health testing of germplasm conserved in in vitro ... · lane 11: trichoderma viride lane 12:...

77
S. C. Dubey Principal Scientist and Head Division of Plant Quarantine ICAR-National Bureau of Plant Genetic Resources New Delhi 110 012, India Health testing of germplasm conserved in in vitro Genebanks and cryogenebanks

Upload: others

Post on 29-Aug-2020

9 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

S. C. Dubey Principal Scientist and Head

Division of Plant Quarantine

ICAR-National Bureau of Plant Genetic Resources

New Delhi 110 012, India

Health testing of germplasm conserved

in in vitro Genebanks and

cryogenebanks

Page 2: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

ICAR-NBPGR, New Delhi, has one of the mandates for

acquisition and management of PGR for conservation and their

utilization ensure food security and sustainability.

Seed health testing of collected and indigenously multiplied

material is a pre-requisites for conservation of PGR of agri-

horticultural crops in the Genebank bank (NGB) at ICAR-

NBPGR, New Delhi with the aim to make them pest-free.

Seed health testing was initiated in 1998 at ICAR-NBPGR, New

Delhi for the germplasm collected under mission mode National

Agricultural Technology Project (NATP) on agro-biodiversity

Introduction

Page 3: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Objectives of

Seed-Health

Testing

Quarantine

Seed Trade

Seed

Certification

Seed Treatment

Feed or Food Conservation

Planting Value

Seed Health

The presence or absence of disease causing organisms (ISTA, 1976)

Page 4: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Seed-borne pathogens affect

534 genera of 109 plant families

Pathogens known to be seed-borne

Fungi:~1500 (~331 not reported from India)

Bacteria:~302 (~270 not reported from India)

Viruses: ~120

• Insects: ~60,000 species known from India, ~6% of

the world total diversity of insects

Why seed health testing?

Page 5: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

First seed-health testing station was

established in 1918 in Wageningen,

The Netherlands

Dr Lucie C Doyer first official Seed

Pathologist, Wageningen- 1919

First International Rules for Seed

Testing published by ISTA in 1928

included a chapter on phytosanitary

conditions of seed with reference to

pathogens

Background

Page 6: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Processing

of samples

Page 7: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Techniques

Visual examination

Washing test

NaOH soaking

Blotter/Agar plating

X-ray radiography

Seed transparency test

Seed soaking test

Molecular markers

Page 8: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Visual examination

Discolored, deformed & shriveled seeds/ weed seeds

Live/ dead insects or parts thereof

Infected/ infested seeds

Fungal growth/ fructifications (bunt balls, sclerotia)

Magnifier Stereo binocular

Page 10: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Botrytis grey mold Fusarium Purple staining

Discolouration on seeds

Soybean - Mottling Pea - Split seed coat Pea – Tennis boll Necrosis

Viral symptoms

Fungal symptoms

Page 11: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Fungal fructifications mixed with seeds

Karnal bunt Hill bunt Smut of bajra False smut

Ergot of Agropyron Ergot of bajra Ergot of wheat Ergot of oat

Kernel smut

Page 12: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Detection and identification of pathogens

Incubation test for detection of pathogens

Planting Material

Alternating cycles of 12 hours

fluorescent light and darkness

22±10C for 7 days

Stereo-cum-compound Microscopy

Agar Blotter

Page 13: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Bipolaris sorghicola

Page 14: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Colletotrichum graminicola

Page 15: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Phoma sorghina

Page 16: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Alternaria spp.

Alternaria sesami

Alternaria radicina

Alternaria zinniae

Page 17: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Colletotrichum capsici (a-g) C. gloeosporiodes

g

Page 18: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Drechslera spp.

D. oryzae

D. sorokiniana

D. soghicola

D. bicolor

Page 19: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

D. tetramera

D. sorokiniana

Drechslera spp.

D. avenae

Page 20: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Fusarium spp.

F. moniliforme

Page 21: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Saprophytes

Melanospora zamiae

Melanospora zamiae Cladosporium

Curvularia spp.

Aspergillus - weed fungus

Aspergillus

Page 22: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Safflower Rust (Puccinia carthami)

Washing test

Seed shaking

Sunflower Rust

(Puccinia helianthi)

Seeds in a test tube +

10 ml water

Stirring on shaker

for 30 sec.

Fig. 4. Fungi Detected during Washing Test: Downy mildew spores; Smuts; Bunts; Rusts, etc.

Oospores of

Perenospora manshuricaSeeds on mechanical shaker

Uromyces betae (Sugarbeet rust)

Smut spores

Chlamydospores

Page 23: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Molecular marker based identification

and detection

Conserved region based markers ITS, IGS, 16s rDNA and TEF etc. Species specific markers Gene specific, SCAR, RFLP

Page 24: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Detection of Fusarium verticillioides infecting sorghum

germplasm collected from different parts of India

0.57kb 0.57kb

0.57kb

0.5kb

1kb

M 1 2 3 4 5 6 7 8 9 10 11

Lane M: 100 bp Marker;

Lane 1-10: F. verticillioides infected sorghum samples;

Lane 11: Negative control

Page 25: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

PCR-based detection of Colletotrichum capsici fungus

causing anthracnose in Capsicum annuum in India

Lane M: 100 bp DNA ladder; Lane 1-26: C. capsici isolates; Lane NC: negative control

447 bp

Colletotrichum capsici primers (ITS based): C.cap-F: 5’- ACCTAACTGTTGCTTCGGCG-3’ C.cap-R: 5’- AAATTTGGGGGTTTTACGGC-3’

Page 26: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

M 1 2 3 4 5 6 7 8 9 10 11 12

Lane M: 1Kb marker

Lane 1-3: Colletotrichum capsici samples

Lane 4: Colletotrichum gloeosporioides

Lane 5: Colletotrichum lindemuthianum

Lane 6: Alternaria alternata

Lane 7: Drechslera rostrata

Lane 8: Fusarium solani

Lane 9: Macrophomina phaseolina

Lane 10: Aspergillus flavus

Lane 11: Trichoderma viride

Lane 12: Negative control

Rapid detection of Collectotrichum capsici by loop-

mediated isothermal amplification (LAMP) assay

β-tubulin gene at 65°C for 45 min.

Colour changes of LAMP amplification

products after adding 2μl of 10x SYBR

green

Pathogen Specificity Test

Page 27: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Identification of Plant Bacterial Contamination in Taro

(Colocasia esculenta) Tissue Culture Plantlets Using

16S rDNA Sequencing

M 1 2 3 4 5 6 7

Use of universal bacterial

primers for amplification of 16S

rDNA region of unknown

bacteria (1390 bp).

Product eluted, Sequenced and

Blasted (99-100% identity).

Lane M: 100 bp plus marker.

Lane 1, 2, 3 and 6:

Paenibacillus spp.

Lane 4 and 5: Ralstonia spp.

Lane 7: Negative control.

1390 bp

3 kb

1 kb

0.5 kb

Paenibacillus spp. – gram negative, rod shaped, anaerobic, spore-forming

bacteria, sensitive to tetracycline and kanamycin.

Ralstonia spp. – gram negative, motile rod shaped, aerobic, non-spore

forming bacteria, sensitive to tetracycline and cephalosporins (cefotaxmine

and ceftazidime).

Page 28: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Molecular detection of various nematode intercepted in germplasm

under exchange and from pest free conservation in genebank

750 bp

700 bp

M 1 2 3 4 N M 1 2 3 4 5 N 3 kb 3 kb

1 kb

1 kb 0.5 kb

0.5 kb

PCR amplification of ITS region of

Pratylenchus penetrans detected in

Apple germplasm (IQ 15/2015)

PCR amplification of ITS region of

Aphelenchoides besseyi detected in

Rice germplasm

Lane M: 100 bp plus marker, lane 1: Variety-

Sunlight, lane 2: Moon light; lane 3: Redlane;

lane 4: Goldlane; lane N: Negative control

Lane M: 100 bp plus marker, lane 1: DQ50/14;

lane 2: DQ51/14; lane 3: DQ270/14; lane 4:

DQ337/14; lane 5: DQ3/15; lane N: Negative

control.

Page 29: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Amplified product of different isolates of Foc with A-167 F2R1. Lane 1-14 Foc

isolates, 15- Foc inoculated chickpea plant, 16- Un-inoculated chickpea plant, 17-

R. bataticola, 18- R. solani, 19- S. sclerotiorum, 20- NTC, and M– 100bp ladder at

both sides.

Primer Sequence

A-167 F2 TACCAGTGCGGTGGTATTGA

A-167 R1 GCGACAACATACCAATGACG

Amplified product of Foc inoculated plant with a set of

markers 1BR-B125F1R1 at different dilutions. Lane 1-

100ng, 2- 50ng, 3- 25ng, 4- 10ng, 5- 5ng, 6- 2ng, 7- 1ng, 8-

0.5ng, 9- 100pg, 10- 50pg, 11- 25pg, 12- 12.5pg, 13-

6.25pg, 14- 3.12pg, 15- 1.56pg, 16- 0.78pg and M – 100bp

ladder at both sides.

Amplified product of Foc with a set of markers 1BR-

B125F1R1 at different dilutions. Lane 1- 25ng, 2- 10ng,

3- 5ng, 4- 2ng, 5- 1ng, 6- 0.5ng, 7- 100pg, 8- 50pg, 9-

25pg, 10- 12.5pg, 11- 6.25pg, 12- 3.12pg, 13- 1.56pg, 14-

0.78pg and M – 100bp ladder at both sides.

M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 M

409 bp

M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 M 409 bp

M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 M

409 bp

TEF 1α based Foc specific

marker

Page 30: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Detection level: 2.8 pg

Quantitative analysis by real time PCR

Page 31: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Detection of insects

Planting Material

X-ray radiography Bruchid infestation in legume seeds

Specialized detection for

insects

Detection and identification

of insects

X –ray radiographs of seeds showing

hidden infestation of bruchids

Seed Transparency test

Page 32: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Retrieval and mounting of insect pests

Identification Keys Reference Collection

Infested seeds from X ray Seed soaking

Insect

retrieval

Mounting and

Labeling +

Insect Identification

Page 33: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Digitized Keys for

Identification of

Bruchids

Insect Identification

Database of >1,658 species

under 71 genera of world

bruchid species

Page 34: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Visual examination (For presence of soil, shriveled/ discolored seeds, galls etc.)

Soaking and teasing of seeds for isolation of nematodes

Detection and Identification of Nematode

A. Nematode suspension under stereoscopic microscope at 40 X B. Nematode image under compound microscope at 400 X

A B

Page 35: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Detection and identification of weed seeds

Visual Inspection

• With naked eye

• With aided eye

Identification of weed seeds

• Based on morphological characters

• Based on vegetative and floral characters

Page 36: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Weed Information System

Page 37: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Detection of pathogens in samples of

various crops under cryo-preservation

49 49

111

26

103

75

12

30

55 40.82 53.06 28.83

38.46

11.65 6.67

50.00

6.67 12.73

0

20

40

60

80

100

120

Yr-2011 Yr-2012 Yr-2013 Yr-2014 Yr-2015 Yr-2016 Yr-2017 Yr-2018 Yr-2019

Year wise processing of cryo samples and observed infection level

Samples Infection (%)

Infected:

120/510

Page 38: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Interception Crop

Alternaria brassicae Brassica compestris

A. brassicicola B. juncea

A. sesami Sesamum spp.

Bipolaris avenae B. oleracea

B. hawiiensis Capparis decidua

B. rostrata Coix lacryma-jobi

B. tetramera B. juncea, Eleusine coracana

Botrydiplodia theobromae Carissa carandus, Vigna sp.

Colletotrichum capsici Capsicum annuum, Carissa carandus, Sesamum sp., Vigna sp.

C. gloeosporioides Abelmoschus spp., Citrus sp., *Elaeis guineensis

Fusarium culmorum Vigna umbellata

F. dimerum Luffa hermaphrodita

F/equiseti Trichosanthes cucumerina

F. oxysporum Asparagus secemoses, Eruca sativa, Sesbania grandiflora

Important detection of fungal pathogens in

cryo-materials

C. gloeosporioides

on Elaeis guineensis New Record

Page 39: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Interception Crop

F. semitectum Abelmoschus spp., Brassica juncea, Eruca sativa,

Sesamum spp., Trichosanthes cucumerina, Vigna spp.

F. solani Azadirachta indica, Prunus persica, Viburnum mullaha,

Vigna sp.

F. verticillioides Abelmoschus spp., Asparagus officinalis, Azadirachta

indica, Crotalaria fillipis, Viburnum mullaha

Myrothecium roridum Abelmoschus sp., Cucumis sp.

Pestalotia guepini *Rubus spp.

Phoma exigua Abelmoschus spp., Cucumis spp., Lycopersican

hirsutum, *Sesamum spp., Solanum melongena, Vigna

spp.

P. sorghina Carica papaya, Phyllanthus emblica, Sesamum spp.

Phomopsis sp. Abolmoshcus esculantus, *Sesamum spp.

Sclerotium rolfsii Sesamum spp.

X. c. pv. campestris Brassica juncea, B. rapa

Detection of important fungal pathogens in

Cryo-material

Page 40: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

New host records

Phomopsis sp. on Sesamum

Pestalotia guepini on Rubus

Page 41: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Virus indexing of tissue cultured plants using

ELISA Rubus sp.: 55 accessions

Viruses: 06

o Arabis mosaic virus (ArMV)

o Raspberry bush dwarf virus (RBDV)

o Raspberry ringspot virus (RpRSV)

o Strawberry latent ringspot virus (SLRV)

o Strawberry mild yellow edge virus (SMYEV)

o Tomato ringspot virus (ToRSV)

Fragaria sp.: 54 accessions

Viruses: 09

• Arabis mosaic virus (ArMV)

• Raspberry bush dwarf virus (RBDV)

• Raspberry ringspot virus (RpRSV)

• Strawberry latent ringspot virus (SLRV)

• Strawberry mild yellow edge virus (SMYEV)

• Tomato black ring virus (TBRV)

• Tomato ringspot virus (ToRSV)

• Tobacco necrosis virus (TNV)

• Tobacco streak virus (TSV)

Infection: 3.7% - ArMV, RBDV, SLRV, TBRV, TNV

and ToRSV

Infection: 7% - RpRSV, SMYEV, TBRV and

ToRSV

Page 42: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Allium sp.: 206 accessions

Viruses: 07

• Carnation latent virus (CLRV)

• Garlic common latent virus (GCLV)

• Garlic virus C (GVC)

• Leek yellow stripe virus (LYSV)

• Onion yellow dwarf virus (OYDV)

• Shallot latent virus (SLV)

• Shallot yellow stripe virus (SYSV)

Infection: 28.16% - CLV,

GCLV, GVC,

LYSV, OYDV,

SLV and SYSV

Dioscorea: 162 accessions

Viruses: 02

• Dioscorea latent virus (DLV)

• Yam mosaic virus (YMV)

Infection: 4% - DLV and YMV

Page 43: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Detection and salvaging of insect-pests

infested samples of various crops under cryo-

preservation

Year Crop (number of samples) Samples

X-rayed

Infested

Samples

Insect

detected

Samples

salvaged

2015-16 Capparis decidua (5), Pithecellobium

dulce (4), Tamarandus indica (5),

Fagopyrum esculentum (5), Pisum

sativum (5), Sesbania grandiflora (6),

Prunus americana (22), Vigna

unguiculata (1), Crotolaria felipes (6) and

Gossypium hirsutum (5)

64 4

(S. grandiflora)

Immature

stages of

bruchid

4

2016-17 Bixa Orellana (1), Terminalia bellerica

(1), Vigna umbellata (1), Cordia myxa (5),

Cordia rothii (4), Capparis decidua (32)

and Annona squimosa (11)

55 32

(C. decidua)

Immature

stages of

bruchid

32

2018-19 Elaeis quineensis (17), Phaseolus

lathyroides (7) and Rhynchosis minima (2)

26 Nil Nil Nil

2019-20 Arachis hypogea (3), Sesbania grandiflora

(6), Cajanus cajan (3), Cordia myxa (4),

Rosa spp. (9), Prunus spp. (7), Pyrus

pashia (1), Malus baccata (2), Buchanania

lanzan (6), Rosa microphylla (7)

48 4

(S. grandiflora

and C. cajan) )

Immature

stages of

bruchid

4

Page 44: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Disinfestation of insect infested seeds

Real time X-ray radiography machine

Infested:

40/193

Fumigation chamber

Page 45: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Survival of fungal pathogens

Page 46: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

ISPM 40

International movement of growing media

in association with plants for planting

Soil as a growing medium is considered to be a high-risk pathway because it can harbour numerous quarantine pests and a number of other growing media are also recognized pathways for the introduction and spread of quarantine pests. The pest risk of growing media in association with plants for planting depends on factors related to both the production of the growing media and the production of the plants, as well as the interaction between the two.

Page 47: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Impact on biodiversity and the environment Pests associated with the international movement of growing media in association with plants for planting may have negative impacts on biodiversity. Implementation of this standard could significantly reduce the introduction and spread of quarantine pests associated with growing media and consequently reduce their negative impacts.

Growing media free from quarantine pests Growing media free from quarantine pests may be achieved by: • using growing media produced in a process that renders the growing

media free from pests • using growing media or their components collected from a pest free

area or a pest free production site • applying appropriate treatments to growing media that are not free

from pests, before their use.

Page 48: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

DESTRUCTIVE INSECTS AND PESTS ACT 1914 (AMENDED THROUGH NOTIFICATIONS FROM TIME TO TIME)

Plants, Fruits and Seeds (Regulations of Import into India)

Order 1984

New Policy on Seed Development 1988

PFS Order 1989

SPS Agreement of WTO 1995

Plant Quarantine Order 2003 (Pest Risk Analysis prior to import, Prohibition of 31 invasive alien weed species)

Legislations

• 1906 under the Sea Customs Act to stop the entry of the Mexican cotton boll weevil

• Compulsory fumigation of cotton bales

Page 49: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Salient Features of New PQ Order

PRA made pre-condition for import of items other than those in Schedule V, VI, and VII

Prohibition on import of commodities with specific weed/ alien species contamination

Restriction on import of packaging material of plant origin unless treated

Additional declarations specified in the Order for import of 820 agricultural commodities with specific lists of more than > 1000 quarantine pests and 31 weed species.

Notified points of entry increased to 130

Plant Quarantine

(Regulation of Import into India)

Order 2003

Page 50: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Agricultural imports have been classified as:

Prohibited plant species-14 crops from different countries (Schedule IV)

Restricted species where import permitted only by authorized institutions-

about 17 different species (Schedule V).

Restricted species permitted only with additional declarations of

freedoms from quarantine/ regulated pests and subject to specified

treatment certifications – about 693 different species (Schedule VI).

Plant material imported for consumption/ industrial processing permitted

with normal Phytosanitary Certificate - about 29 species (Schedule VII).

List of quarantine weed species - 57 species (Schedule VIII)

Inspection fee (Schedule IX)

List of Permit Issuing Authorities for Import of Seeds, Plants and Plant

Products and other articles (Schedule X)

List of Inspection Authorities for Certification of Post entry quarantine

facilities and inspection of growing plants (Schedule XI)

Quantities of seeds permitted for trial purpose/accession to gene bank of

National Bureau of Plant Genetic Resources (Schedule XII)

Page 51: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Exotic Pests Introduced into India

Parthenium hysterophorus

Mexico

BBTV of banana

Sri Lanka

San Jose scale of apple

U.S.A Lantana camara

C. America

Phalaris minor

Mexico

Golden nematode of potato

U.K.

Blight of chickpea

Middle East

B. tabaci

Biotype B in cotton

Page 52: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Pests Year of introduction

Woolly apple aphid, Eriosoma lanigerum 1889 Lantana weed, Lantana camara 1809 Coffee rust, Hemilia vastatrix 1879 Late blight of Potato, Phytophthora infestans 1883 Grape downy mildew, Plasmopara viticola 1910 San Jose scale, Quadraspidiotus perniciousus 1911 Water hyacinth, Eichhornia crassipes 1914 Potato tuber moth, Phthorimaea operculella 1937 Banana bunchy top virus 1940 Potato wart, Synchytrium endobioticum 1953 Carrot grass, Parthenium hysterophorus 1956 Golder nematode, Globodera rostochinensis, G. pallida 1961 Apple scab, Venturia enequalis 1978 Downy mildew of sunflower, Plasmopara halstedii 1984 Peanut stripe virus 1987 Sunflower necrosis disease, Sunflower necrosis virus 1997 Cotton mealy bug, Phenococcus solenopsis 2006 Papaya mealy bug, Paracoccus marginatus 2009 Tomato leaf minor, Tuta abosoluta Meyrick 2014 Root knot nematode, Meloidogyne enterolobii 2016 White rust of chrysanthemum, Puccinia horiana 2016 Fall Armyworm (Spodoptera frugiperda) in maize 2018

Pests Introduced in India

Page 53: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

(Seed/ Veg. Propagules/ in-vitro)

•Bulk consignments

for consumption

for planting or sowing

•Small samples including transgenics

for research work

Movement of Agricultural Material

Transboundary

•Import/ Export

Regional (Inter-state)

•Trials and Release

Agricultural Commodities

Page 54: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

National Bureau of Plant Genetic Resources

Nodal agency for

issue of import permit

quarantine clearance

issue of Phytosanitary Certificate

for germplasm including transgenics

……Small samples

Page 55: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Head Quarter, DPPQ&S, Faridabad

01

Plant Quarantine Stations

57

Central IPM Centres 35

Locust Control Stations 12

Central Insecticide Lab 1

Regional Pesticide Testing Labs

2

Plant Protection Network of DPPQ&S in India

Page 56: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

344429

121186

416225 403578

498368

441893 436315

545187

304749

3095810987

241108 237474

7839352164

89198

6617 5831

0

100000

200000

300000

400000

500000

600000

Sam

ple

nu

mb

ers

Years

Import Export

Germplasm Processed in Quarantine

> 10,000 Phytosanitary Certificates issued for material (after quarantine

testing) meant for export

Page 57: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Samples infected/ infested with different pests

(1976-2018)

57

Page 58: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

From 1976-2016, a total of 74 pests not yet reported from

India during quarantine examination have been

intercepted in exotic germplasm imported into the

country for research purposes

Fungi -5

Viruses - 17

Insects/ mites -25

Nematodes -9

Weeds -16

Interceptions of quarantine

pests at NBPGR

Page 59: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Fungi Host Source of import

Fusarium oxysporum f.

sp. cucumerinum

Cucumis sativus USA

Monographella nivalis Triticum aestivum Germany, Hungary, Italy, Mexico,

Sweden, Turkey, UK and USA

Hordeum vulgare Italy

Peronospora manshurica Glycine max Belgium, Brazil, Canada,

Colombia, Costa Rica, Ghana,

Hungary, Indonesia, Israel, Italy,

Japan, Korea, Malaysia, Nepal,

Papua New Guinea, Poland,

Romania, Russia, Taiwan,

Thailand, USA and Zimbabwe

Phomopsis longicolla Helianthus annuus USA

Uromyces beticola Beta vulgaris Belgium, Denmark, Holland,

Hungary, Germany, The

Netherlands, Sweden, UK, USA

and SSR

Exotic Fungal Interceptions

Page 60: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

34.4

16.2

51.8

0.7

1.5

7.1

21.3 16.0

Infection in soybean germplasm (%)

Korea (21/61)

USSR (11/68)

Brazil (57/110)

Malaysia (1/145)

Zimbabwe (3/200)

Taiwan 157/2219)

USA (1605/7518)

Others 13/81)

Intercepted from several countries Oospores of P. manshurica remain

viable up to 8 years A large number of physiologic

races exist. Pathogen is of high quarantine

significance for the country.

Peronospora manshurica

(Downy mildew of soybean)

Oospores crust

Phomopsis longicolla (Seed decay in soybean)

Causes pod and stem blight/ seed decay of soybean, has wide hosts and detectad in sunflower from USA in 2011

It is a new host record from USA and elsewhere

Phomopsis logicolla on

Sunflower

Page 61: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Crop Pest Yield loss in

exporting country

(%)

*Estimated annual

loss in India (Rs.

lakhs)

Wheat

Monographella nivalis (fungus) 3.0 to 52.4 (USSR)

15193.80 Barley stripe mosaic virus Up to 30.0 (USA)

Bromus secalinus (weed) 28.0 to 48.0 (USA)

Soybean

Bean pod mottle virus Up to 52.0 (USA)

2619.95 Peronospora manshurica

(fungus)

Up to 80.0 (USA)

Cotton Anthonomus grandis (insect) Up to 51.0 (USA) 2214.43

Maize Maize chlorotic mottle virus 90.0 (USA)

310.65 High plains virus Up to 100.0 (USA)

*Assuming only 0.1% yield loss due to appearance of pest. The total yield and minimum support

price have been taken for 2015-16

(Source: http://eands.dacnet.nic.in/)

Probable annual losses due to various

exotic pests, if introduced into India

Page 62: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Sanitary and Phytosanitary Agreement

Aims to protect

Plants

from pests/ pathogens

Human beings and animals

from toxins, additives in food, feed and

beverages and

diseases/ pests

Page 63: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

ISPM 1 Principles of plant quarantine as related to international trade 1995

ISPM 2 Guidelines for pest risk analysis 1996

ISPM 3 Code of conduct for the import and release of exotic biological control agents

1996

ISPM 4 Requirements for the establishment of pest free areas 1996

ISPM 5 Glossary of phytosanitary terms 2002

ISPM 6 Guidelines for surveillance 1997

ISPM 7 Export certification system 1997

ISPM 8 Determination of pest status in an area 1998

ISPM 9 Guidelines for pest eradication programmes 1998

ISPM 10 Requirements for the establishment of pest free places of production and pest free production site

1999

ISPM 11 Pest risk analysis for quarantine pests including analysis of environmental risks and living modified organisms

2003

ISPM 12 Guidelines for phytosanitary certificates 2001

ISPM 13 Guidelines for the notification of non- compliance and emergency action

2001

ISPM 14 The use of integrated measure in a systems approach for pest risk management

2002

ISPM 15 Guidelines for regulating wood packaging material in international trade

2002

ISPM 16 Regulated non-quarantine pests: concept and application 2002

ISPM 17 Pest reporting 2002

International Standards for Phytosanitary Measures

Page 64: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

ISPM 18 Guidelines for the use of irradiation as a phytosanitary measure 2003

ISPM 19 Guidelines on list of regulated pests 2003

ISPM 20 Guidelines for phytosanitary import regulatory system 2004

ISPM 21 Pest risk analysis for regulated non-quarantine pests 2004

ISPM 22 Requirements for the establishment of areas of low pest prevalence 2005

ISPM 23 Guidelines for inspection 2005

ISPM 24 Guidelines for the determination and recognition of equivalence of phytosanitary measures

2005

ISPM 25 Consignments in transit 2006

ISPM 26 Establishment of pest free areas for fruit flies (Tephritidae) 2006

ISPM 27 Diagnostic protocols for regulated pests 2006

ISPM 28 Phytosanitary treatments for regulated pests 2007

ISPM 29 Recognition of pest free areas and areas of low pest prevalence 2007

ISPM 30 Establishment of areas of low pest prevalence for fruit flies (Tephritidae)

2008

ISPM 31 Methodologies for sampling of consignments 2008

ISPM 32 Categorization of commodities according to their pest risk 2009

ISPM 33 Pest free potato (solanum spp.) micropropagative material and

minitubers for international trade

2010

ISPM 34 Design and operation of post-entry quarantine stations for plants 2010

Page 65: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

ISPM 35 Systems approach for pest risk management of fruit flies (Tephritidae) 2012

ISPM 36 Integrated measures for plants for planting 2012

ISPM 37 Determination of host status of fruit to fruit flies (Tephritidae) 2017

ISPM 38 International movement of seeds 2017

ISPM 39 International movement of wood\ 2017

ISPM 40 International movement of growing media in association with plants

for planting

2017

ISPM 41 International movement of used vehicles, machinery and equipment 2017

ISPM 42 Requirements for the use of temperature treatments as a phytosanitary

measures

2018

Page 66: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

National Standards on Phytosanitary Measures

• Prepared by –

DPPQS under DAC & FW

Aim –

1. Guidelines for application of phytosanitary measures

as harmonized with international standards.

2. Facilitate trade & avoid rejection due to

non-compliance.

• Endorsed by – Ministry of Agriculture

Page 67: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

NSPM No.

Title of Standard Adopted on

1 Plant Quarantine Operation Systems Manual July, 1999

2 Import Inspection Manual July, 1999

3 Export Inspection Manual July, 1999

4 Post-Entry Quarantine Inspection Manual July, 1999

5 Pest Risk Analysis: Administrative Process Manual January, 2004

6 Pest Risk Analysis-Technical Methodology November,

1999

7 Guidelines for Reporting Plant Quarantine Activities March, 2003

8 Guidelines for Auditing of Plant Quarantine Activities November,

2002

9 Guidelines for Certification of Forced Hot-Air Treatment Facilities

for Wood Packaging Material Revision 1 on: May, 2011

August, 2004

10 Guidelines for Export Inspection & Phytosanitary Certification of

Fresh Mango (Mangifera indica) Fruits to P. R. China

January, 2005

11 Quarantine Treatments and Application Procedures-1. Methyl

Bromide Fumigation

February,

2005

12 Guidelines for Assessment, Accreditation & Auditing of Fumigation

AgenciesRevision 1 on: May, 2011

February,

2005

13 Requirements for establishment of pest free areas for mango nut

weevil (Sternochetus mangiferae) and pulp weevil (Sternochetus

frigidus)

May, 2005

National Standards

Page 68: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

NSPM No.

Title of Standard Adopted on

14 Requirements for Establishment of pest free areas for Tephritid

fruit flies May, 2005

15 Guidelines for Certification of Hot-Water Immersion Treatment

Facilities May, 2005

16 Guidelines for development of National Standards for

Phytosanitary Measures

February,

2005

17 Guidelines for Regulating Export, Import & Release of Biological

Control Agents & other Beneficial Organisms

December,

2004

18 Guidelines for Certification of Heat Treatment Facilities for Niger

Seed

December,

2004

19 Requirements for establishment of pest free areas for brown rot

(Ralstonia solanacearum) of potato

February,

2005

20 Guidelines for Certification of Vapour Heat Treatment facilities for

fresh fruits

December,

2005

21 Guidelines for Certification of Irradiation Treatment Facilities for

Fresh Fruits January, 2006

22 Guidelines for Assessment, Audit and Accreditation of Fumigation

Agencies for Undertaking Aluminium Phosphide Fumigation August, 2011

Page 69: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Codling moth

Fluted scale

San Jose scale

Apple scab

Potato cyst nematode

Coffee berry borer

Banana mosaic virus

Potato wart

Banana bunchy top virus

Domestic Quarantine

• Section 4A of DIP Act empowers Central Government to implement Domestic quarantine regulations

• 9 Domestic Quarantine Regulations have been notified to regulate movement of specific commodities from state to state within India

Page 70: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Pest/disease Host plant

material

Restricted States

From To

Fluted Scale

(Icerya purchasi)

Many host plant Mysore (Karnataka),

Madras (Tamil Nadu) & Kerala

To any other

state or place

San Jose Scale

(Aspidiotus perniciosus)

Many host plant

species

Punjab, UP, Madras (TN), WB,

Assam, Orissa, HP, J& K

Any other part

of India

Banana bunchy top (virus) Banana planting

material

Assam, Kerala, Orissa, Tamil

Nadu, & West Bengal

Any other State

& UT

Banana mosaic (virus) Banana plants&

plant material

Maharashtra & Gujarat Any other State

&UT

Potato Wart (Synchytrium

endobioticum)

Potato Darjeeling (West Bengal) Any other State

or place in India

Apple Scab

(Venturia inaequalis)

Apple planting

material

J & K and HP Any other State

Codling Moth

(Carpocapsa pomenella)

Apple & walnut

plants including

fruits

Ladakh District Any other area

in J&K

Potato Cyst Nematodes

(Globodera rostochiensis

& G. pallida)

Potato Tamil Nadu Any other State

& UT

Coffee Berry Borer

(Hypothenamus hampei)

Coffee seeds/

plants/powder

Nilagiri (T.N), Kodagu

(Karnataka) & Wynad (Kerala

Any other parts

of the India

Domestic Quarantine…..

Page 71: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Interception of quarantine potential

pathogens

80 4.1

100

37.5 100

100

63.6

100

Interception (%)

Denmark (4/5)

Germany (6/147)

Italy (5/5)

The Netherlands

(6/16)Sweden (2/2)

UK (3/3)

USA (7/11)

USSR (11/11)

Uromyces beticola from sugar beet a) Teliospoes; b) Uredospores

(a) (b)

Yield losses: 50-70%

48.7

100.0

0.7 0.3 0.3 0.1

Interception (%)

Italy (146/300)

UK 252/252)

GDR (3/422)

Hungary (2/690)

USA (2/321)

Others (3/805)

Fusarium nivale causing snow

mold in wheat

Infected

Healthy

Yield losses: ~ 50%

Page 72: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Interception of quarantine potential

pathogens

Major, minor and wild hosts - 21

Detection on sunflower imported from USA

with infection level of 87.0 per cent

Phomopsis longicolla causing pod and

stem blight/ seed decay of soybean

34.4

16.2 51.8

0.7

1.5

7.1

21.3 16.0

Interception (%)

Korea (21/61)

USSR (11/68)

Brazil (57/110)

Malaysia (1/145)

Zimbabwe (3/200)

Taiwan 157/2219)

USA (1605/7518)

Others 13/81)

White mixed with golden

oospores crusts

Web-comb structured

oospores crust

Peronospora manshurica causing downy

mildew of soybean

Yield losses: up to 80%

Page 73: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Interception of quarantine potential

pathogens

34

49

44

30

28

9 34

228

13 Australia

Canada

Italy

Netherlands

Sweden

Taiwan

UK

USA

Others

Xanthomonas campestris pv. campestris

causing black rot of crucifers

Yield losses: 30-70%

Leptosphaeria maculans causing

balck-leg of crucifers

25

31

12

1

1 1

3 Australia

Canada

Italy

Netherlands

Russia

Sweden

UK

Yield losses: up to 100%

Page 74: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

NBPGR prevented introduction of

noxious weeds

Case I: Import of 6 MT of Basil seeds

from Germany under relaxed

conditions without IP and PC

• Request sent to NBPGR for PRA

• PRA showed 4 viruses, 2 pathogens,

one nematode and several weeds of

quarantine significance

• Samples for testing for presence of

pests

• Intercepted exotic weeds

1. Atriplex patula (Spear Saltbush) 2. Asphodelus fistulosus (Onion weed)

Atriplex patula

Recommendation: In view of quarantine weeds intercepted in the sample submitted to NBPGR, it would not be advisable to allow the entry of 6MTS of Basil Ocimum basilicum from Germany.

Asphodelus fistulosus

Page 75: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

NBPGR prevented introduction of

noxious weeds

Case II: Import of 78 MT of Niger seeds

for consumption from Ethiopia under

relaxed conditions without IP and PC

• Sample sent to NBPGR for testing

• Samples for testing for presence of

pests

• Intercepted three exotic weeds

1. Bromus diandrus (great brome) 2. Festuca arundinacea (tall fescue) 3. Phalaris paradoxa (awned canary-

grass

Bromus diandrus

Recommendation: Complete inactivation of embryo through irradiation or

dry heat treatment at 122°C for 25 minutes followed by ensuring no

germination on blotter test

Festuca arundinacea

Page 76: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Nematodes intercepted in introduced

germplasm

Microphotographs of Rotylenchus minutus A&B- Anterior body region; C- Oesophageal region;

D- posterios body region; E- tail region. (Bar=20µm).

African potato corms

Hypoxis hemerocallideas

Rotylenchus minutus intercepted during the quarantine processing for the first time in India on imported African potato corms

Page 77: Health testing of germplasm conserved in in vitro ... · Lane 11: Trichoderma viride Lane 12: Negative control Rapid detection of Collectotrichum capsici by loop-mediated isothermal

Acknowledgement

Dr. Jameel Akhtar Dr. Kavita Gupta Dr. V. Celia Chalam Dr. M.C. Singh Dr. B. H. Gawade