kingdom3Cancer Immunogenetics Laboratory, University of Manchester, St. Mary’s Hospital, Manchester, United Kingdom

Somatic inactivation of NFKBIA, the gene encoding IjBa, is a fre-quent occurrence in the malignant Hodgkin and Reed-Sternberg(HRS) cells of Hodgkin lymphoma (HL). Impairment of IjBa func-tion results in deregulated NF-jB activity, a characteristic of HRScells. The molecular basis for familial HL, which accounts forapproximately 4% of all HL cases, is unclear. To date, familial HLcases have not been evaluated for germline NFKBIA mutations. Wescreened the entire NFKBIA gene in 8 individuals with familial HLbut found no mutations in the coding region or promoter sequences.We identified the first germline NFKBIA missense mutation in apatient with presumed sporadic HL. The frequency of 4 polymor-phisms within the NFKBIA gene and promoter region was investi-gated in a series of HL and control samples; no significant differencesemerged but a novel polymorphism was identified in the promoterregion. Overall, our results suggest that germline mutations ofNFKBIA are not a significant cause of familial aggregation of HL butmay contribute to inherited susceptibility to HL.' 2005 Wiley-Liss, Inc.

Key words: familial Hodgkin lymphoma; NFKBIA; mutation;germline

In 4.5% of cases, Hodgkin lymphoma (HL) occurs in individu-als who have a family history of the disease in at least one first-degree relative.1 The relative risk of developing HL has beenreported to be increased 3-fold in first-degree relatives2 and 7-foldin siblings of affected young adults.3 Such familial aggregation isconsistent with a role for both environmental and genetic factors.

In one-third of HL cases in the United Kingdom, Epstein-Barrvirus (EBV) genomes are present in Hodgkin and Reed-Sternberg(HRS) cells, the tumour cells in HL, and these cases are regardedas EBV-associated.4 The lack of concordance for HRS cell EBV-positivity among affected members of the same family5 suggeststhat EBV may not play an important role in familial HL. Signifi-cant concordance for HL in monozygotic compared to dizygotictwins of HL patients suggests a principal role for genetic factors infamilial HL.6 In light of this, several groups have examined HLAclass I7,8 and II9 associations in familial HL. Although associa-tions have been described, it is likely that only a proportion offamilial HL cases are HLA-associated10 and the possibilityremains that non-HLA genetic factors are involved in inheritedsusceptibility to HL. Although it has been speculated that heritablepredisposition to HL may be linked to the major pseudoautosomalregion (PAR) of the X and Y chromosomes,11,12 no HL suscepti-bility gene in PAR has yet been located.

A common germline defect in inherited cancers is the loss of atumour suppressor gene. Deleterious somatic mutations in theNFKBIA gene, a candidate tumour suppressor gene involved incontrolling the oncogenic potential of NF-jB, have been describedin HRS cells.13–15 Persistent nuclear NF-jB activity is a character-istic of HRS cells and is thought to be responsible for dysregula-tion of growth and protection against apoptosis.16,17 The primaryaim of our study was to determine whether germline mutations ofthe NFKBIA locus are involved in familial HL. We have definedfamilial HL as HL in more than one first-degree family member;however, inherited susceptibility is also likely to be important incases that do not fulfill this definition.

During the course of our study it became evident that theNFKBIA gene harbours a relatively large number of polymor-phisms including those involving single nucleotides (SNPs)[http://www.ncbi.nlm.nih.gov/SNP/NCBI]. Eight variants fromthe published sequence are frequently detected, including 4 exonicand 4 intronic changes.18 Two of the exonic SNPs, 212Y and1059Y, represent silent changes and the intronic SNPs, 1193Y,1678R and 2025Y, are not within splice sites and are thereforeunlikely to affect gene expression. The remaining 2 SNPs, 2787Y(C or T) and 2911R (A or G), are located in the 30UTR of exon 6;these may have functional significance because there is accumu-lating evidence that the 30UTR of mRNA regulates gene expres-sion and may be altered in various disease states.19 The eighthpolymorphism is a 19-base pair deletion in intron 5, which wasfirst identified in the HL-derived cell line L428.13 This results inshortening of an intronic polypyrimidine tract, an occurrence thathas been implicated in aberrant splicing in certain genetic disor-ders.20,21 This deletion could potentially create a new 50 spliceacceptor site for exon 6 at position 2554, computed according toknown algorithms,22,23 resulting in a protein with a novel car-boxy-terminus. The NFKBIA promoter region also contains sev-eral polymorphisms, including some that have been linked to spe-cific diseases.24,25 An insertion of 8 bases has been associated witha decreased risk of developing primary progressive multiple scle-rosis (MS); 15.4% of alleles from patients with primary progres-sive MS harboured the insertion vs. 28.4% of alleles from con-trols.25 The epidemiology of HL and MS share many features,26

and there is recent evidence for an increased risk of HL in familymembers of patients with MS and vice versa.27 On the basis of theabove data, we investigated the frequency of this promoter inser-tion, the 2787Y and 2911R SNPs, and the 19-base pair deletion inHL cases and controls.

Material and methods

Patients and samples

Eight patients with familial HL were identified through theScotland and Newcastle Epidemiological Study of Hodgkin’s Dis-ease (SNEHD). SNEHD is a population-based, case-control studyof HL, which has been described previously.28,29 Briefly, all casesof HL aged 16–74 years diagnosed with HL while resident inScotland (excluding Dumfries and Galloway and the Western

Grant sponsor: Leukaemia Research Fund; Grant sponsor: Kay KendallLeukaemia Fund.*Correspondence to: LRF Virus Centre, Institute of Comparative

Medicine, Bearsden Road, University of Glasgow, Glasgow, G61 1QH.Fax:144-141-330-5733. E-mail: r.f.jarrett@vet.gla.ac.ukReceived 23 August 2004; Accepted after revision 7 December 2004DOI 10.1002/ijc.21036Published online 11 April 2005 in Wiley InterScience (www.interscience.

wiley.com).

Abbreviations:EBV, Epstein-Barr virus; HL, Hodgkin lymphoma; HRS,Hodgkin and Reed-Sternberg; MS, multiple sclerosis; PAR, pseudoautoso-mal region; SNEHD, Scotland and Newcastle Epidemiological Study ofHodgkin’s Disease; SNP, single nucleotide polymorphism.

Int. J. Cancer: 116, 646–651 (2005)' 2005 Wiley-Liss, Inc.

Publication of the International Union Against Cancer

Isles) and the Northern region of England from 1 January 1993 to31 July 1997 were eligible for the study (n 5 584). Controls (n 5513) were randomly selected so that cases and controls had similarfrequencies by age group, gender and region. A structured studyquestionnaire (that included questions on family medical history)was completed at face-to face interview with subjects who gaveinformed consent, and blood samples were collected.

The germline sequence of NFKBIA was determined for theabove 8 cases of familial HL. Only index cases were studied. Casedetails and the relationship of the affected, first-degree relative toeach index case are shown in Table I. DNA was extracted fromblood (7 cases) or lymph node (n 5 1) using standard techniques.Germline NFKBIA sequences were also obtained from 23 patientswith sporadic HL who were part of a contemporaneous studyinvestigating NFKBIA mutations in HRS cells; the analysis of oneof these cases (a 43-year-old female with nodular sclerosis HL) isreported here.

To examine the frequency of NFKBIA polymorphisms withpotential functional significance in HL, a test set of samples from51 classical HL cases and 50 controls was examined. DNA wasextracted from lymph node (n 5 96), blood (n 5 4) or spleen (n 51) and samples were analysed in a linked anonymous fashion.Potentially interesting polymorphisms were then investigatedusing a larger series of samples derived from SNEHD. This seriescomprised an additional 376 classical HL cases and 328 controls;

overall, 71% of the cases with classical HL and 64% of the con-trols in SNEHD were analysed. Peripheral blood samples wereused as a source of germline DNA.

NFKBIA mutation analysis

The nucleotide positions used in our study conform to those ofIto et al.18,30 Primers and probe sequences are shown in Table II.The complete NFKBIA coding sequence from the 8 familial caseswas amplified in a nested PCR reaction containing 0.5 lM primers(Table II, primers 699, 708, 626 and 627), 1 lg DNA, 2.5 U ofHotStarTaq DNA polymerase (Qiagen, West Sussex, UK), 5 UTaq Extender PCR additive (Strategene, Amsterdam, The Nether-lands), Taq Extender reaction buffer, 200 lM nucleotides and 5%DMSO. Thermal cycling was carried out on a GeneAmp PCR Sys-tem 9600 (Applied Biosystems, Warrington, UK) using the fol-lowing cycling conditions for both rounds of PCR: 95�C for15 min followed by 35 cycles of 95�C for 60 sec, 60�C for 60 sec,72�C for 60 sec and a final extension at 72�C for 10 min. The3104-base pair amplification products were cloned using theTOPO TA Cloning kit (Invitrogen, Paisley, UK) and at least5 clones from each product were subjected to sequence analysis.Promoter sequences were amplified in 4 separate reactions using0.5 lM primers (Table II, primers 814–821), 1 lg DNA and Hot-StarTaq DNA Master Mix (Qiagen) in a 25-ll reaction volume.Thermal cycling conditions were: 15 min at 95�C followed by 35

TABLE 1 – CHARACTERISTICS FOR FAMILIAL HODGKIN LYMPHOMA CASES

CaseIndex Case Affected family member

Age1 Gender Histological subtype EBV status2 Relationship to index case Age1

1 20 M NS 2 Mother 342 70 F NS 2 Daughter 203

3 21 M NLP 2 Sister 224 56 M NS 1 Mother 565 46 M MC 2 Father 506 23 M NLP 2 Father 457 25 M NLP 2 Father 208 58 M NS 1 Brother 11

1Age at diagnosis.–2EBV status of tumour cells: NS, nodular sclerosis Hodgkin lymphoma; NLP, nodular lymphocyte predominant Hodgkinlymphoma; MC, mixed cellularity Hodgkin lymphoma.–3Age at death, age at diagnosis not known.

TABLE II – PRIMERS AND PROBES1

PCR reaction Primer reference Usage Sequence Position1

Complete coding sequence 699 Forward outer TGGTCTGACTGGCTTGGAAATTC 270 to 248708 Reverse outer TTCAGTGATGTGGGGTGAAA 3152 to 3171626 Forward inner TGCAGAGCCCACAGCAGTCC 17 to 36627 Reverse inner GGATACCACTGGGGTCAGTCACTC 3097 to 3120

Exon 3 684 Forward AGGAGACACGGGTTGAGG 1340 to 1357694 Reverse AAAGGCATCCAATAGGCAC 1786 to 1768

Promoter 1 814 Forward GAGCTCTGACCGAAGTTTGC 21275 to 21256815 Reverse CCCAAATTCGAGGAGAACTT 2913 to 2932

Promoter 2 816 Forward CAGGATGCCTGGCAACTACT 21004 to 21023817 Reverse CCCGCCAGGTAGAAGTTGTG 2597 to 2616

Promoter 3 818 Forward GATTTGAGAGTTCTCCAAGG 2664 to 2645819 Reverse CTGCACCCTGTAATCCTGTC 2256 to 2275

Promoter 4 820 Forward CGTCCTTGGGATCTCAGCAG 2358 to 2339821 Reverse CACGGACTGCTGTGGGCTCT 20 to 39

Promoter 3b 839 Forward (FAM) CCAGTCAACAGGGCTGTTCATC 2696 to 2675840 Reverse (HEX) AAGGACGCACTGTGGTTAGGG 2489 to 2509

19 base pair deletion 687 Forward CCTAGAGCTGCTCCTTATCAGAGGG 2451 to 2475688 Reverse GGGAGGCCACTACTGGAAATAACTC 2671 to 2647

2787Y Forward GGAGGCCAGCGTCTGA 2762 to 2777Reverse GTACAAATATACAAGTCCATGTTCTTTCAGC 2826 to 2796Probe 1 (VIC) CCCTTTGCGCTCATAA 2795 to 2780Probe 2 (FAM) CCCTTTGCACTCATAA 2795 to 2780

2911R Forward TTTAAAGGGTGTACTTATATCCACACTGC 2873 to 2901Reverse GCTGATCCTACCACAATAAGACGTT 2942 to 2918Probe 1 (VIC) ACACTGCCTAGCCCAA 2902 to 2917Probe 2 (FAM) ACTGCCTGGCCCAA 2904 to 2917

1Nucleotide positions are according to Ito et al. (18; 30).

647GERMLINE NFKBIA MUTATIONS IN HODGKIN LYMPHOMA

cycles of 94�C for 30 sec, 55�C for 30 sec, 72�C for 90 sec and afinal extension at 72�C for 10 min. Amplification products weresequenced directly without prior cloning. Sequence analysis wascarried out using the Big Dye Terminators v3.1 Cycle SequencingKit and an ABI Prism 3100 Genetic Analyzer (AppliedBiosystems).

Exon 3 sequences were amplified from the 51 HL cases in thetest series in a 50-ll reaction containing 1 lg DNA, 200 nM pri-mers (Table II) and HotStarTaq DNA Master Mix (Qiagen). Ther-mal cycling conditions were: 15 min at 95�C followed by 35cycles of 94�C for 50 sec, 65�C for 30 sec, 72�C for 90 sec and afinal extension at 72�C for 10 min. Direct sequencing of PCRproducts was carried out as described above.

Details of polymorphisms within the NFKBIA gene and pro-moter are available at http://www.ncbi.nlm.nih.gov/SNP/NCBIand accession numbers are given where available. Allelic discrim-ination assays (Applied Biosystems) were used to analyse the2787Y (rs8904) and 2911R (rs696) SNPs. Reactions included20 ng of DNA, primers and probes at 900 nM and 200 nM respec-tively (Table II), and 12.5 ll of TaqMan Universal MasterMix(Applied Biosystems). Thermal cycling and analysis were carriedout using an ABI Prism 7700 Sequence Detection System(Applied Biosystems). The presence of the 19-base pair deletion(rs6145295) was analysed using primers 687 and 688 (Table II) ina 25 ll PCR reaction containing 100 ng of DNA, Qiagen HotStar-Taq MasterMix, and primers at 0.5 lM. Thermal cycling condi-tions were: 95�C for 15 min followed by 35 cycles of 94�C for60 sec, 55�C for 60 sec, 72�C for 60 sec and a final extension at72�C for 10 min. Products were analysed on 8% polyacrylamidegels. The presence of an 8-base pair insertion (2708ins8 accord-ing to numbering used by Miterski et al.)25 in the NFKBIA pro-moter was investigated initially using primers 818 and 819 asdescribed above for the familial cases; primer 818 was dye-labeledto facilitate GeneScan analysis on an ABI Prism 3100 GeneticAnalyzer (Applied Biosystems).25 Selected products were sub-jected to sequence analysis as described above. The SNEHD seriesof DNA samples (n 5 704) was investigated subsequently for pro-moter polymorphisms in this region using dye-labeled primers 839and 840 (Table II) and the reaction conditions described aboveexcept that 40 cycles of amplification were carried out. Reactionproducts were analysed on an ABI Prism 3100 Genetic Analyzer(Applied Biosystems).

Statistical analysis

For the above polymorphisms, case control differences in geno-type and allele frequencies were analysed for �all cases� and afterstratification by gender and age group (16–34 years, 35–49 yearsand �50 years). HL cases were further analysed with respect tohistological subtype (nodular sclerosis vs. not nodular sclerosis).Statistical analyses were implemented using SPSS v11.5.

Results

NFKBIA mutations

Eight cases of HL, each with an affected first-degree relativewith HL (Table I), were selected for analysis and the completegermline sequence of the NFKBIA gene was determined. No func-tionally significant point mutations or deletions were detected inany of the 6 exons of NFKBIA. Polymorphisms described previ-ously were confirmed in this dataset including 212Y, 1059Y,1193Y, 1678R, 2025Y, 2787Y, 2911R and deletion of 2544–2562(Y 5 C or T; R 5 A or G). The distribution of these polymor-phisms among the familial cases was unremarkable. Analysis ofthe promoter region from these 8 cases showed only wild-typesequence.30

Analysis of NFKBIA coding sequences from 23 cases of spora-dic HL showed a case with a germline mutation (C > T) at posi-tion 1519 in exon 3 (Fig. 1a). The patient was a 43-year-oldfemale with non-EBV-associated, nodular sclerosis HL. This

mutation will result in an amino acid change from threonine toisoleucine at residue 146, a highly conserved residue in the IjBamolecule (Fig. 1b).31,32 Because this mutation is likely to be sig-nificant biologically and may contribute to susceptibility to HL,we amplified and sequenced exon 3 from an additional 51 cases ofsporadic HL. The mutation was not detected in any further cases.

NFKBIA polymorphisms

The frequency of 4 NFKBIA polymorphisms of potential func-tional significance was compared in samples from 51 HL casesand 50 controls (Table III). Allelic discrimination assays wereused to analyse the SNP 2787Y and 2911R. The expected fre-quency of alleles was observed in the control groups (http://www.ncbi.nlm.nih.gov/SNP/NCBI) and there were no significantdifferences in genotype or allele frequencies between cases andcontrols in the complete data set (Table III), or after stratificationby age and gender. There was complete concordance between theresults of the 2 assays with all individuals who were homozygousfor C at position 2787 being homozygous for G at 2911, and allindividuals who were heterozygous at 2787 being heterozygous at2911. The 19-base pair deletion in intron 5 was detected in 30% ofthe 202 alleles examined and genotype frequencies were in Hardy-Weinberg equilibrium. There was no difference in the frequencyof this deletion between cases and controls when �all cases� wereanalysed (Table III), or after stratification by age and gender.Among HL cases, the allele and genotype frequencies at the above3 polymorphic sites were similar in nodular sclerosis and non-nod-ular sclerosis cases.

GeneScan analysis was used to detect an 8-base pair insertion inthe NFKBIA promoter, which has been associated with decreasedrisk of MS.25 An initial analysis was carried out using samplesfrom 51 HL cases and 50 controls. The insertion was detected in 3cases and 3 controls; sequence analysis showed insertion of thesequence GGGGGGGA at position 2581 relative to the transcrip-tional start site. PCR and sequence analysis also identified an adja-cent deletion of 8 bases (position 2589 to 2582; GGGGGGGT),which was present in 3 HL cases but none of the controls. On thebasis of the latter results, we analysed a larger series of cases andcontrols, derived from a population-based study of HL, for thepresence of deletions and insertions in this region. In this series,the deletion was identified in 4 of 376 cases (1.1% of subjects and0.6% of alleles) and 12 of 328 controls (3.6% of subjects and2.4% of alleles) (Table III). The insertion was detected in 11 cases(2.9% of subjects and 3% of alleles) and 7 controls (2.1% of sub-jects and 2% of alleles). There were no significant differences bycase control status, and cases with the deletion or insertion did notshow any consistent clinical features. Only one case was heterozy-gous for the insertion and there were no cases with both the inser-tion and deletion.

During the course of our study we identified a number of minorerrors in reports published previously of NFKBIA sequence analy-sis that are as follows: a T nucleotide, rather than a G nucleotide,at position 2734 was detected consistently in all sequences ana-lysed (our study and Jungnickel et al.14); we found the nucleotideposition of the second exon 6 polymorphism to be at 2911 in allsequences analysed, rather than 2921 as reported previously; thenucleotide position of the 19-base pair deletion polymorphism inintron 5 is 2544–2562, rather than 2555–2573 as reported previ-ously.13

Discussion

Constitutive NF-jB activation is a feature of HRS cells and lossof IjBa function is one mechanism by which this can occur. TheNFKBIA gene is mutated frequently in the HRS cells of HL(unpublished results).13–15 To determine whether NFKBIA muta-tions occurring in the germline contribute to familial clustering ofHL, we examined the entire NFKBIA gene sequence in 8 HL caseswith an affected first-degree family member. We found no inacti-

648 OSBORNE ET AL.

vating germline mutations or deletions in any of the 6 exons ofNFKBIA, although sequence polymorphisms were detected. Ourresults, albeit in a limited series of families, suggest that mutationsof NFKBIA do not play a major role in familial aggregation of HL.We cannot exclude the possibility that germline NFKBIA muta-

tions play a minor role in familial HL, given the likely genetic het-erogeneity of the heritable form of the disease.

During the course of our study, we identified a germline muta-tion (C > T transition) at position 1519 in exon 3 of NFKBIA inwhole lymph node DNA from a presumed sporadic HL patient

TABLE III – FREQUENCY OF NFKBIA POLYMORPHISMS IN CASES AND CONTROLS1

Polymorphism Genotype Cases n (%) Controls n (%) Total n (%) p-value

Test series2787Y CC 21 (41.2) 20 (40.0) 41 (40.6)

CT 26 (51.0) 22 (44.0) 48 (47.5)v2 TT 4 (7.8) 8 (16.0) 12 (11.9) 0.432911R GG 21 (41.2) 20 (40.0) 41 (40.6)

GA 26 (51.0) 22 (44.0) 48 (47.5)v2 AA 4 (7.8) 8 (16.0) 12 (11.9) 0.4319 bp del Wild type 27 (52.9) 24 (48.0) 51 (50.5)

Hetero 19 (37.3) 20 (40.0) 39 (38.6)v2 Deleted 5 (9.8) 6 (12.0) 11 (10.9) 0.87Promoter ins/del Homo del 2 (3.9) 0 (0) 2 (2.0)

Hetero del 1 (2.0) 0 (0) 1 (1.0)Wild type 45 (88.2) 47 (94.0) 92 (91.1)Hetero ins 1 (2.0) 0 (0) 0 (0)

v2 Homo ins 2 (3.9) 3 (6.0) 5 (5.0) 0.38SNEHD seriesPromoter ins/del Homo del 1 (0.3) 4 (1.2) 5 (0.7)

Hetero del 3 (0.8) 8 (2.4) 11 (1.6)Wild type 361 (96.0) 309 (94.2) 670 (95.2)Hetero ins 0 (0) 1 (0.3) 1 (0.1)Homo ins 11 (2.9) 6 (1.8) 17 (2.4)

1p-value for case control differences analysed using Pearson’s v2 test. Bp, base pair; ins, insertion; del,deletion; homo, homozygous; hetero, heterozygous; SNEHD, Scotland and Newcastle EpidemiologicalStudy of Hodgkin’s disease.

FIGURE 1 – (a) Nucleotidesequence of mutated NFKBIA exon3 from a sporadic HL patientshowing 1519C > T transition,resulting in the amino acid substi-tution Thr146Ile. (b) Proteinsequence alignment of the ankyrinrepeat 3 of human IjB familymembers and Drosophila homo-logue Cactus. The conserved sec-ondary structural elements that arecritical for binding NF-jB areshown at the top. Each repeat con-sists of a b-strand followed by 2antiparallel a helices. The ankyrinrepeat consensus sequence isshown at the bottom. Residues thatare boxed in black are identical in3 or more sequences at the sameposition. Stars identify amino acidresidues in IjBa that have beenshown to contact NF-jB fromcrystal structure studies.31,32 Arrowidentifies the mutated threonineresidue at position 146 in IjBa,which is conserved in IjBb, IjB�,bcl-3 and Cactus.

649GERMLINE NFKBIA MUTATIONS IN HODGKIN LYMPHOMA

(Fig. 1a). This mutation results in an amino acid change fromthreonine to isoleucine at residue 146 of the IjBa protein(Thr146Ile). To our knowledge this is the first report of a con-stitutional missense mutation in the NFKBIA gene. Wild-typeIjBa physically interacts with NF-jB via ankyrin repeatdomains and this prevents nuclear localisation of NF-jB andDNA binding. Thr146 is a highly conserved residue in the thirdankyrin repeat region of the IjBa protein molecule and is adja-cent to key contact residues in the IjBa/NF-jB complex (Fig.1b).31,32 Substitution of a hydrophilic threonine for a hydropho-bic isoleucine residue at this position may therefore affect theability of IjBa to interact with, and thus inhibit, NF-jB. Thismutation was not detected in any of the familial HL casesexamined or in an additional 51 cases of sporadic HL. Itremains to be determined whether this represents an uncommonpolymorphism in the general population or whether it repre-sents a functional disease-related mutation.

We next investigated the frequencies of 4 polymorphisms in theNFKBIA gene and promoter region in a series of HL cases andcontrols. Polymorphisms with the potential to affect expression ofthe NFKBIA gene were chosen for evaluation, as described above.No significant differences in the frequencies of the SNPs at posi-tions 2787 and 2911, or in the 19-base pair deletion in intron 5,were observed in case and control groups (Table III). The 19-basepair deletion was selected for analysis because loss of thissequence could potentially create a novel splice site. RT-PCRanalysis using mRNA from the HL-derived cell lines L428 (thatcontains only a mutant NFKBIA allele with the 19-base pair dele-tion)13 and L591 (wild-type) did not show the presence of an alter-natively spliced transcript in L428 cells (data not shown).

Miterski et al.25 reported previously that an insertion of an8-base pair sequence in the NFKBIA promoter was associated witha decreased risk of primary progressive MS. Because MS and HLhave been associated previously,26,27 we investigated the fre-

quency of this polymorphism in HL. In our initial analysis of 101samples, the insertion was found at similar frequencies in case andcontrol groups (Table III). An additional deletion restricted to 3HL cases was also detected. This raised the possibility that thenumber of copies of the imperfect repeat sequence(GGGGGGGA/T) might be associated with risk of MS and HL.We therefore investigated this region of the promoter using alarger series of samples that were derived from a population-basedstudy of HL. Insertions and deletions accounted for 2.5% and1.5% of the alleles, respectively, and were similarly distributed incase and control groups, thus providing no evidence for an associ-ation between risk of HL and the number of repeats. In the presentanalysis the insertion was detected much less frequently than inthe study by Miterski et al.,25 who detected the insertion in 28.4%of alleles in their control population. The reasons for this differ-ence are not clear.

In conclusion, we found no inactivating germline mutations ordeletions in any of the 8 familial HL patients investigated,although frequent germline polymorphisms in NFKBIA were con-firmed. A novel missense mutation with the potential to impairIjBa/NF-jB binding was detected in the germline of a case ofpresumed sporadic HL. Investigation of a larger number of fami-lial HL cases is required to screen for additional missense muta-tions and to test for potential associations between less frequentpolymorphic variants and risk of disease.

Acknowledgements

We are grateful to L. Shield and J. Freeland for technical assis-tance and to B. Miterski for helpful correspondence. Our studywas supported by the Leukaemia Research Fund as part of a LRFSpecialist Program and the SNEHD study was funded by the KayKendall Leukaemia Fund.

References

1. Kerzin-Storrar L, Faed MJ, MacGillivray JB, Smith PG. Incidence offamilial Hodgkin’s disease. Br J Cancer 1983;47:707–12.

2. Razis DV, Diamond HD, Craver LF. Familial Hodgkin’s disease: itssignificance and implications. Ann Intern Med 1959;51:933–71.

3. Grufferman S, Cole P, Smith PG, Lukes RJ. Hodgkin’s disease in sib-lings. N Engl J Med 1977;296:248–50.

4. Jarrett RF, MacKenzie J. Epstein-Barr virus and other candidateviruses in the pathogenesis of Hodgkin’s disease. Semin Hematol1999;36:260–9.

5. Lin AY, Kingma DW, Lennette ET, Fears TR, Whitehouse JM,Ambinder RF, Jaffe ES, Levine PH, Tucker MA. Epstein-Barr virusand familial Hodgkin’s disease. Blood 1996;88:3160–5.

6. Mack TM, Cozen W, Shibata DK, Weiss LM, Nathwani BN, Hernan-dez AM, Taylor CR, Hamilton AS, Deapen DM, Rappaport EB. Con-cordance for Hodgkin’s disease in identical twins suggesting geneticsusceptibility to the young-adult form of the disease. N Engl J Med1995;332:413–8.

7. Greene MH, McKeen EA, Li FP, Blattner WA, Fraumeni JF Jr.HLA antigens in familial Hodgkin’s disease. Int J Cancer 1979;23:777–80.

8. Hors J, Dausset J. HLA and susceptibility to Hodgkin’s disease.Immunol Rev 1983;70:167–92.

9. Harty LC, Lin AY, Goldstein AM, Jaffe ES, Carrington M, TuckerMA, Modi WS. HLA-DR, HLA-DQ, and TAP genes in familialHodgkin disease. Blood 2002;99:690–3.

10. Chakravarti A, Halloran SL, Bale SJ, Tucker MA. Etiological hetero-geneity in Hodgkin’s disease: HLA linked and unlinked determinantsof susceptibility independent of histological concordance. Genet Epi-demiol 1986;3:407–15.

11. Horwitz M, Wiernik PH. Pseudoautosomal linkage of Hodgkin dis-ease. Am J Hum Genet 1999;65:1413–22.

12. Shears DJ, Endris V, Gokhale DA, Dearden SP, Radford JA, RappoldGA, Taylor GM. Pseudoautosomal linkage of familial Hodgkin’s lym-phoma: molecular analysis of a unique family with Leri-Weill dys-chondrosteosis and Hodgkins lymphoma. Br J Haematol 2003;121:377–9.

13. Cabannes E, Khan G, Aillet F, Jarrett RF, Hay RT. Mutations in theIjBa gene in Hodgkin’s disease suggest a tumour suppressor role forIjBa. Oncogene 1999;18:3063–70.

14. Jungnickel B, Staratschek-Jox A, Brauninger A, Spieker T, Wolf J,Diehl V, Hansmann ML, Rajewsky K, Kuppers R. Clonal deleteriousmutations in the IjBa gene in the malignant cells in Hodgkin’s lym-phoma. J Exp Med 2000;191:395–402.

15. Emmerich F, Meiser M, Hummel M, Demel G, Foss HD, Jundt F,Mathas S, Krappmann D, Scheidereit C, Stein H, Dorken B. Over-expression of IjBa without inhibition of NF-jB activity and muta-tions in the IjBa gene in Reed-Sternberg cells. Blood 1999;94:3129–34.

16. Bargou RC, Emmerich F, Krappmann D, Bommert K, Mapara MY,Arnold W, Royer HD, Grinstein E, Greiner A, Scheidereit C, DorkenB. Constitutive nuclear factor-jB-RelA activation is required for pro-liferation and survival of Hodgkin’s disease tumor cells. J Clin Invest1997;100:2961–9.

17. Wood KM, Roff M, Hay RT. Defective IjBa in Hodgkin cell lineswith constitutively active NF-jB. Oncogene 1998;16:2131–9.

18. Ito CY, Adey N, Bautch VL, Baldwin AS Jr. Structure and evolutionof the human IjBa gene. Genomics 1995;29:490–5.

19. Conne B, Stutz A, Vassalli JD. The 30 untranslated region of messen-ger RNA: a molecular �hotspot� for pathology? Nat Med 2000;6:637–41.

20. Ejima Y, Yang L, Sasaki MS. Aberrant splicing of the ATM geneassociated with shortening of the intronic mononucleotide tract inhuman colon tumor cell lines: a novel mutation target of microsatel-lite instability. Int J Cancer 2000;86:262–8.

21. Hefferon TW, Broackes-Carter FC, Harris A, Cutting GR. Atypical 50splice sites cause CFTR exon 9 to be vulnerable to skipping. Am JHum Genet 2002;71:294–303.

22. Mount SM. A catalogue of splice junction sequences. Nucleic AcidsRes 1982;10:459–72.

23. Shapiro MB, Senapathy P. RNA splice junctions of different classesof eukaryotes: sequence statistics and functional implications in geneexpression. Nucleic Acids Res 1987;15:7155–74.

24. Mozzato-Chamay N, Corbett EL, Bailey RL, Mabey DC, Raynes J,Conway DJ. Polymorphisms in the IjB-a promoter region and risk ofdiseases involving inflammation and fibrosis. Genes Immun2001;2:153–5.

25. Miterski B, Bohringer S, Klein W, Sindern E, Haupts M, SchimrigkS, Epplen JT. Inhibitors in the NFjB cascade comprise prime candi-

650 OSBORNE ET AL.

date genes predisposing to multiple sclerosis, especially in selectedcombinations. Genes Immun 2002;3:211–9.

26. Newell GR. Etiology of multiple sclerosis and Hodgkin’s disease. AmJ Epidemiol 1970;91:119–22.

27. Hjalgrim H, Rasmussen S, Rostgaard K, Nielsen NM, Koch-Henrik-sen N, Munksgaard L, Storm HH, Melbye M. Familial clustering ofHodgkin lymphoma and multiple sclerosis. J Natl Cancer Inst2004;96:780–4.

28. Alexander FE, Lawrence DJ, Freeland J, Krajewski AS, Angus B,Taylor GM, Jarrett RF. An epidemiologic study of index and familyinfectious mononucleosis and adult Hodgkin’s disease (HD): evi-dence for a specific association with EBV1ve HD in young adults.Int J Cancer 2003;107:298–302.

29. Jarrett RF, Krajewski AS, Angus B, Freeland J, Taylor PR, TaylorGM, Alexander FE. The Scotland and Newcastle epidemiologicalstudy of Hodgkin’s disease: impact of histopathological reviewand EBV status on incidence estimates. J Clin Pathol 2003;56:811–6.

30. Ito CY, Kazantsev AG, Baldwin AS Jr. Three NF-j B sites in theIjB-a promoter are required for induction of gene expression by TNFa. Nucleic Acids Res 1994;22:3787–92.

31. Huxford T, Huang DB, Malek S, Ghosh G. The crystal structure ofthe IjBa/NF-jB complex reveals mechanisms of NF-jB inactivation.Cell 1998;95:759–70.

32. Jacobs MD, Harrison SC. Structure of an IjBa/NF-jB complex. Cell1998;95:749–58.

651GERMLINE NFKBIA MUTATIONS IN HODGKIN LYMPHOMA