in vivo shrna screens in solid tumors2014

8/16/2019 In Vivo ShRNA Screens in Solid Tumors2014

1/23

PROTOCOL

2880 | VOL.9 NO.12 | 2014 | NATURE PROTOCOLS

INTRODUCTION

Tumorigenesis is a multistep process that encompasses multiplegenetic and epigenetic alterations. Mechanistically, cellulartransformation involves alterations of cell-autonomous functions,

as well as interaction between tumor cells and their microenvi-ronment. High-throughput sequencing of cancer genomes, tran-scriptomes and epigenetic features has uncovered an enormous

number of aberrations that include both driver mutations and(confounding) passenger alterations. Unbiased genetic screensare powerful tools for investigating functional relationships

between (cancer) genes and phenotypes. Genetic screens basedon insertional mutagenesis by either retroviruses or transposonsare traditionally used to discover new cancer genes, to investigate

collaborative oncogenic relationships or—to a lesser extent—to

uncover haploinsufficient tumor-suppressor genes (TSGs)1.Traditionally, these systems are exploited for genetic screens inspontaneous models for tumorigenesis and progression. Their

limitations include potential nonphysiological overexpressionbias (e.g., oncogene discovery) and the impossibility of knock-ing out both alleles of a TSG in diploid cells (LOF). In addition,

they have limited potential for use in genetic screens in orthotopicand patient-derived xenograft models.

In vivo genetic screening using RNAi

RNAi using pooled shRNA results in heritable, long-term and sta-ble suppression of multiple gene functions, facilitating unbiased

or large-scale LOF screens during tumorigenesis. RNAi screens

meet the criteria of a forward genetic screen when consideringthe tumors as the phenotypic manifestation of genetic or epige-

netic aberrations. This technology has been exploited for morethan a decade by cancer biologists to investigate the phenotypicconsequences of genetic LOF in established cell lines2. It is now

applicable to animal models owing to the increasing throughputand decreased costs associated with next-generation sequenc-ing (NGS), which has enabled individual shRNAs to be used asbiological probes to induce phenotypes but also as ‘cellular bar-

codes’ to track cell fate in vitro or in vivo. Indeed, successful LOFexperiments using pooled shRNA libraries have been reported inanimal models of hepatocellular carcinoma, lymphoma, glioma,

leukemia and breast cancer3–8.

Experiments in lymphomas have shown that several geneshave functions that are dispensable in tissue culture conditionsbut are important during tumorigenesis owing to interactionwith the host tissues5. This observation underscores the value

of in vivo RNAi screens, and it illustrates their power inexposing the tumor cells’ vulnerability in the context of theirmicroenvironment.

An in vivo RNAi screening experiment relies on the silencing ofa panel of genes in a cell population with tumor-initiating capac-ity, followed by implantation of the modified cells into recipient

animals (generally mice), and it uses the tumor outgrowth asan endpoint (Fig. 1). In these experiments, TICs modified withpooled shRNA libraries proliferate until tumors are detectable

and the initial homogeneous representation of single-shRNAmodified cells is skewed toward a set of tumor cells that receiveda functional advantage owing to the RNAi-induced LOF. Here we

generically define TICs as a population of cells with the abilityto generate a tumor in recipient animals, which includes—but isnot limited to—the so-called ‘cancer stem cells’.

In vivo shRNA screens in solid tumorsGaetano Gargiulo1, Michela Serresi1, Matteo Cesaroni2, Danielle Hulsman1 & Maarten van Lohuizen1,3

1Division of Molecular Genetics, the Netherlands Cancer Institute, Amsterdam, the Netherlands. 2Fels Institute, Temple University School of Medicine, Philadelphia,Pennsylvania, USA. 3Cancer Genomics Centre, the Netherlands. Correspondence should be addressed to G.G. ([email protected]).

Published online 20 November 2014; doi:10.1038/nprot.2014.185

Loss-of-function (LOF) experiments targeting multiple genes during tumorigenesis can be implemented using pooledshRNA libraries. RNAi screens in animal models rely on the use of multiple shRNAs to simultaneously disrupt gene function,as well as to serve as barcodes for cell fate outcomes during tumorigenesis. Here we provide a protocol for performingRNAi screens in orthotopic mouse tumor models, referring to glioma and lung adenocarcinoma as specific examples.The protocol aims to provide guidelines for applying RNAi to a diverse spectrum of solid tumors and to highlight crucialconsiderations when designing and performing these studies. It covers shRNA library assembly and packaging into lentiviralparticles, and transduction into tumor-initiating cells (TICs), followed by in vivo transplantation, tumor DNA recovery,sequencing and analysis. Depending on the target genes and tumor model, tumor suppressors and oncogenes can be identifiedor biological pathways can be dissected in 6–9 weeks.

b

Neutral shRNA

Tumor-promoting shRNA(candidate tumor suppressor)

Dropout shRNA(candidate oncogene)

Target genes

required for cell viability

TSGs

Oncogenes

Synthetic lethal interactions

Mechanisms of (intrinsic) resistance

Modulators of biological pathways

Library representation(suggested)

100–200×

1,000–2,000×

1,000–2,000×

1,000–2,000×

Variable

Tumor-initiating cells potency

a

Figure 1 | Principles underlying in vivo RNAi screen in tumorigenesis.(a,b) Possible applications for in vivo RNAi screens (a) and suggestions forlibrary representation thresholds (b).

http://www.nature.com/doifinder/10.1038/nprot.2014.185http://www.nature.com/doifinder/10.1038/nprot.2014.185


2/23

PROTOCOL

NATURE PROTOCOLS | VOL.9 NO.12 | 2014 | 2881

Typically, shRNA-mediated suppression

of (cooperative) oncogenes will cause theprogressive depletion of the cells carry-ing the ‘adverse’ shRNA. The final set of

tumor-enriched shRNAs will be com-posed of hairpins that target putative TSGswith ‘contaminating’ neutral shRNAs,

the extent of which largely depends onthe duration of the experiment (i.e., thelonger the experiment, the lower thenumber of neutral shRNAs recovered).

Successful tumorigenesis indicates thatpart of the modified TICs retained orenhanced their ability to induce a diseased

state compared with the bulk population:the real information is uncovered by track-ing single-hairpin segregation during

this process, as it may expose factors thatare either required for or detrimentalto it. Specifically, if the genetic makeup

of a TIC population is predisposedto induce tumorigenesis, hairpins thatimpair the tumor suppressor functions

will promote the outgrowth of a clonalcell population. Conversely, when a cru-cial gene function that entails tumor

growth in vivo is targeted by one shRNA,the relative cells will be depleted over timeor may even disappear from the finaltumor. Hairpins with little or no func-

tional consequences may show an interme-diate phenotype. Hence, a typical in vivo RNAi screen reveals the dynamics of

individual cells modified by one addi-tional genetic event (i.e., LOF) involvingeither an oncogene or a TSG. To eventu-

ally track down single hairpin dynamics,shRNA counts are determined in tumorsand normalized to a reference sample

(hereafter referred to as ‘input’) in whichthe initial library complexity is preserved. It is noteworthy thatfeatures such as proximal or distal metastasis may also be set as

an end point.

Overview of the procedure for a typical in vivo RNAi screen

Our current procedure for performing in vivo RNAi screens can

be divided into six main modules, as outlined in Figure 2:

Production of shRNAs. Preselected shRNAs are first individuallyexpanded as bacterial cultures and then pooled together whenconfluence is reached. This enables flexibility in shRNA selection,

and it allows individual confirmation of successful amplifica-tion of bacterial stocks. Finally, it reduces the risk of unbalancedgrowth, which may result in any given shRNA being over- or

under-represented (Figs. 2 and 3).Transfection. A shRNA library pool is transfected into HEK293Tcells along with third-generation lentiviral particle packag-

ing constructs, and target TICs are infected at a multiplicity ofinfection (MOI) that should be tumor-promoting shRNA(candidate tumor suppressor)

**shiii --> dropout shRNA(candidate oncogene)

In vivo

In vitro

f

Figure 2 | Outline of an in vivo shRNA screen. (a–d) shRNA library assembly, transfection andtransduction (a–c), is followed by implantation of shRNA modified cells into recipient animals (d).(d–f ) Tumor-enriched shRNAs are amplified from tissue or FACS-purified cells by PCR (d,e) and countedto identify enrichments and dropouts (f ).


3/23

PROTOCOL


amplification, barcode-tagging for multiplex sequencing) and

PCR2 (to introduce Illumina Solexa P5–P7 adapters), and thenlibraries are quantified, mixed and sequenced (Fig. 4).Data analysis. DNA sequences are aligned to the reference setof the hairpin list, and each identified hairpin is counted and

associated with the related barcode (i.e., the original sample).Each hairpin within each tumor sample is normalized by the se-quencing depth (i.e., total counts per sample) and by the relative

abundance to the input control. A final list of tumor enrichmentsand dropouts is then generated for validation (Fig. 5).

Applications and variations in in vivo RNAi screen in solid tumors

Solid tumors present challenges that should be considered whenperforming an in vivo shRNA screen. Ideally, it should be possible

•

to perform in vivo RNAi screens in TICs to simultaneously

uncover oncogenes and tumor suppressors; however, somelimitations apply.

Here we outline two in vivo RNAi screening settings in whichcrucial restrictions surmised from our experience are highlighted

and addressed. We performed an in vivo enrichment RNAi screenfor tumor suppressors in a mouse model for glioma whereby wedesigned a custom shRNA library that had a high likelihood of

including tumor suppressors and that would be active in vivo but not in vitro. This was achieved by selecting interspecies-conserved target genes of a well-established oncogenic transcrip-

tional repressor (the Polycomb-group protein Bmi1). In this screen,we used EgfrvIII ;Cdkn2a−/− TICs, which are sufficiently potentto ensure an homogeneous graft and high penetrance, and which

0

20

40

60

80

100

120

~130× per

mouse

~2,000× per

mouse

Predicted

Sequenced

Transduced

Maintained in vivo

Maintained in vitro

F r a c t i o n o f t h e s h R N A l i b r a r y ( % )

b

105

105

104

104

103

103

102

102

101

101

100

100

10–1

O v e r n i g h t e x p a n s i o n

Plasmid libraries

R = 0.9791

a

105

104

103

102

101

100

4-h expanded shRNA library

Transduced versus plasmid library

R = 0.9904 I n p u t R N A i s c r e e n

105

104

103

102

101

100

R = 0.9239 I n v i t r o

R N A i s c r e e n

In vitro versus plasmid library

Figure 3 | Example of hairpin segregation during in vitro or in vivo procedures. (a) Left graph depicts the pairwise correlation of an ~1,300-hairpin libraryafter assembly and propagation for either short (4 h, x axis) or long amplification duration (~12 h, y axis). Middle and right graphs represent the correlation

between the hairpins present in a mouse lung adenocarcinoma cell line input (reference sample) before and after ~3 weeks of in vitro propagation,

respectively. Note the high correlation after sequencing. R-squared values are calculated using polynomial quadratic nonlinear regression. ( b) Total number ofindividual hairpins retrieved in an in vivo RNAi screen in glioma with limited library representation or in lung adenocarcinoma with higher representation. All

animal experiments were conducted in compliance with EU guidelines for the use and care of laboratory animals and were reviewed and approved by the animal

ethics committee (DEC) of the Netherlands Cancer Institute.

Box 1 | shRNA library technologies for in vivo RNAi screens

The most widely used commercially available libraries for RNAi screens (both in vitro and in vivo) are from the TRC consortium,

whereby stem-loop shRNAs are individually available in the pLKO.1 lentiviral third-generation self-inactivating lentiviral vector

derived from pRRLSIN.cPPT.PGK/GFP/WPRE14. Recently, the TRC 1.0 library has been optimized and released as a TRC 2.0 version

with improved vector-dependent silencing efficiency, shRNA design and validation. The main asset of this technology is the intrinsic

flexibility, which enables a high level of customization owing to the availability of single clones for each hairpin. ShRNAs are

transcribed by a polymerase III promoter endowed with intrinsic low risk of insertional mutagenesis compared with retroviral vectors29.

One limitation of the pLKO.1 is that several hairpins (~50%) show weak functional knockdown under single-copy transduction

conditions (G.G. and M.S., unpublished observations). In contrast, because of the low level of expression with single integrations,

the toxicity reported in animal models owing to the saturating effect of shRNAs over endogenous miRNA is less concerning.

An alternative technology for shRNA libraries uses the mir30 design in retroviral vectors. This system has the advantage of being

more ‘physiological,’ as it engages the microRNA machinery early on and is driven by a polymerase II promoter allowing cocistronic

expression of fluorescent markers for selection (optimal for in vivo use). Recent improvements of this technology overcome most of the

former limitations (retroviral vectors and low-potency knockdown), by introducing a dual-color system that enables tracking of

reasonably equally effective integrations, a lentivector backbone and a sequence motif enabling more efficient knockdown30,31.

Although the predicted risk of insertional mutagenesis owing to the use of a PolII promoter remains, experimental data do not

support this concern4,5.

Finally, a recent technology distributed by Cellecta and recently used in in vivo RNAi studies32 is based on a lentivector with

dual selection markers, the pRSI9-U6-(sh)-UbiC-TagRFP-2A-Puro. Currently, mouse and human libraries are preassembled in sets or

(common) pathways and distributed through Addgene (http://www.addgene.org/decipher/ ), with a pipeline for use and analysis

(http://www.decipherproject.net/ ). Thus, the system is freely accessible but is less flexible than the TRC library. However, the

lentivector uses fluorescent reporters for simple assessment of MOI. Moreover, barcodes are independent of shRNAs, enabling the

discrimination of clonal expansion versus collective tumor formation, and creating a potent system for delivery, long-term and stable

knockdown (it is claimed up to ~65% of functional hairpins).

http://www.addgene.org/decipher/http://www.decipherproject.net/http://www.decipherproject.net/http://www.addgene.org/decipher/


4/23

PROTOCOL


become more aggressive upon additional tumor suppressorinactivation6. In addition, we performed an RNAi dropout screen

to optimize oncogene discovery in a KrasG12D;Trp53−/− lungadenocarcinoma model (G.G. and M.S., unpublished data), whichis more permissive for transplantation of thousands of cells.

Dropout RNAi screens are very important to uncover oncogenes

and synthetic lethal interactions between two genes or betweenone gene and one pharmacological treatment.

Although it will be important to optimize each parameter to

the specific setting, we provide a simplified set of principles inFigure 1b and Tables 1 and 2.

F L 2

a

b

105

103

104

100

105

103

104

100

FL1

*

*autofluorescence

Sort GFPpos

Tumor-cell gate

1503

1003

503

2003

2503

1003

503

S S C - A

Live-cell gate

Life gate

FSC-A150

3100

350

3

Single cells

Single-cell gate

SSC-A

S S C - H

d

300

M #1 #2 #3 #4 #5 #6 #7 #8 #9 #10 #11 #12 M Mpool

200


5/23

PROTOCOL


Enrichment RNAi screens for TSG discovery. In this type of screen,

each single hairpin is scored for the ability to accelerate tumorigen-esis. We recommend using cells with defined tumor-prone geneticbackgrounds—that is, with the ability to initiate tumors, yet ena-bling tumor acceleration or increased aggressiveness. Specifically,

tumor genotype with either incomplete penetrance or long latencyshould be favored. For instance, in their proof-of-principle workfor TSG discovery, Zender et al.3 initially assessed the library com-

plexity limits through a pool of 48 shRNAs including two hairpinstargeting APC, which provided a critical hit to transform theirTp53−/−; Myc embryonic hepatocytes. Likewise, Bric et al. used fetal

liver Eµ-Myc hematopoietic stem and progenitor cells (fl-HSPCs),which have incomplete penetrance, as a lymphomagenesis model.The authors analyzed the segregation of a validated shRNA target-

ing Trp53 within a pool of 48 hairpins and demonstrated that thisshRNA scored as tumor-promoting, thusserving as an internal reference4. In our gli-

oma study, we demonstrated the ability ofthe shRNA library used to accelerate tum-origenesis of EgfrvIII ;Cdkn2a−/− TICs byperforming an in vivo competition experi-

ment6. Hence, it is important to challengethe library complexity in advance using sin-gle shRNAs to initiate/accelerate the tumor,

as well as to perform a competition assaybetween tumor-promoting shRNA-bearingand control cells. Conversely, we do not

recommend using potent genotypes, as thismay blur the consequence of inactivatingtumor suppressive mechanisms. To avoid

loss of resolution power, we also discouragethe inclusion of potent tumor-promotingshRNAs in the main screen.

Finally, the number of animals used inthis RNAi screen type should be sufficientto perform adequate statistical analyses

(e.g., >20; ref. 6). In fact, if multiple targets

within a given library are expected to be

tumor promoting, a large set of animalswill be required to discriminate a positiveeffect on tumorigenesis from the random

occurrence of tumor clones. To this end,we recommend that the final number ofanimals in the analysis be estimated on the

basis of a pilot screen.

Dropout RNAi screens for oncogene

discovery. This type of screen is based on

the negative selection or dropout of thecells targeted by a hairpin. A pre-requisiteto discriminate functional dropouts from

the neutral hairpins that may also behaveas dropouts is using potent tumor geno-types. This would circumvent the impact

of stress-related genetic pressure, which inturn might result in clonal expansion dueto the acquisition of additional confound-

ing genetic or epigenetic events.To provide experimental (indirect)

support to a functional dropout in their Eµ-Myc lymphomacell population, Meacham et al.5 performed an in vivo competi-tion experiment showing that tumors treated with doxorubicinpromote the enrichment of a small fraction of cells previously

modified with an shRNA targeting topoisomerase 2α (Top2a),which is required for chemotherapy-induced cytotoxicity.

When less-potent tumor genotypes are used, we recommendincluding in the screen shRNAs that suppress one or two crucial

oncogenes on which the tumorigenesis previously showeddependence (i.e., epidermal growth factor receptor (Egfr ) forglioblastoma multiforme (GBM) or β-catenin (Ctnnb1) and high

mobility group box 3 (Hmgb) for MLL-AF9-leukemia; refs. 6,9).In our hands, five animals per group are sufficient to obtainreproducible profiles, provided that the library representation is

appropriate (see ANTICIPATED RESULTS).

TABLE 1 | Model system of choice for in vivo RNAi enrichment screen in gliomagenesis.

Transplantation limit 100,000a

Library size (hairpins) 789

Coverage per animal ~125×

Genotype Oncogene gain (EgfrvIII ), TSG loss ( INK4a and ARF )

Genetic and epigenetic makeup Homogeneous

Tumorigenic potential Medium

Power to score enrichments High

Inference on Input (abundance) and in vitro (biological activity)

Power to score dropout Low

Potential caveats Non-cell-autonomous clonal expansionaThe number of cells may be increased by decreasing the speed of injection (preferably) or by increasing the cell concentration(not recommended because of clumping).

TABLE 2 | Model system chosen for in vivo RNAi dropout screen in lung adenocarcinomaformation.

Transplantation limit 2,600,000

Library size (hairpins) 1,300

Coverage per animal ~2,000×

Genotype Oncogene gain (Kras), TSG loss (Tp53)

Genetic and epigenetic makeup Heterogeneous

Tumorigenic potential High

Power to score enrichments Medium (but scoring liver/kidney/spleen/bone metas-

tasis as endpoint is possible)

Inference on Input (abundance) and in vitro (biological activity)

Power to score dropout High

Potential caveats Grafting issues


6/23

PROTOCOL


A slight variation on the theme is the quest for synthetic lethal

interactions, a setting in which tumor genotypes are screenedfor genes on which they appear to be specifically dependent onor ‘addicted’ to. For instance, different tumor genotypes may

be screened with the same library. In this case, the syntheticlethal hits specifically drop out in one genotype and not in theothers, which requires a substantial library representation (Fig. 1b)

and the use of reasonably comparable tumor genotypes in terms ofgrowth rate.

Experimental design

The following parameters need careful consideration whendesigning an in vivo RNAi screen experiment:

Number of cells to be implanted in recipient animals. Orthotopicmodel systems are valuable tools to dissect both cell-autonomousand microenvironment-dependent mechanisms, but they impose

numerical limitations to in vivo RNAi screens. The number ofcells introduced into a single animal should be carefully relatedto the pathophysiology of the tumor under analysis. Clonal selec-

tion may occur because of excessively stringent conditions, and,vice versa, from the use of a markedly high cell number createsfavorable conditions for nonpathophysiological tumors to arise.

These limitations are generally addressed in validated models.For instance, in line with current literature, for glioma and lungadenocarcinoma models, we reached the limit of 1 × 105 and

2.6 × 106 cells, respectively (Tables 1 and 2). In turn, we restrictedour screen to ~1 × 103 hairpins. We expect our design of thelibrary size, taking into account the transplantation limit, to beextendable to other tumor models.

TIC genotype and species. TICs need to have a homogeneousand strong grafting ability to enable control over the library rep-

resentation and to minimize the potential occurrence of unre-lated genetic or epigenetic alterations10. We suggest calibrating thechoice of the TICs to the scientific aim of the screen. To investigate

the mechanisms involved in tumor initiation, we choose to per-form RNAi screen in primary mouse EgfrvIII;Cdkn2a−/− neuralprogenitor cells, which comprise a phenotypically or genetically

homogeneous TIC population (i.e., in the absence of additionalmutations, each cell has an identical ability to contribute to glio-mas). To understand tumor progression mechanisms, we used pri-

mary mouse KrasG12D;Trp53−/− lung adenocarcinoma cells. Thesecells are tumor-derived and tissue culture–adapted, and as suchthey might bear heterogeneous genetic or epigenetic alterationswhile being homogeneously dependent on the KrasG12D; Trp53−/−

genotype (G.G. and M.S., unpublished observations).We suggest caution when using human tumor cells owing toissues that relate to graft rejection and that are biologically irrel-

evant for tumorigenesis (G.G. and M.S., unpublished observa-tions). In this case, a higher library representation may be required(see ‘Library complexity and representation’ below).

Tumor initiation potential. This feature defines the ability ofeach transplanted cell to participate in tumor formation, and it isimportant when screens are designed to discover cancer genes such

as tumor suppressors or oncogenes. For TSG-oriented screens,cells should not be extremely potent to allow effective resolu-tion of tumor-promoting hairpins (e.g., Eµ-Myc nontransformed

fl-HSPCs). Conversely, potent tumor genotypes are best suited to

screen for cooperative oncogenes or synthetic lethal interactions(e.g., Eµ-Myc tumor cells). If freshly isolated human tumor cellsare used, a prevalidated subpopulation of cells such as CD133+,

CD44+ and CD15+ (refs. 11,12) should be considered.

Target gene selection. Genes should be selected on the basis

of their conceivable impact on the model system of choice. Forinstance, genes deleted in liver cancer were tested in liver tum-origenesis3, genes generally associated with tumorigenesis weretested in lymphoma initiation and progression4,5, direct targets

of Polycomb-group repression in glioma cells were tested ingliomagenesis6 and genes functionally related to acute myeloidleukemia (AML) by previous in vitro RNAi screens were tested

in leukemogenesis9.

Library complexity and representation. The complexity (or

size) of an shRNA library refers to the number of hairpins thatcompose one pool. The representation of a single library is thenumber of times each hairpin is theoretically represented in one

animal (i.e., injected cells per complexity). Pragmatically, a rep-resentation outnumbering the complexity is required, includ-ing the experimental variation in abundance for each hairpin

(e.g., 1–2 logs). In enrichment screens, a representation of100–200× reasonably represents each hairpin in one animal, andmultiple animals in experiments grant the full representation. In

dropout screens, it is important to represent as many hairpins aspossible in each animal and to control for additional factors, suchas grafting defects, non-cell-autonomous effects, stochastic driftand heterogeneity in tumorigenic potential. To cope with this

and with upper transplantation limitations, we suggest aimingfor 1,000–2,000-fold representation.

Latency. For solid tumors, long latency (usually associated withlow-potency genotype) may result in the acquisition of additionalgenetic or epigenetic events or in the overexpansion of clonal

populations owing to non-cell-autonomous effects. This issuemay be overcome by killing the animals at half the median latency(G.G. and M.S., unpublished observations). We recommend

including a noninvasive imaging procedure for measuring tumorgrowth, such as luciferase transduction of TICs.

Biological inference. To ensure normalization of each hairpinto its initial abundance, it is essential to perform sequencing ofinput cells. However, to maximize the control for biologicallymeaningful versus stochastic variation, we suggest performing an

in vivo RNAi screen with at least one variable for the main theme(i.e., enrichment/depletion). These variables include, but are notlimited to, tissue culture versus in vivo5,6, single-gene knock-in

or knockout/knockdown versus control13, selective proteininhibitors and so on.

In summary, it is assumed that before starting the PROCEDURE,

the following requirements have been met:

Tumor models have to be chosen on the basis of validatedorthotopic mouse models (e.g., brain, lung and so on)

TICs must be chosen on the basis of the aim of the screen (e.g.,enrichment = low penetrance/long tumorigenesis = EgfrvIII ;Cdkn2a−/− GICs, and dropout = high penetrance/short latency =KrasG12D;Trp53−/− tumor cells)

•

•


7/23

PROTOCOL


Target genes must be selected (e.g., Polycomb protein Bmi1

target in brain and lung mouse tumors)Controls for dropout have to be included (e.g., mouse Egfr : 5′-GCTGGATGATAGATGCTGATA-3′, 5′-CCAAGCCAAATGGCATATTTA-3′, 5′-GCATAGGCATTGGTGAATTTA-3′ or Kras, 5′-CAAGTAGTAATTGATGGAGAA-3′, 5′-CTATACATTAGTCCGAGAAAT-3′).

Comparison between RNAi and CRISPR technologies. TheshRNA screening approach described here has been extensively usedin vitro14–16, and more recently in vivo6. Notably, it is also now feasi-

ble to perform direct in vivo RNAi screenings17. For syngenic studiesin the mouse tissues with immediate perfusion and homogeneouscellular architecture (e.g., the liver), the direct delivery of hairpins

may represent an appealing alternative to this PROCEDURE, whichinvolves the in vitro/ex vivo manipulation of TICs.

More recently, it has become possible to perform in vitro LOF

screens using the clustered regularly interspersed short palin-dromic repeat (CRISPR) technology, when considering singleguide RNAs (sgRNAs) as equivalent of the shRNAs18,19. The use

of CRISPR enables the simultaneous and irreversible knockoutof both alleles in diploid cells and, as such, the effective LOF.Although the limited application of the CRISPR technologies to

genome-wide studies in vitro showed enormous potential, thechoice between shRNA and CRISPR for in vivo experiments awaitsthe comparison of the technologies in in vivo studies, specifically

as to the role of off-target effects and the ability to perform drop-out screenings. Moreover, CRISPR may be less comparable totherapeutic intervention than the reversible gene dosage modu-lation that is achieved with RNAi, and thus these technologies

should be seen as complementary rather than exclusive. Notably,many guidelines presented here are applicable to in vivo screensusing CRISPR.

Limitations of in vivo RNAi screens in solid tumors

Limitations related to library design. Theoretically, unbiased

genome-wide RNAi screens can be performed by maintaining thecomplexity of the subpools related to the model system of choiceand by calculating the library representation on the number

of animals in the experiment. In practical terms, however, thisapproach remains cumbersome, as it relies on an initial libraryrepresentation 4)

need to be designed for each gene to confirm on-target effectsand to rule out off-target effects.Introducing a large number of cells into the orthotopic site of

a given tumor is not always possible or recommended owing to‘space constrains’ or because of possible generation of pathophy-siologically artifactual tumors. When the average limit for ortho-

topic transplants is 105–106, we prefer limiting the library size to103–104 hairpins, respectively (for ~1,000× representation).Nonorthotopic sites of injection such as s.c. flanks or the renalcapsule may provide only limited useful information (compared

with orthotopic sites).

Notably, genome-wide screen analysis is complicated by alarge fraction of hairpins that are toxic because of their activity

on cell viability 13.Thus, researchers had to make compromises between their

eagerness to perform large-scale studies and current limitations

of the in vivo RNAi platform. We and others reported proof-of-principle studies based on the rational preselection of target genesto be tested in one single experiment or on the separation of

shRNA libraries in subpools3–6,9,13,20,21. This approach is clearlysuboptimal for unbiased cancer gene discovery during tumorinitiation or progression or for investigating mechanisms of

resistance, whereas it perfectly fits the scope of a narrowed genequest or mechanistic dissection of biological pathways.

Limitations of the shRNA technology. A general consideration

that should be taken into account when designing a library forin vivo RNAi screens is that if knockdown is incomplete it can beovercome by hyperactivation of the upstream signaling; in addi-

tion, multiple non-cell-autonomous effects may confound theinterpretation of an in vivo screen. Although increasing libraryrepresentation is intended to correct for such a variable, when

designing such experiments we recommend predetermininghow validated cancer genes targeted by hairpins would behavein a competition assay or by including ‘spike-in’ controls (that is,

validated hairpins that can illustrate the resolution of the assay individing tumor-promoting or neutral versus dropout hairpins).

Furthermore, current technologies rely on permanent silenc-

ing by shRNAs (Box 2). As hairpins are biologically active shortlyafter transduction, transplantation-related stress may introducebias. Although this is not a concern for some developmental genes

that are inactive in TICs in the absence of an appropriate micro-environment (e.g., targets of Polycomb, Wnt and so on), this iscertainly an important issue for cellular nodes such as kinases orphosphatases, and transcription and splicing regulators.

•

•

Box 2 | Quality control for TRC library amplification ● TIMING ~3 d

A few deep wells with TB and without bacteria are sufficient to exclude TB contamination. To ensure that the shRNA library has being

successfully amplified, we recommend the following steps:

1. Run an agarose gel with purified DNA.

2. Perform restriction digestion analysis as indicated on the Addgene website (http://www.addgene.org/10878/ ). Please note that

the AgeI 5′ cloning site may be mutated during cloning and thus absent in several clones.

3. Perform PCR1 and PCR2 (Steps 30–38 of the main PROCEDURE) from plasmid DNA followed by TOPO cloning/Sanger sequencing of

individual colonies using PCR2 forward (P5; see Table 3). Include plasmid DNA in the high-throughput sequencing multiplexed run(Fig. 2a and Steps 30–38).

? TROUBLESHOOTING

http://www.addgene.org/10878/http://www.addgene.org/10878/


8/23

PROTOCOL


Limitations imposed by grafting efficiency. Depending on the

tumor model system of choice, issues associated with graftingefficiency may arise. For example, when performing xenotrans-plantation experiments or injecting cells into the bloodstream,

the actual number of cells initiating the tumor in situ may differsubstantially from the number of transplanted cells. This is a cru-cial issue to be taken into account and addressed before planning

the shRNA screen, as either the total representation of the library(inefficient grafting) or hard-to-control selective pressures (graft-versus-host response) might impinge on the screening results. Toprecisely measure the grafting efficiency, we recommend the use of

noninvasive bioluminescence. The simplest solutions to graftingissue are to increase the representation or to reduce the librarycomplexity. In the case of tail-vein injections as an orthotopic

model for lung adenocarcinoma, we have experienced a twofolddecrease in luciferase emission within the first 24 h after trans-plantation (Supplementary Fig. 1). Accordingly, we have increased

the library representation from 1,000 to 2,000× (Figs. 2 and 3b).However, other measures may also be taken into account depend-ing on the model system of choice, including but not limited to

the use of extremely immunocompromised mice (e.g., NOD scidgamma (NSG) mice) and the use of scaffolding such as Matrigelto enhance seeding efficiency, or of methotrexate, cyclosporin and

tacrolimus to reduce the acute graft-versus-host response.

In vivo RNAi screen validation. The outcome of the shRNA

screen will depend on the target gene preselection (i.e., the

library effect), as well as on the model system of choice (i.e., the

niche effect). In general, however, the library representation andthe duration of the tumorigenesis are key determinants of thepositive outcome of a screen (Fig. 3b). Regardless, when some

hairpins reliably stand out in a screen (e.g., multiple hairpinper gene, same behavior in multiple tumors), they are usuallyvalidated in single hairpin experiments (Fig. 5b,d). It is

important to validate the ability of individual hairpins toeffectively knockdown the predicted target (i.e., to excludeoff-target effects) and the use of different hairpins to recapitu-late one phenotype (i.e., to rule out multitranscript repression

through imperfect match or microRNA-like effects, among othersdiscussed in refs. 22,23).

To exclude that the dropout is predetermined by stable RNAi

interference, a focused validation RNAi screen may be performedusing doxycycline-regulated hairpins.

In addition, although it is very challenging in vivo, a more

elegant validation entails genetic complementation experiments,the protocol for which has been described previously in detail forin vitro RNAi screens24.

Importantly, Bric et al.4 reported on the discovery of RAD17homolog (S. pombe) (Rad17 ) as a haploinsufficient TSG in lym-phoma, a discovery that was only possible owing to moderately

effective shRNA. Hence, complementary approaches should beundertaken to fully appreciate the authentic power of in vivo RNAi screen: to uncover biological phenotypes in a context-

dependent manner.

MATERIALSREAGENTS

Custom-assembled shRNAs libraries are from the RNAi Consortium (TRC).

shRNA clones can be ordered from Sigma-Aldrich (http://www.sigmabioinfo. com/Informatics_tools/batch-search.php#shRNA ) as whole-genomelibraries, gene family subsets or individually. They are provided as frozenbacterial glycerol stock (Escherichia coli) containing terrific broth (TB) withcarbenicillin at 100 µg ml−1 and 15% (vol/vol). Glycerol clones can be usedmultiple times provided that the plates are properly sealed and stored at−80 °CCustom-designed primers (Table 3). We use standard desalted primersfrom Invitrogen, Life TechnologiesBD Difco TB (BD, cat. no. 243810, brand not crucial)Carbenicillin disodium salt (Sigma-Aldrich, cat. no. C1389-250MG, brandnot crucial) CRITICAL We advise not to substitute carbenicillin withampicillin for TRC clones, because ampicillin degrades faster and becausein our hands it impairs the bacterial amplification.FuGENE6 (Roche, cat. no. 11814443001)

pCMV-G (vesicular stomatitis virus (VSV)-G; http://www.addgene.org/8454/)pRSV-REV plasmid (http://www.addgene.org/12253/ )pMDLG/pRRE plasmid (http://www.addgene.org/12251/ )DMEM/F12 + GlutaMAX (Gibco, cat. no. 31331-093)Dulbecco’s PBS (DPBS; Gibco, cat. no. 14190-250)FBS, dialyzed, US origin (Invitrogen, cat. no. 26400)Recombinant human epidermal growth factor, carrier free (EGF, CF;R&D Systems, cat. no. 236-EG)Recombinant human fibroblast growth factor (bFGF, R&D Systems,cat. no. 233-FB)Heparin sodium salt from porcine intestinal mucosa (Sigma-Aldrich,cat. no. H3149-10KU)RHB-A stem cell culture medium (StemCells, cat. no. SCS-SF-NB-01)Laminin (Sigma-Aldrich, cat. no. L6274-.5MG)Poly-l-ornithine hydrobromide (Sigma-Aldrich, cat. no. P3655-50MG)Hydrocortisone, water-soluble (Sigma-Aldrich, cat. no. H-0396)

•

•

••

•

•••••••

•

•

••••

Penicillin-streptomycin solution, 100× (Gibco, cat. no. 15140-122)Insulin/transferrin/selenium solution (Gibco, cat. no. 41400045)

Trypsin-EDTA (0.05% (wt/vol); Gibco, cat. no. 25300-054)293T/17 (HEK 293T/17) cells (ATCC, cat. no. CRL-11268)Primary tumor cells. We have used KrasG12D/+;Trp53−/− primary lungadenocarcinoma cells (gift from A. Berns), but these can be substituted withcell lines that are freshly derived from the tumors of interest. In this case,the conditions for propagation may substantially differPrimary tumor-initiating cells (TICs). We have used EgfrvIII ;Cdkn2a−/− primary neural progenitor cells (described in Bruggeman et al.25), but thesecan be substituted with cell lines that are freshly derived from the tissue ofinterest. In this case, the conditions for propagation may substantially differAccutase solution (Sigma-Aldrich, cat. no. A6964)Genopure plasmid maxi kit (Roche, cat. no. 03143422001)Caffeine (Sigma-Aldrich, cat. no. C0750-100G, brand not crucial)Valproic acid sodium salt (VPA; Sigma-Aldrich, cat. no. P4543,brand not crucial)

Lentiviral titer instant test (Clontech Laboratories, cat. no. 631244)Protamine sulfate salt from salmon (Sigma-Aldrich, cat. no. P4020-5G,brand not crucial)dNTPs set (100 mM each A, C, G and T; GE Healthcare, cat. no. 28-4065-52)Hypnorm, 10 ml (anesthesia; Vetapharma)Dormicum, 5 mg ml−1 (anesthesia; Roche)NaCl, 0.9% (wt/vol) and water, injection grade (Braun);brand not crucialTemgesic (buprenorphine); 0.3 mg ml−1 Temgesic is to be diluted100× in NaCl and injected i.p. at a dose of 1 ml per animal CRITICAL Anesthesia should be always freshly prepared.Rimadyl (FANS; Pfizer); Rimadyl 50 mg ml–1 is ready for s.c. injection(mouse back), and it should be given at a range of 2.5–5 mg kg−1 CRITICAL Anesthesia should be always freshly prepared.FORANE (isoflurane, USP) liquid for inhalation, 250 ml (Baxter)Ionosit Baseliner (DMG dental); brand not crucial

••

•••

•

••••

••

••••

•

•

••

http://www.sigmabioinfo.com/Informatics_tools/batch-search.php#shRNAhttp://www.sigmabioinfo.com/Informatics_tools/batch-search.php#shRNAhttp://www.addgene.org/8454/http://www.addgene.org/12253/http://www.addgene.org/12251/http://www.addgene.org/12251/http://www.addgene.org/12253/http://www.addgene.org/8454/http://www.sigmabioinfo.com/Informatics_tools/batch-search.php#shRNAhttp://www.sigmabioinfo.com/Informatics_tools/batch-search.php#shRNA


9/23

PROTOCOL


Eight-week-old NOD.CB17-Prkdc scid /J female mice (Jackson Laboratory,cat. no. 001303). The mice should be housed in individually ventilatedcages (IVCs)Eight-week-old BALB/c nude male or female mice (194 Charles RiverLaboratories). The mice should be housed in IVCs

Bone wax, nylon thread (brand not crucial)Hydrogen peroxide, 3% (vol/vol) (Fisher Scientific, brand not crucial)d-Luciferin (Promega, cat. no. E1601)Doxycycline hyclate (Sigma-Aldrich, cat. no. 44577)Sucrose (Sigma-Aldrich, cat. no. S0389)Collagenase/hyaluronidase solution (STEMCELL Technologies,cat. no. 012345)DNeasy blood & tissue kit (Qiagen, cat. no. 69504)Phusion high-fidelity (HF) DNA polymerase (2 U µl−1; ThermoScientific, cat. no. F-530L) CRITICAL It is possible to use otherHF hot-start DNA polymerases such as Kapa (Kapa Biosystems,cat. no. KK2501).High Pure PCR product purification kit (Roche, cat. no. 11732676001)or QIAquick PCR purification kit (Qiagen, cat. no. 28106) or GFX PCR/gelband purification kit (GE Life Sciences, cat. no. 28-9034-70)AMPure XP solid-phase reversible immobilization kit (SPRI; BeckmanCoulter, cat. no. A63881)Agarose, multipurpose (MP) (Roche, cat. no. 11388991001; brand notcrucial)Ethidium bromide (Sigma-Aldrich, cat. no. E8751; brand not crucial)! CAUTION Ethidium bromide is a mutagen. Always wear gloves when youare handling gels and solutions containing ethidium bromide.TAE, 50× (Lonza, cat. no. 51216; brand not crucial)PicoGreen dsDNA quantification kit (Invitrogen, cat. no. P11496)

EQUIPMENTMicrobiological incubators (Thermo Scientific) or equivalentNanoDrop spectrophotometer (Thermo Scientific) or equivalentMicrocentrifuge (Eppendorf) or equivalentDeep-well plates, 96 wells, 1 ml (Thermo Scientific, cat. no. 278606,brand not crucial)Cell incubator, CO2 (5%) and O2 (5%; Thermo Scientific) or equivalent

•

•

••••••

••

•

•

•

•

••

••••

•

Biosafety (level 2) cabinet with aspirator for replication-incompetentlentivectorsMicroplate filling dispenser for 96-well plates (Thermo Scientific),or equivalentTissue culture dishes, 10 cm (Corning Incorporated, cat. no. 353003)

Tissue culture plates, six-well (Corning Incorporated, cat. no. 3506)Ultra-low-attachment culture dish, 100 × 20 mm (Corning, cat. no. 3262)Ultra-low-attachment, six-well plates (Costar Corning, cat. no. 3471)Sterile 15-ml conical tubes (Corning Incorporated, cat. no. 352096)Sterile 50-ml conical tubes (Corning Incorporated, cat. no. 352070)Filter, 45 µm (Millipore, cat. no. slha033sb)RNase-free sterile aerosol-barrier tips (10, 20, 200 and 1,000 µl;brand not crucial)Amicon Ultra filter units (Millipore, cat. no. UFC910024)Syringe pump controllers (Basinc) or equivalentMicromotor drill and bits (Dremel, brand not crucial)Stereotaxic system (ASI, brand not crucial)Syringe, 10 µl per needle, 26 gauge (Hamilton, 701N) or 50 µl per needle,30 gauge (Hamilton, 1705)Heated pad (brand not crucial)Timer (brand not crucial)Xenogen Lumina (Caliper)Insulin syringe (Terumo, 29 gauge × 1/2 inch; brand not crucial)Luminescence/fluorescence plate reader (Tecan) or equivalentComputer: Macbook Pro 2.53 GHz Intel Core i5 or similar/higher(processor), 4 GB 1067 MHz DDR3 (RAM) or higher, Mac OS X 10.6.8or similar/higher (Software)FASTX-Toolkit (http://hannonlab.cshl.edu/fastx_toolkit/)Perl interpreter (http://www.perl.org/get.html )FastQC software (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/)Microsoft Excel 2008 for Mac v12.3.6 or higherPrism 6 for Mac, v6b or higher

REAGENT SETUP

TB medium Dissolve 47.6 g of TB powder per 1 liter of distilled water,

and add 4 ml of glycerol. Sterilize the medium by autoclaving it for 15 min

•

•

•

•••••••

•••••

••••••

•••

••

TABLE 3 | Primer sequences for Illumina sequencing multiplexing strategy.

PCR1 forward barcode#1 ACACTCTTTCCCTACACGACGCTCTTCCGATCT CGTGAT CTTGTGGAAAGGACGAAACACCGG

PCR1 forward barcode#2 ACACTCTTTCCCTACACGACGCTCTTCCGATCT ACATCGCTTGTGGAAAGGACGAAACACCGG

PCR1 forward barcode#3 ACACTCTTTCCCTACACGACGCTCTTCCGATCT GCCTAACTTGTGGAAAGGACGAAACACCGG

PCR1 forward barcode#4 ACACTCTTTCCCTACACGACGCTCTTCCGATCT TGGTCACTTGTGGAAAGGACGAAACACCGGPCR1 forward barcode#5 ACACTCTTTCCCTACACGACGCTCTTCCGATCT CACTGT CTTGTGGAAAGGACGAAACACCGG

PCR1 forward barcode#6 ACACTCTTTCCCTACACGACGCTCTTCCGATCT ATTGGCCTTGTGGAAAGGACGAAACACCGG

PCR1 forward barcode#7 ACACTCTTTCCCTACACGACGCTCTTCCGATCT GATCTGCTTGTGGAAAGGACGAAACACCGG

PCR1 forward barcode#8 ACACTCTTTCCCTACACGACGCTCTTCCGATCT TCAAGT CTTGTGGAAAGGACGAAACACCGG

PCR1 forward barcode#9 ACACTCTTTCCCTACACGACGCTCTTCCGATCT CTGATCCTTGTGGAAAGGACGAAACACCGG

PCR1 forward barcode#10 ACACTCTTTCCCTACACGACGCTCTTCCGATCT AAGCTACTTGTGGAAAGGACGAAACACCGG

PCR1 forward barcode#11 ACACTCTTTCCCTACACGACGCTCTTCCGATCT GTAGCCCTTGTGGAAAGGACGAAACACCGG

PCR1 forward barcode#12 ACACTCTTTCCCTACACGACGCTCTTCCGATCT TACAAGCTTGTGGAAAGGACGAAACACCGG

PCR1 reverse (P7) CAAGCAGAAGACGGCATACGAGATTTCTTTCCCCTGCACTGTACCC

PCR2 forward (P5) AATGATACGGCGACCACCGAGATCT ACACTCTTTCCCTACACGACGCTCTTCCGATCT

PCR2 reverse (P7) CAAGCAGAAGACGGCATACGAGAT

PCR1 forward (see #1) is designed to include: Illumina/Solexa adapter 1 (italics), barcode (bold and underline), pLKO.1 common region (plain text).

http://hannonlab.cshl.edu/fastx_toolkit/http://www.perl.org/get.htmlhttp://www.bioinformatics.babraham.ac.uk/projects/fastqc/http://www.bioinformatics.babraham.ac.uk/projects/fastqc/http://www.bioinformatics.babraham.ac.uk/projects/fastqc/http://www.bioinformatics.babraham.ac.uk/projects/fastqc/http://www.perl.org/get.htmlhttp://hannonlab.cshl.edu/fastx_toolkit/


10/23

PROTOCOL


at 121 °C and cooling it to room temperature (RT; 20–25 °C). Prepare

TB 1–2 d in advance and store it at RT.

Carbenicillin stock solution (100 mg ml−1) Dissolve 250 mg in 2.5 ml of

distilled water and sterilize it by filtration. Dispense the solution into 500-µl

aliquots and store it for 1–2 years at −20 °C. CRITICAL The use ofcarbenicillin is recommended over the use of ampicillin for reasons that

include antibiotic stability and efficacy.

Complete medium TICs For glioma: RHB-A is ready to use, and it needs

to be supplemented with EGF (20 ng ml−1), bFGF (20 ng ml−1), heparin

(1 µg ml−1) and—unless preferred otherwise—50–100 units per literpenicillin-streptomycin solution. Freshly prepare complete medium and

store it for a maximum of 1–2 weeks at 4 °C protected from light.

Hypnorm-Dormicum anesthesia Mix water, Dormicum and Hypnorm

in a 2:1:1 ratio and inject i.p. 80–100 µl of this solution for an ~25-g mouse.

The proper dose needs to be experimentally determined, as the suggested

dose per kg is associated with severe hypothermia, in our experience.

CRITICAL Anesthesia should be always freshly prepared.Doxycycline water Acidified water for animal use should be supplemented

with 2 grams per liter doxycycline and 10 grams per liter sucrose.

Store each stock for a maximum of 6–12 months. Sucrose should be stored

at RT, whereas doxycycline should be stored at 4 °C, protected from light.

The final solution should be always freshly prepared, dispensed in bottles

protected from light and used within 1 week.

Tissue lysis solution for FACS sorting of tumor cells Tissue digestion

solution can be freshly prepared by combining 300 U ml−1 collagenase,

100 U ml−1 hyaluronidase and 1,500 Kunitz units of DNaseI in 0.05%

(vol/vol) trypsin. This solution will need to be inactivated by either

FBS-containing medium or by trypsin-inactivating solutions. Store the

individual stock components at −20 °C for a maximum of 6–12 months. CRITICAL Always freshly prepare the tissue digestion mix.Red blood cell (RBC) lysis buffer Mix 41.45 g of NH4Cl (155 mM final)

with 5.0 g of KHCO3 (10 mM final) and fill it with sterile H2O to 400 ml.

Add 1.0 ml of 0.5 M EDTA, pH 7.4 (0.1 mM final) and make aliquots

of 40 ml to be further diluted with 460 ml of Millipore H2O to get the

final concentrations. For sterile use, autoclave H2O and filter-sterilize the

RBC buffer stock into H2O, and then filter-sterilize but do not autoclave

an aliquot of the diluted stock as the final RBC buffer. Store the buffer

at 4 °C for up to 6–12 months.

PROCEDUREshRNA library assembly ● TIMING ~2 d

CRITICAL We strongly advise users to take measures to avoid contaminating work surfaces and instruments withpurified library DNA. For instance, it is recommended to perform DNA purification (Steps 6 and 7, and 35 and 36),PCR amplification (Steps 37–48) and DNA sequencing (Step 49) in different dedicated rooms. CRITICAL Purified plasmids can also be purchased at Sigma-Aldrich as a custom-designed library, or shRNA libraries maybe acquired in collaboration. In this case, Steps 1–6 should be omitted.

1| Add 1 ml of TB supplemented with 100 µg ml −1 carbenicillin (final concentration) to each well of a 96-well deep-wellplate. The final number of plates required depends on the number of hairpins (e.g., 500-hairpin library = six 96-well plates).

2| Use sterile p10 pipette tips or wooden toothpicks to individually transfer single shRNA-containing bacterial clonesfrom the 96-well bacterial glycerol stock plate (keep on dry ice) to the TB-containing 96-well plate. Leave a few empty wellsto control for contamination (Fig. 2a). Grow the culture overnight at 37 °C with moderate shaking (~150 r.p.m.).

3| The next day, carefully check the 96-well deep-well plates for bacterial outgrowth. Typically, TB will be turbidcompared with empty wells. In addition, pellets will be visible on the bottom of the plates. If desired, create glycerolstocks for the individual shRNA clones: add 50 µl of bacterial culture to a 96-well plate containing 50 µl of 30% (vol/vol)glycerol/TB + 100 µg ml −1 carbenicillin, and store it at −80 °C indefinitely. CRITICAL STEP If necessary, confluent cultures can be kept at 4 °C for 2–3 d to allow slow-growing clones to reachconfluence by culturing them further at 37 °C in fresh TB medium.? TROUBLESHOOTING PAUSE POINT Bacterial cultures in 96-well deep-well plates can be stored for 2–3 d at 4 °C without subsequent stepsbeing compromised.

4| Pool the clones together either using a multichannel pipette or by inverting the 96-well deep-well plates into asterile 2-liter beaker. Optionally, at this point, to maximize DNA recovery after maxiprep, centrifuge the pooled bacterial

stocks at 6–7,000 g and resuspend the bacterial pellets in half the original volume of TB medium + 100 µg ml −1 carbenicillin(e.g., if 1,000 wells are being combined, 500 ml of TB will be required).

5| Transfer the bacterial cultures into flasks, with 250 ml of culture per 1-liter flask. Incubate the cultures for ~4 h(or overnight if more convenient) at 37 °C with vigorous shaking (at 220 r.p.m.). CRITICAL STEP Overnight propagation of cultures will not affect library representation (Fig. 3a). PAUSE POINT After incubation for 4 h, the bacterial stock can be stored at 4 °C overnight.

6| Isolate plasmid DNA from bacterial cells using the Genopure plasmid maxi kit according to the manufacturer’sinstructions. Dissolve the plasmid DNA pellet in 0.5–1 ml of nuclease-free water or Tris-containing buffer. CRITICAL STEP Follow the ‘Low-copy-number protocol’ included in the kit to maximize DNA recovery from pLKO plasmids. PAUSE POINT The purified DNA can be stored at −20 °C indefinitely.


11/23

PROTOCOL


7| Measure the DNA concentration of the shRNA library using a NanoDrop. The yield largely depends on the number ofclones: we generally obtain up to 20–30-µg library yield (i.e., >3–5 experiments). Performing the overnight growth inan excess of TB would ensure a 100–500-µg library yield (i.e., >15 experiments). Further quality assessment of the shRNAlibrary can be performed as described in Box 2. CRITICAL STEP If a plasmid library is to be reamplified, the library representation needs to be preserved. This canbe achieved by transforming 10–50 ng in 20 µl of XL-Gold or Stbl3 cells (or other >108 chemically competent or >109 electrocompetent cells) for pLKO.1 vectors and plating transformed cells onto multiple (5–10) 15-cm LB agar plates.Count colonies on dishes with well-spaced colonies, and aim for >100× library representation.? TROUBLESHOOTING

shRNA library packaging and titration ● TIMING ~3 d8| To generate viral supernatant in 293T cells, seed 15 × 106 cells in 15 ml of DMEM/F12 without antibiotics(e.g., penicillin/streptomycin) in a 15-cm dish, and then incubate the cells at 37 °C for ~4 h.

9| Thaw the target cells at RT, and seed them in the appropriate medium (complete). Incubate the cells at 37 °C untilthe viral supernatant is ready for infection (Step 21). For brain tumor screening, we seed 1 × 105 EgfrvIII;Cdkn2a−/−;Bmi1i;Luciferase GICs on polyornithine/laminin-coated wells (of a six-well plate) in RHB-A medium supplemented withEGF-bFGF-heparin. For lung adenocarcinoma screening, we seed 1 × 105 KrasG12D;Tp53−/−;EEDi;Luciferase per well of asix-well plate containing DMEM/F12 supplemented with FBS, EGF and hydrocortisone.

CRITICAL STEP Target cells need to be seeded in advance and be at 60–70% on the day of infection. CRITICAL STEP Seed twice as many target cells as required for the in vivo RNAi screen and controls. Our example is for5 × 106 cells required for the in vivo RNAi screen, excluding controls. Indeed, one should be prepared for potentialmisestimation of the viral supernatant and perform multiple dilutions in parallel, if possible (see examples in the tableat Step 26 below). The MOI ≤ 5 control (>99% infection rate) may be omitted if cells/virus are limiting: in our hands,we usually find negligible differences compared with the noninfected MOI ≤ 0.5 control.

10| In a polypropylene tube (e.g., Falcon), add 45 µl of FuGENE to 450 µl of DMEM/F12 (no serum or antibiotics) andincubate the mixture for ~5 min at RT. CRITICAL STEP Before starting transfection, bring all the reagents to RT.

11| In a separate tube, mix plasmid DNA as follows:

Plasmid Amount (ml) Amount (mg)

shRNA library (1 µg µl −1) 6.4 6.4

pCMV-G (VSVg; 1 µg µl −1) 1.8 1.8

pRSV-REV (Rev; 1 µg µl −1) 1.3 1.3

pMDLG/pRRE (Pol; 1 µg µl −1) 2.5 2.5

CRITICAL STEP Plasmid preparations should be quantified by NanoDrop after thawing and spinning at top speed(>10,000 g at RT for 1 min) before setting up the transfection mix.

12| Add 12 µg of DNA mix to the FuGENE-DMEM/F12 mix from Step 10. Incubate the DNA-FuGENE-DMEM/F12 mix for15 min at RT.

13| Add DNA/FuGENE mix to 10 ml of antibiotic-free medium covering the 293T cells from Step 12, and then incubatethe cells at 37 °C overnight.! CAUTION VSV-G viruses can infect mammalian cells including human cells. From this point onward, all work must becarried out at biosafety containment level 2 (check your institutional guidelines). CRITICAL STEP FuGENE/DNA mix should be applied to cells within 30 min.

14| (Optional) 12–24 h after transfection and before applying the collection medium, refresh 293T from Step 13 withprewarmed (37 °C) DMEM/F12 containing 2 mM VPA + 4 mM caffeine; this will enhance the viral titer to increase the titermore than threefold26.


12/23

PROTOCOL


15| The next day, refresh the transfected cells with 15 ml of prewarmed (37 °C) target cell complete medium(we use RHB-A + 20 ng ml −1 EGF + 20 ng ml −1 bFGF + 1 mg ml −1 heparin). If you are using serum-free medium,carefully wash 293T cells twice with warm (e.g., at RT) PBS to remove FBS traces. Incubate the cells at 37 °C until 48 hafter transfection. CRITICAL STEP The medium used to refresh 293T cells should be at ~37 °C to prevent cells from detaching from theplasticware.

16| (Optional) Collect a first-tap of viral supernatant at 40 h after transfection using a pipette, and then repeat Step 15without washing with PBS. CRITICAL STEP It is possible to prepare two or three dishes of viral supernatants, as they can be stored at −80 °C forseveral months.

17| Collect the viral supernatant at 48 h after transfection.

18| Combine viral supernatants, remove as much floating debris as possible by centrifugation (e.g., 1 min at RT at 3,320 g )and filter the supernatant through an acetate filter with a 0.45-um pore size.

19| (Optional) Concentrate the viral particles either by ultracentrifugation or—as we currently do—by centrifugation for10 min at 5,000 g at RT using Amicon Ultra-15 centrifugal filter units; 15 ml of medium will be concentrated to 0.5 ml.

20| Perform a qualitative titration of the viral supernatant using the p24 rapid titer kit according to the manufacturer’sinstructions. When control and test bands are similar, assume the infection units (IFUs) to be 5 × 105 IFU ml −1. CRITICAL STEP Although more precise titration can be obtained with quantitative PCR-based kits, it is reasonableto directly test the IFUs on target cells. To this end, aim for an MOI of 1 and perform 1:2 and 1:4 dilutions (or addthe appropriate amount of virus, if available). For a comprehensive protocol covering supernatant titration, please referto Kutner et al.27.? TROUBLESHOOTING PAUSE POINT The viral supernatant can be snap-frozen in cryovials using CO2 /ethanol and stored at −80 °C for severalmonths. Frozen stocks should be re-titrated on thawing, as the stability of viral particles cannot be guaranteed.

Target TIC infection and selection ● TIMING ~4 d

21| On the day before the infection (i.e., Step 15), seed 5 × 106

cells distributed in six separate 10-cm dishes.

22| Apply viral particles (from Step 20) to target cells in complete medium supplemented with 2.5 µg ml −1 protaminesulfate; experimental and control infections should be set up as tabulated below. Incubate the cells in a tissue culture incu-bator for 12–14 h at 37 °C (e.g., overnight; Fig. 2b).

Sample Desired MOI

Cell number

(for one 10-cm dish)

Viral stock

(2.5 × 107 IFU ml−1)

Puromycin

(24 h after infection)

In vivo ≤0.5 5 × 106 100 µl Yes

Control MOI ≤0.5 5 × 106 100 µl No

Backup ≤0.25 5 × 106 50 µl Yes

Low MOI ≤0.125 5 × 106 25 µl Yes

Control Puro 0 5 × 106 No virus Yes

Control MOI ≤5 5 × 106 1 ml Yes

CRITICAL STEP It is highly recommended to perform as many parallel dilutions as possible and to directly assess therate of infection on target cells. However, when the target cells are delicate or hard to grow, it is possible to scale down thecontrols or to even test the viral titer on 293T cells; although the infection may not be exactly equivalent to the targetcells, it should be noted that the IFU valid for 293T can be substantially lower for other cell lines. In this case, anMOI ≤ 0.75 control could be considered.


13/23

PROTOCOL


23| After 12–14 h of incubation with the viral supernatant, refresh the medium.

24| 24 h after infection, apply 2 µg ml −1 puromycin to the shRNA-infected cells where applicable (see the table in Step 22).Incubate the cells in a tissue culture incubator for 24 h at 37 °C. CRITICAL STEP The amount of puromycin used to select infected cells needs to be determined on the basis of thesensitivity of the target cells to the antibiotic.? TROUBLESHOOTING

25| 48 h after infection, remove the medium, add trypsin/Accutase, incubate the cells for 5 min at 37 °C and spin the cellsdown by centrifugation for 5 min at 270 g at RT. Next, split the cells into two halves and re-plate them into equal-sizeddishes (in 2 µg ml −1 puromycin containing medium where it applies). Incubate the cells for 12–14 h at 37 °C.

26| On the next day, in our experience, puromycin-selected control cells are floating (and trypan blue–positive). Count bothpuromycin-selected target cells and control cells, and compare puromycin-selected MOI ≤ 0.5 target cells with nonselectedcells of an MOI ≤ 0.5 and with cells at an MOI of ~5 to verify that the target cells meet the criteria of 0.5 ≥ MOI ≥ 0.25. CRITICAL STEP We generally obtain 30–40% of the control cells (MOI ≤ 0.3–0.4). If the yield is higher, we proceed withthe second backup dilution, as the third dilution is usually MOI ≤ 0.25. We do not recommend proceeding if there is evidenceof overinfection (MOI of ~1), as this will result in multiple hairpins per cell. Likewise, it is not advisable to proceed with anextremely low MOI (≤0.25), as this would provide unnecessary stress, nor do we recommend proceeding when long antibiotic

selection is required, as biological activity of the hairpins in vitro would affect the in vivo screen.

Injection of TICs ● TIMING 3–8 h27| If you intend to inject TICs intercranially, proceed with option A. This should be used when performing a screen fororthotopic brain grafting or when metastasis is intended. If you intend to inject cells into the tail vein, follow option B.This should be used when performing a screen for orthotopic lung grafting or when metastasis is intended.(A) Preparation for intracranial TIC injection ● TIMING 6–8 h (i) Obtain a single-cell suspension by passing puromycin-selected glial TICs from Step 26 through a 40-µM nylon mesh

filter. Resuspend the cells at 5 × 104 cells µl −1 in Ca2+Mg2+-free HBSS or in serum-free medium (in the example above,resuspend 5 × 106 cells into a final volume of 100 µl), to reduce clumping or to preserve viability, respectively. Thechoice depends on the cell-type sensitivity and on the length of the procedure (i.e., number of animals to be injected).

(ii) Assemble a stereotaxic device, a small drill and a heating pad under a laminar flow cabinet, a syringe pump

controller and a Hamilton 50-µl syringe with a 30-gauge needle. (iii) Anesthetize each animal with i.p. injections of a 1:1:2 mixture of Hypnorm/Dormicum/water solution.! CAUTION All animal experiments and all procedures must be approved by the relevant animal usecommittee. Procedures include anesthesia, which should be planned to obtain long-lasting sleepiness (~6–8 h)while preventing severe hypothermia. A video guide to this procedure is available at http://www.jove.com/video/4089/ stereotactic-intracranial-implantation-vivo-bioluminescent-imaging (ref. 28), and it may be useful, although somesteps are performed differently from the protocol described here. CRITICAL STEP To maximize recovery, animals should be physically in contact with a 37 °C surface, either aheating pad (during surgical procedures) or a water bath for animal cages for the next ~12 h. Furthermore, 1 mlper mouse of physiological saline solution should be administered to all animals undergoing surgery to preventdehydration. This step can be combined with postoperative analgesia by dissolving Temgesic in 1 ml of salinesolution (see Reagents). CRITICAL STEP When using NOD.CB17-Prkdc scid background mice, we have noticed that female mice are better fitfor these procedures.

(iv) On an anesthetized animal, perform a small incision in the skin protecting the skull at the midbrain level and peelaway the skin using a razor blade to expose the skull.

(v) Immobilize the animal on the frame of the sterotaxic device according to the manufacturer’s instructions. (vi) By using the stereotactic frame and a syringe, label the spot 1 mm anterior and 2 mm to the right of the bregma

suture coordinates with a marker. (vii) Use the drill to perform a small incision in the skull.

CRITICAL STEP Use a guide for the drill tip to avoid hitting the brain. (viii) Load the Hamilton syringe with the cell suspension from Step 26, mount it into the controller/stereotactic frame

apparatus and allow the controller to reach the syringe plunger. Eject one small droplet and then clean the needle with3% (vol/vol) hydrogen peroxide to prevent unwanted subcranial non-brain tumor formation.

(ix) Dip the needle 3 mm into the brain parenchyma reaching the corpus callosum.

http://www.jove.com/video/4089/stereotactic-intracranial-implantation-vivo-bioluminescent-imaginghttp://www.jove.com/video/4089/stereotactic-intracranial-implantation-vivo-bioluminescent-imaginghttp://www.jove.com/video/4089/stereotactic-intracranial-implantation-vivo-bioluminescent-imaginghttp://www.jove.com/video/4089/stereotactic-intracranial-implantation-vivo-bioluminescent-imaging


14/23

PROTOCOL


CRITICAL STEP Move 3.5 mm inside the brain, and then retract the needle 0.5 mm to create a small gap to injectthe cells into.

(x) Begin the injection using a speed of 1 µl min−1 and use a timer to stop injection after two min. Next, allow 1 minfor the cells to seed properly, and then retract the needle very slowly to prevent backflow leading to subcranialnon-brain tumors (Fig. 2c).? TROUBLESHOOTING

(xi) When all animals are injected, set aside two 2-µl aliquots of cell suspension as an input control (and, optionally,three to six 2-µl aliquots of cell suspension to be propagated in tissue culture as an in vitro control). These samplesshould be stored as cell pellets at −80 °C until needed (Step 30).

(xii) Seal the hole in the skull with bone wax and suture the skin with nylon thread. Four stitches are usually required toprevent reopening of the wound.

(xiii) House the animals in filter-top cages immersed 2 cm deep in a waterbath or on top of a warm blanket overnight, andthen transfer them back to the IVC rack. If you are using a doxycycline-inducible system for gene knockdown oroverexpression, administer acidified water supplemented with 2 mg of doxycycline flavored with 10 mg ml −1 sucrose. CRITICAL STEP If doxycycline administration is crucial for all the phases of tumorigenesis, consider an alternativemethod of administration, as mice reduce water uptake at the onset of neurological symptoms. CRITICAL STEP If gene knockdown or overexpression is required upon injection of TICs, doxycycline-water can beadministered 2–4 d in advance of surgery. Conversely, to avoid immediate phenotypic consequences on TICs, doxycycline-water can be administered 2 d after surgery, when cells are already seeded and transplantation stress is reduced.

(xiv) (Optional) If the luciferase-expressing gene is present in the cells, mice can be observed using the IVIS Lumina imag-ing station. 1 d after surgery, inject isoflurane-anesthetized animals with D-luciferin potassium salt, 150 mg kg−1 inPBS, and then scan them 10 min after injection using the following settings: exposure 2 min, binning 8 and field ofview 19. After imaging, return the mice to the IVC rack.

(xv) Humanely kill the animals according to local guidelines once neurological signs appear. In our hands, glioma-bearinganimals have a median survival time of 6–9 weeks. Depending on the model system and on the effect of the library onthe TICs, deviations from the median survival time may be observed.? TROUBLESHOOTING

(B) Preparation for tail-vein TIC injection ● TIMING 3–4 h (i) Obtain a single-cell suspension by passing puromycin-selected lung TICs from Step 26 through a 40-µm nylon

mesh filter. Resuspend cells at 0.8–2.6 × 105 cells per µl in 100 µl of 1:1 Ca2+Mg2+-free HBSS/0.9% (vol/vol) NaCl(experiments in Figs. 3–5 report on the 2.6 × 105 cells per µl concentration). This procedure does not require anesthesia.! CAUTION All animal experiments and all procedures must be approved by the relevant animal use committee. (ii) Place one animal in the dedicated holder and warm up the tail using a heating lamp to expose the tail vein.

(iii) Load a 0.3-ml insulin syringe with cells, insert the 29-gauge needle into the vein and slowly inject the cells (Fig. 2c). CRITICAL STEP Retract the plunger to confirm the correct positioning of the needle by traces of blood.The first attempt should be ~2 cm from the body so that in case the vein is missed, the injection can be repeatedin the upper positions.? TROUBLESHOOTING

(iv) When all animals are injected, set aside 2 × 100 µl of cell suspension as the input control and 3–6 × 100 µl as anin vitro control, to be propagated in tissue culture. Where applicable, control cells to be propagated in vitro undertissue culture conditions should be seeded at high density (e.g., 1 million cells per well in a six-well plate). PAUSE POINT The input cells should be stored at −20 °C as a pellet until required.

(v) Place animals on a heating pad for ~1–2 h to enable recovery, and then place them in IVCs until needed. If you areusing a doxycycline-inducible system for gene knockdown or overexpression, administer acidified water supplemented

with 2 mg of doxycycline flavored with 10 mg ml −1 sucrose. CRITICAL STEP If doxycycline administration is crucial for all the phases of tumorigenesis, consider an alternativemethod of administration as the mice reduce water uptake at the onset of neurological symptoms such as shortnessof breath.

(vi) (Optional) If the luciferase-expressing gene is present in the cells, mice can be observed using the IVIS Luminaimaging station. From 2 h onward, inject isoflurane-anesthetized animals with D-luciferin potassium salt, 150 mg kg−1 in PBS, and then scan them 10 min after injection using the following settings: exposure 2 min, binning 8 and fieldof view 19. After imaging, return the mice to the IVC rack.

(vii) Humanely kill the animals according to local guidelines on the appearance of shortness of breath. In our hands,adenocarcinoma-bearing animals have a median survival time of 4 weeks. Depending on the model system andon the effect of the library on the TICs, deviations from the median survival time may be observed.


15/23

PROTOCOL


Tumor dissection and DNA extraction ● TIMING 1–2 h28| Dissect the tissue of interest from the animals that were euthanized, and place it in a tube containing ice-cold PBS.

29| In a tissue culture hood, use a scalpel to remove the normal tissue from the tumor. At this point, either dissect thetumor tissue into single cells for FACS analysis, as described in Box 3, or proceed to Step 30 to prepare DNA directly from

the tissue. We prefer the first option, although we have successfully performed downstream steps starting with whole-tumortissue lysates (Fig. 2d). PAUSE POINT Tumor tissue pellets can be snap-frozen and stored indefinitely at −80 °C.

30| Extract the tumor tissue DNA in RLT buffer (included in the DNeasy tissue kit) or resuspend FACS-sorted cells in PBS:add AL buffer (part of the DNeasy tissue kit) and proteinase K in a 1:1:0.1 ratio and proceed with column isolationaccording to the manufacturer’s instructions. Take along control cell samples (e.g., input and/or in vitro–propagated).Cell pellets from Step 30, as well as from Box 3, can be directly lysed in PBS, AL buffer and proteinase K.! CAUTION Proteinase K solution is an irritant; wear gloves when working with it. CRITICAL STEP When FACS-sorted cells are used to perform the DNA extraction, please consider that sorted eventsmay not be comparable to the input samples. Adjust the number of sorted cells, taking into account that the recovery is

~50%, or extract DNA from all cells and use DNA quantity as a surrogate for comparing cell numbers. CRITICAL STEP To avoid ethanol contamination, perform a SpeedVac centrifugation for 5 min at 60 °C, and to maximizeDNA recovery, perform two rounds of elution per column with 100 µl using AE buffer (from the DNeasy kit) heated to 42 °C.

31| Measure the DNA concentration using a NanoDrop. The typical yield is ~12 µg of DNA per million cells.

PCR amplification and barcode-tagging of shRNAs● TIMING ~4 h CRITICAL We strongly advise taking measures against sample contamination, e.g., work in a PCR cabinet or laboratory,and clean all surfaces and pipettes thoroughly with 0.1 N NaOH and/or expose them to UV light. CRITICAL Tumor and control samples can be handled in parallel to save time.

Box 3 | Cell isolation and preparation for FACS sorting ● TIMING ~6–8 h

Tumor-promoting or dropout hairpins (i.e., targeting TSGs and oncogenes, respectively) may be differentially enriched in cells with

differential degrees of viability. The choice of whether to purify tumor cells using FACS and whether to use DAPI (or similar dyes) to

enrich for viable cells or to directly proceed through DNA isolation may affect the relative hairpin representation within each tumor

and should be given careful consideration. Perform FACS purification of tumor cells from Step 29 as follows:

1. Dissect lungs from Step 30 under a sterile hood and aim to remove as much normal tissue as possible.

2. Move tumor pieces into a 1.5-ml tube and use scissors to cut them into small pieces.3. Add 1 ml of collagenase/hyaluronidase/trypsin/DNaseI solution and incubate the mixture in a Thermomixer at 37 °C for 30–60 min.

If needed, use a syringe with a large needle gauge (i.e., 18–21 gauge) to further break down the remaining nodules, and pass the

solution through a 70-µm filter.4. Fill in a 15-ml Falcon tube with a serum-containing medium to quench the enzymatic reaction, and then centrifuge the tube

at 540 g for 10 min at RT.

5. Resuspend the tumor pellet in 500 µl of PBS, and add 2 ml of 1× RBC lysis buffer. Centrifuge the mixture at 540 g for 10 min at RT.

If RBCs are still present (red pellet), repeat the passage above once or twice.

6. Resuspend cells in PBS and proceed with FACS-sorting isolation.

7. Filter the cell suspension into a 5-ml round-bottom Falcon tube through a cell-strainer cap to reduce the occurrence of cell

aggregates before sorting. Load the Falcon tube into the FACSAria cell sorter, adjust the gates in the forward-scatter area (FSC-A)

and the side-scatter area (SSC-A) to visualize individual cells (Fig. 4a, left). Place gates into the scatter plot to exclude cell debrisand visualize gated cells into a side-scatter height (SSC-H)–SSC-A plot to set a single-cell gate (Fig. 4a, middle). Sort out the cells

with desired levels of fluorescence marker (e.g., GFP) expression. Nonfluorescent cells from the host provide internal controls (Fig. 4a,right). Collect the sorted cells in 1 ml of PBS. CRITICAL STEP Perform stringent washing of the cell sorter after collecting the cells, as the mouse lungs are not sterile.8. Centrifuge the sorted cells for 5 min at 270 g at RT. Aspirate the medium and proceed with Step 30.


16/23

PROTOCOL


32| To amplify the shRNAs from the genomic DNA (from Step 31), prepare the following 50-µl PCR mix on ice.Primers are listed in Table 3. To amplify multiple libraries in single HiSeq lanes, we provide sequences for multiple‘TRC-primerF+barcode’ primers. Use one per sample and assign each sample to one barcode for later barcodeannotation (Box 4). CRITICAL STEP The amount of DNA indicated in the table is the amount required from 400,000 mouse cells for200× representation of a 1,000-hairpin library. If the amount of DNA needs to be increased by >5 µg, it is recommendedto set up multiple PCR1 reactions.

Component Amount per sample (ml) Final

DMSO (PCR grade) 1.5 3% (vol/vol)

Phusion HF buffer (5×) 10 1×

dNTP mix (10 mM) 1 0.2 mM

TRC-primerF+barcode (10 µM) 1.25 0.25 µM

TRC-primerR (10 µM) 1.25 0.25 µM

Tumor or control DNA from Step 31 (1 µg µl −1) 2 2 µg

Phusion DNA polymerase (2 U µl −1) 1.25 0.04 U µl −1

Nuclease-free water 31.75

33| Perform PCR1 using the following conditions.

Cycle number Denature Anneal Extend

1 98 °C, 1 min

2–15 98 °C, 10 s 60 °C, 30 s 72 °C, 60 s

16 72 °C, 5 min

Box 4 | Tips for data analysis

Raw sequencing files (.fastq) that passed the quality (FastQC. 101) will have the following sequences: index (6 bp)-constant

pLKO.1 region (24 bp)-sense hairpin strand (21 bp). If >78 bp are being sequenced, a 6-bp loop and a 21-bp antisense hairpin will

also be present.

We provide a simple Perl script (hairpins_fast.pl, included as Supplementary Software) having as input an annotation table(example included as Supplementary Table 1) with hairpin names and sequences (example provided below), a .fastq file, anda barcode file (‘barcode.txt’) with the barcode used in the library generation, if applicable. The files should be provided in this order:

$perl harpin_fast.pl annotation_table.txt fastq_file.fastq output_file.txt barcode.txt. Unless otherwise specified by the user, thescript will find the files in the same folder in which the user runs the script. harpin_fast.pl uses pattern matching to associate each

single sequence with the appropriate hairpins. Supplementary Figure 2a provides an example for the table format. These instructionscan be easily launched and customized by the user.

The final table will consist of the following columns: ‘TRC number’, ‘Gene symbol’, ‘Sample x,y,z perfect match count’

(see supplemental Perl script; Supplementary Software). Furthermore, to increase the efficiency in retrieving hairpins, allowingone nucleotide mismatch may be included. Sequencing the full hairpin (>78 nt) does not usually provide substantial improvement

over the simpler half-hairpin sequencing (51 bp only).

CRITICAL Allowing one mismatch may be skipped if >5,000× coverage is reached, as in our experience it only enables therecovery of 2–3% more reads, which are usually limited numbers in terms of adding any statistical power.

For user-friendly analyses, it is possible to use Excel and Prism. With Excel, data can be rank-ordered to visualize the hairpins

that have been enriched and depleted, to normalize the data and to obtain a general overview of the experiment.


17/23

PROTOCOL


34| To introduce Illumina P5 and P7 extension to each shRNA library, prepare the following 50-µl PCR mix on ice. PCR2 willpreserve each barcode for each sample (Fig. 2e).

Component Amount pre sample (ml) Final concentration

DMSO (PCR grade) 1.5 3% (vol/vol)

Phusion HF buffer (5×) 10 1×

dNTP mix (10 mM) 1 0.2 mM

PCR2 forward (P5; 10 µM) 1.25 0.25 µM

PCR2 reverse (P7; 10 µM) 1.25 0.25 µM

Template DNA (PCR1 product, Step 33) 2.5 1:20

Phusion DNA polymerase (2 U µl −1) 1.25 0.04 U µl −1

Nuclease-free water 31.25 Up to 50

CRITICAL STEP Multiplexing of samples on an Illumina sequencing lane can also be performed using the standardIllumina indexing procedure, where the index sequence is between the sequencing primer 2 and the adapter A2/P7.However, it is important to note that this would require modifications in the design of primers described in this protocol.

35| Perform PCR2 using the following cycling conditions.

Cycle number Denature Anneal Extend

1 98 °C, 1 min

2–15 98 °C, 10 s 60 °C, 30 s 72 °C, 60 s

16 72 °C, 5 min

36| Run 10–15 µl of PCR2 on a 2% (wt/vol) agarose gel with a 100-bp or 1-kb DNA marker. The expected size of the PCR2product is 200–300 bp. CRITICAL STEP Do not increase the number of amplification cycles, as this would impair the ability to preserve the

linearity of the PCR amplification.? TROUBLESHOOTING PAUSE POINT Samples can be left in the thermal cycler overnight at 4 °C, or they can be stored at −20 °C indefinitely.

37| To purify PCR2, add 0.8 volumes of AMPure XP SPRI (i.e., 40 µl), mix, separate the beads using a magnet and washthem once with an equal volume of 70% (vol/vol) ethanol. Resuspend the dried beads at RT for 5–10 min and elute DNA inwater or Tris (pH 8.0) buffer by vortexing the samples at 42 °C in a Thermomixer.

38| Measure the DNA concentration using a NanoDrop.

39| Perform PicoGreen quantification of each library. In a black 96-well plate, dilute 5 µl of each purified library in200 µl of 1× PicoGreen solution according to the manufacturer’s protocol (PicoGreen is to be used at a 1:200 dilution).Use the sample with the highest NanoDrop value to assemble a dilution series of five or six, and measure luminescence

values using a plate reader.

40| Select the sample with the highest concentration in Step 38 to build a serial dilution using 1:2 up to 1:32 dilutionsin order to perform an accurate quantification of the libraries based on PicoGreen emission. Read PicoGreen emissionon a plate reader (e.g., Tecan reader) using the following parameters: excitation at 485 nm and emission at 520 or 530 nm.Determine the final concentration for each library via an xy scatter analysis in Excel on the basis of the control sampledilution scale, the relative emission and the equation inferred by the trendline function. CRITICAL STEP If primer dimers or high-molecular-weight bands are present, PicoGreen may not be accurate andalternative measurements should be considered, such as Bioanalyzer microfluidics (Agilent). CRITICAL STEP The Bioanalyzer profile may reveal the presence of multiple entities of close but distinct molecularweights despite the gel purification (Fig. 4d). We have noticed this on multiple occasions, and we sequenced the librarywith no measurable negative effect on our results.


18/23

PROTOCOL


41| If PCR products show a single band, proceed with mixing libraries based upon DNA concentration, as measuredby PicoGreen. When primer dimers or higher-molecular-weight bands are still visible, gel-purify the library mix usinga 3–4% (wt/vol) agarose gel, and proceed with Bioanalyzer analysis. Alternatively, repeat the AMPure XP beads purificationwith 0.7 volumes (vol/vol), which should allow purification of samples >200 bp. CRITICAL STEP As a quality control step, one sample and its control can be mixed together and a quick MiSeq runcan be performed; this will provide an indication of whether the libraries are of sufficient quality to continue with theexperiment (Fig. 5c).? TROUBLESHOOTING PAUSE POINT The purified library mix can be stored at −20 °C indefinitely.

Preparation of samples for Illumina high-throughput sequencing ● TIMING ~10 d42| Measure the molar concentration of the library using the following formula: molar concentration = moles ofsol

in vivo shrna screens in solid tumors2014

Documents