grna/shrna hit distribution (cml-p cell line) 100% 60% ... · 60% hits/gene grna shrna grna/shrna...

1

Upload: others

Post on 20-Apr-2020

8 views

Category:

Documents

0 download

Report

Download

Embed Size (px):

TRANSCRIPT

Page 1: gRNA/shRNA hit distribution (CML-P cell line) 100% 60% ... · 60% hits/gene gRNA shRNA gRNA/shRNA hit distribution (CML-R cell line) 100% hits/gene shRNA RNAi/CRlSPR: shared Gene

PrecisionX™ Multiplex gRNA Cloning Kit Cat. # CAS9-GRNA-KIT€¦ · Cloning Kit is also compatible with the most popular Cas9/gRNA cloning vectors developed in labs across the world,

CRISPR / Cas9-mediated Gene Knockout to Address Primary ... · LNP-based liver knockout approach is limited to 20-mer of gRNA Potential to treat PH1 with either: 1. CRISPR / Cas9-mediated

A pipeline for the generation of shRNA transgenic mice

3/23/[email protected] shRNA libraries with DNA Sudoku Yaniv Erlich Hannon Lab Yaniv Erlich Hannon Lab shRNA libraries sequencing using DNA Sudoku

GeneArt Precision gRNA Synthesis Kit · The GeneArt™ Precision gRNA Synthesis Kit provides a fast workflow for generating full length gRNA for use with Streptococcus pyogenes Cas9

Oligo sequence for shRNA cloning TurboGFP shRNA upper strand CCGGCGTGATCTTCACCGACAAGATCTCGAGATCTTGTC…

Invitrogen TrueGuide Synthetic gRNA · TrueGuide™ Synthetic Guide RNA User Guide 3 Prepare working stock of TrueGuide™ Synthetic gRNA 1.Before opening, centrifuge each TrueGuide

Lentiviral shRNA expression Cloning Kit User Manual for ...Lentiviral shRNA expression Cloning Kit User Manual for making shRNA expression lentivectors Each Kit Contents Amount One

Research Paper Localized Delivery of shRNA against … Paper Localized Delivery of shRNA against PHD2 ... ... Theranostics)

Supplementary Information for - PNAS · 2020. 2. 22. · shRNA-resistant CPSF6 (GenBank NM_007007.2; synonymous mutations in the nucleotide sequence targeted by CPSF6 shRNA were introduced)

PLATINUM Select MLP Retroviral shRNA-mir - transOMIC · Platinum Select MLP Retroviral shRNA-mir collections are available as individual constructs, target gene sets, gene families

PrecisionX™ Multiplex gRNA Cloning Kit Cat. # CAS9-GRNA-KIT€¦ · efficiency of the Multiplex gRNA Cloning Kit is an industry-first – designed with the researcher in mind who

transEDIT™ Lentiviral Pooled gRNA Libraries...All gRNA/Cas9 plasmid DNA pools are evaluated by next-generation sequencing (NGS) for distribution and representation analysis. Quality

Inducible Dharmacon TRIPZ Lentiviral shRNA · IRES PuroR WPRE shRNA AmpR pUCori SV40 ori UBC pTRIPZ 5 ʹ 3' SIN LT R 3 ʹ SI N LT R Ψ RRE tRFP TRE rtTA3 IRES PuroR WPRE shRNA hCMV

In Vivo ShRNA Screens in Solid Tumors2014

One step generation of customizable gRNA vectors for

Genome-wide shRNA screening identifies genes involved in fulvestrant … · Pedro André Dias Ramos Licenciatura em Bioquímica Genome-wide shRNA screening identifies genes involved

static-content.springer.com10.1245... · Web viewThe National RNAi Core Facility, Academia Sinica provided CDC25A, PDCD4, c-Myc, and IκBα shRNA. The target sequences for shRNA are

shRNA Lentiviral Packaging Service - System Biosciences · 2019-09-27 · shRNA. Why choose SBI ? SBI’s custom service scientists have significant packaging expertise and over 10

Improved delivery of Cas9 protein/gRNA complexes …...ORIGINAL RESEARCH PAPER Improved delivery of Cas9 protein/gRNA complexes using lipofectamine CRISPRMAX Xin Yu . Xiquan Liang

CRISPR SYSTEM DESIGN GUIDE gRNA RNAs · 2020-06-26 · CRISPR-mediated knock-out screens are a powerful tool to investigate gene function directly in mammalian cells. Genes of interest

Coupling shRNA screens with single-cell RNA-Seq identifies

CRISPR/Cas9 mediated chicken Stra8 gene knockout and ... · down efficiency was 12% (3/25). Cell morphology, qRT-PCR, immunostaining and FCS indi-cated that Cas9/gRNA not only resulted

Functional genomics screen with pooled shRNA …Functional genomics screen with pooled shRNA library and gene expression profiling with extracts of Azadirachta indica identify potential

CRISPR / Cas9-mediated Gene Knockout to Address Primary … · 2020. 4. 29. · LNP-based liver knockout approach is limited to 20-mer of gRNA Potential to treat PH1 with either:

Design high specificity CRISPR-Cas9 gRNAs: principles and ... · Similar principle as gRNA design for wild-type Cas9 Two gRNAs are needed to target each strand of the target gene

Silencing the HSL Gene in Human 293 Cells - Worcester · PDF file · 2007-01-04Silencing the HSL Gene in Human 293 Cells ... Construction of pQHSL-shRNA ... to many uses of gene silencing

Gene editing and modulation tools for long non-coding RNA ... · GENE EDITING AND MODULATION TOOLS FOR LONG NON-CODING RNA APPLICATIONS P2 5. Functional Validation of Dual-gRNA Vector

Agilent SureGuide gRNA Synthesis Kit Guide · a U.S. Government prime contract or sub-contract, Software is delivered and ... Agilent SureGuide gRNA Synthesis Kit Kit Components and

shERWOOD UltramiR Retroviral shRNA (pLMN) - … · shERWOOD UltramiR Retroviral shRNA (pLMN) ... Neomycin selection (Neomycin kill curve) The pLMN retroviral vector has a neomycin

shRNA: The Basics Einstein Presentation Title...2012/02/29 · Einstein Presentation Title Albert Einstein College of Medicine Presentation Subtitle shRNA: The Basics! Deborah Smith,

NIH Public Access Cancer Gene Ther B Guo …...Targeted therapy via oral administration of attenuated Salmonella expression plasmid-vectored Stat3-shRNA cures orthotopically transplanted

Dharmacon solutions for studying gene function · Ready-to-use plates or standard quantities? microRNA Are your cells difficult to transfect? lncRNA shRNA glycerol stock clones GIPZ,

Cas9/gRNA-mediated genome editing of yeast …Cas9/gRNA-mediated genome editing of yeast mitochondria and Chlamydomonas chloroplasts Byung-Chun Yoo, Narendra S. Yadav, Emil M. Orozco