how do spores wake up? proteins involved in the first ... involved in the first steps of spore...

University of Groningen

How do spores wake up? Proteins involved in the first stages of spore germinationVelasquez Guzman, Jeanette

IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite fromit. Please check the document version below.

Document VersionPublisher's PDF, also known as Version of record

Publication date:2015

Link to publication in University of Groningen/UMCG research database

Citation for published version (APA):Velasquez Guzman, J. (2015). How do spores wake up? Proteins involved in the first stages of sporegermination [S.l.]: [S.n.]

CopyrightOther than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of theauthor(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).

Take-down policyIf you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediatelyand investigate your claim.

Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons thenumber of authors shown on this cover page is limited to 10 maximum.

Download date: 18-06-2018

https://www.rug.nl/research/portal/en/publications/how-do-spores-wake-up-proteins-involved-in-the-first-stages-of-spore-germination(e1bfe48b-7a2b-4db0-8241-89c72b0ce662).html

How do spores wake up? Proteins involved in the first steps of spore

germination

Jeanette C. Velásquez Guzmán

Cover: artistic impression of a Bacillus subtilis sample, and the ultra structure of the bacteria. The scene was rendered using the Blender 3D creation suite (http://www.blender.org/).

This Ph.D. was carried out in the Membrane enzymology group of the Biochemistry Department of the Groningen Biomolecular Sciences and Biotechnology Institute (GBB). The work was also financially supported by the TI Food and Nutrition (TIFN), Wageningen, The Netherlands. The study presented in this thesis was performed within the framework of TI Food and Nutrition (TIFN) Typesetting by Latex 2 ISBN: 978-‐90-‐367-‐7664-‐6 (electronic) ISBN: 978-‐90-‐367-‐7665-‐3 (printed) @ 2015 Jeanette Consuelo Velásquez Guzmán All rights reserved. No part of this publication may be reproduced, stored in a retrieval system of any nature, or transmitted in any form or by any means, electronic, mechanical, now known or hereafter invented, including photocopying or recording, without prior written permission of the publisher.

How do spores wake up? Proteins involved in the

first stages of spore germination

PhD thesis

to obtain the degree of PhD at the University of Groningen on the authority of the

Rector Magnificus Prof. E. Sterken and in accordance with

the decision by the College of Deans. This thesis will be defended in public on Friday 20 February 2015 at 14.30 hours

by

Jeanette Consuelo Velásquez Guzmán

born on 8 August 1977 in Lima, Peru

Supervisors Prof. B. Poolman Prof. T. Abee Assessment committee Prof. E.J. Smid Prof. J. Kok Prof. M.W. Fraaije

Contents

Contents

1 General introduction 51.1 History of spore research . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 51.2 Bacillus subtilis as model organism . . . . . . . . . . . . . . . . . . . . . . . . 61.3 Taxonomy and Phylogeny of Bacillus subtilis . . . . . . . . . . . . . . . . . . 61.4 The life cycle of B. subtilis . . . . . . . . . . . . . . . . . . . . . . . . . . . . 61.5 Sporulation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7

1.5.1 Activation of histidine-sensor kinases and changes in gene expression . 71.5.2 Gene regulation of sporulation . . . . . . . . . . . . . . . . . . . . . . 7

1.6 Structure of bacterial spores . . . . . . . . . . . . . . . . . . . . . . . . . . . . 101.7 Spore Germination . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 111.8 Germinant receptors in Bacilli . . . . . . . . . . . . . . . . . . . . . . . . . . 121.9 GerD protein . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 131.10 SpoVA proteins . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 131.11 Non-nutrient germination . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 131.12 The role of mechanosensitive channels in germination of bacillus spores . . . . 141.13 Outline of this thesis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16

2 Biochemical characterization of the ABC subunits of germinant receptor GerAfrom Bacillus subtilis 172.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 172.2 Material and Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19

2.2.1 Cloning and expression of GerA genes . . . . . . . . . . . . . . . . . . 192.2.2 Cell lysis and membrane vesicle preparation . . . . . . . . . . . . . . . 192.2.3 Purification of GerAA, GerAB and GerAC . . . . . . . . . . . . . . . 202.2.4 Multi-angle laser light scattering (SEC-MALLS) . . . . . . . . . . . . 202.2.5 Membrane reconstitution of GerAA and GerAB . . . . . . . . . . . . . 202.2.6 Intrinsic fluorescence of GerAA, GerAB and GerAC . . . . . . . . . . 212.2.7 ANS binding to GerAC . . . . . . . . . . . . . . . . . . . . . . . . . . 212.2.8 Homology modeling of GerAC . . . . . . . . . . . . . . . . . . . . . . 212.2.9 Circular dichroism (CD) of GerAC . . . . . . . . . . . . . . . . . . . . 212.2.10 Differential scanning calorimetry (DSC) of GerAC . . . . . . . . . . . 212.2.11 Unfolding and refolding of GerAC . . . . . . . . . . . . . . . . . . . . 222.2.12 Counterflow assay with GerAA and GerAB reconstituted in liposomes 222.2.13 Counterflow experiment using fused membranes . . . . . . . . . . . . . 22

2.3 Results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 222.3.1 Cloning, expression and purification of GerAA, GerAB and GerAC . . 222.3.2 Fluorescence studies . . . . . . . . . . . . . . . . . . . . . . . . . . . . 232.3.3 Circular dichroism (CD) . . . . . . . . . . . . . . . . . . . . . . . . . . 252.3.4 Differential Scanning Calorimetry (DSC) . . . . . . . . . . . . . . . . 28

3

Contents

2.3.5 Binding or transport of GerAA and GerAB triggered by L-Ala . . . . 282.4 Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29

2.4.1 Cloning and overexpression of GerA receptor proteins . . . . . . . . . 292.4.2 Spectroscopic and calorimetric analysis of GerA receptor proteins . . . 292.4.3 Binding or transport mediated by GerAA and GerAB . . . . . . . . . 29

3 Bacillus subtilis spore protein SpoVAC functions as a mechanosensitive channel 313.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 313.2 Experimental Procedures . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33

3.2.1 E. coli strains used in this study . . . . . . . . . . . . . . . . . . . . . 333.2.2 Cloning and expression of 10His-SpoVAC . . . . . . . . . . . . . . . . 333.2.3 Cloning and expression of SpoVAC-myc-6His . . . . . . . . . . . . . . 333.2.4 Analysis of cell viability . . . . . . . . . . . . . . . . . . . . . . . . . . 343.2.5 Membrane vesicle preparation . . . . . . . . . . . . . . . . . . . . . . . 343.2.6 Purification and membrane reconstitution of SpoVAC-myc-6His . . . . 353.2.7 Fluorescence dequenching assay . . . . . . . . . . . . . . . . . . . . . . 353.2.8 Electrophysiology studies . . . . . . . . . . . . . . . . . . . . . . . . . 36

3.3 Results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 373.3.1 Expression and complementation studies: 10His-SpoVAC . . . . . . . 373.3.2 Expression and complementation studies: SpoVAC-myc-6His . . . . . 373.3.3 Purification of SpoVAC-myc-6His . . . . . . . . . . . . . . . . . . . . . 383.3.4 Calcein release assay . . . . . . . . . . . . . . . . . . . . . . . . . . . . 383.3.5 Electrophysiology characterization of SpoVAC . . . . . . . . . . . . . . 39

3.4 Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 403.4.1 Characteristics of SpoVAC . . . . . . . . . . . . . . . . . . . . . . . . 403.4.2 Gating mechanism and role of lipids . . . . . . . . . . . . . . . . . . . 423.4.3 A role for SpoVAC in germination . . . . . . . . . . . . . . . . . . . . 43

4 General discussion and future perspective 454.1 GerA receptor proteins of Bacillus subtilis . . . . . . . . . . . . . . . . . . . . 454.2 SpoVAC works as a mechanosensitive channel during spore germination . . . 454.3 Model of spore awakening . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 46

5 Samenvatting 495.1 GerA receptoreiwitten van Bacillus subtilis . . . . . . . . . . . . . . . . . . . 495.2 SpoVAC werkt als een mechanosensitief kanaal tijdens het ontkiemen van spore 49

6 List of publications 51

7 Acknowledgements 63

4

General introduction

1 General introduction

1.1 History of spore research

Figure 1.1.1. Bacillus subtilis spores observed byphase-contrast microscopy. The arrowheads in panel Apoint to phase-bright spores (refractile bodies), and inpanel B the arrowheads point to phase-dark spores. 1 mmbars. Picture modified from Real G et al [1].

Research on bacterial spores started almosttwo centuries ago. In 1838, Ehrenbergreported the presence of refractile bodiesin bacterial cells (Figure 1.1.1), which wasthe first description of bacterial spores.Posteriorly, in 1876, Ferdinand Cohn andRobert Koch reported that bacillus sp. areable to form spores that are resistant at100 °C, which had an enormous impacton the science of bacteriology [2]. Between1940 and 1970, several studies about sporeresistance, sporulation and germinationappeared. More recently, and related tothe first sequenced Gram-positive bacterialgenome, new genetics methods were appliedto study the Bacillus subtilis 168 strain asa model organism (see below) [3].

Bacterial spore research is of high sci-entific and technological importance, be-cause they are the most stress-tolerant cellsknown on our planet. They are metabol-ically dormant, environmentally resistant,and capable of surviving extreme temper-atures, desiccation and high ionizing radi-ation [4]. The longevity of bacterial sporeshas been described as thousands to mil-lions of years and these dormant cells canbe found in every type of environment onearth [5].

Bacilli and Clostridia are the main spore-forming organisms although many Strep-tomyces species produce spores with somesimilarity to bacillus spores, but they areless resistant to harsh conditions [6]. It hasbeen described that Clostridium botulinum,Clostridium perfringens and Bacillus cereusare involved in food-borne illnesses, andother spore formers such as Bacillus subtilis are known to cause food spoilage. Clostridium

5


difficile is the leading cause of hospital-acquired infections, and Bacillus anthracis has beenstudied extensively because of its potential in biological warfare [7]. For all these reasonsunderstanding spore formation, spore germination and the mechanism(s) of spore killing isstill of eminent importance these days.

1.2 Bacillus subtilis as model organism

B. subtilis is the model organism in most sporulation studies, because it is regarded as safeand genetically accessible; B. subtilis cells are naturally competent and readily transformedby foreign DNA [8]. Furthermore, given that the large majority of genes expressed duringsporulation are not essential for growth, sporulation mutants are easily obtained [2,9]. B.subtilis was the first Gram-positive bacterium to be sequenced [3] and is up to date the bestunderstood Bacillus species. B. subtilis sporulation has served as a model for prokaryoticcell differentiation [4].

1.3 Taxonomy and Phylogeny of Bacillus subtilis

B. subtilis taxonomy [5,10]:

Phylum : FirmicutesClass : Bacilli

Order : BacillalesFamily : Bacillaceae

Genus : Bacillus

The genus Bacillus includes Gram-positive and rod-shaped bacteria, occurring singly,in pairs and in chains. They are generally aerobic endospore formers [6,10]. A 16S rRNAmaximum likelihood phylogeny of the selected strains from class Bacilli is depicted in Figure1.4.1. This class can be divided into a number of orders, some with sporulating others withnon-sporulating genera (orders or genera not shown) [7,11].

1.4 The life cycle of B. subtilis

The life cycle of B. subtilis is composed of two growth phases: vegetative cell growth (Stage0 to I) and sporulation (Stage II to VII). The former has features present in other bacteria;each cell produces two identical daughter cells after each round of division (Figure 1.5.1).However, as nutrients become depleted from the environment and cells enter stationaryphase, some of the cells in the population initiate the process of sporulation (see below) toincrease their survival under harsh conditions [8,12]. Successful sporulation ultimately leadsto the release of a mature dormant spore into the environment (Figure 1.5.1) [13]. Spores willremain dormant until they encounter specific nutrient stimuli, which cause rapid germinationand loss of resistance properties. Eventually, the germinated spore will outgrow to becomea normal vegetative cell (Figure 1.5.1) [14,15].

6


1.5 Sporulation

Figure 1.4.1. Phylogenetic tree of 24 species fromclass Bacilli. Maximum likelihood phylogeny using 16SrRNA. The bacillus strains depicted in colors representtheir habitat and phenotype (red: pathogenic, blue:aquatic, pink: deep ocean isolate, green: halophiles andbrown: soil). Modified from Alcaraz et al [1,16].

Sporulation is a developmental process, inwhich the cells sense nutrient limitation andform a dormant spore. For some recentreviews about sporulation see [11,12,17–19].During sporulation the cells suffer a mor-phologic differentiation that is initiatedwith asymmetric cell division. A divisionseptum is formed near an extreme pole ofthe cell, creating a sporangium composedof two compartments: a smaller cell (theforespore) and a larger cell (the mothercell) [19,20]. Following completion of engulf-ment, the septum begins to curve and, even-tually, the smaller forespore becomes totallycontained within the mother cell in a pro-cess that resembles phagocytosis in highercells. The forespore is fully engulfed andpitches off a free cell in the mother cell cyto-plasm, so that the inner cell will become thespore and the outer mother cell nurtures thespore. Finally, the spore is released throughcell lysis (Figure 1.5.1) [19,20]. Seven differ-ent morphological stages during sporulationare recognized through which metabolicallyactive vegetative cells enter a stage of dor-mancy [12,17,21], as depicted in Figure 1.5.1.

1.5.1 Activationof histidine-sensor kinases andchanges in gene expression

Sporulation is triggered by the activation of histidine sensor kinases (including KinA,KinB and KinC), which shuttle phosphate through an extended phosphorelay, resultingin phosphorylation of the master regulator of sporulation, the transcription factor Spo0A.Phosphorylated Spo0A controls a large regulon of genes, including those involved inasymmetric cell division and those involved in activation of the sporulation-specific sigmafactors [20]. These changes in gene expression induce morphological differentiation in boththe pre-divisional sporangium and later in the two compartments (Figure 1.5.1) [20].

1.5.2 Gene regulation of sporulation

Sporulation is controlled by five transcription factors: svH, svF, svE, svG and svK (Figure 4).These transcription factors belong to a family of regulatory proteins in bacteria known asRNA polymerase sigma factors that direct the polymerase to particular promoter sequences

7


Stage II Stage III

Stage IV and V

Stage VI and VII

Stage 0

Figure 1.5.1. Life cycle of B. subtilis. The vegetative and the sporulation cycle. For simplicity stage Ihas been omitted. Sporulation begins when a sporangium divides asymmetrically to produce two compartments(stage II): the mother cell and the forespore, which are separated by a septum. Next, the mother cell engulfs theforespore (Stage III), and following membrane fission at the opposite pole of the sporangium, a double-membranebound forespore is formed. Coat assembly begins just after the initiation of engulfment and continues throughoutsporulation. The peptidoglycan cortex between the inner and outer forespore membranes is assembled during latesporulation (Stage IV and V). In the final step, the mother cell lyses to release a mature spore into the environment.Modified from McKenney et al [20].

8


Spo0AδH

δE δF

δE δFδK δG

(a)(

(b)

(c)

(d)

(e)

δGδK

Figure 1.5.2. Gene regulation during sporulation. (a) Spo0A and svH are activated in the pre-divisional cell,which leads to asymmetric division and (b) early compartmentalized gene expression with svF becoming active inthe pre-spore and svE in the mother cell. (c) A series of proteins produced in the mother cell degrade the asymmetricseptum and trigger migration of the membrane around the pre-spore, which is called engulfment, (d) When themembranes fuse at the pole of the cell, the pre-spore is released as a protoplast in the mother cell, and a secondround of compartmentalized gene expression occurs, with svG becoming active in the prespore and svK in the mothercell. These late factors activate transcription of the genes that build the structural components of the spore thatprovide its resistance qualities. (e) By lysis of the mother cell, the spore is released into the environment. Whenthe dormant spore encounters an appropriate environmental stimulus, it initiates the process of germination thatcan result in the re-initiation of vegetative growth if sufficient nutrients are present. Modified from Higgins et aland Piggot and Hilbert [17,19].

on the chromosome [22] (Figure 1.5.2). Spo0A (mentioned before) and also svH are activated inthe pre-divisional cell, which leads to asymmetric division. After asymmetric division takesplace, transcription factor svF is activated. When svF becomes activated in the foresporecompartment, a sigma factor called svE gets activated in the mother cell compartment.

After engulfment takes place, svF gets replaced on the forespore by a transcription factorcalled svG. Lastly, in the mother cell, the final transcription factor svK is activated [17].The svK-regulated genes include spore coat proteins that are connected to the outer partof the spore, whereas in the spore, the ger operons encoding for germination receptors,are transcribed by a svG-regulated RNA polymerase [23]. In addition, in the last step ofsporulation, the decrease of the core water content within the spore promotes the mothercell to lyse as a consequence of three autolysins referred to as programmed (mother) celldeath [24], with the concomitant release of the spore into the environment .

9


1.6 Structure of bacterial spores

The bacterial spore is composed of a number of compartments that are termed (i)exosporium, (ii) coat, (iii) outer membrane, (iv) cortex, (v) germ cell wall, (vi) innermembrane, and (vii) central core (Figure 1.6.1). (i) The exosporium is the most externallayer but is not found in all species of Bacillus. In B. cereus and its close relatives B.anthracis and B. thuringensis, the exosporium consists of a basal layer adorned with hair-like projections.

Recent structural studies have documented the crystalline bi-dimensional architecture ofthe basal layer [25]. It is composed of glycoproteins and may provide resistance to chemicaland enzymatic treatments, providing the spore with the ability to adhere to surfaces [26,27].

The exosporium is separated by a gap called interspace [20]. (ii) In B. subtilis the coat isformed by up to 70 different proteins. The function of the coat has not been completelyaddressed, however, it is implicated in spore resistance to chemicals and predation byprotozoa [28].

Figure 1.6.1. Schematic representation of typicalstructures in Bacillus subtilis spores. The multiple layersof the spore serve to protect the genome and proteins,which are housed in the partially dehydrated centralcore. The inner forespore membrane and the outerforespore membrane are represented in gray. The coreis protected by the cortex (green) and the spore coat,which consists of four layers: the basement layer (blue),inner coat (orange), outer coat (purple) and crust (red).The concentric rings of the basement layer and innercoat reflect the lamellar appearance of the inner coat inelectron micrographs. Modified from McKenney et al [20].

Recently, it has been shown that the coatis formed by three layers: the inner coat,the outer coat and the crust (Figure 1.6.1).(iii) The outer membrane is an essentialstructure during sporulation and may playa role as permeability barrier [26,28]. (iv)The cortex is essential for the formationof a dormant spore. It is composed ofpeptidoglycan, especially of muramic acid-d-lactam, which is important for the cortexlytic enzymes and recognition during sporegermination. During spore germination,the cortex is degraded by cortex lyticenzymes in order to allow the expansionof the core and further outgrowth [28,29].(v) The germ cell wall is also composedof peptidoglycan. During the final stageof spore germination the germ cell wallexpands and forms the cell wall of theoutgrowing spore. (vi) The inner membraneis a strong permeability barrier, playinga major role in resistance to a widerange of chemicals. It contains proteinsthat are important in germination such asthe nutrient germinant receptors and theSpoVA proteins. The lipid molecules in the inner membrane of the spore are largelyimmobile [30]. The viscosity of the bilayer is much higher when compared to that of thecell membrane of a growing cell or fully germinated spore [31]. The phospholipids and fattyacids found in the inner membrane of the spore are almost identical to those of the growingcell, indicating that the high viscosity is caused by a tight packing of the lipids as a result ofthe dehydration. Note, the phase transition temperature of dioleoyl lipids is well below -10°C and increases to higher than 60 °C when membranes are dehydrated [32,33]. A similar

10


situation is likely to exist in the inner membrane of the spore. (vii) The central coreof the spore has a low water content (25-50% of wet weight) and is rich in pyridine-2,6-dicarboxylic acid (DPA, s10% of total spore dry weight). The core plays an important rolein spore resistance, containing most of the spore enzymes, DNA, ribosomes and tRNAs.Furthermore, the core is the reservoir of small acid-soluble spore proteins, which is crucialfor spore resistance [28,34]. The internal pH of the core is another important feature, rangingfrom 6.3 to 6.5 in dormant spores and 7.5 to 7.8 in germinated spores or growing cells.The low pH may contribute to the spore metabolic dormancy [29,30,35], however, the lowwater content in the core is likely the major reason for zero metabolic activity in the spore.Although proteins appear to be immobile in the core, Kaieda et al have suggested that mostof the water molecules in the spore are highly dynamic [36].

1.7 Spore GerminationThe spore can be resistant and dormant for a long period of time, but underappropriate environment conditions, the spore looses its resistance and becomes agrowing and dividing cell. This process is called spore germination, which isan irreversible process that takes place in several stages (Figure 1.7.1) [29]. Thegermination process is triggered by the exposure to nutrients called ‘germinants’ [37].

Figure 1.7.1. Stages in germination of B. subtilis.Germination starts with activation of the spore, however,the exact mechanism of activation step is not known yet,hence are denoted in question marks. The first eventafter addition of nutrient is commitment to germination,even if the germinant is removed. Then the release ofmonovalent cations also takes place and is also associatedwith commitment. Shortly after, the Ca-DPA is releasedand the core is partial hydrated (Stage I). Note thatthe germ cell wall between the cortex and the innermembrane is not shown in this figure, and the germ cellwall expands somehow as the cortex is hydrolyzed in StageII of germination. This figure is reproduced from Setlowet al with permission and authorization [29].

The exact molecular mechanisms associatedwith the event are not well known, althoughit is associated with a major change inthe inner membrane permeability and theinner membrane structure. Monovalentcations, including H+, K+, and Na+ arereleased during this stage, followed by therelease of Ca-DPA (Stage I) [28,29]. Therelease of most Ca-DPA takes only a fewminutes for individual spores and is mostlikely via channels composed of SpoVAproteins (seven in B. subtilis spores, seebelow) [28,38]. Ca-DPA release marks theend of stage I, while the spore still isin a metabolically inactive phase. Instage II, the cortex lytic enzymes becomeactivated and specifically hydrolyze thepeptidoglycan of the cortex by targetingmuramic acid & lactam [39]. Spores ofBacillus species generally contain two majorcortex lytic enzymes, CwlJ and SleB, eitherof which alone is sufficient to allow thecompletion of spore germination [28,40]. Asthe cortex is hydrolyzed, the spore corebecomes further hydrated and expands,leading to further loss of resistance anddormancy (Figure 1.7.1). The re-start of

the metabolic activity signifies the end of stage II of germination and the beginning of

11


outgrowth.Upon completion of stage II of germination, the core water content has risen to 80%

of wet weight, equal to that in vegetative cells. This increased core water content allowsmetabolism in the core to begin, followed by macromolecular synthesis, ultimately convertingthe germinated spore into a growing cell [30]. In addition during outgrowth, acid-soluble sporeprotein that were bound to the spore DNA during dormancy are degraded by the germinationprotease, making the DNA available for transcription. This process results in the synthesisof proteins and further metabolic activity. As metabolism and macromolecular synthesisproceed, the spore escapes the coat to become a growing cell again (Figure 1.7.1) [41–43].

1.8 Germinant receptors in Bacilli

Bacillus spores are equipped with a specific set of germinant receptors that continuouslymonitor the environment for proper outgrowth conditions. Germinants, including aminoacids, sugars and purine nucleosides, are able to initiate germination when present inappropriate concentration and mixture in close proximity of the spore [14,28,44,45]. How thesegerminants transverse the outermost layers of the spore is not clear. However, there isevidence that GerP proteins are responsible for allowing nutrients and small molecules topermeate the outer layers (particularly the coat) of spores [28,46–48]. After the nutrientstraverse the outermost layers of the spore, they interact with specific germinant receptorsthat reside in the spore’s inner membrane [14,28,49,50].

B. subtilis expresses three major families of germinant receptors: GerA, GerB and GerK.The genes belonging to GerA represent the first germination operon described and GerAis the most studied receptor, mediating L-Alanine or L-Valine-triggered germination [51].Furthermore, GerB and GerK are both involved in a germination response to a mixture ofL-asparagine, D-glucose, D-fructose and potassium ions (AGFK response) [52].

The GerA receptors comprise three genes: gerAA, gerAB and gerAC [53]. Disruptionof any of these cistrons abolishes germination [54–56]. Recently, a putative fourth proteincomponent of germinant receptors has been described as ‘D subunit’. It has been suggestedthat D subunit plays a role in modulating rates of germinant receptors-dependent sporegermination, however the mechanism has not been fully understood [29,40,57].

GerAA is an integral membrane protein with 4 to 6 transmembrane (TM) segments witha large N-terminal hydrophilic domain and a small hydrophilic C-terminal domain [29,58,59].GerAB is predicted to be an integral membrane protein with 10 to 12 TM segments flankedby short hydrophilic termini [58,59]. GerAC is predicted to contain a pre-lipoprotein signalsequence, suggesting that the C-subunit is anchored to the outer surface of the membrane viaan N-terminally attached lipid moiety [40,60,61]. Mutational analysis indicates that lipidationof GerAC is essential for its role in germination [60,62]. The crystal structure of B. subtilisGerBC (homolog of GerAC) has been solved, but its function is still matter of debate [63].Interestingly, all GerA receptors are expressed and localized in the inner membrane of thespore. Mutations of highly conserved residues in GerAA, GerAB and GerAC have beenshown to affect germinant receptors function [29,56,62,64,65].

There is molecular-genetic and bioinformatic evidence that germinants bind specificallyto germinant receptors in the inner membrane of the spore [43,56,62,64,66,67]. However, thereare no studies showing that purified germinant receptors bind specific germinants, whichwould be definitive proof that these proteins are indeed serving as receptors [28].

12


1.9 GerD protein

Recent studies suggest that GerD, a lipoprotein of approx. 180-residues, is essential forgerminant receptors-dependent germination [29]. It is located in the outer surface of theinner membrane of the spore [28]. Its function is unknown, however, deletion of the gerDgene decrease the rate of germinant receptors-dependent of germination. Spores, which lackGerD, germinate normally with non-nutrient germinants. It is also known that germinantreceptors and GerD colocalize to a single cluster [68].

1.10 SpoVA proteins

In B. subtilis the SpoVA proteins are encoded by a heptacistronic operon that comprisesspoVAA, spoVAB, spoVAC, spoVAD, spoVAEa, spoVAEb and spoVAF. From these protein,SpoVAA, SpoVAB, SpoVAC, SpoVAEb and SpoVAF are predicted to be membrane proteins,with two to five membrane spanning regions and most likely present in the inner membraneof the spore [12,68–70]. Mutations in any of the first six cistrons of the spoVA operon eliminateCa-DPA uptake during sporulation [69,71,72].

Previous studies suggested that proteins encoded by the spoVA operon are involved inCa-DPA release [73,74]. This release of Ca-DPA is triggered not only by nutrients but alsoby agents such as the cationic surfactant dodecylamine, which bypasses the germinantreceptors [74,75]. There is strong evidence that one or more SpoVA proteins are involved inCa-DPA release: (i) a temperature-sensitive spoVA mutant is defective in Ca-DPA releasein spore germination. (ii) overexpression of the spoVA operon in spores increases the rateof Ca-DPA release in germination. (iii) loss of the SpoVAEa and SpoVAF proteins fromB.subtilis spores has an effect on the rate of DPA release during spore germination [28,76].Furthermore, recent studies showed SpoVAC to share features with channel like proteins,that would allow the release of Ca-DPA during germination of the spore [38], this thesischapter 3.

1.11 Non-nutrient germination

Germination of spores can be activated by non-nutrient germinants and regardless of thepresence of any of the germinant receptors. The best-studied non-nutrient germinantsare Ca-DPA [77–79] and cationic surfactants, in particular dodecylamine [75,80]. Additionof exogenous Ca-DPA appears to directly activate CwlJ, one of the cortex lytic enzymes,inducing the degradation of the cortex [78,79].

Dodecylamine induces quick loss of refractivity of the spore, release of DPA and lossof heat resistance. Mutants lacking all germinant receptors or the cortex lytic enzymesCwlJ and SleB germinated well with dodecylamine, indicating bypassing of the germinantreceptors and the cortex lytic enzymes [15,75]. The molecular mechanism of this effect isnot well understood, but it is possible that dodecylamine modifies the tension (lateralpressure profile) of the membrane with the concomitant activation of an associated proteinchannel [74]. There is strong evidence that SpoVA proteins are involved in Ca-DPA releasetriggered by dodecylamine. Notably, SpoVAC channel activity (see above) can also be gatedby surfactants including dodecylamine [38].

13


Additional non-nutrient germinants include N-acetyl glucosamine and N-acetyl muramic(muropeptide) derived from the breakdown of peptidoglycans from growing cells. Themuropeptide appears to trigger germination through activation of a spore protein kinase(PrkC), which phosphorylates serine/threonine residues, and whose kinase activity isrequired to trigger spore germination in response to muropeptides [81].

Bacillus spores also germinate when exposed to specific physical conditions like abrasionand high pressure [4,82–84]. High pressure is used in the industry to kill microbialcontaminants in order to preserve certain food products. Pressures ranging from 50 to350 Mpa and moderate temperature (20 to 50°C) induce spore germination by activation ofone or more of the germinant receptors, while higher pressure (500 to 1000 MPa) initiatesgermination, probably by the release of Ca-DPA through SpoVA channels [29,43,83,85].Abrasion causes mechanical damage to the spore, which in turn seems to activate CwlJand SleB and leads to the degradation of the cortex [82] followed by ion fluxes and hydrationof the core.

1.12 The role of mechanosensitive channels ingermination of bacillus spores

B. subtilis is a ubiquitous soil bacterium [9]. The solute and moisture content of the soilenvironment frequently fluctuates due to desiccation or to rain fall. B. subtilis must adjustthe levels of intracellular solute and water to avoid swelling or shrinkage due to excessiveor minimal soil moisture. In situations with low soil moisture, the bacterium accumulateshigh levels of solutes (e.g. glycine betaine) to prevent dehydration of the cytoplasm [86].The cell takes up water when soil water content increases, with an accompanying increasein cell turgor pressure to levels that can cause cell lysis. In this situation, the bacteriumrapidly releases accumulated solutes, probably via one or more mechanosensitive channels.Mechanosensitive channels work as safety valves allowing cells to extrude ions and solutesupon exposure to an osmotic downshift (Figure 1.12.1) [87]. These channels were firstdetected in Escherichia coli spheroplast by using patch clamp [87] (Figure 1.12.2).

This electrophysiology method measures the ion currents through individual channelproteins. The best studied mechanosensitive channels are: (i) the mechanosensitive channelof large conductance (MscL), (ii) the mechanosensitive channel of Small conductance (MscS),(iii) the mechanosentive channel depending of potassium in the medium (MscK) and (iv)the small mechanosensitive channel of minimum conductance MscM from E.coli [88]. Thesechannels respond to changes in membrane tension by releasing the internal pressure of thecell under hypoosmotic conditions [88] It is known that during the spore germination inbacillus, Ca-DPA is excreted in the first seconds of germination of individual spores [75].Given the dramatic osmolyte fluxes in sporulation and germination, it is not unreasonableto imagine that mechanosensitive channels are involved in this process [89]. However, all theknown mechanosensitive channels expressed in vegetative cells of B. subtilis are not involvedin germination and dodecylamine-triggered release of Ca-DPA [90]. We describe in chapter 3of this thesis that SpoVAC reconstituted in liposomes works as a mechanosensitive channel,releasing a fluorescent dye triggered by ionic surfactants [38]. These findings are in line withprevious studies that support that SpoVA proteins are working as a channel during sporegermination.

14


a b c d e

f

Hyperosmotic

shock

Hypoosmotic

shock

Hypoosmotic

shock

Figure 1.12.1. Physiological function of mechanosensitive channels in bacteria. a) Low osmolarity cells inosmotic balance. b) Cells shrink due to water loss. c) Turgor regain. d) Mechanosentive channels-assisted soluterelease. e) Normal growth. f) Channels fail to gate, which causes cell lysis. Taken from Booth et al [87].

5 s

60 mmHg

200 pA

bath

electrode

cell

electrical seal

amplifier

+

-

sensing electrode

Ag/AgCl wire

current i

glass capillary

output signal (V)

A

B

Negative presure

Command

Voltage

Figure 1.12.2. Patch clamp set up. A) The tip of an electrode-containing glass pipette is brought in contactwith the cell. A mild suction is then applied to form a very tight seal and to pull away the piece of membraneenclosed by the pipette tip. The bath solution is usually the same as for the pipette solution. The electrode, whichis connected to specialized circuitry, can measure currents passing across ion channel of the cell. A second electrodein the bath solution serves as reference or ground electrode. The arrows represent the negative pressure applied tothe membrane of the cell. B) A typical trace of MscL from giant unilamellar vesicles. Currents are depicted as pAand negative pressure as mmHg.

15


1.13 Outline of this thesisChapter I of this thesis summarizes the current view of sporulation and germination ofbacillus spores. We describe crucial events during life cycle of Bacillus subtilis, together withinsights in structure of the spore. In addition, we give new information about germinantreceptors and SpoVA proteins that are required during the initial events in germination anddescribe the function(s) of mechanosensitive channels. Chapter 2 focuses on the biochemicalcharacterization of the ABC subunits of GerA receptor proteins from Bacillus subtilis.

Chapter 3 elucidates the mechanism of one of the SpoVA proteins: SpoVAC. We presentstrong evidence that SpoVAC acts as mechanosensitive channel, presumably facilitating therelease of Ca-DPA and other low molecular compound during germination in vivo.

In Chapter 4, we present some final conclusions and future perspective of this study.

16

Biochemical characterization of the ABC subunits of germinant receptor GerA from

Bacillus subtilis

2 Biochemical characterization of theABC subunits of germinant receptorGerA from Bacillus subtilis

Jeanette Velásquez, Gea Schuurman-Wolters, Tjakko Abee and Bert Poolman

Bacillus spores can survive for extended periods of time in their dormant state, butspore germination can be triggered upon binding of nutrient germinants to spore-specific protein complexes, the so-called germinant receptors. Despite the large amountof genetic evidence supporting a role for germinant receptors in the initiation ofgermination, there are no studies showing that purified germinant receptors bind specificgerminants in vitro. In this work, we study the GerA family receptor of Bacillus subtilis.We successfully cloned and overexpressed gerAA, AB and AC genes in Lactococcus

lactis, with the subsequent isolation, purification and incorporation of GerAA, AB andAC proteins into artificial membranes. We characterize the proteins by performingintrinsic and extrinsic fluorescence assays to monitor conformational changes of GerAA,AB or AC upon addition of potential ligands. Unfortunately, we have not observed anychanges in fluorescence that would characterize such a ligand as germinant. The stabilityand folding of GerAC was studied with differential scanning calorimetry and circulardichroism. Moreover, membrane reconstitution of GerAA and GerAB in liposomes andtransport assays were performed using radiolabelled substrate. We did not observedetectable transport of the substrate. In summary, GerA receptor proteins isolated withour experimental approach are not very stable after purification, which was a limitationfor biochemical characterization. Improvements of purification and reconstitution ofGerA receptors proteins will help to understand the function of these proteins.

2.1 IntroductionBacterial spores are formed under conditions of nutrient limitation. They have the ability toremain dormant for long periods of time and are resistant to heat, desiccation, extreme pHchanges and toxic chemicals [34]. However, upon exposure to specific nutrients they rapidlyenter into a growing cell stage, a process called germination [15,61]. During germinationa series of events occur, wherein the germinant receptors, located in the spore’s innermembrane, mediate the first step(s) [14,40,91]. To start the germination process, ‘germinants’should activate these receptors. It is not clear how the germinants reach the inner membraneof the spore and to what extent the permeability of the spore coat is sufficient for passage ofexogenous germinants. There is some evidence that GerP could be involved in facilitatingthe access of germinants to the inner membrane of the spore. However, the underlyingmechanism is not clear yet [28,46–48].

17


Bacillus subtilis

Upon germination, the cell releases monovalent cations and dipicolinic acid (DPA)complexed with Ca2+ ions. The concomitant influx of water results in an increase of thehydration of the spore core and subsequent hydrolysis of the spore’s peptidoglycan cortex.Next, the spore core takes in more water and the germ cell wall expands, allowing enzymaticaction and full germination of the spore [15,40,91].

Bacillus subtilis expresses three major families of germinant receptors: GerA, GerB andGerK. However, GerA family is the most studied receptor, mediating L-Alanine- or L-Valine-triggered germination. Arranged in a tricistronic operon, the GerA receptors comprisethree genes: gerAA, gerAB and gerAC [53]. Disruption of any of these cistrons abolishesgermination [54–56].

Previous reports suggest that GerAA is an integral membrane protein with 4 to 6transmembrane (TM) segments with a large N-terminal hydrophilic domain and a smallhydrophilic C-terminal domain [29,58,59]. GerAB is predicted to be an integral membraneprotein containing 10 to 12 TM segments, flanked by short hydrophilic termini [58,59].GerAC is predicted to contain a pre-lipoprotein signal sequence, suggesting that the C-subunit is anchored to the outer surface of the membrane via an N-terminally attachedlipid moiety [40,60,61]. Mutational analysis indicates that lipidation of GerAC is essential forgermination (18, 19). The crystal structure of B. subtilis GerBC (homolog of GerAC) hasbeen solved, but its function is still matter of debate [34,63].

Mutations of highly conserved residues in GerAA, GerAB and GerAC have been shownto affect germinant receptor function [15,28,56,61,62,64,65]. GerAB has been proposed to beinvolved in the recognition of the germinant [14,40,62,91–93]. GerAB protein has a certainhomology with a superfamily of transmembrane amino acid permeases [28,46–48,67]. Previousreports of GerAB homologs in B. megaterium QM 1551 suggest that germinant specificityvaries when alternate B subunits (GerUB and GerVB) are used [53,93]. In addition, pointmutations in TM 9 and 10 of GerVB protein from B. megaterium reduces the affinityand specificity for germinants [54–56,94]. Furthermore, it has been suggested that the C-terminus of the B subunits is involved either in the formation of a binding pocket oraffects the conformation of nearby functionally-important regions [29,58,59,95]. A recent study,using site-directed mutations in B. subtilis gerAB, shows that the residues modified in thetransmembrane domain affect the function of GerAB and the whole GerA complex [58,59,62].

There is yet little understanding of how germinant-receptor interactions trigger Ca-DPArelease, an essential event in the first step of spore germination. Vepachedu et al [40,60,61,74]suggest that germinant receptors interact with SpoVA proteins that are involved in Ca-DPA release [60,62,74]. Recent in vitro studies demonstrated that SpoVAC can act as amechanosensitive channel, which would allow release of low molecular weight moleculesfrom the spore during germination [38].

Most of the conclusions about the function of germinant receptors are based on geneticexperiments, but biochemical characterization of the proteins is lacking. One of thebottlenecks in the characterization of germinant receptors is the difficulty to overexpressand purify the protein complexes [61]. Here, we report the cloning and overexpression of thegerAA, gerAB and gerAC genes, and the purification and membrane reconstitution of therespective GerAA, GerAB and GerAC proteins. We performed several biochemical assaysincluding ligand binding and transport studies but could not unequivocally assign a functionto the GerA proteins.

18


Bacillus subtilis

2.2 Material and Methods

2.2.1 Cloning and expression of GerA genes

GerAA, gerAB and gerAC were amplified by PCR, using the Bacillus subtilis 168 genome astemplate and Phusion polymerase, according to the manufacturer’s instructions (FermentasLife Sciences (Burlington, CA). Full-length gerAA and gerAB were cloned in frame in thepRE-NLIC vector (described by Geertsma) [96]. On the other hand, gerAC was clonedwithout the nucleotide sequence coding for the signal sequence (gerAC�ss). The PCRproducts were cloned in pRE-NLIC vector and converted into Lactococcus lactis expressionvectors, using vector-backbone exchange system [96].

All the primers used in this work are described here:

gerAA and gerAB fwd nLic5’ ATGGTGAGAATTTATATTTTCAAGGTGAACAAACAGAGTTTAAGGAATATATA 3’

gerAA and gerAB rev nLic5’ TGGGAGGGTGGGATTTTCATTTTGTTGTAATCCTCCTCTTGAGAGC 3’

gerAC�ss fwd nLic5’ ATGGTGAGAATTTATATTTTCAAGGTTGGGACAGTGAGAATATCGAGGAATTA 3’

gerAC�ss rev nLic5’ TGGGAGGGTGGGATTTTCATTTGTTTGCGCCTTTCGTTCCGAAGTC 3’

GerAA and GerAB proteins containing N- and C-terminal His10 tag, respectively [96], andGerAC containing a N-terminal His10 tag followed by TEV cleavage site were producedin L. lactis NZ9000, grown semi-anaerobically in M17 medium [97] and supplemented with1% (w/v) of glucose and 5 mg l−1 chloramphenicol. For large-scale protein production, L.lactis was grown in 2 or 10 litter batch reactors (Applikon Biotechnology, Delft) at 30 °C.The pH was kept constant at 6.5 by titration with 1M KOH. The cells were induced with0.1 % (v/v) culture supernatant of the nisin A-producing strain NZ9700. After 2 hours ofinduction the cells were harvested at 5,000×g for 15 min at 4 °C and the pellet of 1 L of cellswas resuspended in 10 ml of 50 mM KPi at pH 7.5. The cells were frozen in liquid nitrogenand stored at -80 °C.

2.2.2 Cell lysis and membrane vesicle preparation

Frozen cells expressing GerAA, GerAB or GerAC were thawed at room temperature andsupplemented with 1 mM PMSF, 1 mM MgSO4 and DNase (⇠50 mg ml-1). The cellswere lysed using two passages through a Constant System Ltd cell disrupter, operated at39 kpsi and 5 °C. Cell debris was removed by centrifugation (20 min 18,500×g, at 4 °C),and subsequently membrane vesicles containing both GerAA and GerAB were collected byultracentrifugation (90 min, 150,000×g at 4 °C); the supernatant was discarded. Membranevesicles were kept resuspended in 50 mM potassium phosphate, pH 8.0 and store at -80 °C,following flash freezing of 1ml aliquots in liquid nitrogen. The total protein content wasmeasured with a BCA protein assay (Thermo Scientific Pierce).

To isolate the water-soluble GerAC protein, the supernatant after ultracentrifugation oflysed cells was collected and kept on ice for purification of the protein; here, the pellet wasdiscarded.

19


Bacillus subtilis

2.2.3 Purification of GerAA, GerAB and GerAC

For purification of GerAA and GerAB, membrane vesicles (40 mg of total protein) werethawed and diluted to approximately 5 mg ml-1 total protein in buffer A (50 mM KPi pH7.5, 200 mM KCl, 20% (v/v) glycerol, 0.5% (w/v) n-dodecyl-b-D-maltoside (DDM) and15 mM of imidazole) plus 1 mM of dithiotreitol (DTT) for 30 min on ice with occasionalgentle mixing. Next, the mixture was centrifuged (20 min, 325,000×g, 4 °C) to separatethe soluble from non-soluble material. For purification, 0.8 ml of Ni2+ - Sepharose resin(Amershan Biosciences) was placed in a disposable column (BioRad) and washed with10 column volumes (CV) of MilliQ water and equilibrated with 10 CV of buffer A. Thesolubilized material was added to the Ni2+ - Sepharose, and the mixture was incubated for1 hour at 4 °C under gentle mixing. Subsequently, the resin was washed with 20 CV ofbuffer A supplemented with 50 mM of imidazole plus 0.05% (w/v) DDM. The His-taggedproteins were eluted from the column by adding subsequently 640 µl, 960 µl and 960 µl ofbuffer A supplemented with 500 mM of imidazole plus 0.05% (w/v) DDM; most of GerAAand GerAB eluted in the 960 µl fraction. DTT (1 mM) was present in all the steps ofpurification.

In case of GerAC, 0.5 ml of Ni2+ – Sepharose resin (Amersham Biosciences) was mixedwith 40 ml of supernatant from lysed cells. The mixture was incubated overnight by rotationat 4 °C in buffer A (50mM KPi, 300 mM NaCl, 10% (v/v) glycerol, pH 7.5) supplementedwith 15 mM imidazole. The next day, the sample was collected in a polypropylene columnand the flow through was discarded. Subsequently, the resin was washed with 40 columnvolumes of buffer A containing 70 mM of imidazole. The protein was eluted in fractionsof 400 µl, 600 µl and 600 µl, using elution buffer containing 500 mM of imidazole. Thesecond elution fraction was concentrated, using the 30 kDa cut-off Vivaspin concentratorswith PES membrane from Sartorius, and GerAC was purified further on a Superdex 20010/ 300 GL size exclusion column (Amersham Bioscience), using 50 mM KPi plus 200 mMNaCl at pH 7.5. Fractions of pure protein were kept on ice and used immediately for furtherstudies. The purity of the protein samples was confirmed by SDS-PAA gel electrophoresisand Coomassie Brilliant Blue staining.

2.2.4 Multi-angle laser light scattering (SEC-MALLS)

To determine the oligomeric state of GerAC, size-exclusion chromatography coupled to multi-angle laser light scattering (SEC-MALLS) was used. 200 ml of ⇠0.5 mg ml-1 GerAC wasapplied on a Superdex 200 10/300 GL gel filtration column (GE health care) in 50 mM Kpiand 200 mM NaCl pH 7.5, using an Agilent 1200 series isocratic pump (flow rate of 0.5ml min-1) at room temperature. Detectors were used for absorbance at 280 nm (Agilent),static light scattering (miniDawn TREOS Wyatt) and differential refractive index (OptilabRex Wyatt). The ASTRA software package version 5.3.2.10 (Wyatt) was used for dataanalysis [98,99].

2.2.5 Membrane reconstitution of GerAA and GerAB

Purified GerAA and GerAB were reconstituted in E. coli polar lipids plus eggphosphatidylcholine (PC) in a ratio 3:1 (w/w), according to Geertsma et al [100], at 20mg ml-1 of total lipid in 50 mM KPi, pH 8.0, and homogenized by extrusion through a400-nm filter. For detergent-mediated reconstitution, the liposomes were destabilized by

20


Bacillus subtilis

the stepwise addition of Triton X-100 as described previously [100]. Protein and lipids weremixed at 1:50, 1:100 and 1:250 (w/w). Subsequently, Biobeads (SM-2 Absorbents; Bio-Rad)were added in steps to remove the detergent [100].

2.2.6 Intrinsic fluorescence of GerAA, GerAB and GerAC

Measurements of fluorescence were performed on a Spex Fluorolog 322 fluorescencespectrophotometer (Jobin Yvon) at 25 °C in a 500 ml stirred cuvette. The excitation andemission wavelengths were 280 and 340 nm, with slit widths of 1 and 2 nm, respectively.Solutions of substrate were added in 4 mL steps. We tested all amino acids, either individuallyor as mixtures at concentrations ranging from 1 mM to 10 mM. As a control, titrations withbuffer (50 mM kPi plus 200 mM NaCl, pH 7.5) in the presence of protein were performed.

2.2.7 ANS binding to GerAC

To monitor conformational changes via an extrinsic fluorophore, GerAC was labeled with8-anilino-1-naphthalene sulfonate (ANS). 100 µM final concentration of ANS was used forlabelling. The GerAC-ANS complex was excited at 297 nm and the fluorescence emissionwas monitored between 300 and 550 nm [101]. Solutions of substrate were added in 4 mLsteps. We tested at all amino acids individually or as mixtures at concentration rangingfrom 0.2 mM to 100 mM.

2.2.8 Homology modeling of GerAC

The tertiary structure of GerAC was modeled theoretically using MODELLER, a programfor protein structure modeling [102], using as a template the structure of GerBC [63].

2.2.9 Circular dichroism (CD) of GerAC

To determine (changes in) the secondary structure of GerAC, Far-UV circular dichroismspectra were recorded on a Jasco J-815 CD spectrometer (Jasco, UK) at room temperature,using a quartz cell of 1 mm path length between 198 and 250 nm and scanning every 2nm. A buffer containing 50 mM kPi plus 200 mM NaCl (pH 7.5) was used as a reference.In order to estimate GerAC secondary structure from CD spectra, we used K2D2 methodcurrently available on line [103,104].

2.2.10 Differential scanning calorimetry (DSC) of GerAC

The stability of GerAC without and with amino acids was measured by DSC on a VP-DSC(MicroCal) at 25 °C and at 25 psi. 600 mL of GerAC (7.5 µM) in buffer containing 50 mM kPiplus 200 mM NaCl (pH 7.5) was added to the cell. To prevent the formation of air bubbles,protein samples and buffers were degassed before injection into the cell. For temperaturescans in the presence of L-Ala, the samples were equilibrated for 10 min at 25 °C prior tothe temperature ramps. A scan rate of 60 °C/hour and a temperature range of 30 to 65 °Cwere used. Data was analyzed by the MicroCal software [105].

21


Bacillus subtilis

2.2.11 Unfolding and refolding of GerAC

The fluorescence emission spectrum of the native GerAC was obtained with emission scansfrom 300 to 400 nm and following excitation of 280 nm. For (partial) unfolding, GerAC wastreated with 3 M of urea, and, subsequently, the protein was refolded by dilution of urea(the concentration of urea remained was 0.6 mM) in the absence or presence of amino acids.

2.2.12 Counterflow assay with GerAA and GerAB reconstituted inliposomes

GerAA and GerAB reconstituted in E. coli polar lipids plus egg PC in a ratio 3:1 (w/w) at1:50, 1:100 and 1:250 protein to lipid ratio (w/w) was assayed for amino acid counterflowactivity. To preload the vesicles with amino acid, the proteoliposomes were frozen andthawed 3 × in 50 mM KPi, pH 7.5, 50 mM NaCl and 10 mM L-Ala. The samples werefrozen in liquid nitrogen and thawed slowly at room temperature. After 11× extrusionthrough a 400-nm filter, the proteoliposomes were centrifuged (15 min at 280,000×g, 4 °C)and resuspended in 30 ml of buffer (50 mM KPi, pH 7.5, 50 mM NaCl and 10 mM L-Ala)to about 6.6, 3.3, and 1.3 mg ml-1 of protein and 333.3 mg ml-1 of lipid.

To determine putative binding or transport of L-Ala, aliquots of 3 ml of proteoliposomeswere diluted into 293 ml of 50 mM KPi, pH 7.5 plus 50 mM NaCl, containing 5 mM of [14C]L-Ala (105 mM, final concentration). The uptake of [14C] L-Ala was stopped at differenttime intervals by dilution of the sample with 2 ml of ice-cold 0.1 M LiCl and rapid filteringon 0.45-nm cellulose nitrate filters (Schleicher & Schuell). Empty liposomes were taken as anegative control.

2.2.13 Counterflow experiment using fused membranes

The membrane vesicles expressing GerAA and GerAB were thawed at room temperatureand subsequently fused with liposomes composed of E.coli polar lipids plus egg PC as wasdescribed previously by Driessen et al [106]. 1 mg of membrane vesicles and 10 mg of liposomeswere mixed by pipetting. The suspension was rapidly frozen and stored in liquid nitrogen.Fused membranes were equilibrated with 1 or 5 mM of L-Ala and 5 mM of MgSO4 for3 or 5 hours at 25 °C. Then the sample was extruded through 400 nm and subsequentlythrough 200 nm polycarbonate filters. The fused membranes was washed by centrifugation(15 min at 280,000×g, 4 °C) in 50 mM KPi, pH 7.5 plus 5 mM MgSO4 and containing 1 or5 mM L-Ala; the sample was resuspended at final protein concentration of 25 mg ml-1. Forcounterflow assays, 4 ml of sample was rapidly diluted into 200 ml of KPi pH 6.0 plus MgSO4and 3 mM [14C] L-Ala (103 mM, final concentration).

2.3 Results

2.3.1 Cloning, expression and purification of GerAA, GerAB andGerAC

The Vector-Backbone Exchange system (VBEx), described by Geertsma et al [96], gavegood results for the overexpression of GerA receptors proteins in L. lactis. ThegerAA and AB genes were cloned in tandem in the same construct and gerAC was

22


Bacillus subtilis

cloned as a soluble protein without the lipid anchor (described in Materials andMethods). We were able to co-purify GerAA and GerAB with a final yield of0.03 mg and 0.3 mg respectively from 40 mg (total membrane protein); these valueswere calculated from gel using ImageJ, Image processing and analysis in java [107].

130957255

36

28

M 1 2 3 4 5 6 7 8

GerAA

GerAB

976645

33

20

GerAC

A

B

C

Elution volume (ml)

0

10000

20000

30000

40000

50000

Mol

ecul

ar m

ass

(Da)

15 17 19 0

1

2

3

4

A 280

(Arb

itrar

y un

its)

14 16 18

M 1 2 3 4 5 6 7 8 9 10

20

Figure 2.3.1. Expression and purification of GerAA,GerAB and GerAC. (A) Protein samples from differentpurification steps of GerAA and GerAB expressed inL. lactis. Membrane vesicles were used as startingmaterial for the protein purification. Lane 1: DDM-insoluble fraction (⇠10 µg of total protein loaded), lane 2:DDM-soluble fraction, lane 3: flow-through of the Ni2+-Sepharose column, lane 4: wash fraction of the Ni2+-Sepharose column, lanes 5-7: three elution fractions ofthe Ni2+-Sepharose column, lane 8: GerAA and GerABreconstituted in liposomes. (B) Protein samples fromthe GerAC purification, using the cell lysate as startingmaterial. Lane 1: flow-through of the Ni2+-Sepharosecolumn, lane 2: wash fraction of the Ni2+-Sepharosecolumn, lanes 3-5: three elution fractions of the Ni2+-Sepharose column. Lanes 6-10: peak elution fractions(⇠0.5 mg ml-1) of the size-exclusion chromatography.The peak elution fraction shown in lane 9 was appliedto a Superdex 200 column for SEC coupled to multi-angle laser light scattering SEC-MALLS measurements.(C) Molecular weight determination by SEC-MALLS. Themolecular mass was calculated through the eluting peaksand is indicated in blue line. The protein samples wererun on a 12.5 % SDS-PAA gel electrophoresis and stainedwith Coomassie Brilliant Blue.

In case of GerAC we purified 0.5 mgfrom 200 mg (total soluble protein) (Figure2.3.1).

The GerAA and GerAB proteins wereexpressed at different levels (Figure 2.3.1-A). The predicted molecular weights ofGerAA and GerAB are 55 and 44 kDa,respectively. GerAA migrates in the gelaround 55 KDa and GerAB migrates around32 kDa. The apparent increased mobility ofGerAB can be explained by the tendencyof very hydrophobic proteins not to unfoldcompletely. The levels of GerAA werelow and barely visible after Ni2+-Sepharosechromatography (Figure 2.3.1-A).

Figure 2.3.1-B shows the purification pro-file of GerAC after Ni2+-Sepharose and size-exclusion chromatography. A monomericstate of GerAC was confirmed by static-light scattering measurements, yielding amolecular weight of 45 kDa (Figure 2.3.1-C), which is close to the predicted molecularweight of 42.7 kDa. Thus, of the three GerAreceptors proteins, we could purify GerABand GerAC to a high degree of purity.

2.3.2 Fluorescence studies

Intrinsicfluorescence of GerAA, AB and GerAC

In order to study the binding of L-Ala(proposed germinant) or mixtures of aminoacids to GerA subunits, we performed anintrinsic protein fluorescence assay eitherin the presence or absence of potentialsubstrates as described in the Materialsand Methods. GerAA, GerAB and GerACshow a high peak of emission spectraaround 345 nm in the absence of substrate(Figure 2.3.2-A and 2.3.2-B), and we didnot observe any change in emission spectraupon addition of L-Ala or a mixtureof amino acids compared to the control

23


Bacillus subtilis

300 320 340 360 380 400

0

0.2

0.4

0.6

0.8

1.0

1.2 ion

0.1 mM 0.5 mM 1 mM 5 mM

F

(AU

)

Wavelength (nm)

0 mM

300 320 340 360 380 400

0

0.2

0.4

0.6

0.8

1.0

1.2

0 µM 1 µM

10 µM 100 µM

F(A

U)

Wavelength (nm)

A B

300 320 340 360 380 4000

0.5

1

1.5

2.0

2.5

F (A

U)

Wavelength (nm)

0 mM 1 mM

C

Figure 2.3.2. Effect of L-Alanine (L-Ala) or mixtures of amino acids on the intrinsic fluorescence of GerAAand GerAB and GerAC. (A). Emission spectra of GerAA and GerAB were recorded in the absence (black line)and presence of L-Ala (red, blue, green and light blue lines correspond to increasing concentrations of L-Ala). (B)Emission spectra of GerAA and GerAB in the absence (black line) or presence of mixture of all amino acids (red,blue and green indicate increasing concentrations). (C). Emission spectra of GerAC in the absence (black line) andpresence of 1mM of L-Ala (red line).

(addition of buffer). Also, in case of GerAC(Figure 2.3.2-C), no clear difference was observed after the addition of 1mM of L-Ala. Thesepreliminary results suggest that the proteins do not exhibit a recordable binding of L-Alaor other amino acids under our experimental set up.

300 350 400 450 500 550 600

0

0.5

1.0

1.5

2.0

2.5

F (A

U)

Wavelength (nm)

Buffer Buffer + ANS GerAC GerAC + ANS

Figure 2.3.3. Fluorescence emission spectra of ANSin the absence and presence of GerAC. The excitationwavelength for the four samples was 297 nm, and theemission spectra were recorded between 300 and 600 nm.The measurements were performed in 50 mM KPi (pH7.5). Buffer only (open circles), buffer plus 100 µM ANS(closed circles), 3 µM GerAC in buffer (open triangles)and ANS in the presence of 3 µM GerAC (closed triangle)

Changes in intrinsic protein fluorescencerequire a fraction of aromatic residues,most notably Tryptophan (Trp), to changeenvironment upon binding of ligand, whichdoes not always happen in proteins bindinga particular ligand. We thus performedan alternative fluorescence-based assay toprobe ligand-binding activity, using ANSas extrinsic probe for GerAC. We obtaineda successful binding of ANS to GerAC,as can be seen from the resonance energytransfer from the protein (decrease in peakat around 345 nm) to ANS (increase in peakat around 475. nm) (Figure 2.3.3).

Figure 2.3.4 shows the effect of sub-sets of amino acids (neutral, basic andacid in Figure 2.3.4-B, 2.3.4-C and 2.3.4-D,respectively) in the fluorescence of GerAC-ANS. Clearly, the protein did not exhibita significant and reproducible change in theprofile of the fluorescence upon the additionof the amino acid mixtures, i.e. whencompared to the control sample (buffer).In fact, a decrease of the fluorescence was

24


Bacillus subtilis

observed for every case, disregarding the nature of the amino acids, and the effect wassimilar in the control sample (Figure 2.3.4-A). Taking together, the protein did not clearlyexhibit specificity for any of the substrates tested in our experiments.

Unfolding and refolding of GerAC with Urea

The fluorescence maxima of a native protein is strongly correlated with the polarity of theenvironment of the Trp residues and can range from 308-350 nm, with aromatic residues inapolar microenvironments having blue emission and residues in polar environments havingred emission. Unfolding of a protein almost always leads to a red shift in the emission towavelength maxima of around 345-355 nm [108,109].

A feature found in the previous experiments with GerAC protein clearly shows thatthe emission spectra of unlabelled GerAC have a maximum at 345 nm. Apparently thisbehaviour can be attributed to high degree of solvent accessibility to aromatic residues(e.g. Trp). This indicates that a significant fraction of aromatic residues of recombinantly-expressed and purified GerAC are (partially) exposed to solvent with emission in the red.

Next, we tested whether the fluorescence spectra of GerAC could be shifted upon (partial)denaturation and refolding. Firstly, we treated the protein with 3M of urea. Unfolding ofthe protein was confirmed by the emission spectra with a peak near 360 nm. After that,we attempted to refold GerAC by dilution of urea with buffer and observed an emissionmaximum at 350 nm (Figure 2.3.6-A), indicating that GerAC did not go back to its nativestructure. Posteriorly, we added the amino acid mixture but did not observe any change inthe intrinsic protein fluorescence.

Homology modelling of GerAC

In order to understand the molecular details of our previous fluorescence experiments, weanalysed the X-ray structure of the highly homologous GerBC (33 % of sequence identity,PDB: 3N54). The structure reveals that tryptophan residues are indeed exposed to theenvironment (Figure 2.3.5-B). To depict the structural organization of GerAC more clearly,we modelled the tertiary structure followed by a relaxation and 1 ms molecular dynamicssimulation. Figure 2.3.5-A depicts the average structure, revealing a clear exposure of thearomatic residues to the solvent. Further calculation of the surface area accessible to solventof tryptophans revealed a total of 8 nm2 and 11 nm2 for GerBC and GerAC respectively.In fact, this result is attributed to the extra aromatic residue present in GerAC, increasingthe area of exposure.

Overall, our results suggest that GerAC shows a partially red shifted emission spectrum,similar to GerBC, which structure shows that most of the residues are exposed to thesolvent [63]. Moreover, the aromatic residues in GerAC are prone to be solvent exposed,which is in agreement with our fluorescence measurements.

2.3.3 Circular dichroism (CD)

In order to validate the results from the fluorescence assays, we performed circular dichroism(CD) measurements to determine the secondary structure of unfolded and refolded GerAC.We observed that GerAC contains a mixture of a-helix and b-sheet structures with predictedvalues of 24.05 % and 22.54 %, respectively [104] (Figure 2.3.6-B). These results are inagreement with those for GerBC. As described previously, GerBC adopts an uncharacterized

25


Bacillus subtilis

300 350 400 450 500 550 6000

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

1.0

F (A

U)

Wavelength (nm)

2 3 4 5 6 7

01

8

300 350 400 450 500 550 6000

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

1.0 0 0.2 µM 0.4 µM 0.6 µM 0.8 µM 1 µM 5 µM 10 µM 100 µM

Wavelength (nm)

F (A

U)

300 350 400 450 500 550 6000

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

1.0

Wavelength (nm)

0.2 µM 0.4 µM 0.6 µm 0.8 µM 1 µM 5 µM 10 µM 100 µM

0 µM

F (A

U)

300 350 400 450 500 550 6000

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

1.0

Wavelength (nm)

0.2 µM 0.4 µM 0.6 µM 0.8 µM 1 µM 5 µM 10 µM 100 µM

0 µM

F (A

U)

A B

C D

µM

Figure 2.3.4. Fluorescence Spectra of GerAC-ANS complex titrated with amino acid mixture. (A) Titration ofGerAC-ANS with buffer (1 to 8 represent, buffer addition of 4 µl ). (B) Titration of GerAC-ANS with 0 to 100 µMof neutral amino acids (mixture). (C) Titration of GerAC-ANS with 0 to 100 µM of basic amino acids (mixture).(D) Titration of GerAC-ANS with 0 to 100 µM of acid amino acids (mixture). For each addition 4 µl of solutionwas used in all the experiments.

26


Bacillus subtilis

A

B

Figure 2.3.5. Homology modelling of GerAC. (A) GerAC homology model; (B) GerBC crystal structure; datataken from Li et al [63]. The red arrows show Trp residues that are depicted in purple color.

27


Bacillus subtilis

290 300 310 320 330 340 350 360 370 380 390 400 4100

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.91.0

1.1

1.2

Wavelength (nm)

GerAC GerAC Unfolded GerAC refolded GerAC refolded

+ Aa

F (A

U)

190 200 210 220 230 240 250-4

-3

-2

-1

0

1

2 GerAC GerAC refolded GerAC unfolded

Wavelenght (nm)

Elli

ptic

ty *

10-3(d

eg*c

m2 *

dmol

-1)

A B

Figure 2.3.6. Unfolding and refolding of GerAC. Emission spectra scans from 300 to 400 nm was measured.GerAC in the absence of urea is shown as black line; GerAC in the presence of 3M urea is shown as red line; GerACrefolded upon dilution of urea is shown as blue line; refolded GerAC in the presence of amino acid mixture isshown as green line. (B) CD spectra of unfolded and refolded GerAC. GerAC without urea (open circles); GerACwith 3 M of urea (closed triangles) and GerAC refolded (closed circles). The concentration of GerAC used in bothexperiments was 0.3 µM. Both experiments (A) and (B) were done the same day with the same protein preparation.

type of protein fold consisting of three distinct domains containing b−sheets surrounded bymultiple a-helices [63].

We were unable to record CD spectra below 205 nm upon incubation with 3M of urea,however, we observed changes in the CD signals at either 222 or 225 nm, which are essentialto assess protein unfolding [110,111]. The observed shift in ellipticity of a-helix and b-sheettowards random coil structures indicates that the protein was indeed unfolded. Upon ureadilution, the original secondary structure was not totally recovered, indicating that theprotein does not refold well.

2.3.4 Differential Scanning Calorimetry (DSC)

DSC was used to study the thermal stability of GerAC without or with added amino acids.Figure 2.3.7 shows thermograms of GerAC in the presence or absence of 1 mM of aminoacid mixture. We determined a melting temperature of around 47 °C and a very low heatcapacity (Cp), which is indicative of a largely unstable or unfolded protein.

2.3.5 Binding or transport of GerAA and GerAB triggered by L-Ala

Because other studies indicate that GerAB could be involved in binding of germinants andconceivably transport L-alanine [62], we purified and reconstituted GerAA and GerAB inE.coli polar lipids plus egg PC and probed the counterflow uptake of L-Ala. The counterflowuptake is a useful assay to measure the inward flux of an isotopic-labelled solute ([14C] L-Ala)for the outward flux of an unlabelled compound (L-Ala or other amino acid).

28


Bacillus subtilis

Proteoliposomes were loaded with 10 mM of L-Ala at pH 7, and uptake of [14C] L-Ala at 5 mM was measured. Three protein-to-lipid ratios (1:20, 1:50 and 1:100, w/w)were tested, however, we did not find significant uptake of radiolabeled L-Ala (data notshown). In addition, we fused membrane vesicles from L. lactis expressing GerAA andGerAB with liposomes composed of E.coli polar lipids plus egg PC as described in Materialsand Methods, but again no uptake above background was observed (data not shown).

35 40 45 50 55 60 65

4.0x10-4

4.5x10-4

5.0x10-4

5.5x10-4

Cp

(cal

/ o C)

Temperature (oC)

GerAC + 1mM amino acid GerAC

Figure 2.3.7. Differential scanning calorimetry ofGerAC in the absence and presence of amino acidsmixture (1 mM final concentration). The concentrationof GerAC was 7.5 µM.

2.4 Discussion

2.4.1 Cloning and overexpressionof GerA receptor proteinsWe have successfully cloned and overex-pressed gerAA, gerAB and gerAC genes inL. lactis, and purified the GerA receptorproteins. GerAB and GerAC were obtainedin higher amounts than GerAA, but the iso-lated GerAA and GerAB protein productswere sufficient for biochemical studies suchas reconstitution of the proteins in E. colipolar lipids and egg PC.

2.4.2 Spectroscopicand calorimetric analysis of GerAreceptor proteinsTryptophan fluorescence emission spectroscopy is a standard method to monitorconformational changes in proteins upon binding of ligands [112]. We have not observed anychanges in fluorescence upon the addition of amino acids to GerAA, GerAB and GerAC,implying that i) the (individual) proteins do not bind amino acids. ii) a complex of allthree is necessary for the binding. iii) one or more of the proteins are misfolded, which mayaffect the overall activity. The latter was specifically studied for GerAC, using extrinsicprobe-protein fluorescence, DSC and CD spectroscopy. Overall, our results indicate thatthe secondary structure of GerAC and GerBC protein are similar [63], and both proteinsexpose several aromatic residues (tryptophans) to the solvent. Thus, the localization of thearomatic residues in the GerBC protein suggests that they are not part of a proper bindingsite to allow screening of ligand binding by fluorescence changes.

2.4.3 Binding or transport mediated by GerAA and GerABGerAA and GerAB were reconstituted in liposomes composed of E.coli polar lipids plusegg PC, and counterflow assays have been performed, to probe for potential transportof radiolabeled L-Ala. However, no additional influx of labeled L-Ala was observedin pre-loaded liposomes compared to the empty (control) liposomes. This outcomemay have been affected by experimental limitations. Firstly, in our binding assaysthe proteins were reconstituted in E. coli polar lipids (57.5% phosphatidylethanolamine,

29


Bacillus subtilis

15.1% phosphatidylglycerol, 9.8% cardiolipin and 17.6% of unknown lipids), plus eggphosphatidylcholine 3:1 (wt/wt). The in vivo composition of the B. subtilis spore innermembrane lipids is different [113], which may have affected potential transport activity.Secondly, it is conceivable that the purified GerAA and GerAB were not sufficiently stablein the detergent-solubilized state. Increased stability may be obtained by using other typesof detergent, increase the amount of glycerol, modification of the ionic strength of thebuffer, and/or adding lipids to the solubilized protein(s). Thirdly, germinant receptors maycooperatively work as a complex, not only among GerA family (GerAA, AB and AC) butalso with other operons such as GerB and GerK (which were not present in this study) aswas suggested by Atluri et al and Li et al [65,66]. Notably, we managed to co-reconstitute thethree different GerA proteins: GerACs (with signal sequence for lipid modification),GerAAand GerAB according to a previously described method by Geerstma et al [100]. We wereunable to monitor any binding and/or transport activity with the three GerA proteins (datanot shown). We faced several shortcomings in expression and purification of the proteins(e.g. low amount of GerACs, poor detergent-solubilization and aggregation), which mayhave prohibited the detection of ligand binding or transport activity.

30

Bacillus subtilis spore protein SpoVAC functions as a mechanosensitive channel

3 Bacillus subtilis spore proteinSpoVAC functions as amechanosensitive channel⇤

Jeanette Velásquez, Gea Schuurman-Wolters, Jan Peter Birkner, Tjakko Abee, BertPoolman

A critical event during spore germination is the release of Ca-DPA (calcium in complexwith dipicolinic acid). The mechanism of release of Ca-DPA through the inner membraneof the spore is not clear, but proteins encoded by the Bacillus subtilis spoVA operonare involved in the process. We cloned and expressed the spoVAC gene in Escherichia

coli and characterized the SpoVAC protein. We show that SpoVAC protects E. coli

against osmotic downshift, suggesting that it might act as a mechanosensitive channel.Purified SpoVAC was reconstituted in unilamellar lipid vesicles to determine the gatingmechanism and pore properties of the protein. By means of a fluorescence-dequenchingassay, we show that SpoVAC is activated upon insertion into the membrane of theamphiphiles lysoPC and dodecylamine. Patch clamp experiments on E. coli giantspheroplast as well as giant unilamellar vesicles (GUVs) containing SpoVAC show thatthe protein forms transient pores with main conductance values of about 0.15 and 0.1nS respectively. Overall, our data indicate that SpoVAC acts as a mechanosensitivechannel and has properties that would allow the release of Ca-DPA and amino acidsduring germination of the spore.

3.1 IntroductionThe genera Bacillus and Clostridium are the best-studied endospore-forming bacteria, whichare characterized by extreme resistance to unfavourable environmental conditions such asheat, radiation, and chemical agents [15,34]. The bacterial spore is composed of a number ofcompartments that are termed (i) exosporium, (ii) coat, (iii) outer membrane, (iv) cortex,(v) germ cell wall, (vi) inner membrane, and (vii) central core. (i) The exosporium is themost external layer but is not found in all species of Bacillus. It is composed of glycoproteinsand may provide resistance to chemical and enzymatic treatments, providing the spore withthe ability to adhere to surfaces [26,27]. (ii) In Bacillus subtilis the coat is formed by up to 70different proteins. The function of the coat has not been completely addressed; however, it isimplicated in spore resistance to chemicals and predation [28]. (iii) The outer membrane is anessential structure during sporulation and it might play a role as a permeability barrier [26,28].(iv) The cortex is composed of peptidoglycan (PG) and essential for the formation of adormant spore. During spore germination, the cortex is degraded to allow the expansion of⇤Published in Molecular Microbiology (2014) 92:813-823

31


the core and further outgrowth. (v) The germ cell wall is also composed of PG and forms thecell wall of the outgrowing spore. (vi) The inner membrane is a strong permeability barrierplaying a major role in resistance to a wide range of chemicals. It contains proteins that areimportant in germination such as the nutrient germinant receptors (GRs) and the SpoVAproteins. (vii) The central core plays an important role in spore resistance, containing mostof the spore enzymes, DNA, ribosomes and tRNAs. It has unique molecules such as pyridine-2,6-dicarboxylic acid (DPA) and small acid-soluble spore proteins (SASP), which are crucialfor spore resistance [28,34].

The ability to form spores makes the cells renitent to environmental contaminants aswell as mild food-processing regimes and antiseptic procedures. Spores are able to developinto growing cells in response to specific nutrients (germinants) in the environment suchas amino acids, sugars, nucleosides or mixtures of nutrients [14,15,91]. This process is calledgermination and it is transduced into a cascade of events, wherein the GRs located in thespore’s inner membrane mediate the first step(s) [14,40,91]. Upon nutrient binding to specificGRs, a series of physiological events is initiated, including the rapid release of monovalentcations and (dipicolinic acid, DPA) together with Ca2+ ions. The concomitant water/Ca-DPA exchange results in an increase of the hydration of the spore core and the hydrolysis ofthe spore’s peptidoglycan cortex. The posterior swelling of the spore core through furtherwater intake and expansion of the germ cell wall allows enzyme action and germination ofthe spore [15,40,91].

A crucial event during spore germination is the release of Ca-DPA, which takes placewithin the first minutes of the germination process [15,70,72–74]. The mechanism of release ofCa-DPA across the inner membrane of the spore is not clear. Previous studies suggestedthat proteins encoded by the spoVA operon are involved in Ca-DPA release [73,74]. Thisrelease of Ca-DPA is triggered not only by nutrients but also by agents such as the cationicsurfactant dodecylamine, which bypasses the GRs [75,114]. The molecular mechanism of thiseffect is not well understood, but it is possible that surfactants modify the tension (lateralpressure profile) of the membrane with the concomitant activation of an associated proteinchannel. The effect would be reminiscent of the activation by amphipaths of mechano-sensitive (MS) channel proteins involved in cellular osmoregulation [86,115–117]. The bacterialMS channels sense and respond to membrane tension and act as emergency release valvesunder conditions of hypo-osmotic stress [118]. Thus, the insertion of amphipaths in one ofthe membrane leaflets causes a change in the lateral pressure profile and gates MS channelssuch as MscL [115,116].

Although the notion of Ca-DPA release through a MS channel during germination isappealing, previous reports suggested that B. subtilis homologues of known MS channelsare not involved in sporulation or germination. Setlow specifically looked at mutants ofMscL and MscS, which showed identical sporulation and germination properties comparedto the wild type [89,90,119]. On the basis of genetic studies, the SpoVA proteins are the mostlikely candidates for the release of Ca-DPA. SpoVA could behave either as a channel or asa regulator of channel activity [74]. During spore germination, temperature-sensitive spoVAmutants do not release Ca-DPA at non-permissive temperature [70,73,114]. However, howCa-DPA is released in germinating spores is not known.

In B. subtilis the SpoVA proteins are encoded by a heptacistronic operon that comprisesspoVAA, spoVAB, spoVAC, spoVAD, spoVAEa, spoVAEb and spoVAF. Of these, SpoVAA,SpoVAB, SpoVAC, SpoVAEb and SpoVAF are predicted to be membrane proteins, withtwo to five membrane spanning regions and most likely present in the inner membrane

32


of the spore [12,68–70]. Mutations in any of the first six cistrons of the spoVA operoneliminate Ca-DPA uptake during sporulation [69,71,72]. The biochemical characterization ofSpoVA proteins is limited to one study of Li et al. [120] (http://www.rcsb.org/pdb/; PDBcode 3LM6), who found that the structure of SpoVAD is similar to that of b-ketoacylsynthase and polyketide synthases. In addition, Ca-DPA has been shown to bind toSpoVAD and mutations in the binding pocket eliminate Ca-DPA uptake by developingspores [120]. SpoVAD is located at the outer surface of the spore inner membrane, possibly incomplex with other SpoVA membrane proteins [55,59]. Thus, SpoVAD could be the receptorcomponent that acts in conjunction with a membrane-bound component(s) in the uptake ofCa-DPA in maturating spores. Overall, there is strong evidence that one or more SpoVAproteins are involved in Ca-DPA release [28].

We cloned and expressed several SpoVA genes in Escherichia coli and Lactococcus lactis.Best expression was obtained for SpoVAC in E. coli and the protein produced with a C-terminal myc epitope and 6His tag. We purified SpoVAC from membrane vesicles andreconstituted it into synthetic lipid vesicles. We show that SpoVAC has channel likeproperties that would allow the release of Ca-DPA during germination of the spore.

3.2 Experimental Procedures

3.2.1 E. coli strains used in this study

MC1061 (araD139, D(ara-Ieu)7697, D(lac)X 74, galU -, galK−, hsdR−, rpsL) [121] was usedfor cloning and expression of SpoVAC MJF641, D7 (mscS−, mscK−, ybdG−, ybiO−, yjeP−,ynaI− and mscL−) [122] and MJF465 (Frag1DmscL::cm, DmscS,DmscK::kan) [123] was usedfor cell viability experiments after osmotic downshock, and MJF455 (Frag1 DmscL::cm,DmscS ) [124] was used for electrophysiology experiments.

3.2.2 Cloning and expression of 10His-SpoVAC

SpoVAC was cloned in the pBAD vector [125] and expressed in E. coli strain MC1061.The primers for amplification of spoVAC were designed to allow LIC (ligation-independentcloning), as described by Geertsma et al. [96]. The spoVAC gene was amplified using genomicDNA of B. subtilis 168 as template and the following primers were used:

SpoVACfwdnLic5�-ATGGTGAGAATTTATATTTTCAAGGTACAAACATAAAAGAAAATTACAAATCA-3�

SpoVACrevnLic5�-TGGGAGGGTGGGATTTTCATGACATCAGTTTCTCAAAAGCAAACCG-3�

3.2.3 Cloning and expression of SpoVAC-myc-6His

The spoVAC was cloned in pBAD/Myc-His B expression vector (pBAD 24 derivative;Invitrogen). The protein SpoVAC-myc-6His was expressed in E.coli strain MC1061 [121].The primers for amplification of SpoVAC-myc-6His (see below) were designed to allowLIC (ligation-independent cloning), as described by Geertsma et al. [96], but with a slightmodification; the reverse primer which has one nucleotide extra to allow cloning in the

33


pBAD/Myc-His B plasmid. The primers used to amplify spoVAC-myc-6His are thefollowing:

Forward5�-ATGGTGAGAATTTATATTTTCAAGGTACAAACATAAAAGAAAATTACAAATCA-3�

Reverse5�-TGGGAGGGTGGGATTTTCATTAATGACATCAGTTTCTCAAAAGCAAACC-3�

The SpoVA proteins containing an N-terminal 10His tag and TEV cleavage site (10His-SpoVAC) or C-terminal myc epitope and 6His tag (SpoVAC-myc-6His) were grownaerobically in Luria–Bertani (LB) medium and supplemented with 100 mg ml−1 ampicillin.For large-scale cultures, a 2 or 10 l batch reactor (Applikon Biotechnology, Delft) was usedand operated at 37 °C, pH 7.5, > 30% air (flow console, Applikon Biotechnology, Delft).When the cells had reached OD600 ⇠1.8, the temperature was lowered to 25 °C. Once thistemperature was reached (at OD600 ⇠2), 10−3% (w/v) L-arabinose was added; 0.2% (v/v)of glycerol was added to obtain a higher biomass. After 2 h of induction, E. coli cells wereharvested by centrifugation at 5000 g, 15 min, 4 °C, followed by resuspension in 50 mMpotassium phosphate, pH 8, to OD600 ⇠200. The cell suspension was flash frozen in liquidnitrogen and stored at -80°C.

3.2.4 Analysis of cell viabilityTo analyse the viability of cells after osmotic downshift, E. coli MJF641, with seven genesencoding mechanosensitive channels deleted [122] or MJF465 with three of the major MSchannels deleted [123] was transformed with pBADnLIC-10his-spoVAC or pBAD-spoVAC-myc-6His respectively, pBAD-mscL or empty plasmid. Freshly streaked colonies were grownovernight at 37 °C in LB [per litre: 5 g of yeast extract, 10 g of bactotryptone (Difco labsDetroit, MI), and 5 g of NaCl (0.085 M)]. The overnight culture was diluted 1:20 in 10 mlof LB and grown for l h. The culture was then diluted to an OD600of 0.05 in 10 ml of thesame medium supplemented with 0.5 M NaCl. The cultures were grown to an OD600 of0.2–0.25, at which stage expression of spoVAC or mscL was induced for 1 h with 5 × 10−3%(w/v) of L-arabinose. The induced cultures were diluted 1:20 into LB (osmotic downshift)or LB plus 0.5 M NaCl. Cells were grown with shaking at 37 °C for 15 min, and thenserially diluted into medium containing either no additional salt (osmotic downshift) or 0.5M NaCl (iso-osmotic). The diluted cultures were plated in triplicate and grown overnightat 37 °C on LB-ampicillin agar plates. The colony-forming units were counted and averagedper experiment. Each experiment was carried out as true biological replicate in triplicate.

3.2.5 Membrane vesicle preparationThe frozen cells were thawed at room temperature and supplemented with 1 mM PMSF, 1mM MgSO4 and DNase (⇠50mg ml−1). The cells were lysed by single passage through theConstant Systems Ltd cell disrupter, operated at 25 kPsi and 5 °C. Cell debris was removedby centrifugation (20 min, 18 500 g at 4 °C), and subsequently the membrane vesicles werecollected by ultracentrifugation (90 min, 150 000 g at 4 °C). The membrane vesicles werekept on ice and resuspended in 50 mM potassium phosphate, pH 8.0, and the total proteincontent was measured with a BCA protein assay (Thermo Scientific Pierce). Finally, themembrane vesicles were aliquotted, flash frozen in liquid nitrogen and stored at −80 °C.

34


3.2.6 Purification and membrane reconstitution of SpoVAC-myc-6His

Membrane vesicles at 5mg ml−1 of total protein were solubilized in buffer A containing 50mM KPi pH 8.0, 300 mM KCl, 10% (v/v) glycerol, 0.5% (w/v) DDM and 15 mM of imidazolefor 30 min on ice with occasional gentle mixing. Then the mixture was centrifuged (20 min,325 000 g, 4 °C) to separate the soluble from non-soluble materials. For purification, 0.250mlresin of Ni2+-Sepharose (Amershan Bio-sciences) was placed in a disposable column (Bio-Rad) and washed with 10 column volume (CV) of MilliQ water and equilibrated with 10CV of buffer A. The solubilized material was added to the Ni2+-Sepharose, and the mixturewas incubated for 1 h at 4 °C and gently rotated. Subsequently, the resin was washed with30 CV of buffer A supplemented with 50 mM of imidazole plus 0.04% (w/v) DDM. TheSpoVAC-myc-6His proteins were eluted from the column by adding subsequently 200 ml,300 ml and 300 ml of buffer A supplemented with 500 mM of imidazole plus 0.04% (w/v)DDM; most of SpoVAC-myc-6His eluted in the 300 ml of the second elution fraction. Asecond purification step was performed on a Superdex 200 10/300 GL size-exclusion column(Amershan Biosciences), using 50 mM KPi, pH 8.0, 150 mM KCl plus 0.2% (v/v) TritonX-100. The purity of the protein samples was confirmed by SDS-PAA gel electrophoresisand Coomassie Brilliant Blue staining of the gels.

The purified proteins were reconstituted in liposomes according to Geertsma et al [100].Liposomes composed of Azolectin (Soy total extract lipid; Avanti Polar Lipids) or E. colipolar lipid plus egg phosphatidylcholine in a ratio 3:1 (wt/wt) at 20 mg ml−1 of total lipidin 150 mM KCl, 10 mM potassium phosphate, pH 8.0, were homogenized by extrusion 11times through a 400 nm filter. The liposomes were destabilized by the stepwise additionof Triton X-100 as described previously [96]. Protein and lipids were mixed at 1:100 weightratio and incubated for 30 min at 50 °C for Azolectin lipids or at room temperature for E.coli polar lipids plus egg phosphatidylcholine. Subsequently, Biobeads (SM-2 Absorbents;Bio-Rad) were added in steps to remove the detergent [100].

The proteoliposomes were converted to giant-unilamellar vesicles (proteoGUVs) byelectroformation, that is rehydration of the lipid film in an oscillating electrical field using avesicle PrepChamber (Nanion Technologies). Therefore, 0.8–1 mg ml−1 of proteoliposomeswere spotted and dried on two indium tin oxide coated glass slides (ITO-slides). A chamberwas built from the two ITO-slides separated by a spacer, creating a reservoir filled with 500mM sorbitol. A voltage of 1.2 V at 10 Hz was applied for at least 3.5 h through electrodessealed onto the glass plates. The resulting giant-unilamellar vesicles (GUVs), 5–50 mm indiameter, were used for electrophysiology measurements.

3.2.7 Fluorescence dequenching assay

For the fluorescence dequenching assay, 200 mM of calcein, in 10 mM NaPi, pH 8.0 plus 150mM KCl was included into the vesicle lumen of large-unilamellar vesicles (LUVs), accordingto Koçer et al. [126]. To remove the external calcein, a Sephadex G50 size-exclusion columnwas equilibrated with buffer B (10 mM KPi, pH 8.0, 150 mM KCl plus 1 mM Na2- EDTA).The proteoliposomes with reconstituted SpoVAC or empty liposomes were applied onto thecolumn to remove the free calcein dye. All elution fractions were assayed in a Varian CaryEclipse Fluorimeter at an excitation wavelength of 495 nm and recording the emission at 515nm; the slit width was 5 nm. For monitoring the efflux of calcein, 2.5 to 5 ml of calcein-filled(proteo)liposomes were diluted into 2100 ml buffer B. Following 5 min of equilibration atroom temperature, lysophosphatidylcholine (LysoPC) (Avanti Polar lipids) or dodecylamine

35


10

15

25

35

55

70

100

1 2M

kDa

0

20

40

60

80

100

% o

f via

bility

Vector control MscL 10His-SpoVAC

A B

0

20

40

60

80

100

% o

f via

bility

Vector control MscL SpoVAC-Myc-6His

C

Figure 3.2.1. Expression of N-terminal tagged SpoVAC and rescuing of E. coli from osmotic downshiftconditions. A. Expression of 10His-SpoVAC in E. coli MC1061. Lane 1: Total protein (60 mg) from cells carryingpBADnLIC-10his-spoVAC and induced with 5 × 10−3% (w/v) of L-arabinose. The sample was run in a 15%SDS-PAA gel and the protein was visualized by Coomassie Brilliant Blue staining. Lane 2: Immunoblot of thesame gel, using an anti-His antibody. The arrow indicates the band that corresponds to SpoVAC. B. Viability of E.

coli MJF641 with vector control, or expressing MscL or 10His-SpoVAC, following exposure to osmotic downshift.The P-value for the difference in viability of the vector control and 10His-SpoVAC was 0.056 as determined by theStudent’s t-test, indicating a low significance. The immunoblot below panel B shows the relative levels of expressionof MscL and SpoVAC. C. Viability of E. coli MJF465 with vector control or expressing MscL or SpoVAC-myc-6His, following exposure to osmotic downshift. All experiments were performed in triplicate with three independentbiological replicates; the standard error (SE) is shown. The data are presented as percentage of the viability underiso-osmotic conditions (LB supplemented with 0.5 M NaCl). The immunoblot below panel B shows the relativelevels of expression of MscL and SpoVAC.

(SIGMA-ALDRICH) was added at final concentrations of 4 and 32 mM respectively. Thefluorescence was measured continuously, and the 100% signal was determined by the additionof 0.5% (v/v) Triton X-100 (complete lysis of the liposomes), typically after 15 min. Therelease of the calcein self-quenching dye is referred as % of release and equals (I

t

− I0

/I100

−I0

) × 100, where It

is the fluorescence intensity at a given time, I0

is the initial fluorescenceintensity, and I

100

is the fluorescence intensity after the addition of Triton X-100.

3.2.8 Electrophysiology studiesEscherichia coli giant spheroplast and giant-unilamellar vesicles containing SpoVAC-myc-6His were prepared as previously described [127]. For spheroplast preparation, cephalexintreatment was done for 1 h and when the cell had sufficiently elongated (microscopicinspection), SpoVAC-myc-6His expression was initiated with 0.1% of L-arabinose for 45–60min. The expression was checked by Western blot.

For patch clamp measurements, 5 ml of spheroplasts or giant-unilamellar vesiclescontaining SpoVAC-myc-6His were transferred to a sample chamber containing a groundelectrode and 160 ml of patch clamp buffer: 5 mM HEPES-KOH, pH 7.2, 200 mM KCl, 90mM MgCl2, 10 mM CaCl2. As negative control, we used giant-unilamellar vesicles withoutSpoVAC- myc-6His. In case of E. coli spheroplasts obtained from strain MJF455, we used thesame buffer but with KCl replaced by NaCl to suppress MscK activity. Channel activity wasrecorded using an Axopatch 200A amplifier and a digital converter, and Axoscope softwarewas used for the data analysis (Axon Instruments, Foster City, CA). Data were acquired at

36


a sampling rate of 33 kHz and filtered at 10 kHz. The presented traces were additionallyfiltered to decrease electronic noise, using Clampfit 10.3 software (Axon Instruments) withthe low pass Boxcar filter at smoothing point 21. Offline analysis was performed usingPClamp 10.3 software (Axon Instruments).

3.3 Results

3.3.1 Expression and complementation studies: 10His-SpoVAC

6 7 8 9 10 11 12 13 14 15 16 17

0

50

100

150

200

250

300

350

A 2

80 n

m

Volume (ml)

Void volume

SpoVAC

97664530

20

14

M 1 2 3 4 5 6 7 M 8976645

30

20

A

B

Figure 3.3.1. Purification of SpoVAC-myc-6His. A.Protein samples from different purification steps. Lane 1:DDM-soluble fraction, lane 2: flow-through of the Nickel-Sepharose column, lane 3–4: wash fractions of the Nickel-Sepharose column, lanes 5–7 three elution fractions of theNickel-Sepharose column, lane 8 peak fraction (at around12 ml) of the size-exclusion chromatography. The proteinsamples were run on a 15% SDS-PAA gel and stained withCoomassie Brilliant Blue. B. The peak elution fractionshown in lane 6 was applied to a Superdex 200 columnand the chromatogram is shown.

Initially, we expressed in E. coli MC1061SpoVAC with an N-terminal 10-His tagand the recombinant protein was detectedafter immunoblotting and using an anti-His antibody (Fig. 3.2.1-A). 10His-SpoVACmigrated at approximately 16 kDa, whichis consistent with its calculated molecularmass (18.4 kDa) and the tendency ofvery hydrophobic proteins not to unfoldcompletely. We used the in vivo osmoticdownshift assay to assess the functionalityof 10His-SpoVAC. The MJF641 strain,constructed in the Booth laboratory [122],lacks detectable MS channel activity andwhen these cells are grown in LB plus 0.5 MNaCl and subsequently diluted into LB thenthe majority of cells lyse. When MJF641 iscomplemented in trans with the mscL gene,all the cells survive the osmotic downshift.For 10His-SpoVAC, we obtain significantbut lower survival than with MscL (Fig.1B, upper panel), which most likely reflectsthe much lower expression of SpoVAC inMJF641 as compared to MscL (Fig. 3.2.1-C, lower panel). Overall, these dataprovide the first indication that SpoVACmay function as mechanosensitive channel,and release osmolytes at a high rate. Tocarry out more detailed biochemical studies,we needed to increase the expression level ofSpoVAC.

3.3.2 Expressionand complementationstudies: SpoVAC-myc-6HisWe tested numerous conditions (inducer concentration, temperature, medium, and growthphase for induction) to boost the expression of 10His-SpoVAC in E.coli or L. lactis; however,

37


the amounts of protein that we could purify remained very low. Then we made modificationsin the recombinant protein, and constructs with a modified N-terminus and extendedC-terminus (myc epitope plus C-terminal 6-His tag) expressed significantly better than10His-SpoVAC; hereafter, this protein is named SpoVAC-myc-6His. Figure 1C shows thatSpoVAC-myc-6His rescues E. coli MJF465 from osmotic downshift to the same extent asMscL.

3.3.3 Purification of SpoVAC-myc-6His

Escherichia coli MC1061 cells carrying pBAD-spoVAC- myc-6His were grown in a 10 lbioreactor with pH of 7.5 and oxygen control above 30%. The membrane fraction wasisolated and the protein was solubilized and purified in DDM (Fig. 3.3.1-A) as describedunder Experimental procedures. The SpoVAC-myc-6His protein was observed in Coomassieblue stained gels and its identity confirmed by immunoblot and mass spectrometry analysis.The sample was highly enriched in SpoVAC-myc-6His after Ni-Sepharose chromatographybut numerous contaminants were present as well. After size-exclusion chromatography (Fig.3.3.1-B), we observed a major peak around 12 ml corresponding to an oligomer of SpoVACplus bound detergent. The two purification steps allowed us to obtain sufficient amounts ofhighly pure SpoVAC (Fig. 3.3.1-A, lane 8), which was used later on for functional studiesin proteoliposomes and proteoGUVs.

3.3.4 Calcein release assay

To further test the functionality of SpoVAC-myc-6His, the protein was reconstituted in lipidvesicles composed of azolectin lipids. The proteoLUVs were loaded with the fluorescentdye calcein, which was incorporated at a ‘self- quenching’ concentration of 100 mM. Uponaddition of lysoPC a rapid increase in fluorescence (dequenching) was observed, whichreflects the release of calcein from the vesicle lumen (Fig. 3.3.2-A). The release data werefitted to a first-order rate equation:

[F ]t = [F ]1(1� e�(k.t)) (3.3.1)

The first-order rate constant (k) was 1.8 min−1; [F ]t represents the total fluorescence;[F ]1, the fluorescence at infinity; and t the time of reaction. The release was strictlydependent on the addition of lysoPC and 100% of the liposomes released their cargo.Amphipathic molecules such as lysoPC intercalate into one of the bilayer leaflets and therebycreate mismatch in the lateral pressure profile between the two leaflets. Importantly, we alsoobserved specific release of calcein upon addition of dodecylamine (Fig. 3.3.2-B), the cationicsurfactant that has been shown to trigger the release of Ca-DPA from B. subtilis spores invivo. We find that SpoVAC responds to lysoPC (and dodecylamine) in a manner similar toMscL, at least in vitro (Fig. 3.3.2-C), and the mechanistic basis for its activation might besimilar to that of mechanosensitive channels involved in osmoregulation. Contrary to theactivation of spores in vivo, presumably by acting on SpoVAC, there is yet no informationthat MS channels like MscL are activated by amphipaths in vivo.

38


0

20

40

60

80

100

Time (min)4 5 6 7 8 9 10 11 12 13 14 15 16

C

0

20

40

60

80

100

Time (min)%

of r

elea

se

% o

f rel

ease

B

4 5 6 7 8 9 10 11 12 13 14 15 16

A%

of r

elea

se

Time (min)4 5 6 7 8 9 10 11 12 13 14 15 16

0

20

40

60

80

100

Figure 3.3.2. Channel activation by neutral and cationic surfactants. A. Effect of lysophosphatidylcholine(lysoPC) on SpoVAC-myc-6His activity reconstituted in azolectin liposomes. The data from empty liposomes(#, ) and SpoVAC-containing liposomes ( , ) are shown upon addition of 4 mM lysoPC (closed symbols)or without addition (open symbols). B. Effect of dodecylamine on SpoVAC-myc-6His activity reconstituted inazolectin liposomes. The data from empty liposomes (#, ) and SpoVAC-containing liposomes ( , ) are shownupon addition of 32 mM dodecylamine (closed symbols) or without addition (open symbols). C. E. coli MscLactivation upon addition of 4 mM lysoPC. The arrows indicate the times of lysoPC or dodecylamine (—; after 6min) and Triton X-100 (– – –, after 14 min) addition.

3.3.5 Electrophysiology characterization of SpoVAC

Patch clamp recordings of E. coli giant spheroplasts and inside-out patches of proteoGUVswere carried out to determine the conductance properties of SpoVAC. Most of the recordingswere made at +/−30 mV or +/−40 mV. We observed little channel activity with negativepipette pressures of 65–80 mmHg for both E. coli giant spheroplasts and proteoGUVs (Fig.3.4.1 A and B). However, raising the pressure to values close to 100 mmHg or higher (closeto the lytic membrane tension), we frequently observed channel activity that we attributeto SpoVAC (level 1 in Fig. 3.4.1-A). The unitary conductance of SpoVAC in E. coli giantspheroplasts is 0.15 ± 0.004 nS (standard error of the mean is given; n = 3). A conductanceof 0.91 ± 0.0023 nS was also found (level 2 in Fig. 3.4.1-A) but it may correspond to one ormore endogenous E. coli channels (Li et al., 2002), as the E. coli MJF455 strain only lacksMscL and MscS, the dominant mechanosensitive channels (Fig. 3.4.1-A). To unambiguouslyresolve which conductance corresponds to SpoVAC, we purified the protein and reconstitutedSpoVAC in liposomes composed of E. coli polar lipids plus egg phosphatidylcholine in aratio 3:1 (wt/wt) (Fig. 3.4.1-B). In membrane patches from SpoVAC-containing GUVs, weobserved a ⇠ 0.11 ± 0.002 nS conductance as the dominant channel activity. The negativecontrol, GUVs without SpoVAC, did not show channel activity when subjected to similarpressures (Fig. 3.4.1-C), indicating that the observed conductance is not due to membranedisruption.

All-points amplitude histograms show the main levels of conductance of SpoVAC in E.coli giant spheroplasts (Fig. 3.4.2-A) and proteoGUVs (Fig. 3.4.2-B). We also calculated theopen dwell times of SpoVAC in patches derived from E. coli giant spheroplasts (Fig. 3.4.2-C) and proteoGUVs (Fig. 3.4.2-D). The channel open time (dwell) is shown in histogramsand the best fit was with two-component exponential function. The dwell times for E.coligiant spheroplasts are 0.87 ± 0.14 ms and 3.7 ± 0.31 ms, and for proteoGUVs the dwelltimes are 0.85 ± 0.1 ms and 7.9 ± 0.13 ms. Taken collectively, we conclude that SpoVAC

39


has properties akin that of mechanosensitive channels in bacteria [118,128].

3.4 DiscussionWe have purified and membrane-reconstituted SpoVAC from B. subtilis. To ob-tain sufficient protein, we used SpoVAC-myc-6His for most of our studies; 10His-SpoVAC was expressed at least an order of magnitude less well, but the proteinwas functional. Our results provide for the first time clear biophysical and biochem-ical evidence for channel-like activity of SpoVAC. Our data indicate that SpoVAChas mechanosensitive channel-like properties, like MscL or MscS from E. coli [122,129].

50 s

60 mmHg

200 pA

0.2 s

50 pA

200 pA

60 mmHg

20 s

0.1 s

50 pA

A

B

Level 2

Level 1

Level 1

C200 pA

60 mmHg

10 s

Figure 3.4.1. Electrophysiological recordings ofmembrane patches containing SpoVAC-myc-6His. A.Recordings at −30 mV of SpoVAC-myc-6His containingspheroplasts. The top trace is an expansion of part ofthe middle trace; the bottom trace shows the appliednegative pressure (bar corresponds to 60 mmHg). B.Recording at +40 mV of ion conductance in patches fromSpoVAC-containing GUVs. Level 1 and 2 correspond tothe histogram peaks of Fig. 5. C. Negative control, GUVswithout SpoVAC.

SpoVAC provides protection against hypo-osmotic stress in E. coli and responds tothe asymmetric insertion into the mem-brane of the amphiphile lysoPC and do-decylamine, and its electrophysiological be-haviour is typical of that of mechanosensi-tive channels.

3.4.1 Characteristics of SpoVACProkaryotic MS channels function as safetyvalves that open when cells are exposed tosevere osmotic downshift, that is, whenthe membrane tension gets too high due toexcessive water intake. Upon activation ofMS channels cytoplasmic osmolytes are re-leased, the turgor pressure is lowered andmembrane damage is prevented [88]. Whenexpressed in E. coli SpoVAC provides pro-tection against osmotic downshift. In ad-dition, in proteoLUVs SpoVAC releases cal-cein upon asymmetric insertion of lysoPC ordodecylamine into the membrane. Calceinis a 623 Da anionic fluorophore, which sug-gests that SpoVAC most likely mediates thepassage of a wide range of low-molecular-weight solutes (ions, nutrients). Taken col-lectively, we conclude that SpoVAC acts aschannel that facilitates the efflux down theconcentration gradient of osmolytes up toa mass of at least 600 Da. Our results arein accordance with in vivo studies in B. sub-

tilis, showing the early release of molecules in this mass range (e.g. divalent cations, arginine,glutamic acid and DPA) [74,130].

The unitary conductance of the most frequent open state of SpoVAC in E. coli giantspheroplast is somewhat higher than in proteoGUVs. Similar differences have been observedpreviously [127] and may relate to difference in the membrane environment; the spheroplast

40


0.0 0.1 0.2 0.3 0.40

20

40

60

80

Num

ber o

f eve

nts

Conductance (nS)

Level 1 Fitting

-1.5 -1.0 -0.5 0.0 0.5 1.0 1.50

2

4

6

8

10

Log dwell-time (ms)

Squ

are

root

cou

nt (N

)

-1.5 -1.0 -0.5 0.0 0.5 1.0 1.5 2.00

1

2

3

4

Log Dwell-time (ms)

Squ

are

root

cou

nt (N

)

BA

C D

0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1.00

50

100

150

200

250

Num

ber o

f eve

nts

Conductances (nS)

Level 1 Level 2 Fitting

Figure 3.4.2. Electrophysiological characterization of SpoVAC-myc-6His. A and C. All points-amplitudehistograms showing the main levels of conductance from recordings on SpoVAC-myc-6His containing spheroplastsand GUVs at −30 mV and +40mV respectively. B and D. The corresponding dwell time analysis of the first level ofconductance of SpoVAC-myc-6His in spheroplasts and GUVs. The continuous lines are the fit of the two-componentexponential function to the data and the dashed lines show the individual components of these functions. The fitof the data yielded dwell times of 0.874 and 3.69 ms for spheroplast and 0.89 and 7.9 ms for GUVs. The y-axisshows the square root of the counts (N); the fit had a correlation coefficient near 1.

41


system is obviously more complex and crowded and differs in lipid composition from theGUVs. The conductance of SpoVAC falls in the category of MS channels with a relativelylow conductance, like MscM (0.3–0.4 nS) and YnaI (0.1 nS) [122]. The diameter of theSpoVAC channel in the open state was estimated using the Hille equation [131]:

d =⇢g

⇡(⇡

2+

s⇡2

4+

4⇡l

⇢g(3.4.1)

where d is the pore diameter, ⇢ = the buffer resistivity (25.3 W cm), g = conductanceand l = the membrane spanning length (40 Å). For g is 0.15 nS, this would correspond toa pore diameter of 4.6 Å, i.e. on the assumption that the pore has a symmetric cylindricalshape. The value of the pore calculated on the basis of the conductance of E. coli giantspheroplasts is somewhat smaller than the dimension of calcein (5 × 7 × 13 Å) [132]. We donot have information on the geometry and surface properties of the SpoVAC pore, and thusthe pore diameter should be regarded as gross estimate.

The dwell times of SpoVAC indicate that the channel generally opens and closes quicklyas was described by Moe et al. for MscL from Staphylococcus aureus [128]. However, weoccasionally observed channel activity with very long dwell-times as shown in Fig. 3.4.1-B, which is atypical for MS channels. Another important observation is that the openprobability of SpoVAC increases with membrane tension. It is well known that ultrahighpressures may induce germination of bacterial spores, but the mechanistic basis is notknown [84]. Indeed, it has been shown that high pressures (500 MPa) by-pass germinantreceptors during spore germination [83,85]. However, it is difficult to estimate how thesepressures translate to tension changes in the inner spore membrane, and how these relate tochanges in membrane tension modulated by pipette pressure in proteoGUVs (vide infra).

3.4.2 Gating mechanism and role of lipidsThe open probability of SpoVAC increases upon increasing of the pipette pressure inmembrane patches derived from E. coli giant spheroplasts and in proteoGUVs. Theseresults are in line with the observation that SpoVAC protects E. coli against osmoticdownshift, which is indicative for gating by membrane tension. In our experimentalset up, the electrophysiology assays were performed either in E. coli giant spheroplastor SpoVAC-reconstituted in E. coli polar lipids (⇠ 57.5% phosphatidylethanolamine, ⇠15.1% phosphatidylglycerol, ⇠ 9.8% cardiolipin and ⇠ 17.6% of unknown lipids), plus eggphosphatidylcholine 3:1 (wt/wt). We note that the B. subtilis spore inner membranehas a different lipid headgroup composition with 12% phosphatidylethanolamine, 35%,phosphatidylglycerol, 50% cardiolipin and 3% diglucosyl diacylglycerol [113]. Thus, the lipidcomposition used in our ‘membrane models’ may not be totally mimicking the endogenousmembrane environment. As a consequence, the kinetic properties of channel gating maydiffer from those in the in vivo situation. Next to the lipid headgroup composition, thephysical state of the membrane is crucial for membrane protein function. We determinedthe activation of SpoVAC in membranes in a hydrated, liquid-crystalline state, whereasgermination initiates in spores in which the water content is extremely low. Biophysicalstudies of the inner spore membrane indicated that the lipids are largely immobile, butupon germination the mobile fraction is increased [30]. Cowan et al. suggested that therestricted mobility of lipids is due to the dehydrated state of the spore, implying that thelipid bilayer is in a gel-like state [30]. The lateral pressure profiles and thus the forces acting

42


on the protein will be different under conditions that the membrane is in a liquid-crystallineor gel-like state. Thus, next to a different headgroup composition, a different (more fluidic)state of the membrane may have contributed to the gating behaviour and conductance stateof SpoVAC in our in vitro experiments.

3.4.3 A role for SpoVAC in germinationSpoVA proteins have been implicated in the Ca-DPA release that takes place in the firstminutes of spore germination, but still there is no strong evidence that these proteinscan associate and form a channel to release Ca-DPA [28,120]. Our data provide the firstbiochemical evidence that one of the SpoVA family proteins is sufficient to act as a non-selective solute channel. We cannot rule out the possibility that in complex with otherSpoVA proteins SpoVAC has an altered activity. We tried to express the other membranecomponents of the spoVA gene cluster in E. coli and L. lactis, but in general the proteinsexpressed poorly or failed to express at all.

In conclusion, we make an important step in the elucidation of the action mechanismof one of the SpoVA proteins, SpoVAC, that can act as a mechanosensitive channel,conceivably facilitating the release of CaDPA and other low-molecular-weight compoundsduring germination in vivo. Possible roles of other SpoVA proteins in channel activity andthat of germinant receptors in signalling and germination triggering in vivo remain to beelucidated.

43

General discussion and future perspective

4 General discussion and futureperspective

It is almost 140 years ago that research on sporulation and germination started withindependent contributions from Cohn and Koch, yet there are still many questions tobe answered in order to fully understand the mechanism of dormancy, resistance andgermination of bacterial spores. This thesis aims to answer the question: how do sporeswake up during the early stages of germination? Based on this question, the work is dividedin two sections: the first part concerns the biochemical characterization of GerA receptorproteins; proteins involved in nutrient binding. The second part involves the study of SpoVAproteins implicated in Ca-DPA release, a very important step in the germination process.As an epilogue, we describe a possible model of how GerA receptor proteins and SpoVAcould work during early steps of germination.

4.1 GerA receptor proteins of Bacillus subtilisGerminant receptors are involved in nutrient recognition in the early steps of the germinationprocess. Although there is a lot of genetic data that support this function, conclusiveevidence is yet elusive, especially because biochemical analysis of germinant receptor proteinsis lacking. In chapter 2, we have used several biochemical approaches to reveal the functionof the germinant receptor proteins of the GerA family from B. subtilis (GerAA, GerABand GerAC). Unfortunately, the instability of GerA proteins after purification precludedfull assessment of their function(s). The stability and folding of GerAC was tested bymeans of microcalorimetry and spectroscopy methods. On the basis of in silico homologymodeling, we show that GerAC exhibits a similar folding profile as GerBC, a protein forwhich the crystal structure is available but the function is still elusive. GerAC and GerBCexpose several tryptophan residues to the solvent, which we detected through a partiallyred shifted emission spectrum (chapter 2). Together, the experiments combined with thein silico modeling, suggest that GerAC does not adopt a typical globular configuration,which may explain the instability of the protein (chapter 2). Further improvement inexpression of germinant receptors and stability screening is necessary for further biochemicalcharacterization. In addition, crystallization of the three subunits, either alone or incomplex, and the analysis of the full complex will aid our understanding of the functionof the proteins in the germination process.

4.2 SpoVAC works as a mechanosensitive channel duringspore germination

A key step in spore germination is the Ca-DPA release that takes place during the firstminutes of the germination process. There is strong evidence that SpoVA proteins (either one

45


or more of 7 proteins in total) are involved in the release of Ca-DPA, but there are still openquestions as to whether all of these 7 proteins work together in Ca-DPA release. Proteinscould work as a channel independently or as a regulator of channel activity. In chapter 3, wecloned and expressed the genes of several SpoVA membrane proteins and obtained moderatelevels of expression. We purified and membrane-reconstituted the proteins into syntheticlipid vesicles. We present strong evidence that SpoVAC has a channel-like property and maybe able to release Ca-DPA during germination of the spore. First, we show that SpoVACprovides protection against hypoosmotic stress in E.coli by rapidly releasing osmolytes andacts as a channel protein. We also show that SpoVAC responds to the asymmetric insertioninto the membrane of the amphiphiles lysoPC and dodecylamine. The latter activity linksto in vivo observations on release of Ca-DPA in the presence of amphipaths [74]. Theelectrophysiological behavior of SpoVAC is typical of that of mechanosensitive channels.Our results provide for the first time clear biophysical and biochemical evidence for channel-like activity of SpoVAC. We propose that SpoVAC facilitates the release of Ca-DPA andother low molecular weight compounds during germination in vivo. We believe that ourwork has set the first stage for a molecular understanding of the different SpoVA proteincomponents involved in germination.

4.3 Model of spore awakeningIn the light of our experimental observations, we present a speculative model of theearly step(s) of spore germination that builds on the model that was recently reviewedby Setlow [28]. Upon favorable conditions, the germinants have to cross the spore outerlayers in order to reach the germinant receptors in the inner membrane. The germinantreceptor GerA is composed of the integral membrane proteins GerAA and GerAB and thelipoprotein GerAC. GerAC is located on the outer surface of the spore membrane [58]. Ithas been described that germinants binding to the receptors somehow trigger the release ofthe spore core’s depot of Ca-DPA via the SpoVA proteins. The topology of SpoVA proteinsindicates that most of them are integral membrane proteins with the exception of SpoVADand SpoVAEa (soluble proteins). Recently, SpoVAD and SpoVAEa have been shown tobe located on the outer surface of the spore’s inner membrane, presumably by interactingwith other SpoVA components [59,76]. Unfortunately, there is no strong biochemical evidencethat support the specific binding of germinants to receptors. However, mutation of highlyconserved residues in GerAA, GerAB and GerAC have been shown to affect germinantreceptor function [56,62,64,65]. GerAB has been implicated in germinant recognition. Somespecific mutations in transmembrane regions of GerAB from Bacillus megaterium QM 1551affect the affinity of the protein for specific germinants [64,94].

Bioinformatic analyses indicated that the amino acid sequences of GerA receptor proteinsare conserved not only within species but also across species. The GerAB is homologous tobacterial transporters of the superfamily of amino acid permeases, and GerAB could thusact as germinant receptor or even transport the germinant [67]. SpoVA proteins are alsoconserved within and across species, but they share no significant identity with proteinsof known function. SpoVAF is homologous to GerAA. Although genetic studies suggestdifferent functions for SpoVAF and GerAA, their activity is not known [12].

Our findings suggest that SpoVAC is working as a mechanosensitive channel, which canbe triggered by amphipaths that alter the membrane tension or lateral pressure profile. Thequestion then is: what is the trigger for activation of SpoVAC in vivo? It is known that

46


during germination stage I, partial core hydration is associated with Ca-DPA release, andinflux of water into the spore core may allow the spore inner membrane to expand. As aresult, the membrane tension will increase, which we propose as gating signal for SpoVAC.Upon opening of the channel, Ca-DPA (and other small molecules) are released leading tosome loss of spore stress resistance [28,29]. In germination Stage II, spore cortex hydrolysisresults in full core hydration and core expansion, finally resulting in loss of dormancy andstress resistance.

It is plausible to think that germinant receptors and SpoVA could work together duringthe early step(s) of germination, because they share the same location in the inner membraneof the spore [40]. In addition, Vepachedu and Setlow suggested a possible interactionbetween GerA receptor proteins and SpoVA proteins. Using yeast two-hybrid and FarWestern analysis, they showed that some GerA receptor proteins interact with SpoVAD andSpoVAE [133]. Finally, Setlow has suggested that germinant receptors could form a channelfor monovalent cations or signal to SpoVA proteins that would be the actual channel [28].However, neither of these proposals has been experimentally tested.

In summary, we are still not in the position to fully explain the early events in nutrientgerminant-induced spore germination from a molecular point of view. However, our resultsindicate that channel (-like) proteins play a key role in the process of Ca-DPA release andspore awakening.

47

Samenvatting

5 Samenvatting

Het is bijna 140 jaar geleden dat het onderzoek naar spore vorming en ontkieming isbegonnen met onafhankelijke bijdragen van Cohn en Koch. Toch zijn er nog veel vragendie beantwoord moeten worden voor het volledig begrijpen van het mechanisme van derusttoestand, weerstand en ontkieming van bacteriesporen. Dit proefschrift richt zich op hetbeantwoorden van de vraag: hoe ontwaken sporen tijdens de vroege stadia van ontkieming.Op grond van deze vraag, is het werk opgedeeld in twee delen: het eerste deel heeft betrekkingop de biochemische karakterisering van GerA receptoreiwitten; eiwitten die betrokken zijnbij de binding van voedingsstoffen. Het tweede deel beschrijft de studie van SpoVA eiwittendie betrokken zijn bij de afgifte van calcium-dipicolinezuur (Ca-DPA) en andere kleinemoleculen, een belangrijke stap in het kiemproces.

5.1 GerA receptoreiwitten van Bacillus subtilisKiemreceptoren zijn betrokken bij de opname van voedingsstoffen in de eerste stadia van hetkiemproces. Hoewel er veel genetische gegevens zijn die deze functie ondersteunen ontbreektovertuigend bewijs vooralsnog, vooral omdat biochemische analyse van kiemreceptoreiwittenniet gedaan zijn.

In hoofdstuk 2 hebben we een aantal biochemische methoden gebruikt om de functie van dekiemreceptor eiwitten van de GerA familie van Bacillus subtilis (GerAA, GerAB en GerAC)te bepalen. De instabiliteit van GerA eiwitten na zuivering verhinderde helaas volledigekarakterisering van hun functie(s). De stabiliteit en de vouwing van het GerAC eiwit werdgetest met behulp van microcalorimetrie en spectroscopische methoden. Door middel van insilico homologie modellering werd de vouwingsstructuur van het eiwit geanalyseerd, dwz doorGerAC, te vergelijken met een eiwit (GerBC) waarvan de kristalstructuur beschikbaar is,maar waarvan de functie nog onbekend is. GerAC en GerBC stellen verscheidene hydrofoberesiduen bloot aan de omgeving, terwijl dergelijke aminozuren normaliter meer opgeborgenliggen in het binnenste van het eiwit (hoofdstuk 2). De experimenten, gecombineerd metde in silico modellering, suggereren dat GerAC niet een compact gevouwen eiwit is, wat deinstabiliteit na zuivering zou kunnen verklaren.

Verdere verbetering van de expressie van kiemreceptoren en het vergroten van de stabiliteitvan de eiwitten is nodig voor een verdere biochemische karakterisering. Bovendien zalkristallisatie van de drie eiwittenen, alleen of als complex, en ons begrip van de functievan de eiwitten in het kiemproces verbeteren.

5.2 SpoVAC werkt als een mechanosensitief kanaaltijdens het ontkiemen van spore

Een belangrijke stap bij het ontkiemen van sporen is het vrijkomen van Ca-DPA (calcium-dipicoline zuur). Er zijn sterke aanwijzingen dat SpoVA eiwitten (een enkele of meerdere

49

Samenvatting

van zeven eiwitten in totaal) zijn betrokken bij de afgifte van Ca-DPA, echter er zijn nogvragen in hoeverre deze zeven eiwitten samenwerken in de Ca-DPA afgifte. De eiwittenzouden kunnen werken als een afzonderlijk kanaal of als regulator van kanaalactiviteit. Inhoofdstuk 3, hebben we de genen van verschillende SpoVA membraaneiwitten gekloneerd entot expressie gebracht en konden kleine hoeveelheden van de eiwitten zuiveren. We hebbende membraaneiwitten ingebouwd in synthetische membraanblaasjes om daarin de eventueletransportfunctie(s) te kunnen bestuderen. We laten zien dat SpoVAC een kanaalachtigefunctie heeft en Ca-DPA tijdens ontkieming van de spore zou kunnen vrij maken. Eerstetonen we aan dat SpoVAC beschermt tegen hypo-osmotische stress in de bacterie Escherichiacoli, daarna laten we zien dat SpoVAC reageert op de asymmetrische inbedding in hetmembraan van de amfifiele stoffen lysoPC en dodecylamine. Deze laatste activiteit maakteen koppeling naar in vivo waarnemingen mogelijk, omdat amfifiele stoffen sporen doenontkiemen zonder dat kiemnutriënten nodig zijn. Het idee is dat deze stoffen aangrijpenop de stap(pen) na de initiële ontkieming. Het elektrofysiologische gedrag van SpoVACis typisch voor die van mechanosensitieve kanalen. Onze resultaten leveren voor de eerstekeer een duidelijk biofysisch en biochemisch bewijs voor kanaalactiviteit van SpoVAC. Wepostuleren dat SpoVAC het vrijkomen van Ca-DPA en andere laagmoleculaire verbindingenvergemakkelijkt tijdens de ontkieming in vivo. We geloven dat ons werk een eerste stap heeftgezet voor een moleculaire begrip van de verschillende SpoVA eiwit componenten betrokkenbij de ontkieming.

50

List of publications

6 List of publications

Publications are giving in chronological order

[1] Velásquez J, Schuurman-Wolters G, Birkner JP, Abee T, Poolman B. 2014.Bacillus subtilis spore protein SpoVAC functions as a mechanosensitive channel. Molecularmicrobiology. Mol Microbiol. 2014 May;92(4):813-23.

[2] van den Bogaart G, Guzmán JV, Mika JT, Poolman B. 2008. On the Mechanism ofPore Formation by Melittin. Journal of Biological Chemistry. 283 (49): 33854–57

[3] van den Bogaart G, Kusters I, Velásquez J, Mika JT, Krasnikov V, Driessen AJM,Poolman B. 2008. Dual-color fluorescence-burst analysis to study pore formation andprotein-protein interactions. Methods 46:8–8.

[4] Verastegui M, Gilman RH, Arana Y, Barber D, Velásquez J, Farfán M, Chile N, KosekJC, Kosek M, Garcia HH, Gonzalez A; Cysticercosis Working Group in Peru. Infection andImmunity. 2007. Nov;75(11):5158-66

[5] Zimic MJ, Infantes J, López C, Velásquez J, Farfán M, Pajuelo M, Sheen P, VerasteguiM, Gonzalez A, Garciá HH, Gilman RH." The Journal of Parasitology. 2007 Aug;93(4):727-34

[6] Kyngdon CT, Gauci CG, Rolfe RA, Velásquez Guzmán JC, Farfán Salazar MJ,Verástegui Pimentel MR, Gonzalez AE, Garcia HH, Gilmanl RH, Strugnell RA, LightowlersMW. Journal of Parasitology. 2006 Apr;92(2):273-81

51

Bibliography

Bibliography

[1] G. Real, S. M. Pinto, G. Schyns, T. Costa, A. O. Henriques, C. P. Moran, A geneencoding a holin-like protein involved in spore morphogenesis and spore germinationin Bacillus subtilis., J. Bacteriol. 187 (18) (2005) 6443–6453.

[2] G. W. Gould, History of science–spores., J. Appl. Mircobiol. 101 (3) (2006) 507–513.

[3] F. Kunst, The complete genome sequence of the gram-positive bacterium Bacillussubtilis., Nature 390 (6657) (1997) 249–256.

[4] W. L. Nicholson, N. Munakata, G. Horneck, H. J. Melosh, P. Setlow, Resistanceof Bacillus endospores to extreme terrestrial and extraterrestrial environments.,Microbiol. Mol. Biol. R. 64 (3) (2000) 548–572.

[5] R. J. Cano, M. K. Borucki, Revival and identification of bacterial spores in 25- to40-million-year-old Dominican amber., Science 268 (5213) (1995) 1060–1064.

[6] K. Flardh, M. J. Buttner, Streptomyces morphogenetics: dissecting differentiation ina filamentous bacterium, Nat. Rev. Micro. 7 (1) (2009) 36–49.

[7] L. M. Bush, M. T. Perez, The anthrax attacks 10 years later., Ann. Intern. Med. 156 (1Pt 1) (2012) 41–44.

[8] C. Anagnostopoulos, J. Spizizen, Requirements For Transformation in Bacillus subtilis,J. Bacteriol. 81 (5) (1961) 741–746.

[9] P. Graumann, Bacillus: Cellular and Molecular Biology, Caister Academic Press, 2012.

[10] F. Sharmin, S. Wakelin, F. Huygens, M. Hargreaves, Firmicutes dominate the bacterialtaxa within sugar-cane processing plants., Scientific reports 3 (2013) 3107.

[11] M. J. L. de Hoon, P. Eichenberger, D. Vitkup, Hierarchical evolution of the bacterialsporulation network., Curr. Biol. 20 (17) (2010) R735–R745.

[12] J. Errington, Bacillus subtilis sporulation: regulation of gene expression and controlof morphogenesis., Microbiol. Rev. 57 (1) (1993) 1–33.

[13] J. Errington, From spores to antibiotics via the cell cycle., Microbiology 156 (Pt 1)(2010) 1–13.

[14] A. Moir, How do spores germinate?, J. Appl. Mircobiol. 101 (3) (2006) 526–530.

[15] P. Setlow, Spore germination, Curr. opin. Microbiol. 6 (6) (2003) 550–556.

[16] L. D. Alcaraz, G. Moreno-Hagelsieb, L. E. Eguiarte, V. Souza, L. Herrera-Estrella,G. Olmedo, Understanding the evolutionary relationships and major traits of Bacillusthrough comparative genomics., BMC genomics 11 (2010) 332.

53

Bibliography

[17] P. J. Piggot, D. W. Hilbert, Sporulation of Bacillus subtilis., Curr. opin. Microbiol.7 (6) (2004) 579–586.

[18] I. Barák, E. Ricca, S. M. Cutting, From fundamental studies of sporulation to appliedspore research, Mol. Microbiol. 55 (2) (2005) 330–338.

[19] D. Higgins, J. Dworkin, Recent progress in Bacillus subtilis sporulation., FEMSmicrobiol. Rev. 36 (1) (2012) 131–148.

[20] P. T. McKenney, A. Driks, P. Eichenberger, The Bacillus subtilis endospore: assemblyand functions of the multilayered coat., Nat. Rev. Micro. 11 (1) (2013) 33–44.

[21] P. Stragier, R. Losick, Molecular genetics of sporulation in Bacillus subtilis., Ann. Rev.Genet. 30 (1996) 297–241.

[22] J. Errington, Regulation of endospore formation in Bacillus subtilis., Nat. Rev. Micro.1 (2) (2003) 117–126.

[23] S. T. Wang, B. Setlow, E. M. Conlon, J. L. Lyon, D. Imamura, T. Sato, P. Setlow,R. Losick, P. Eichenberger, The forespore line of gene expression in Bacillus subtilis.,J. Mol. Biol. 358 (1) (2006) 16–37.

[24] K. Lewis, Programmed death in bacteria., Microbiol. Mol. Biol. R. 64 (3) (2000) 503–514.

[25] P. T. McKenney, P. Eichenberger, Dynamics of spore coat morphogenesis in Bacillussubtilis., Mol. Microbiol. 83 (2) (2012) 245–260.

[26] A. O. Henriques, C. P. Moran, Structure, assembly, and function of the spore surfacelayers., Annu. Rev. Microbiol. 61 (2007) 555–588.

[27] W. Abhyankar, A. H. Hossain, A. Djajasaputra, P. Permpoonpattana, A. Ter Beek,H. L. Dekker, S. M. Cutting, S. Brul, L. J. de Koning, C. G. de Koster, In pursuitof protein targets: proteomic characterization of bacterial spore outer layers., J.Proteome Res. 12 (10) (2013) 4507–4521.

[28] P. Setlow, Germination of spores of Bacillus species: what we know and do not know.,J. Bacteriol. 196 (7) (2014) 1297–1305.

[29] P. Setlow, Summer meeting 201–when the sleepers wake: the germination of sporesof Bacillus species., J. Appl. Mircobiol. 115 (6) (2013) 1251–1268, ISSN 1365-2672,doi:10.1111/jam.12343, URL http://www.ncbi.nlm.nih.gov/pubmed/24102780.

[30] A. E. Cowan, E. M. Olivastro, D. E. Koppel, C. A. Loshon, B. Setlow, P. Setlow, Lipidsin the inner membrane of dormant spores of Bacillus species are largely immobile., P.Natl. Acad. Sci. USA 101 (20) (2004) 7733–7738.

[31] P. Loison, N. A. Hosny, P. Gervais, D. Champion, M. K. Kuimova, J.-M. Perrier-Cornet, Direct investigation of viscosity of an atypical inner membrane of Bacillusspores: a molecular rotor/FLIM study., Biochim. Biophys. Acta 1828 (11) (2013)2436–2443.

54

Bibliography

[32] H. Pfeiffer, H. Binder, G. Klose, K. Heremans, Hydration pressure and phasetransitions of phospholipids. II. Thermotropic approach., Biochim. Biophys. Acta1609 (2) (2003) 148–152.

[33] D. E. Vance, Biochemistry of Lipids, Lipoproteins and Membranes, Elsevier, 2008.

[34] P. Setlow, Spores of Bacillus subtilis: their resistance to and killing by radiation, heatand chemicals., J. Appl. Mircobiol. 101 (3) (2006) 514–525.

[35] B. Setlow, P. Setlow, Measurements of the pH within dormant and germinatedbacterial spores., P. Natl. Acad. Sci. USA 77 (5) (1980) 2474–2476.

[36] S. Kaieda, B. Setlow, P. Setlow, B. Halle, Mobility of core water in Bacillus subtilisspores by 2H NMR., Biophys. J. 105 (9) (2013) 2016–2023.

[37] X. Yi, P. Setlow, Studies of the commitment step in the germination of spores ofbacillus species., J. Bacteriol. 192 (13) (2010) 3424–3433.

[38] J. Velásquez, G. Schuurman-Wolters, J. P. Birkner, T. Abee, B. Poolman, Bacillussubtilis spore protein SpoVAC functions as a mechanosensitive channel, Mol.Microbiol. 92 (4) (2014) 813–823.

[39] D. L. Popham, J. Helin, C. E. Costello, P. Setlow, Muramic lactam in peptidoglycan ofBacillus subtilis spores is required for spore outgrowth but not for spore dehydrationor heat resistance., P. Natl. Acad. Sci. USA 93 (26) (1996) 15405–15410.

[40] D. Paredes-Sabja, P. Setlow, M. R. Sarker, Germination of spores of Bacillales andClostridiales species: mechanisms and proteins involved., Trends Microbiol. 19 (2)(2011) 85–94.

[41] B. Setlow, P. Setlow, Small, acid-soluble proteins bound to DNA protect Bacillussubtilis spores from killing by dry heat., Appl. Environ. Microb. 61 (7) (1995) 2787–2790.

[42] P. Setlow, I will survive: DNA protection in bacterial spores., Trends Microbiol. 15 (4)(2007) 172–180.

[43] K. Reineke, A. Mathys, V. Heinz, D. Knorr, Mechanisms of endospore inactivationunder high pressure., Trends Microbiol. 21 (6) (2013) 296–304.

[44] H. F. Foerster, J. W. Foster, Response of Bacillus spores to combinations ofgerminative compounds., J. Bacteriol. 91 (3) (1966) 1168–1177.

[45] P. Zhang, J. Liang, X. Yi, P. Setlow, Y.-Q. Li, Monitoring of commitment, blocking,and continuation of nutrient germination of individual Bacillus subtilis spores., J.Bacteriol. 196 (13) (2014) 2443–2454.

[46] J. Behravan, H. Chirakkal, A. Masson, A. Moir, Mutations in the gerP locus of Bacillussubtilis and Bacillus cereus affect access of germinants to their targets in spores., J.Bacteriol. 182 (7) (2000) 1987–1994.

[47] K. A. Carr, B. K. Janes, P. C. Hanna, Role of the gerP operon in germination andoutgrowth of Bacillus anthracis spores., PloS one 5 (2) (2010) e9128.

55

Bibliography

[48] X. Y. Butzin, A. J. Troiano, W. H. Coleman, K. K. Griffiths, C. J. Doona, F. E.Feeherry, G. Wang, Y.-q. Li, P. Setlow, Analysis of the effects of a gerP mutation onthe germination of spores of Bacillus subtilis., J. Bacteriol. 194 (21) (2012) 5749–5758.

[49] K. D. Hudson, B. M. Corfe, E. H. Kemp, I. M. Feavers, P. J. Coote, A. Moir,Localization of GerAA and GerAC germination proteins in the Bacillus subtilis spore.,J. Bacteriol. 183 (14) (2001) 4317–4322.

[50] M. Paidhungat, P. Setlow, Localization of a germinant receptor protein (GerBA) to theinner membrane of Bacillus subtilis spores., J. Bacteriol. 183 (13) (2001) 3982–3990.

[51] A. R. Zuberi, A. Moir, I. M. Feavers, The nucleotide sequence and gene organization ofthe gerA spore germination operon of Bacillus subtilis 168., Gene 51 (1) (1987) 1–11.

[52] K. P. McCann, C. Robinson, R. L. Sammons, D. A. Smith, B. M. Corfe, Alaninegermination receptors of Bacillus subtilis., Lett. Appl. Microbiol. 23 (5) (1996) 290–294.

[53] R.-M. Cabrera-Martinez, F. Tovar-Rojo, V. R. Vepachedu, P. Setlow, Effects ofoverexpression of nutrient receptors on germination of spores of Bacillus subtilis., J.Bacteriol. 185 (8) (2003) 2457–2464.

[54] M. Paidhungat, P. Setlow, Role of ger proteins in nutrient and nonnutrient triggeringof spore germination in Bacillus subtilis., J. Bacteriol. 182 (9) (2000) 2513–2519.

[55] K.-A. V. Stewart, P. Setlow, Numbers of individual nutrient germinant receptors andother germination proteins in spores of Bacillus subtilis., J. Bacteriol. 195 (16) (2013)3575–3582.

[56] W. Mongkolthanaruk, G. R. Cooper, J. S. P. Mawer, R. N. Allan, A. Moir, Effectof amino acid substitutions in the GerAA protein on the function of the alanine-responsive germinant receptor of Bacillus subtilis spores., J. Bacteriol. 193 (9) (2011)2268–2275.

[57] A. Ramirez-Peralta, S. Gupta, X. Y. Butzin, B. Setlow, G. Korza, M.-A. Leyva-Vazquez, G. Christie, P. Setlow, Identification of new proteins that modulate thegermination of spores of bacillus species., J. Bacteriol. 195 (13) (2013) 3009–3021.

[58] M. J. Wilson, P. E. Carlson, B. K. Janes, P. C. Hanna, Membrane topology of theBacillus anthracis GerH germinant receptor proteins., J. Bacteriol. 194 (6) (2012)1369–1377.

[59] G. Korza, P. Setlow, Topology and accessibility of germination proteins in the Bacillussubtilis spore inner membrane., J. Bacteriol. 195 (7) (2013) 1484–1491.

[60] T. Igarashi, P. Setlow, Interaction between individual protein components of the GerAand GerB nutrient receptors that trigger germination of Bacillus subtilis spores., J.Bacteriol. 187 (7) (2005) 2513–2518.

[61] C. Ross, E. Abel-Santos, The Ger receptor family from sporulating bacteria., Curr.Issues Mol. Biol. 12 (3) (2010) 147–158.

56

Bibliography

[62] G. R. Cooper, A. Moir, Amino acid residues in the GerAB protein important in thefunction and assembly of the alanine spore germination receptor of Bacillus subtilis168., J. Bacteriol. 193 (9) (2011) 2261–2267.

[63] Y. Li, B. Setlow, P. Setlow, B. Hao, Crystal structure of the GerBC component of aBacillus subtilis spore germinant receptor., J. Mol. Biol. 402 (1) (2010) 8–16.

[64] G. Christie, H. Götzke, C. R. Lowe, Identification of a receptor subunit andputative ligand-binding residues involved in the Bacillus megaterium QM B1551 sporegermination response to glucose., J. Bacteriol. 192 (17) (2010) 4317–4326.

[65] Y. Li, P. Catta, K.-A. V. Stewart, M. Dufner, P. Setlow, B. Hao, Structure-basedfunctional studies of the effects of amino acid substitutions in GerBC, the C subunitof the Bacillus subtilis GerB spore germinant receptor., J. Bacteriol. 193 (16) (2011)4143–4152.

[66] S. Atluri, K. Ragkousi, D. E. Cortezzo, P. Setlow, Cooperativity between differentnutrient receptors in germination of spores of Bacillus subtilis and reduction of thiscooperativity by alterations in the GerB receptor., J. Bacteriol. 188 (1) (2006) 28–36.

[67] D. L. Jack, I. T. Paulsen, M. H. Saier, The amino acid/polyamine/organocation (APC)superfamily of transporters specific for amino acids, polyamines and organocations.,Microbiology 146 ( Pt 8) (2000) 1797–1814.

[68] K. K. Griffiths, J. Zhang, A. E. Cowan, J. Yu, P. Setlow, Germination proteins in theinner membrane of dormant Bacillus subtilis spores colocalize in a discrete cluster.,Mol. Microbiol. 81 (4) (2011) 1061–1077.

[69] P. Fort, J. Errington, Nucleotide sequence and complementation analysis of apolycistronic sporulation operon, spoVA, in Bacillus subtilis., J. Gen. Microbiol.131 (5) (1985) 1091–1105.

[70] V. R. Vepachedu, P. Setlow, Localization of SpoVAD to the inner membrane of sporesof Bacillus subtilis., J. Bacteriol. 187 (16) (2005) 5677–5682.

[71] R. A. Daniel, J. Errington, Cloning, DNA sequence, functional analysis andtranscriptional regulation of the genes encoding dipicolinic acid synthetase requiredfor sporulation in Bacillus subtilis., J. Mol. Biol. 232 (2) (1993) 468–483.

[72] F. Tovar-Rojo, M. Chander, B. Setlow, P. Setlow, The products of the spoVA operonare involved in dipicolinic acid uptake into developing spores of Bacillus subtilis., J.Bacteriol. 184 (2) (2002) 584–587.

[73] V. R. Vepachedu, P. Setlow, Analysis of the germination of spores of Bacillus subtiliswith temperature sensitive spo mutations in the spoVA operon., FEMS Microbiol.Lett. 239 (1) (2004) 71–77.

[74] V. R. Vepachedu, P. Setlow, Role of SpoVA proteins in release of dipicolinic acidduring germination of Bacillus subtilis spores triggered by dodecylamine or lysozyme.,J. Bacteriol. 189 (5) (2007) 1565–1572.

57

Bibliography

[75] B. Setlow, A. E. Cowan, P. Setlow, Germination of spores of Bacillus subtilis withdodecylamine., J. Appl. Mircobiol. 95 (3) (2003) 637–648.

[76] A. Perez-Valdespino, Y. Li, B. Setlow, S. Ghosh, D. Pan, G. Korza, F. E. Feeherry,C. J. Doona, Y.-Q. Li, B. Hao, P. Setlow, Function of the SpoVAEa and SpoVAFproteins of Bacillus subtilis spores., J. Bacteriol. 196 (11) (2014) 2077–2088.

[77] H. Riemann, Z. J. Ordal, Germination of bacterial endospores with calcium anddipicolinic acid., Science 133 (3465) (1961) 1703–1704.

[78] M. Paidhungat, K. Ragkousi, P. Setlow, Genetic requirements for induction ofgermination of spores of Bacillus subtilis by Ca(2+)-dipicolinate., J. Bacteriol. 183 (16)(2001) 4886–4893.

[79] A. Magge, A. C. Granger, P. G. Wahome, B. Setlow, V. R. Vepachedu, C. A. Loshon,L. Peng, D. Chen, Y.-Q. Li, P. Setlow, Role of dipicolinic acid in the germination,stability, and viability of spores of Bacillus subtilis., J. Bacteriol. 190 (14) (2008)4798–4807.

[80] L. J. Rode, J. W. Foster, Germination of bacterial spores with alkyl primary amines.,J. Bacteriol. 81 (1961) 768–779.

[81] I. M. Shah, M.-H. Laaberki, D. L. Popham, J. Dworkin, A eukaryotic-like Ser/Thrkinase signals bacteria to exit dormancy in response to peptidoglycan fragments., Cell135 (3) (2008) 486–496.

[82] C. A. Jones, N. L. Padula, P. Setlow, Effect of mechanical abrasion on the viability,disruption and germination of spores of Bacillus subtilis., J. Appl. Mircobiol. 99 (6)(2005) 1484–1494.

[83] E. P. Black, K. Koziol-Dube, D. Guan, J. Wei, B. Setlow, D. E. Cortezzo, D. G. Hoover,P. Setlow, Factors influencing germination of Bacillus subtilis spores via activation ofnutrient receptors by high pressure., Appl. Environ. Microb. 71 (10) (2005) 5879–5887.

[84] E. Y. Wuytack, J. Soons, F. Poschet, C. W. Michiels, Comparative study of pressure-and nutrient-induced germination of Bacillus subtilis spores., Appl. Environ. Microb.66 (1) (2000) 257–261.

[85] E. P. Black, J. Wei, S. Atluri, D. E. Cortezzo, K. Koziol-Dube, D. G. Hoover, P. Setlow,Analysis of factors influencing the rate of germination of spores of Bacillus subtilis byvery high pressure., J. Appl. Mircobiol. 102 (1) (2007) 65–76.

[86] B. Poolman, J. J. Spitzer, J. M. Wood, Bacterial osmosensing: roles of membranestructure and electrostatics in lipid-protein and protein-protein interactions., Biochim.Biophys. Acta 1666 (1-2) (2004) 88–104.

[87] I. R. Booth, M. D. Edwards, S. Black, U. Schumann, S. Miller, Mechanosensitivechannels in bacteria: signs of closure?, Nat. Rev. Micro. 5 (6) (2007) 431–440.

[88] C. Kung, B. Martinac, S. Sukharev, Mechanosensitive channels in microbes., Annu.Rev. Microbiol. 64 (2010) 313–329.

58

Bibliography

[89] P. G. Wahome, P. Setlow, The synthesis and role of the mechanosensitive channel oflarge conductance in growth and differentiation of Bacillus subtilis., Arch. Microbiol.186 (5) (2006) 377–383.

[90] P. G. Wahome, P. Setlow, Growth, osmotic downshock resistance and differentiationof Bacillus subtilis strains lacking mechanosensitive channels., Arch. Microbiol. 189 (1)(2008) 49–58.

[91] A. Moir, B. M. Corfe, J. Behravan, Spore germination, Cell. Mol. Life Sci. 59 (3)(2002) 403–409.

[92] S. D. Sammons, R. L. Moir A, Isolation and properties of spore germination mutantsof Bacillus subtilis 168 deficient in the initiation of germination, J. Gen. Microbiol.124 (229-241).

[93] G. Christie, C. R. Lowe, Role of chromosomal and plasmid-borne receptor homologuesin the response of Bacillus megaterium QM B1551 spores to germinants., J. Bacteriol.189 (12) (2007) 4375–4383.

[94] G. Christie, C. R. Lowe, Amino acid substitutions in transmembrane domains 9 and10 of GerVB that affect the germination properties of Bacillus megaterium spores., J.Bacteriol. 190 (24) (2008) 8009–8017.

[95] G. Christie, M. Lazarevska, C. R. Lowe, Functional consequences of amino acidsubstitutions to GerVB, a component of the Bacillus megaterium spore germinantreceptor., J. Bacteriol. 190 (6) (2008) 2014–2022.

[96] E. R. Geertsma, B. Poolman, High-throughput cloning and expression in recalcitrantbacteria., Nat. Methods 4 (9) (2007) 705–707.

[97] S. W. Terzaghi BE, Improved medium for lactic streptococci and their bacteriophages,Appl. Microbiol. 29 (1975) 807–813.

[98] D. J. Slotboom, R. H. Duurkens, K. Olieman, G. B. Erkens, Static light scattering tocharacterize membrane proteins in detergent solution., Methods 46 (2) (2008) 73–82.

[99] E. Folta-Stogniew, K. R. Williams, Determination of molecular masses of proteins insolution: Implementation of an HPLC size exclusion chromatography and laser lightscattering service in a core laboratory., J. Biomol. Tech. 10 (2) (1999) 51–63.

[100] E. R. Geertsma, N. A. B. Nik Mahmood, G. K. Schuurman-Wolters, B. Poolman,Membrane reconstitution of ABC transporters and assays of translocator function.,Nat. Protoc. 3 (2) (2008) 256–266.

[101] A. R. Walmsley, G. E. Martin, P. J. Henderson, 8-Anilino-1-naphthalenesulfonate isa fluorescent probe of conformational changes in the D-galactose-H+ symport proteinof Escherichia coli., J. Biol. Chem. 269 (25) (1994) 17009–17019.

[102] B. Webb, A. Sali, Comparative Protein Structure Modeling Using MODELLER., Curr.Prot. Bioinfo. 47 (2014) 5.6.1–5.6.32.

[103] C. Perez-Iratxeta, M. A. Andrade-Navarro, K2D2: estimation of protein secondarystructure from circular dichroism spectra., BMC Struct. Biol. 8 (2008) 25.

59

Bibliography

[104] P.-I. C. Louis-Jeune C, Andrade-Navarro MA, Prediction of protein secondarystructure from circular dichroism using theoretically derived spectra, Proteins 80(2011) 374–381.

[105] B. J. L. L. Wiseman T, Williston S, Rapid measurement of binding constants and heatsof binding using a new titration calorimeter, Anal. Biochem. 169 (1987) 2748–2754.

[106] A. J. Driessen, J. Kodde, S. de Jong, W. N. Konings, Neutral amino acid transport bymembrane vesicles of Streptococcus cremoris is subject to regulation by internal pH.,J. Bacteriol. 169 (6) (1987) 2748–2754.

[107] E. K. Schneider CA, Rasband WS, NIH Image to ImageJ: 25 years of image analysis,Nat. Methods 9 (2012) 671–675.

[108] J. R. Lakowicz, Principles of Fluorescence Spectroscopy, Springer, 3rd edn., 2011.

[109] M. R. Eftink, The use of fluorescence methods to monitor unfolding transitions inproteins., Biophys. J. 66 (2) (1994) 482–501.

[110] S. M. Kelly, T. J. Jess, N. C. Price, How to study proteins by circular dichroism.,Biochim. Biophys. Acta 1751 (2) (2005) 119–139.

[111] D. H. A. C. C. H. I. Ramos, The use of circular dichroism spectroscopy to studyprotein folding, form and function, African J. Biochem. Res. 3 (5) (2009) 164–173.

[112] J. T. Vivian, P. R. Callis, Mechanisms of tryptophan fluorescence shifts in proteins.,Biophys. J. 80 (5) (2001) 2093–2109.

[113] K. K. Griffiths, P. Setlow, Effects of modification of membrane lipid composition onBacillus subtilis sporulation and spore properties., J. Appl. Mircobiol. 106 (6) (2009)2064–2078.

[114] G. Wang, X. Yi, Y.-q. Li, P. Setlow, Germination of individual Bacillus subtilis sporeswith alterations in the GerD and SpoVA proteins, which are important in sporegermination., J. Bacteriol. 193 (9) (2011) 2301–2311.

[115] B. Martinac, J. Adler, C. Kung, Mechanosensitive ion channels of E. coli activated byamphipaths., Nature 348 (6298) (1990) 261–263.

[116] E. Perozo, A. Kloda, D. M. Cortes, B. Martinac, Physical principles underlying thetransduction of bilayer deformation forces during mechanosensitive channel gating.,Nat. struct. Biol. 9 (9) (2002) 696–703.

[117] T. Nomura, C. G. Cranfield, E. Deplazes, D. M. Owen, A. Macmillan, A. R. Battle,M. Constantine, M. Sokabe, B. Martinac, Differential effects of lipids and lyso-lipidson the mechanosensitivity of the mechanosensitive channels MscL and MscS., P. Natl.Acad. Sci. USA 109 (22) (2012) 8770–8775.

[118] I. R. Booth, P. Blount, The MscS and MscL families of mechanosensitive channels actas microbial emergency release valves., J. Bacteriol. 194 (18) (2012) 4802–4809.

60

Bibliography

[119] P. G. Wahome, A. E. Cowan, B. Setlow, P. Setlow, Levels and localization ofmechanosensitive channel proteins in Bacillus subtilis., Arch. Microbiol. 191 (5) (2009)403–414.

[120] Y. Li, A. Davis, G. Korza, P. Zhang, Y.-q. Li, B. Setlow, P. Setlow, B. Hao, Role ofa SpoVA protein in dipicolinic acid uptake into developing spores of Bacillus subtilis.,J. Bacteriol. 194 (8) (2012) 1875–1884.

[121] M. J. Casadaban, S. N. Cohen, Analysis of gene control signals by DNA fusion andcloning in Escherichia coli., J. Mol. Biol. 138 (2) (1980) 179–207.

[122] M. D. Edwards, S. Black, T. Rasmussen, A. Rasmussen, N. R. Stokes, T.-L. Stephen,S. Miller, I. R. Booth, Characterization of three novel mechanosensitive channelactivities in Escherichia coli., Channels 6 (4) (2012) 272–281.

[123] U. Schumann, M. D. Edwards, T. Rasmussen, W. Bartlett, P. van West, I. R. Booth,YbdG in Escherichia coli is a threshold-setting mechanosensitive channel with MscMactivity., P. Natl. Acad. Sci. USA 107 (28) (2010) 12664–12669.

[124] N. Levina, S. Tötemeyer, N. R. Stokes, P. Louis, M. A. Jones, I. R. Booth, Protectionof Escherichia coli cells against extreme turgor by activation of MscS and MscLmechanosensitive channels: identification of genes required for MscS activity., EMBOJ. 18 (7) (1999) 1730–1737.

[125] L. M. Guzman, D. Belin, M. J. Carson, J. Beckwith, Tight regulation, modulation,and high-level expression by vectors containing the arabinose PBAD promoter., J.Bacteriol. 177 (14) (1995) 4121–4130.

[126] A. Kocer, M. Walko, B. L. Feringa, Synthesis and utilization of reversible andirreversible light-activated nanovalves derived from the channel protein MscL, Nat.Protocols 2 (6) (2007) 1426–1437.

[127] P. Blount, S. I. Sukharev, P. C. Moe, B. Martinac, C. Kung, Mechanosensitive channelsof bacteria., Method Enzymol 294 (1999) 458–482.

[128] P. C. Moe, P. Blount, C. Kung, Functional and structural conservation in themechanosensitive channel MscL implicates elements crucial for mechanosensation.,Mol. Microbiol. 28 (3) (1998) 583–592.

[129] E. S. Haswell, R. Phillips, D. C. Rees, Mechanosensitive channels: what can they doand how do they do it?, Structure 19 (10) (2011) 1356–1369.

[130] B. Setlow, P. G. Wahome, P. Setlow, Release of small molecules during germinationof spores of Bacillus Species., J. Bacteriol. 190 (13) (2008) 4759–4763.

[131] B. Hille, Ionic Channels of Excitable Membranes, Sinauer Associates, Incorporated,2001.

[132] J. T. Mika, J. P. Birkner, B. Poolman, A. Koçer, On the role of individual subunits inMscL gating: “all for one, one for all?”., FASEB J. 27 (3) (2013) 882–892.

[133] V. R. Vepachedu, P. Setlow, Analysis of interactions between nutrient germinantreceptors and SpoVA proteins of Bacillus subtilis spores., FEMS Microbiol. Lett.274 (1) (2007) 42–47.

61

Acknowledgements

7 Acknowledgements

During my PhD, I met many nice and important people that contributed to finish this thesis.I want to thanks to everybody. I hope I can remember all of you! I am closing my eyesnow trying to remember the lab, the corridors, the walls (and asbestos) the offices and mycolleagues. Most of the people are not there any more! I hope to remember all of you!

Bert, thanks to give me the opportunity to join your group! You give me a place to do mysecond master project with Geert. Also thanks for asking me to join the PhD in your groupand also TIFN group from Wageningen. Thanks also for your patience when the results werenot always positive. And of course for your time in reading and correcting my manuscriptseven you were in holidays or ill! You made rigorously corrections! I remember now when wespent many times in the train going or coming back from Wageningen meetings!

Thanks also to Geert! You also contributed not only in my last master project but alsoyou gave me positives inputs to start my PhD in the same lab! Thanks for showing the niceworld of working with antimicrobial peptides and also with confocal microscopy! Thanks alot because working with you we got two papers published in only 6 months or less of work!You are a Cum Laude supervisor!

Tjakko, thanks for being always positive about Ger receptors studies. Since I got my firstcloning and expression of one of the Ger proteins, you were very excited and you wanted thecrystal structures! Thanks also for answering all my questions from lots of emails! Thanksalso to correct this thesis! You gave me nice comments and advices too!

Oscar Kuipers, thanks for giving me rides to Wageningen for our group meetings. Once, Itook the wrong bus and you found me and saved me! And also thanks a lot for being alwaysvery positive with my project and for your feedbacks after my presentation in EuropeanSpores Conferences. Robin, Thanks also for your interest in my project and your advicesduring my PhD. And also for your supervision during sporulation experiments in your lab!You stayed with me very long! You gave me always feedbacks after my oral presentations! Weshared nice moments in European Spores Conferences; I will always remember the meetingsin Cortona, Italy and the limoncello! And our last meeting in UK.

Fabritzia, We had many meetings together in Wageningen, it was always nice to talk toyou! You always have nice stories to tell. And it was nice to share nice moments duringTIFN meetings and Quizpub!

Alicja and previously Wim you helped me a lot to figure out what were those extra bandsI was purifying all the time!! Thanks a lot for your help.

Thanks to All TIFN team!! I want to thanks to all TIFN team, Roy, Xiao, Greetje, Sachinand Clint. Thanks Roy for being our team manager of C-1056 team! You were always verynice and friendly! You helped me when I had some trouble to reach TIFN meetings andalways very helpful to answer all my questions. Thank Xiao to send a copy of your thesisfrom Wageningen to Los Alamos!

Coming back to our colleagues in Enzymology lab:Dear Armagan thanks a lot for your help during Patch clamp experiments. For your

positive comments and encouragement to continue patching. You shared with me your

63

Acknowledgements

experience as a mom and as a researcher.Dirk, thanks a lot for your help during characterization of one of my proteins, you helped

me with Light scattering chromatography! I always remember you nice sense of humor!Even sometimes I couldn’t understand it ,

Now, I will start with my office mates:I would like to thanks Ria for being always helpful and encourage me when I was not

feeling so good. You gave me many tips to improve my purification and reconstitution ofmy proteins and of course you gave me many advices and tips when I had my child! I willalways remember you! It was very nice we shared office! I wish you all the best.

Gemma, thanks for being there always with a solution for everything! Always verypositive! And happy! We always spoke in spanish and it was so nice for me! Out fromthe lab we shared nice moments with our spanish family and common friends! Y para Edutambien muchas gracias! Les deseo todo lo major a los dos! Estoy segura que juntos seransiempre felices a donde el destino les lleve! Edu muchos animos en tus estudios! Seguro queestas aprendiendo un monton! Felicitacions i exit!!

Nobina! I had many memories together! I met you during master studies and after thatwe shared nice moments together during our PhD in the lab and outside the lab! ThanksIna for your help during my calcein experiments, you gave me all your tips and advices! Wealso spent a lot of time in the patch clamp room! you with the new automatic patch and Itrying to get a Gigaohms with the manual one. Also thanks to Randy! I wish you all thebest in UK! Rianna you came in my last months in the lab and also in my office. I enjoyedlisten your stories about horses and your family thanks to be there. I wish you all the bestin your PhD.

Yuri also you came in my last month where Gemma was sitting before, it was nice to haveyou as an officemate. I wish you all the best.

Next room to my left, the busy and noise one with the red sofa in your office! Dusan,Stephany, Frans, and Gemma! I wish you all the best! Stephanie thanks to help me to findout about my construct!! Akira thanks also for your help and advices during my experiments,we spent many times in the lab also until very late sometimes! And sometimes in the coldroom!

Going to next room to my right Gea, Anton, Pranav and Duygu:Gea, you were part of my PhD project, we have a nice paper together! Thanks to help me

during work discussions and for all your help doing my experiments for my thesis! I learnta lot from you. Thanks to invite us for dinner during Christmas time, we were always verysad to being without our family and you always made a nice full table with delicious foodto share with us!

Anton thanks for helping me to make nice constructs! You explained very well! I rememberyou as the easygoing person in the lab! I have never seen you upset.

Duygu thanks to help me to use the GUV maker machine. Since you showed me how todo it I had nice results all the time! I wish you all the best finalizing your PhD.

Jan Peter, thanks a lot for your help during my last year of PhD! You made a lot of timefor me during patching, and in between you were writing your own thesis and working as apost doc. You also took time to read and gave me good comments for one of my papers!

Pranav, I had nice memories with you especially at the beginning of my PhD. We took acourse together (oral presentation course), you liked my peruvian song! Los pollitos dicenpio pio pio ... I wish all the best in your postdoc and with your family.

Continue to my right I have the next room, McDonald, Nadia, Eric, Ana, Dani, Jonas

64

Acknowledgements

and ArnoldThanks MacDonald, we shared lot of time behind the Patch clamp! You showed me after

Armagan how to patch and have good sealing!! You have a looot of patience with patchingand spent a lot of hours in the patching room. I was always surprised that you could domany experiments at the same time! I wish you all the best in Malawi and with your family!

Dani, muchas gracias!! por toda tu ayuda!, gracias por tu super cepa DML1, gracias pormencionarme en agradecimientos en uno de tus articulos! Tambien gracias por acordartesiempre de nosotros y escribirnos correos para saber como estamos! Y por supuesto dandomemuchos animos para terminar la tesis!! Te deseo todo lo mejor en tu nuevo trabajo en Irlanda!Nadia, we became good friend, we shared pipets and clean flasks sometimes!, and we hadnice chats together. You are very hard worker! I will always admire your perseverance tofinish your thesis! I wish you all the best with your family in Sweden.

Dear Anna I met in my second year of PhD! You are very nice person and positive! I wishyou all the best in Germany with your work and your family! You told me once that beinga mom is wonderful experience! You were right!

Going again to the other side of the lab!Josy, we shared the same office for a couple of months with Ravi and Fabrizia! We also

shared our zumba workout lessons together! I was always impressed how you can practice alot of sports! When we biked together I ended very exhausted! Thanks for all ladies nightyou arranged for us! I wish you all the best in your new job and with your family withRonnie and baby! Andreja, I always remember your very loud laughs! Always very happy!I wish you all the best in Switzerland. Faizah, I met you during our master projects inthe lab, you are very polite and nice colleague! I remember your Bachelorette party it wasgreat! Thanks to send me positive thinking from Groningen when I left the lab. Marysia,I remember you with nice sense of humor, and always being very helpful when I had someproblems during SEC, I always of course remember your cakes!! I still want your recipes!Dorith and Sonja, I met you when I came back after my maternity leave. You are very nicecolleagues I wish you all the best in your future career. Eriba group thanks to all of you:Lizbeth, Anne, Anne Marie, Justyna, Astri, Anton and Petra. The lab was not the samewithout you.

Thanks as well to my previous colleagues (Jacek, Siva, Tejas, Ravi, Adeline and more) allthe best for you! And thanks to all colleagues I met during my PhD! (Sorry if I forgot tomention all)

To my spanish-speaking friends!! Dani; Gemma y Edu; Claudia y Simona; Adriana,German y Violeta; Alberto, Esther y Clarita; Noelia y Jason; Maria, Frank y Tomas! Graciaschicos! Cuantas cosas hemos compartido y pasado juntos! Gracias por haber estado alli, paradarnos fuerzas y animos para seguir adelante y afrontar todo los cambios en nuestras vidas!Besos para todos!! Los tengo en mi corazon!! Y ahora en el whatsApp! Comunicandonos amiles de kilometros de distancias!

Ruti, nuestra amiga peruana en Groningen! Te deseo todo lo major en Alemania!Marijke and Harry! Thanks for being our dutch family! We will always be happy to be

your friends! You help us a lot (until now). We always appreciate how much you did for us!We never imagined that we would find a family in Groningen! Bedankt for everything!! BelenSylvain e hijitos! Muchas gracias chicos por haber estado con nosotros desde que llegamosa Groningen, nos conocimos en la Iglesia! Y desde entonces seguimos siendo amigos, quepena no poder ver crecer a Lise y a Estefan debe estar muy lindos y hablando 4 idiomas!

Ildi, I met you in my student house, in my second year of master. We shared good and

65

Acknowledgements

bad moments, but now I am very happy that you enjoy your new job and you are happyin Hungary, which I would love to visit someday!! I couldn’t imagine that a found a friendthat we have so much in common!

Thanks to Eamon, Annechien and baby, thanks also for all your help and all our dinnerstogether! Thanks to get our baby stuff when we left Groningen. I was very happy to knowthat you could use them.

Mary and Dennis, gracias chicos por vivir en Holanda y ser nuestros amigos. Gracias portodas las fiestas latinas y cenas que compartimos, por los tips para nuevos padres! Y portoda la ayuda que siempre nos han brindado!

To my friends in Lima, gracias a Kathy y Vane. Gracias chicas por estar siempre allinos conocemos tanto tiempo! Gracias tambien por haber venido a visitarnos y conocerGroningen! Gracias por estar siempre pendientes de nosotros! Katy te acuerdas de nuestrosueño de visitar Europa, lo conseguimos!! y subimos hasta las torres mas altas jajaja! Yseguiremos subiendo! Espero verlas pronto!!

My previous lab in The Cayetano Heredia University colleagues! Gracias Dra Manualitaand Dr Gilman, Mirko, Patty, Yanina, Nancy, Edith, Carmen y Marilu! All members ofGilman’s Lab.

To my family, parents and brothers and sister Gracias Cesitar (canito) por siempre estaralli cuando mas lo necesitaba, si tengo que agradecerte muchas cosas no alcanzaria el papelde esta thesis! Muchas gracias por siempre estar alli, dandome animos y mucho empuje paraterminar nuestro sueño de tener ambos nuestro PhD en el extranjero. Gracias por ser unbuen papá y haber cuidado a Andre cuando yo estaba terminando la tesis. Besitos a mihijito lindo aunque no sabe leer, con tu sonrisa de todos los dias me ayudaron a terminar estatesis. Gracias a mis padres y hermanos que aunque no entiendan porque sigo estudiando siyo acabe los estudios de biologia hace mucho tiempo , y se preguntan porque hice tantasmaestrias y ahora doctorado? Gracias por su apoyo y animos para terminar esta tesis.

Finally, I want to thanks to all my new colleagues in Los Alamos, New Mexico Consortium,Dr Sayre, Steve, Sangeeta, Natasha, Angela, Sowyma, Sathish, Angela and more! Thanksto give me the opportunity to learn about Algae research and also give me time and a niceplace to finish my thesis.

66

how do spores wake up? proteins involved in the first ... involved in the first steps of spore...

Documents