how to fingerprint a bat
TRANSCRIPT
![Page 1: How to fingerprint a bat](https://reader034.vdocuments.net/reader034/viewer/2022051315/55a6e0ec1a28ab8f558b458d/html5/thumbnails/1.jpg)
School of Life Sciences Learning and Teaching, University of Dundee
![Page 2: How to fingerprint a bat](https://reader034.vdocuments.net/reader034/viewer/2022051315/55a6e0ec1a28ab8f558b458d/html5/thumbnails/2.jpg)
![Page 3: How to fingerprint a bat](https://reader034.vdocuments.net/reader034/viewer/2022051315/55a6e0ec1a28ab8f558b458d/html5/thumbnails/3.jpg)
Identify a suitable study organism for
small scale (Honours level) projects
Obtain a sequence resource
Do interesting science
› Marker identification
› Genome comparison
› Sequence assembly
› …
![Page 4: How to fingerprint a bat](https://reader034.vdocuments.net/reader034/viewer/2022051315/55a6e0ec1a28ab8f558b458d/html5/thumbnails/4.jpg)
The Soprano Pipistrelle is
Scotland's most
common bat species.
Like all bats it is a
protected species.
No genome sequence
Locally accessible but
poorly understood biology and ecology
http://www.bats.org.uk/data/images/species/pipistrelle_soprano/Pip_Pyg.JPG
Potential for non-invasive monitoring by DNA analysis of faeces
![Page 5: How to fingerprint a bat](https://reader034.vdocuments.net/reader034/viewer/2022051315/55a6e0ec1a28ab8f558b458d/html5/thumbnails/5.jpg)
Genomic DNA from a single donated
individual
1 library (197bp fragment)
1 lane on HiSeq (paired end)
› 140 million mate pairs, 101bp reads
› 28 billion bp.
› Estimated genome size : 2.5-3.0 Gbp
![Page 6: How to fingerprint a bat](https://reader034.vdocuments.net/reader034/viewer/2022051315/55a6e0ec1a28ab8f558b458d/html5/thumbnails/6.jpg)
A
B
Forward primers Reverse primers
Target Length: 150-250bp fragment
![Page 7: How to fingerprint a bat](https://reader034.vdocuments.net/reader034/viewer/2022051315/55a6e0ec1a28ab8f558b458d/html5/thumbnails/7.jpg)
SRA
› QC
› Filter
› Error correct
› Assemble
› Around 4.7 Million contigs
N50 ~11.5 kb
![Page 8: How to fingerprint a bat](https://reader034.vdocuments.net/reader034/viewer/2022051315/55a6e0ec1a28ab8f558b458d/html5/thumbnails/8.jpg)
4.7 Million contigs
>400,000 repeats
Repeat search
with SciRoKo
7140 candidates
‘custom python
script’
1405 primer pairsPrimer 3
![Page 9: How to fingerprint a bat](https://reader034.vdocuments.net/reader034/viewer/2022051315/55a6e0ec1a28ab8f558b458d/html5/thumbnails/9.jpg)
ACACACACACACACAC
Repeat >2
ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG
90bp < Repeat <200 bp
ACTGACTGACTGACTGACTG TGACTGACTGACTGACTGAC
Inter-repeat gaps > 150 bp
ACTGACTGACTGACTGACTG
![Page 10: How to fingerprint a bat](https://reader034.vdocuments.net/reader034/viewer/2022051315/55a6e0ec1a28ab8f558b458d/html5/thumbnails/10.jpg)
1405 primer pairs
126 candidates
‘custom python
script’
22 primer pairs
‘manual
selection’
Lots of gelsOrder!
![Page 11: How to fingerprint a bat](https://reader034.vdocuments.net/reader034/viewer/2022051315/55a6e0ec1a28ab8f558b458d/html5/thumbnails/11.jpg)
Common Tm 58-60 C
Amplified fragment 150-250bp
Filter for low self-annealing/hairpin score
High complexity (no simple sequence
repeats)
![Page 12: How to fingerprint a bat](https://reader034.vdocuments.net/reader034/viewer/2022051315/55a6e0ec1a28ab8f558b458d/html5/thumbnails/12.jpg)
3 primer pairs from already published
data (Racey et al 2005)
7 primer pairs from other bat species
› Reported as potentially cross-species
22 novel primer pairs from our study
All with common PCR conditions.
![Page 13: How to fingerprint a bat](https://reader034.vdocuments.net/reader034/viewer/2022051315/55a6e0ec1a28ab8f558b458d/html5/thumbnails/13.jpg)
Do the primers amplify cleanly?
› If not, do they have potential with tweaks
Are they heterogeneous?
› Test across DNA panel from 7 bats
Do they work on DNA isolated from
pellets?
› i.e. against a very noisy background
![Page 14: How to fingerprint a bat](https://reader034.vdocuments.net/reader034/viewer/2022051315/55a6e0ec1a28ab8f558b458d/html5/thumbnails/14.jpg)
A:
Similar results seen on DNA extracted from
pellets but a few extra PCR cycles needed
![Page 15: How to fingerprint a bat](https://reader034.vdocuments.net/reader034/viewer/2022051315/55a6e0ec1a28ab8f558b458d/html5/thumbnails/15.jpg)
Most of the putative cross species markers failed and
the 2 that worked gave products outwith size
constraints for analysis.
All of the previously identified Pipistrelle markers
amplified well but require a better resolution
technology to determine if they are informative
Primer set Total pairs Failed Heterozygous Homozygous Need work
Novel22 6 9 0 7
Cross sp.7 5 0 2 0
Racey et al3 0 2 1 0
![Page 16: How to fingerprint a bat](https://reader034.vdocuments.net/reader034/viewer/2022051315/55a6e0ec1a28ab8f558b458d/html5/thumbnails/16.jpg)
1 HiSeq lane and straightforward
assembly is sufficient for candidate
marker identification
Careful selection at the bioinformatic
stage gives a good return of candidates.
>70% is an excellent result.
![Page 17: How to fingerprint a bat](https://reader034.vdocuments.net/reader034/viewer/2022051315/55a6e0ec1a28ab8f558b458d/html5/thumbnails/17.jpg)
Optimise the conditions
› Mostly small tweaks
Multiplex for genotyping
› Fluorescent labelling
Apply to populations
› Collection of bat faeces
![Page 18: How to fingerprint a bat](https://reader034.vdocuments.net/reader034/viewer/2022051315/55a6e0ec1a28ab8f558b458d/html5/thumbnails/18.jpg)
Thanks to:
Dr David Booth
Tayside Bat Group
Bat donors
School of Life Sciences Learning and Teaching