icar research complex for neh region umroi road, umiam ...pod-boring weevil indicated interspecific...

ICAR Research Complex for NEH RegionUmroi Road, Umiam – 793 103Telephone : 0364 – 2570257FAX : 0364 – 2570355Gram : AGRICOMPLEXE Mail : [email protected] : www.icarneh.ernet.in

Annual Report 2007 – 08

GuidanceDr. S. V. NgachanDr. N. S. Azad Thakur

EDITORIAL BOARD

Dr. Satish Chandra, ChairmanDr. P. K. Ghosh, MemberDr. A. Kumaresan, MemberDr. A. Viswakarma, MemberDr. A.K. Jha, MemberDr. Anup Das, MemberDr. G. Kadirvel, MemberDr. M.H. Khan, MemberShri Kanchan SaikiaShri A. K. Khound, Member

Summary in HindiShri S. P. Unial

Editing AssistanceMs. Nirmali Borthakur

Published by:DirectorICAR Research Complex for NEH RegionUmroi Road, Umiam – 793103, Meghalaya, India

Correct citation: Annual report 2007 – 08. ICAR Research Complex for NEH Region, Umiam– 793103, Meghalaya, India.

Designed and printed by print21, Ambikagirinagar, R.G.Baruah Road, Guwahati 781024

Preface

The agriculture scenario in the north-eastern India is passing through a transition phasedue to slow but prominent change in climate in one hand and increasing food requirement on theother. ICAR Research Complex for NEH Region taking note of these events and its futureramifications started working on the futuristic technologies while maintaining a balanced focuson improving the present scenario.

As detailed in the report, the institute worked on developing and popularizing rain waterharvesting and moisture conservation techniques. Jalkund is a major success in this area. Forthe first time in the region, programme on quality analysis of water used in agriculture wastaken up. Under NAIP a project on livelihood improvement of rural poor through sustainablefarming system was launched. In addition, new varieties of field and horticultural crops for thepoor farmers living in the unfavourable environment, cost effective technologies for cropmanagement like INM, IPM, weed control, biological pest control, soil health management etc.were developed. A disease biodiversity survey programme to assess current and emerging threatswas initiated.

The farmer friendly soil testing kit and soil health cards developed by the institute wouldgo a long way in addressing one of the basic but major problems of agriculture in the region. Anumber of states in the region are now organic in agriculture and the efforts of the scientists ofthe institute in developing organic fertilizers, bio-pesticides, organic growth promoters, biologicalcontrol agents, etc. will help the states to achieve their goal. In the field of horticulture, work oncitrus rejuvenation was continued and new varieties of other fruits like pineapple, guava, peach,strawberry, etc. were developed / identified. Production of seed and planting material was givenhigh priority. In order to tap the potential of indigenous fruits, technologies were developed fortheir mass multiplication by grafting and breaking dormancy of seeds. Post-harvest processingprotocols for making tooty fruity, nectar and packing methods for reducing weight loss werealso developed. In the animal science research, major breakthroughs were made in standardizationof cryopreservation protocol for pig semen and ultra sonographic method for examiningreproductive organs of goats. Economic analysis of low input pig production system, ornamentalfisheries, local bird-based poultry, rice-based cropping systems were carried out. In order toreduce cost of livestock production, feed formulations based on locally available supplementswere developed. In the HRD sector apart from giving regular training, the institute providedteaching and research support to Central Agricultural University in conducting PG courses.

All these were possible due to the constant support and able guidance received from ourDirector General and Secretary, DARE, Govt. of India. Dr. Mangala Rai and Dy. Director General(NRM) Dr. A.K. Singh in addition to the support received from all my colleagues at the HQ andregional centres.

I complement the editorial board for the pain they took in compiling the report andsincerely believe that the document will be of immense value to the agriculture fraternity of thecountry as a whole and the region in particular.

( S. V. Ngachan )Director

CONTENTS

S. No. Contents Page no

1 Executive Summary 12 Introduction 53 Head Quarters 9

Weather 11• Research Achievements 15• Crop Science 15• Cropping System 30• Organic Farming 33• Oilseeds 39• Soil Science 41• Fruits 46• Vegetables 49• Floriculture 52• Post Harvest Management 53• Spices 56• Mushroom 56• Water Resources 57• Agroforestry 64• Agricultural Economics 74• Agricultural Engineering 81• Soil Water Conservation 84• Agricultural Extension 90• Animal Sciences 97• Fisheries 113• Publications 114

4 Arunachal Pradesh 1255 Manipur 1396 Mizoram 1597 Nagaland 1798 Sikkim 2019 Tripura 21910 List of contributors 26311 Executive Summary (Hindi version) 265

1 Annual Report 2007-08

Achievements of research activities taken underdifferent commodities at the HQ and regionalcentres during 2007 – 08 are summarized below.

In the rice improvement programme at theheadquarter RCPL 1-115, VL 30240 and HPR 2530(4.17 – 3.83 t/ha) were identified as promisingupland genotypes while RCPL 1-126, RCPL 1-72and RCPL 1-160 (both aromatic) were identifiedas promising (5.2 – 5.7 t/ha) low land genotypes.Two released hybrids KRH2 (6.43 t/ha) and PSD3 (5.93 t/ha) also performed well. Eight hundredthirty-four rice germplasm were characterized and108 new collections were made. At ArunachalPradesh 194 lines from national nurseries and 129local germplasm were screened against blast. AtManipur one hundred F7 lines were selected withdifferent maturity dates, height and other yieldattributes for further advancements. A unique ricemutant bearing three spikelets / cluster wasidentified and used in breeding. Two advanced linesMC-34-7-21-15-58-49 and MC-34-7-5-2-75-33-19were found highly resistant to leaf and neck blast.RCM-21 and RCM-22, nominated from Manipurcenter were promoted to AVT – 1. RCM-17, AR-4,AR-12 were identified as promising aromatic andfine grain genotypes. At Nagaland RCPL 1-121,IET 16313 and RCM-11 were identified as bestgenotypes for lowland while RCPL1-115 was thebest genotype for upland. Shahsarang – 1 was thebest performing variety at Sikkim and yielded 5.0t/ha under organic condition. TRC-87-251 andTRC-87-251-1 were identified as promising forTripura condition. IET 20496, IET 19837 and IET20372 were also found promising. Physical,cooking and processing and nutrient qualityanalysis of rice germplasm and varieties were alsocarried out.

Photometric indexing of rice varieties indicatedthat late varieties are more sensitive to CDD andCNP. Studies on N-use efficiency indicated thatnumber of secondary branches per rice hill couldbe improved by management practices. Among thevarious organic nutrients FYM 20 t/ha + Azolladual cropping recorded highest yield of 4.97 t/hain the test variety Shahsarang – 1. Nursery

establishment and genotypes were standardized forpre-kharif rice. Nursery in poly tunnel + open andtransplanting at 45 to 60 days was the best practiceand IR 64 was the highest yielding variety. IR64+ Shahsarang1 combination was identified as bestcombination for rice-rice cropping sequence.Teprhrosia was identified as best source of organicnutrient in a rice-pea cropping system. Underlowland condition application of 5 kg Zn/haimproved yield of RC-Maniphou 7. Similarly, DAP+ PSM increased yield of the variety. However,effect of PSM was reduced when zinc was applied.

Tricyclazole @ 0.6 g/l was found most effectivein controlling rice blast fungus. Rynaxypyr 0.4%G @ 3g a.i./ha and Rynsxypyr 20 SC @ 30 ml a.i./ha were found effective against rice stem borer,leaf folder and root aphid. At Umiam, bio-organicformulation RCHE C-121 was found promising forlowland rice.

Two gene pools of maize were created fromlocal germplasm and several other lines wereidentified. Study of the biology of maize stem boreridentified 4-5 overlapping generations in the maincrop season. In maize paper mill sludge (20t/ha) incombination with dolomite (10% LR) showedenhanced productivity. Twenty composites weretested for 3 years at Sikkim. NAC 6004 yieldedconsistently high (4.62 t/ha). Five QPM lines wereevaluated. Entry FQH 57 was the highest yielder(4.45 t/ha). Among the various organic nutrientformulations, mixed compost 2.5 t/ha + neem cake0.5 t/ha + vermicompost 2.5 t/ha gave highest yieldin variety Vivek Sankuy Makka- 11. TRM-11 (4.46t/ha) was a promising maize genotype for Tripura.

Of the different pulse crops that were tested atUmiam, a fodder ricebean (RB1 - 226 g/plant), pea(TRC P8 and P9) lentil (VL4 – 2.5 t/ha) andrajmash (Carmel – 2.6 t/ha) were identified aspromising pulses. Study of the various species ofpod-boring weevil indicated interspecificcompetition. Imidacloprid @ 0.5 ml/l was effectivein controlling aphids of pea. UPAS-120 (3.1 t/ha),PA 134 (2.87 t/ha) and ICPL 99034 (2.85 t/ha) wereidentified as promising pigeonpea genotypes forManipur.

Executive Summary


MAUS 295, RCS –1 and NRC – 76 wereidentified as promising soybean lines. Ninesoybean lines were identified as moderatelyresistant to soybean rust. I. roseum was highlyeffective in parasitizing soybean rust pustules.Groundnut genotype ICGV 00401 was identifiedas promising for Umiam (3.35 t/ha). At NagalandCentre Sez – 2 (2.1 t/ha) was identified aspromising rapeseed and mustard and PT 303 (1.1t/ha) was identified as promising toria genotype.TRC-T-1-1-5-1 nominated from Tripura centre waspromoted to AVT-1 of AICRP on rapeseed mustard.In IVT-Toria TCN-07-11 (1.43 t/ha) and AVTyellow sarson YSCN-07-18 (1.61 t/ha) were foundpromising for Tripura condition.

Application of phosphate fertilizers with CaSO4showed significant influence on soil N.P.K. and Scontent in groundnut crop. At Manipur limepelleting of groundnut seeds @ 400 g/10 kg wasbetter than furrow application of lime while insoybean furrow application supplemented withRhizobium was better. For groundnut, 2 t/havermicompost was the best source of organicfertilizer but harvest index was better withinorganic NPK. Mixed compost @ 5 t/ha +vermicompost @ 1 t/ha + neem cake 1 t/ha +dolomite 1 t/ha yielded 0.94 t/ha under Sikkimcondition. Tephrosia leaf application (10 t/ha)showed 403 % increase in mustard seed yield overinorganic nutrient application (40:20:20 NPK)under Tripura condition.

Wheat genotype VL 804 was found promising(2.28 t/ha). Promise was identified as suitablegladiolus variety with good spike length, florets/spike and post harvest life.

Khasi mandarin grafted to different root stockswere evaluated for different physico-chemicalproperties. Groundnut was identified as bestintercrop with Khasi mandarin. At ArunachalPradesh, juice content and TSS of Khasi mandarinwas high with FYM and pig manure compared topoultry manure. Spacing trial indicated that 3 x 3m spacing was best for higher fruit weight and juicecontent. Micro propagated, 10 year old Khasimandarin plants being grown at the ArunachalPradesh centre were found uniform in height withsimilar shape fruits having good keeping quality.For Sikkim, Hayward was identified as suitableKiwi variety (1.22 t/ha) in which manualpollination gave maximum fruit set.

Two varieties of pineapple ‘Maurititus’ and‘Amrita’ were introduced in Tripura. Fruit size wasbigger in ‘Maurititus’ and the variety was early.But fruit quality of ‘Amrita’ was better. Lightintensity was found to influence flowering andfruiting percent. In strawberry 100:60:120 NPKwith 30 x 30 cm spacing was found best. In peach75% pruning on 30th October induced 12 daysearly fruiting. A hyperparasite of papaya powderymildew, Cladosporium cladosporioides wasidentified. At Sikkim centre, Chandler was the beststrawberry variety in both open and polyhousecondition. However, fruit quality was better inpolyhouse cultivation. September transplanting andmulching with Sacchrum sp. gave maximum yield.Improvement of under-utilized fruits wasattempted. In Sohiong, tongue grafting was mostsuccessful (70%). In Myrica fruit weight rangedfrom 9.75 to 15.25 gm.

Evaluation trials with various vegetablesidentified Megha Brinjal 2 (41.0 t/ha) as promisingbrinjal genotype. Evaluation of quality charactersof carrot identified ST 14 as the best genotype. Aphoto-insensitive dolichos bean RCDL-10 (14-15t/h) identified at Umiam is suitable for April –November sowing. From among 25 advancedtomato lines tested at Manipur centre, MCTR7Bwas promising (41.7 t/ha). However, Sel. 9A andSel 7 were the best genotypes at Manipur andyielded 42.5 t/ha. Sel 1 was early maturity brinjalline at Nagaland with good fruit length althoughyield of Sel 1, Sel 3 and Sel 4 were at par (20.5 –21.7 t/ha). Gowri was identified as the best orange-fleshed sweet potato variety for the region. Bahar(40 t/ha) was identified as suitable cabbage varietyfor Sikkim and highest yield was obtained whenplanted in October. Cauliflower variety ‘Suwashini’and broccoli var. ‘Aishwarya’ were also foundsuitable for Sikkim.

Tomato genotypes BT-1, LE 1-2, MeghaTomato–1, Megha Tomato–2 and brinjal genotypeRCMBL-3 were found as resistant to bacterial wiltat Umiam. At Tripura centre, bacterial wilt was highin tomato genotypes Sel – 1 and low in CKVT –17, Arka-Abha. Arka Abha showed less leaf curlinfection. During rainy season, brinjal genotypeSingnath was least affected by wilt and wasresistant upto 3 months. In winter season the variety‘Jhuri’ was the best in disease reaction and yield.


Two new insecticides, Novaluron and Spinosadwere found as effective against different instars ofPieris brassicae. In cabbage 50% inorganicfertilizer + 50% vermicompost improved yield andquality at Mizoram. At the Nagaland centre,vermicompost (3.5 kg/m2) was identified as bestsource of organic fertilizer for yield and quality ofcabbage and tomato. Cutworm, semilooper and redants were major pests of the Cole crops at Sikkim.

Experiment with onion genotype N-2-4-1showed that 75% N + biofertilizer Azospirilum andAzotobactor improved yield and induced neckfallearly. It was established that reduced nitrogen canbe used as a strategy in high rainfall areas to induceearly neckfall.

Gerbera cultivation under 50% shade net wasbetter than 75% shade net and produced 7.20flowers/plant. Nine lines of gerbera weremoderately resistant to powdery mildew of whichRCG – 3-showed highest resistance. Twenty sevendifferent wild species were collected fromMeghalaya and established in pots. Bio-organicformulation GF1 was effective in controlling gingersoft rot.

Post harvest management studies wereconducted for fruits and spices. For peach nectarpreparation, pulp and TSS content of 47.86% and32.0%, respectively were found most desirable.Pre-harvest treatment of strawberry with 2% CaCl2reduced weight and decay loss while spraying with2% K2SO4 increased TSS, total sugar and ascorbicacid. Packing of broccoli in LDPE (200 gauge)without perforation reduced weight loss to 0.97%after eight days compared to 50% loss in control.

Under technology mission seed and plantingmaterial of citrus, passion fruit, tomato, Frenchbean, strawberry, mushroom spawn, banana andturmeric were produced and supplied. ‘Kaveri’ wasidentified as the best variety for Manipur. Optimumspacing for the variety was 3 x 2 m.

Two strains of oyster mushroom (P. sajor-caju)PSC – 05 and Code 01 (P. florida) were identifiedas promising. Three species of mushroom werefound suitable for Tripura condition. Paddy strawmixed with blackgram pod shell was identified asa good substrate. An interesting observation wasmade in paddy straw mushroom. Under Tripuracondition when cultivated on paddy straw cubes,all fruit bodies were formed in a flush of 1-3 days,which is uncommon for tropical conditions.

Among the different rodenticides tested for fieldapplication, zinc phosphide placed in bamboo baitstations was the most effective and consumptionranged from 16.05 – 17.80%.

Water quality from various water sources inMeghalaya was analyzed. Water from majority ofthe sources in Meghalaya was acidic, low in K,Na, S, Ca, Mn, nitrate N and carbonate content wasclassified as none. In Tripura water pH ranged from6.1 – 7.68 and nitrate contamination was high.Training on Jalkund and in-situ soil moistureconservation were taken up.

A rapid soil health testing kit for acid soils wasdeveloped, demonstrated and distributed. Soilhealth cards based on soil analysis were introduced.Total 539 samples were collected and 132 cardswere made ready till reporting at Tripura centre.

Grasses like Setaria, Congo signal and Makunaimproved soil physical properties under long-termcultivation, reduced soil erosion by 33% andimproved carbon sequestration. Conservationtillage was found superior for upland rice, mustard(41% increase) and pea (36% increase).

In agroforestry systems, after 14 years ofplantation, G. robusta attained average height of12.21 m and 12.98 cm dbh. Under G. robustapineapple production was 16.5 t/ha. A medicinalplant garden with 35 species was established atUmiam.

Financial viability study of ornamental fishfarming and Jalkund indicated both to be attractivewith 1.31 and 1.61 benefit: cost ratio, respectively.Rice varieties Bhalum – 1, Bhalum – 2,Shahsarang-1, Ranjit, were identified as promisingfor improving yield of marginal rice landscape ofMeghalaya. Economic evaluation of aquaculture-based farming systems in Manipur identified lackof institutional credit, high construction cost andlack of scientific fish culture methods as majorconstraints.

Farm machines like light weight power tiller,pre-germinated paddy seeder, manual paddytransplanter, etc. were tested. Lightweight powertiller holds promise for the hilly terrain. Acardamom dryer with diesel fuel based heatexchanger was developed. Drying at 55- 60oC wasfound to be the best choice. A storage bin withcharcoal as desiccator was also designed for seedstorage at farmers’ field.


Study on the variations in uniformity and areacovered in sprinkler irrigation was undertaken.Although the area covered by the 6th sprinkler was55% less than the first sprinkler and discharge wasalso least in the last sprinkler, there was nodifference in uniformity constant. Assessment ofthe watershed development programme indicatedthat participatory implementation programme withgender based technologies combined with follow-up programmes is the best method for effectiveextension of the technology.

The institute continued its efforts to formulatebalanced feed from local resources. Annual legumefodder like ricebean (RCRB-10), soybean (MOUS-98-2), annual winter fodder like oat and perennialfodder like parari and broom grass were identifiedas good fodder sources. Sweet potato cultivar‘Sankar’ was also identified as good animal feedwith better dry matter, digestible energy andproteins yield. Evaluation of rice bran-based rationfor piglets indicated that the local rice bran waslow in quality and can be used upto 25% in rationfor somewhat acceptable growth. Maize stover-napier-jungle grass silage was identified as goodsilage for non-pregnant, non-lacting sheep.Supplementation of spent malt in maize stover-nevaro based ration increased nutrient utilizationin these sheep. Spent malt supplementation inricebean-based ration in cow showed beneficialeffect on milk production. Study of methaneproduction from local fodder of Sikkim indicatedthat Amlisho and Kimgoo produced lowest quantityof methane under in-vitro condition.

Evaluation of fresh and frozen semen usingzona-binding assay indicated that binding abilitywas significantly reduced from 0 to 24 h in frozensemen and sperm mortality and acrosome integritywere positively correlated. Significant correlationof mortality was also observed with genetic group,age and season. Digestive disorders were the majorcause of mortality.

Small holders low input pig production systemwas analyzed and various input-output flows wereidentified. Mineral profiling of pig feed and pigsindicted that high level of Spilanthus sp. (weed)had high level of majority of the macro andmicronutrients.

However, majority of the pigs were deficient incalcium, phosphorous, sodium, magnesium and

potassium. Interestingly 100% of the pigs weredeficient in Zinc. Testicular abnormalities,brucellosis, swine fever were also prevalent.

Productive and reproductive performances ofAssam hill goats were studied. Supplementationof soybean or ricebean with broom grass improvedavailability of nutrients in goats. A simple andsensitive enzyme immuno assay method fordetermination of LH in goat plasma was developed.An ultra-sonographic method for examiningreproductive organs of goats was also developed.

In case of poultry, rearing of Mizo local birdsupto 12 weeks gave a calculated net return of Rs.30.35 / bird. In broiler chicken, water solubleadjuvant fraction of M. phlei @ 10 mg/kg bodyweight was successfully used as immunostimulator.

Molecular phylogenetic study with indigenouspoultry and livestock indicated various levels ofsequence divergence in the cytochrome b gene.New Zealand white and Soviet Chinchilla breedsof rabbit showed highest (7.9%) sequencedivergence. Turkey birds were introduced in theregion. Molecular diagnosis of several diseases ofpoultry and livestock viz. Salmonellosis,Mycotoxicosis, Clostridium perfringens infection,Collibacilosis etc. were developed. Occurrence ofzoonotic organisms in livestock and poultryproducts were identified using moleculartgechniques. PLCR based identifiction of GIparasitic infections (Haemonchus,Oesophagostomum and Bunostamum) wasstandardized. Staphylococcus, Streptococcus andE. coli were major pathogens in clinical milksamples from Sikkim.

Injection of 1.0 ml Wova FH/Kg body weightwas best for egg stripping, fertilization andhatching. In Labeo bata, Ovaprim and Ovatideenhanced egg laying. Ovaprim was more efficientthan Ovatide.

The institute provided training to farmers,trainers, officials of line department and postgraduate students from universities outside theregion. The institute also provided course work andresearch facilities to the students admitted in 5disciplines of Central Agricultural University.Facilities for hostels, research field and laboratorieswere also provided.


ICAR Research Complex for NEH Region isproviding service for the last 32 years to furtherthe cause of agricultural development in NorthEastern Hill region. The Institute was set up in 1975at Shillong, Meghalaya under the aegis of ICAR,an apex body for agricultural and allied sectorresearch in the country.

The research complex carries out research inall the disciplines of agriculture and allied scienceslike crop science, horticulture, animal science,farming systems research, agroforestry, fisheries,social sciences and agricultural engineering foroverall growth of agriculture in the region. Thecomplex has one centre each in every hill state ofthe region located at Lembucherra (Tripura),Kolasib (Mizoram), Imphal (Manipur), Basar(Arunachal Pradesh) and Tadong (Sikkim) with itsheadquarters at Umiam (Meghalaya). One KVK isalso attached to every centre of the institute (exceptMizoram) to disseminate the technology generatedthrough research under taken by it. In addition, theinstitute provides logistic and academic support tothe CPGS of Central Agricultural University.

Headquarters of the institute’s is located atUmiam, about 22 km from Shillong, covering anarea of about 101 hectare with a mild to steep slopeand flat valleys. At present, the area undercultivation is around 70 ha. Research work of theinstitute is carried out in 16 disciplines belongingto agriculture, NRM animal sciences, fisheries andsocial sciences. The institute has a very strongextension activity and through its 12 KVKs pursuewide and effective technology dissemination.

During the last 33 years of its existence theinstitute major contributions were:

- Development of seven alternate farmingsystem models to replace shifting cultivationand three IIFS models for increasingcropping intensity.

- A model for efficient use of marshy land byconverting it to alternate raised and sunkenbeds.

- Micro rainwater harvesting structure for hills

and its popularization to improve wateravailability during lean season.

- Varieties of hill rice, tomato, turmeric.- Location specific management practices,

cropping sequences, crop combinations etc.for cereals, pulses and oilseeds.

- Soil health management options andschedules supported by software formanaging acidic soils.

- A farmer friendly, low cost soil health testingkit for acid soils.

- A large collection of plant and animalgermplasms including database for butterfly.

- An improved variety of crossbred pig with87.5% exotic blood.

- Feed formulations based on locally availablefodder resources.

- Technologies for composite fish culture,paddy-cum-fish culture, breeding of fishesincluding local and ornamental fishes.

- Database on weather parameters, ITK,medicinal plants, soil nutrient status of somecomponent states.

- Farm implements, tools and machineryspecially situated to hill agriculture.

Although the institute has started working inthe modern areas of biotechnology, moleculardisease diagnosis, GIS based mapping etc., its focusremained on natural resource management anddevelopment of pro-poor low-cost technologies.NAIP on livelihood improvement throughsustainable farming system was launched in onemost backward district of each component state.Seed and planting material was given high priorityand in house as well as external resources weregeared up for its production. Keeping in view thetrend in rainfall deficit and temperature rise,research on efficient rainwater harvesting andmitigating effects of climate change were initiated.Technology development for cryopreservation ofboar semen was vigorously pursued and it isexpected that within a short time piglets from AIwill be produced in the farmers’ field.

INTRODUCTION


Budget(in lakh)

Budget Allotted Expenditure

Plan 670.00 669.00Non-Plan 2355.00 2350.37

Human ResourcesThe staff position during the period under report

was as under

Main Institute

Category Sanctioned Filled VacantR.M.P. 7 6 1Scientific 184 112 72Technical 255 237 18Administrative 133 122 11

KVK

Category Sanctioned Filled VacantScientific 11 4 7Technical 121 99 22Administrative 22 12 10Supporting 22 22 0

Library

Nature of Journal No. of copies Available

Books and reports 21481Back issues 11,063Foreign journals 75Indian journals 85Hindi books 2035

Computer facilitiesComputer facilities are available as per the need

and requirements of various divisions. The institutehas a rich computer database of library resources.It also provides computerized database onenvironmental degradation and meteorologicaldata. A website has been developed giving detailsof every activity of the institute. Accounting systemof the institute is fully computerized.

IMPORTANT EVENTSNAIP on “Livelihood Improvement andEmpowerment of Rural Poor throughSustainable Farming Systems in North EastIndia”

The National Agricultural Policy and the TenthFive Year Plan for the country placed high priority

Mandate- To undertake basic and applied research for delivering technologies based on sustainable farming

system for different agro- climatic and socio-economic conditions.- To improve the productivity of crops, livestock and fishery.- To act as a repository of information on natural resources, different farming and land use systems.- To impart training in research methodology and application of improved technologies for

enhancing agricultural productivity.- To collaborate with the state departments for agricultural development in the region and testing

and promotion of improved farming and land use systems.- To collaborate with national and international agencies.- To provide consultancy.

Thrust Areas- To evolve sustainable integrated farming systems to replace jhum cultivation for increased

productivity.- Restoration of degraded/ jhum fallow lands through tree based farming.- Development of feed and fodder resources including locally available fodder for livestock.- Improvement of citrus plantation to rejuvenate the citrus industry.- To increase the overall productivity of different crops through research in cereals, pulses, oilseeds,

horticultural crops, fisheries and other economical crops.- Animal health coverage and improvement of livestock production system.


on raising agricultural productivity as a means toachieving rapid agricultural growth and reducingrural poverty. Stagnating / decelerating productivityin agricultural growth and declining total factorproductivity in agriculture have cast doubts on theresilience of the rural sector in meeting thechallenges of food security and market drivendemand and supply in the competitive regime. Toaddress these challenges and to generate additionalincome and employment for the rural poor, the roleof agricultural research and development is critical.Another notable feature of agriculturaltransformation is the growing regional disparity indevelopment. Disadvantaged regions did not gainmuch from the development efforts. In thisdirection, the Planning Commission of Indiaidentified 150 disadvantaged districts in the countryto put extra emphasis for the development of theseareas. The National Agricultural Innovation Project(NAIP) of ICAR is an attempt towards thisdirection. The Project on “Livelihood Improvementand Empowerment of Rural Poor throughSustainable Farming Systems in North East India”under Component-III (Sustainable Rural

Livelihood Security) of NAIP was launched on 6th

August, 2007 for implementing in the systemdisadvantaged districts of NEH states (ArunachalPradesh, Meghalaya, Mizoram, Manipur,Nagaland, Sikkim and Tripura). The project hasan outlay of Rs. 22.41 crore under consortiummode. The seven disadvantaged districts in theNEH states chosen for the NAIP Project are SouthGaro Hills (Meghalaya), Upper Subansiri(Arunachal Pradesh), Mon (Nagaland), Saiha(Mizoram), Dhalai (Tripura), North Sikkim(Sikkim) and Tamenglong (Manipur). Theprogrammes in the project include improvedpackage of practices for enhancing cropproductivity, farming system approaches, waterharvesting and multiple use of water, post-harvestprocessing and value addition and strengtheningof SHGs for livelihood improvement of the poorfarmers in an integrated manner.

Annual Review and Planning Meeting ofPartners of IRRI Collaborative Project

Three days Annual Review and PlanningMeeting was held on 26-28th March 2008 at ICARResearch Complex for NEH Region, UmiamMeghalaya, under International Rice ResearchInstitute (IRRI), Philippines collaborativeprogramme “Managing Rice Landscapes inMarginal Uplands for Household Food Securityand Environmental Sustainability”. Sixreprentatives of two institutes from Nepal, 5reprentatives from AAU, Jorhat and 1 reprentativefrom IRRI, Philippines and two scientists fromICAR Research Complex for NEH Region,Barapani, Meghalaya participated in this meeting.Research development and future strategies of thiscollaborative project have been discussed.

LinkagesTo provide advisory services to the line departments of central and state government, public sectorundertakings and NGOs, the institute remains in touch with these departments and meetings/ trainingsare regularly organized. Biennial interface meetings are held at the institute to discuss various problemsof agriculture and related matters for research and development with the departments of agriculture,horticulture and animal husbandry and fisheries of the respective state governments of the region. Theinformation generated through research is disseminated to farmers through line departments, off farmresearch, kissan melas, field days and front line demonstrations (FLDs).The institute also provides logistics and academic services to the College of Post- Graduate Studies,Central Agricultural University, Umiam, Meghalaya .

Hon’ble Chief Minister, Meghalaya Dr. D.D.Lapang and other dignitaries in launching

workshop of NAIP


HEAD QUARTERSMEGHALAYA


The trend of different weather parameters e.g.air temperature, rainfall, evaporation, wind speed,Wind direction, relative humidity, bright sunshinehour etc. recorded daily at ICAR, Umiam at 0622hr, 0830 hr and 1322 hr during Jan-Dec’08 are asfollows:

AIR TEMPERATUREThe mean monthly maximum temperature

varied from 19.70C in the month of January to29.70C in the month of April and 28.50C in themonth of May to 22.10C in the month of Dec. April

was the hottest month than the others. Highestmaximum temperature recorded for a single daywas 31.50C on 9th August and lowest 13.40C on 25th

January. Mean monthly minimum temperaturesrecorded varied from 6.80C in the month ofFebruary to 20.40C in the month of July. Meanmonthly minimum temperature started rising fromFebruary to July and then started declining andrecorded lowest 1.90C on 2nd February. Minimumtemperature was recorded highest 21.50C on 19th

April and 11th July. The Fig. 1 shows the variationin mean maximum and minimum temperatureduring Jan-Dec 2008.

WEATHER

Table 1. Meteorological data for the year 2008 recorded at ICAR, Umiam

Months Jan Feb Mar Apr May June July Aug Sept Oct Nov Dec

Mean max temp (oC) 19.7 20.3 26.1 29.7 28.5 27.9 28.0 27.8 28.1 26.5 24.2 22.1Mean min temp (oC) 7.3 6.8 11.8 15.7 17.2 19.6 20.4 20.2 18.9 15.9 10.1 9.1Mean morning RH (%) 76.8 62.5 58.3 60.4 78.2 86.4 90.7 90.1 86.4 85.1 78.1 82.5Mean afternoon RH (%) 60.6 58.6 49.5 53.1 72.0 77.0 72.9 73.7 73.8 70.7 55.9 60.3Mean wind speed (km/hr) 2.9 3.2 4.6 4.6 3.1 2.5 2.2 2.4 2.2 2.2 2.4 2.1Mean cloud cover 4.4 3.2 4.5 4.0 4.8 6.3 6.6 6.3 4.6 4.3 3.1 4.5Total sunshine hours 6.3 6.8 5.7 7.7 6.0 3.7 2.9 3.0 4.4 NA NA NA Total rain (mm) 34.3 4.7 69.7 58.4 296.2 345.3 285.4 426.1 401.5 228.5 36.4 19.3Total rainy days 3.0 5.0 10.0 9.0 26.0 25.0 28.0 30.0 24.0 24.0 1.0 3.0Mean water temp (oC) 10.5 10.7 16.3 20.7 20.7 22.4 22.3 21.6 21.3 18.8 14.9 12.6Total evaporation (mm) 32.2 32.7 65.9 90.3 66.1 44.2 46.6 46.5 55.3 48.5 38.3 31.0Mean evaporation(mm) 1.5 1.6 3.0 4.3 3.0 2.1 2.1 2.1 2.6 2.2 1.8 1.4

NA=not available


RAINFALL AND RAINY DAYSTotal rainfall received during January to

December at Umiam was 2205.8 mm distributedover 188 days. Yearly rainfall was about 891.1 mmless than last year (3096.9mm) and about 193.9mm less than yearly normal rainfall (2399.7mm)but number of rainy days (60) were more thannormal. Rain occurred almost every monththroughout the year ranging from 4.7 mm in themonth of February to 426.1 mm in the month ofAugust. More than 90% (1983mm) of rainfallreceived during May to October. Highest amountof rainfall for a single day were recorded 92.3 mmon 22nd Spetember The Fig. 2 shows variabilitytrend of rainfall, evaporation and rainy days during2008.

EVAPORATIONEvaporation was measured by a USA-Class A

pan evaporimeter. Total evaporation was highest90.3mm in the month of April. Evaporationrecorded in a single day was highest 6.0 mm on

19th April and lowest 0.4 mm on 17th February.Evaporation was higher than the rainfall duringJanuary and October month whereas rainfall washigher than the evaporation during rest of themonths. This indicates the soil moisture stress onlyduring January and October The total evaporationduring January to December was 597.6 mm, whichis 256.0 mm less than the previous year (853.6.mm)and 458.9 mm less than the yearly normalevaporation (1056.5.mm). The Fig. 3 showscorrelation of daily evaporation with the variationof wind speed and water temperature at ICAR,Umiam.

WIND SPEED AND DIRECTIONMean monthly wind speed ranged from 2.1 km/

hr in the month of December to 4.6 km/hr in themonth of March and April.. During the rainy seasonwind was blowing at 2.2 to 2.5 km/hr, sometimesgone upto 17.6kmph on 27th April. For a single daymean wind speed was 5km/hr and above for 16days and above 10km/hr for 3 days out of 365days.


The wind speed was not significantly high to poseproblems to any crop throughout the year. Meanwind direction during 2008 was mostly blown fromthe Easterly to South easterly direction in themorning hours and South westerly to westerlydirection in the afternoon hours.

RELATIVE HUMIDITYRelative humidity at 0830 hr at Umiam was

highest 98% on 15th July and 27th October, and thelowest 28% on 8thMarch. The relative humidity wasbelow 50% in the morning hours during Februaryand March months. Relative humidity recorded inthe evening at 1322hr was varying from 49.5% inthe month of March to 77% in the month of June.The Fig. 4 shows the variations of relative humidityduring morning and afternoon of 2008 with respectto temperature.

SUN SHINE HOURThe mean sunshine hour at Barapani ranged

from 2.9hrs in the month of July to 7.7hrs in themonth of April. The highest was recorded 9.8hrs/day on 19th April. The correlation betweensunshine, cloud cover and rainy days are depictedin Fig. 5. A linear correlation was found with cloudcover rather than rainy days.

SOIL TEMPERATUREIn the morning hour the mean soil temperature

ranged from 13.1 to 24.50C and from 13.7 to 24.70Cat 5cm and 10cm depth of soil respectively. In caseof sub surface soil, the mean temperature rangedfrom 14.2 to 25.60C and 15.1 to 26.50C at 20cmand 30cm depth of soil respectively. The soil tempvariations at different depths during morning hoursare shown graphically in the Fig. 6.


In the afternoon hour the mean soil temperatureranged from 21.5 to 30.70C and from 19.0 to 29.6at 5cm and 10cm depth of soil respectively. In caseof sub surface soil, the mean temperature ranged

from 18.0 to 28.20C and 16.1 to 26.70C at 20cmand 30cm depth of soil respectively. The soil tempvariations at different depths during afternoonhours are shown graphically in the Fig. 7

Table 2. Soil temperature variations at different depths during morning hours

Soil Monthsdepths

Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec

5cm 13.1 15.7 20.0 21.5 23.1 24.5 24.5 24.5 24.0 22.1 19.1 16.210cm 13.7 14.0 18.4 21.5 23.2 24.6 24.7 24.7 24.2 22.3 19.4 16.520cm 15.0 14.2 18.1 21.9 24.5 25.5 25.6 25.6 25.4 23.6 20.6 17.730cm 15.8 15.1 18.4 22.3 25.2 26.0 26.5 26.5 26.1 24.3 21.3 18.4

Table 3. Soil temperature variations at different depths during afternoon hours

Soil Monthsdepths

Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec

5cm 21.5 22.0 27.1 32.4 30.7 29.3 30.1 29.6 29.5 27.9 26.8 24.610cm 19.0 19.6 24.7 29.6 28.8 28.4 28.9 28.6 28.3 26.9 25.3 22.120cm 18.0 18.2 22.9 27.2 27.6 27.7 28.2 27.9 27.5 26.1 24.2 20.230cm 16.1 17.6 19.8 22.7 25.6 26.3 26.7 26.7 26.3 24.6 21.5 18.6


RESEARCH ACHIEVEMENTS

CROP SCIENCE

RICE

UPLAND

Evaluation of segregating generationsEighteen F1 crosses obtained from line x testers

mating design involving Bhalum 1, Bhalum 2 andRCPL 1-46 as lines and six other genotypesreceived from similar altitudes of rest of the countryviz., VL Dhan 85, VL Dhan 207, VL 3400 and VLSKAU 23 and SKAU 27 as testers were evaluatedin two replications. The crosses involving Bhalum1 were found to be superior to other crosses andtheir parents.

Identification of suitable upland genotypes forkharif season

Research Complex Regional Trial (RCRT) wasconducted with seven genotypes along with twochecks under upland condition at Umiam. Superiorentry identified from this trial is RCPL 1-115 (aselection from IR 755502-24-1-1-B). The genotyperecorded significantly higher yield than best checkBhalum 1. The entry registered significantlysuperior performance than the best check Bhalum1 consistently for last three years. From the AllIndia Coordinated Rice Improvement Project(AICRIP) one trial AVT (UH) was conducted andsuperior entries recording significantly higher yieldthan the best check Bhalum 2 were VL 30240, HPR2363 and Sukaradhan (Table 1).

Identification of weed competing genotypes forupland

Forty-two cultures of advanced generation wereevaluated for weed competing ability in rain fedupland situation. Only one hand weeding 14 daysafter sowing was done for no weeded plots whilefor weeded plots standard weed control proceduresrecommended for upland rice were followed.

Among the cultures evaluated, RCPL 1-129 showedbetter weed competing ability because of its fastinitial growth and greater canopy cover. Thisculture had well developed root system with 4-6tillers and 200 – 250 grains per panicle with morethan 80% spikelet fertility under no weededcondition. It matures in 140 days and gives apotential yield of 3.0 – 3.5 t/ha. For the culturesRCPL 1-79, RCPL 1-85, RCPL 1-93, RCPL 1-97and RCPL 1-106 with relatively low yield, therewas no significant difference between the controlplot and weeded one for the cultures. The cultureswhich recorded higher yield than the best checkBhalum 1 in no weeded plots were RCPL 1-129,RCPLL 1-180 and RCPL 1-82. RCPL 1-129 wasalso tried in farmers field under upland unterracedcondition and was found to yield better thanBhalum –1 due to late maturity avoided birddamage.

LOWLAND

Crossing programmeCrosses were done in dialel mating design

involving RCPL 1-159, RCPLL 1-121, Chakhou,Moirangpahou, Shasarang, IR 64, Daya and CR30.

Table 1. Superior rice genotypes identified forupland

Rank Genotype Yield Duration(t/ha) (days)

RCRT - Upland1 RCPL 1-115 4.17 1332 RCPL 1-117 3.29 1303 RCPL 1-113 3.15 1394 RCPL 1-116 0.75 128

Best check (Bhalum- 1) 3.64 128CV = 11.2%

AVT (UH)1 VL 30240 3.89 1162 HPR 2530 3.83 1333 Sukaradhan 3.81 119

Best Check (Bhalum 2) 3.42 132CV = 9.9%


Identification of suitable genotypes for kharifseason

Three Trials viz., RCRT-Lowland (LL), RCRT-Aromatic rice (AR) and RCRT-Fine grain (FG)were conducted. Among the entries tested, RCPL1-126 from RCRT – LL, RCPL 1-72, RCPLL 1-160, RCM 16 and RCPL 1-73 from RCRT-AR andRCPL 1-118, RCPL 1-76, RCPL 1- 73 and RCPL1-75 from RCRT-FG were found promising andtheir performance during the last three year wasconsistent (Table 2).

Table 2. Superior rice genotypes identified forlowland

Rank Genotype Yield Duration(q/ha) (days)

RCRT – LowlandRCPL 1-126 52.66 140Best Check (Lampnah 1) 49.92 155

CV=7.5% CV=7.5%

RCRT-Aromatic rice1 RCPL 1-72 56.58 1502 RCPL 1-160 55.38 1503 RCM 16 45.72 1554 RCPL 1-73 43.82 155

CV = 8.5%

RCRT – Fine grain rice1 RCPL 1-118 43.96 1562 RCPL 1-76 42.58 1563 RCPL 1-73 40.76 1584 RCPL 1-75 40.28 145

CV = 9.3%

Thirteen homogenous populations were testedalong with the checks in the preliminary yield trial.Among them, two cultures viz., RCPL 1-149 aderivative of the cross IR 61979-1-3-2-2-1/UPR1425-1-4 and RCPL 1-150 a derivative of the crossNgoba/IET-16470 were superior to the local checkShasarang 1. From the AICRIP, three trials viz.,AVT – Irrigated Early (IE), IVT-IE and IVT-IM(Irrigated Medium) on varieties and two trials viz.,Initial hybrid rice trial (IHRT) and multi-locationtrial on released hybrids were conducted. Superiorentries recording significantly higher yield than thebest checks were presented in the Table 3.

Table 3. Superior varieties/hybrids identifiedthrough AICRIP trials for lowland

Rank Genotype Yield Duration(kg/ha) (days)

AVT (IE)- Hills1 SKAU 354 41.65 1242 HPR 2336 40.13 1353 Vivekdhan 82 38.56 1244 VL 30424 37.09 129

Best Check (Lampnah 1) 35.98 144CD 5% - 4.61CV = 10.8%

IVT (IE)- Hills1 HPR 2309 37.66 1342 RP 2421 35.00 1253 HPR 2177 34.06 130

Best Check 33.98 147CD 5% – 5.8CV = 9.3%

IVT (IM) Hills1 RCPL 1-71 42.60 1512 Vivekdhan 82 41.68 1343 UPR 5005-36 41.40 133

Best check (Shahsarang 1) 41.28 149CD 5% - 4.85CV = 9.8%

IHRT1 27P11 54.14 150

Best Check (Shahsarang 1)50.48 160

MLT on released hybrids1 KRH 2 64.34 1452 PSD 3 59.32 1453 Lampnah 1 56.62 150

CD5% – 5.1CV = 8.2%

Advancement of segregating generationF3 populations of the crosses involving four

genotypes viz., Lampnah, Shahsarang, Nagalandwonder rice and LAB-PG 520 (an early mutantderived from anther culture) were evaluated forhigh yielding and early maturity in rain fedlowlands of Meghalaya. Among the 92 F+ familiesevaluated, 79 have been selected for furtheradvancement. Twenty-seven families each of sixcrosses in F6 generation were evaluated and totaltwenty-seven families were advanced to furthergeneration. These families were selected andincluded in the station trials to be conducted inkharif 2008.


Collection, evaluation and characterization ofgermplasm

An exploration to collect rice germplasm wasmade during 8th to 19th December 2007 toSonitpur, Lakhimpur and Dhemaji districts ofUpper Assam and East Siang and West Siangdistricts of Arunachal Pradesh. Number of ricegermplasm collected from different districts ispresented in Table 4.

Table 4. Rice germplasm collected during 2007– 08

State District Number of accessioncovered collected

Assam Sonitpur 22Lakhimpur 19Dheemaji 17

Arunachal Pradesh East Siang 25West Siang 25Total 108

Germplasm characterization and developmentof core collection

Four hundred and forty three accessions ofupland and 391 accessions of lowland germplasmwere grown. Data were collected for 14 quantitativecharacters in both ecosystems. Traits evaluatedwere leaf length, leaf breadth, number of leaves,plant height, flag leaf length, flag leaf breadth, daysto 50% flowering, tillers/hill, EBT/hill, paniclelength, spikelets/panicle, spikelet fertilitypercentage, 1000 grain weight and single plantyield.

The phenotypic coefficient of variations (PCV)were higher for flag leaf length, flag leaf breadth,leaf number, tiller number, spikelets / panicle,spikelet fertility percent in the upland accessionswhile in the lowland accessions only leaf breadthand spikelet fertility percentage showed high PCV.GCV also showed similar trend. Genetic advancewas high for plant height, leaf length, flag leaflength, days to 50% flowering, spikelets/panicle,1000 grain weight and single plant yield.

From the above set of germplasm a corecollection was constituted following a stratifiedrandom sampling strategy. Hierarchical cluster

analysis produced 15 clusters in both upland andlow-land ecosystem. Six clusters in lowland andfour clusters in upland were single accessionclusters. Following a logarithmic strategy 40accessions in lowland and 45 accessions in uplandwere included in the core collections. Thepercentage of range retention ranged from 46.72(1000 grain weight) to 100 (filled grains/panicle)in upland and 57.69 (leaf breadth) to 100 (filledgrains/panicle) in lowland core collection. Averagerange retention was 87.93% in upland and 85.33%in lowland core collection.

Based on grain yield/plant, Majhera 3, RCPL3-5, IR71524-44-1-2, Sungmangtsuk, Epyo,Nkiapeau and Yimyu for upland and Lelhati,Lapyagaol, Pusa33, Punsi mutant, Paijong, RCPL1-5P, UPR89-1190, Sawar, Mitonggijing, Jahanjia,Rangboa, Ikorbao, Kalobordhan, Budomoni, Jowaiearly, Xiang Zhong Xian for lowland wereidentified as lines having potential for contributingtowards yield enhancement of improved varieties.

COLD TOLERANT RICE

Identification of the high yielding cold tolerantrice genotypes

Under the low land ecosystem of high altitude,AVT including 17 test entries and three checkvarieties viz. Khonorullo, Megha rice 1 and Megharice 2 was conducted at two different date of sowingi.e. 17.4.07 and 16.5.07. Transplanting was done40 days after sowing of nursery. From the results,it was found that three entries viz., RCPL 1-81c (aselection form IRCTN 91-95), RCPL 1-80 c (aselection form IRCTN 91-57), RCPL 1-79 (aselection form IRCTN 91-104 ) gave significantlysuperior yield over the best check Khonorullo ontimely sowing. RCPL 1-71c and RCPL 1-79 gaveyield at par with the best check on late sowing.

Advancement of segregating generationsTwenty-two families of ten crosses viz., Newli

/ Nonglwai, Megha rice 2 / RCPL 1-7c, Nonglwai/ RCPL 1-7c Megha rice 2 / Newli RCPL 1-3C /RCPL 1-7C , Megha rice 2 / Nonglwai, RCPL 1-3c/ Newli, Newli / Megha rice 2, RCPL 1- 7c /Nonglwai and RCPL 1-7c / Megha Rice 2 in F4


generations were evaluated for cold tolerance alongwith their parents. Fifteen superior families wereselected for further advancement.

Developing a mapping population foridentifying the QTL of cold tolerance

To map the QTLs of putative traits of coldtolerance, IR 64 / RCPL 1-3c was selected fordeveloping a mapping population through singleseed descent method. One seed each from twohundred F2 plants were selected and advanced toF4.

Rice quality analysis

a) Physical, cooking and processingqualities: Twenty cultivars from Meghalayawere studied for physical, cooking andprocessing qualities. Grain length rangedfrom 5.05 to 7.76 mm and breadth from 1.99to 3.08. L/B ratio varied from 1.76 to 3.48.100-kernel weight was highest inShahsharang and Bhalum – 2 (2.2g) and leastin Nongfugu (1.6 g). Alkali spreading valuevaried from 2 to 7. Chalk content varied from11 - 99%. Head rice recovery ranged from16.7% to 69.8%. Milling percentage variedfrom 54.66 to 76.93. Volume expansion ratioranged from 3.75 to 6.8. Water uptake variedfrom 35 ml to 305 ml.

b) Proximate nutrient analysis: Eighteencultivars from Tripura were analysed forproximate nutrients. Total crude proteincontent ranged from 7.26% to 11.72%. Outof the 18 varieties 4 varieties were of highprotein types. Total carbohydrate contentvaried from 70% to 89.25%. Total fat variedfrom 0.67% to 1.4% and crude fibre from0.13% to 0.59%. Ash content ranged from0.32% to 1.34%. Amylose content variedfrom 4.2% to 30.1%.

c) Essential mineral content analysis:Essential mineral contents of 28 cultivarsfrom Manipur and Tripura were analysed.Fe content ranged from 4.9 ppm to 22.56ppm. Zn content varied from 1.4 ppm to 30ppm. Cl was absent in all the samples.Phosphorus ranged from 32 ppm to 165 ppm.

AGRONOMICAL PRACTICES

AICRP (Plant physiology)

Studies on photothermic indexing in riceTwenty cultures belonging to different duration

groups under normal and late sown conditions weretested with an objective to link a developmentalindicator for identifying the panicle initiation (PI)stage under different cumulative degree days(CDD) and cumulative nycto periods (CNP)conditions. Mean genotypic performance in termsof meeting the CDD and CNP requirements for PI,flowering and maturity, number of nodes on themother tiller and yield under both sets of conditionsinvestigated. The study revealed that, group wiselate duration types were contributing to asignificant reduction in yield and are sensitive toCDD and CNP variations. However, yield levelsof individual genotypes were in a range of 122-580 g/m2 for early sown set while it was 0-206 g/m2 for late sown set. Culture VL 30249 (580 g/m2),AS 06016 (504 g/m2), HPR 2530 (457 g/m2), andHPR 2336 (413 g/m2) were promising. On the otherhand, varieties other than Anjali (206 g/m2), IET19287 (19.7 g/m2) and NDR 2706 are sensitive tolate sown conditions for Umiam (Meghalaya). Itwas also tried to relate a developmental indicatorvariable i.e. no. of nodes on the main or mothertiller with PI stage. Total 3-5 node numbers werefound and it did not vary between the early andlate sown set and thus may serve as an indicatorfor assessing the PI stage.

Studies on N- Use efficiency in riceThe objective was to relate the influence of

nitrogen to the topological features of panicle forunderstanding yield improvement in high yielding,aromatic varieties and hybrids. Experimentalresults revealed that the number of primarybranches did not differ due to N treatmentconfirming that this character is more stable andgenetically controlled. As a result of N treatment,there was an increase in number of secondarybranches per panicle. Increase in the secondarybranches was 10% from native N level (control) to200 kg N/ha application. Maximum increase innumber of secondary branches was observed in


hybrid variety PA 6444 and lowest in aromaticvariety Pusa Basmati 1. An average number of 12grains per panicle increased due to N application.There was an increase of 20 panicles /m2

accounting to 8% increase in grain yield. HybridPA 6444 had 58% higher grain yield than that ofPusa Basmati-1. Present study clearly indicatedthat, the number of secondary branches may beimproved by management practices and is largelygoverned by environment, whereas primarybranches are determined by genetic background ofthe cultivar.

Effect of stand establishment method andplanting geometry on productivity of lowlandrice under in-situ fertility management

A field experiment was conducted under in-situsoil fertility management in lowland rice since. Allthe crop and weed residues were incorporated intothe field time to time and only economic portionof grain was removed from the field. No externalinput whatsoever was applied to the field. Threeestablishment method i.e. SRI, ICM and standardpractice were adopted with time planting geometryi.e. 20x25, 20x20 and 20x15 cm. Result indicatedthat ICM with 20 days old seedlings and 20x20cm spacing recorded the highest grain yield closelyfollowed by modified SRI i.e., 10 days seedlingwith 20x20 cm spacing and modified ICM with25x25 cm spacing. Among various geometry instandard practice, modified geometry i.e., 20x20cm recorded the highest yield (4.9 t/ha). In case ofclose spacing of 20x15cm, SRI establishmentmethods recorded the highest yield (5.2 t/ha).

Effect of stand establishment methods andnutrient management practices on lowland rice

Three stand establishment methods viz., systemof rice intensification (SRI), integrated cropmanagement (ICM) and conventional practice were

assigned to main plots and five nutrientmanagement practices viz., FYM 10t/ha,Recommended NPK (80:60:40 kg/ha),recommended NPK + FYM 5t/ha, 50% NPK +FYM 10t/ha and control to subplots in a split plotdesign and replicated thrice. The nursery for allthe three establishment methods were sown on thesame day but transplanted on different date. ForSRI 10 days old seedling @ 1 seedling/hill with25x25 cm spacing and for ICM 20 days oldseedlings @ 2 seedlings/hill with a spacing of 20 x20 cm spacing was given. Whereas, underconventional rice culture, 30 days old seedlings @3 seedlings/hill with a spacing of 20 x 15 cmspacing was used.

Similar to previous years, this year also highervalues of yield attributes i.e., number of panicles/hill, grains/panicle, panicle weight and test weightetc. were recorded in SRI followed by ICM methodof rice culture. The growth parameters like plantheight, dry matter production/hill and rootparameters like root volume and dry weight werealso significantly higher with SRI compared to ICMand conventional practice. Whereas, maximumgrain yield (4.67 t/ha) was recorded with ICMfollowed by SRI (4.61 t/ha), both of which were atpar with each other but remained significantlysuperior to the conventional practice (4.21t/ha).The higher grain yield in ICM was mainly due tohigher number of panicles/sq. m. compared to SRImethod. However, the grain, straw and totalbiomass recorded with SRI and ICM were at parwith each other but remained statistically superiorto conventional practice in both the years. Lowestgrain yield and straw yield was recorded underconventional practice. This was mainly due to poorgrowth and yield attributes under conventionalpractice compared to other two practices. Amongvarious nutrient management practices, applicationof 50% NPK+ FYM10t/ha (4.81 t/ha) recorded the

Table 5. Effect of stand establishment method and geometry on productivity of rice

Stand Panicles/m2 Grain yield (t/ha)establishment

25x25cm 20x20 cm 20x15 cm 25x25cm 20x20 cm 20x15 cm

SRI 24.7 24.8 26.5 20.9 23.1 22.7ICM 23.4 29.3 24.8 21.9 25.0 22.0STD 21.4 27.8 24.5 18.5 22.5 20.8


highest grain yield that was at par with 100% NPK+FYM5t/ha (4.86 t/ha).

Ratooning of pre-kharif riceA field experiment on double cropping of rice

was conducted under mid altitude subtropicalwetland valley ecosystem of Meghalaya. Pre-kharifcrop was transplanted and after the harvest of thiscrop, half of the plot was left for ratooning and theremaining half was transplanted. IR-64 (4.50 t/ha), and Krishna Hamsha (4.33 t/ha) performedwell during pre-kharif season. The ratooning abilityof Sahsarang-1 (3.1 t/ha) and IR-64 (3.1 t/ha) wasfound highly promising. Duration of main cropvaried from 134 to 155 days whereas, in case ofratoon, it varied from 70 to 95 days. Ratooningcould save time (nursery and field preparation,transplanting etc.), resources (labour, seeds etc.)and gave higher productivity. It was observed thatcutting height of 30 cm recorded higher yield ofratoon crop when harvesting of pre-kharif crop wasdelayed beyond second week of August. For earlyharvest (first week of August) 5-15cm cuttingheight recorded yield at par with each other. Forgetting good result, the pre-kharif crop should beharvested at physiological maturity and not at deadripe.

RCRT trial on aromatic and fine grain riceUnder RCRT trial-2007, nine aromatic and

seven fine grain rice varieties were tested understandard package of practice in the lowlandagronomy field, Division of Agronomy, Umiam,Meghalaya. Among aromatic varieties, IET 16313(4.52 t/ha), RCM-16 (3.24t/ha) and IET-16332(3.03t/ha) were found promising. Whereas, amongfine grain varieties, RCPL-1-118 (3.70 t/ha) andRCPL-1-175 (3.39 t/ha) were found promising. Allthe fine and aromatic varieties recorded grain yieldsignificantly lower than check variety Sahsarang1 (5.03 t/ha). However, if higher market price anddemand of aromatic and fine grain rice areconsidered, it may be profitable to grow suchquality rice.

Evaluation of organic sources of nutrientsThe experiment was continued for the fifth year

with twelve treatments tested in RBD with threereplications. The results revealed that maximum

grain yield of Shahsarang-1 was obtained withFYM 20 t/ha+Azolla dual cropping (4.97 t/ha)which is slightly higher than RDF+Azolla (4.93 t/ha). The recommended dose of fertilizers (RDF)could produce grain yield of 4.42 t/ha, which was12.45% and 11.54% lower than FYM 20 t/ha+Azolla and RDF+Azolla, respectively. Azolladual cropping continuously for five years wasfound to improve grain yield by 53.86% ascompared to control. Application of FYM 10 t/haregistered a grain yield of 3.62 t/ha, whichimproved to tune of 26.69% when FYM wasintegrated with Azolla dual cropping. Similarly incase of FYM, 20 t/ha, Azolla could increase yieldby 8.75%. Application of rabbit manures @ 10 and20 t/ha registered an yield of 3.95 and 4.62 t/ha,respectively, which was 13.68 and 5.95% higherthan the yield due to Azolla dual cropping.

Development of package of practices of pre-kharif rice

Development of nursery techniques of pre-kharif rice

The experiment was continued for the third yearin Split Plot Design with three replications. Therewere three covered cultivation practices for pre-kharif rice viz., poly tunnel, poly house and polytunnel+open in main plots and five varieties viz.,Krishna Hamsa, IR-64, Vivek Dhan-82, VL Dhan-61 and Shahsarang-1 were kept in sub plots. Theresults revealed that polytunnel+ open registeredmaximum grain yield of rice. Amongst the varieties,IR -64 and Krishna Hamsa registered maximumyield during pre-kharif season. The seedling grownin polyhouse were found vigorous but fails theestablishment in field after transplanting. Theseedling age was also determined for pre-kharifrice. It was observed that seedling age of 45 and60 days was optimum in registering maximumyield. Amongst the varieties, IR-64 was the highestyielder (3.65 t/ha) followed by Krishna Hamsa(3.29 t/ha). The effect of seedling hardeningrevealed that seedling grown in polytunnel up to30 days followed by removal of polytunnels onalternate day and night for 15 days and completeremoval of poly tunnel for 10 days, registeredmaximum grain yield of pre-kharif rice. The yield


was lowest of the seedling grown in polytunnelswithout hardening treatment.

Agronomic evaluation of rice germplasms forpre-kharif season

Krishna Hamsa, IR-64, Vivek Dhan-82, VLDhan-61 and Shahsarang-1 were transplanted on15 March, 1 July and 15 August. It was observedthat during pre-kharif season, IR-64 registeredmaximum grain yield (4.33 t/ha) followed byKrishna Hamsa, while during main kharif seasonShahsarang-1 registered maximum yield followedby VL Dhan-61 when the crop was transplantedon 15 August all the varieties except Vivek Dhan-82 and VL Dhan-61 did not perform well. At thistransplanting time Vivek Dhan registered 3.89 t/ha followed by VL Dhan-61 (3.65 t/ha), indicatedthat these varieties were promising under latetransplanting conditions.

DISEASES

AICRIP

Uniform blast nursery trialOut of 542 entries tested against rice blast

disease Pyricularia grisea, 149 entries were foundresistant.

Field monitoring of virulence of Pyriculariagrisea

The nursery included twenty-five cultivarsconsisting of international differentials, donars andcommercial cultivars. IR 64, Tetep, Raminad str 3,NP 125, Rasi, C101 LAC, C101 A52, A57 and Usenwere found to be highly resistant against blastdisease. Co 39 and HR 12 were highly susceptible.Virulence pattern was found to be different fromthe previous year (2006) reaction.

Evaluation of new fungicides against blastdisease

Two new fungicide viz. trifloxistrobin 25% +tebuconazole 50% (Nativo 75 WG) and fenoxanil5% + isoprothiolane 30% (RIL 013/F1 35 SC) wereevaluated against leaf and neck blast along withstandard check fungicide like tricyclazole etc. HR12 was used as a test variety under lowland

conditions. Three sprays were given starting fromthe appearance of the disease. Two sprays weregiven at 15 days interval and third spray was givenat panicle initiation stage. Both new formulationsand check fungicides were found effective inchecking the blast severity and increasing the grainyield over untreated check (Table 6).

Table 6. Evaluation of new fungicide againstblast disease

Fungicides Dose/ Leaf Neck Grainliter blast blast yield

severity severity (Kg/ha)(%) (%)

fenoxanil 5% + 1.5 ml 19.3 18.5 2025isoprothiolane 30% (4.4)* (4.4)(RIL 013/F1 35 SC)fenoxanil 5% + 2.0 ml 19.3 9.3 1850 isoprothiolane 30% (4.4) (3.0)(RIL 013/F1 35 SC)trifloxistrobin 25% + 0.4 g 14.8 14.5 1875tebuconazole 50% (3.9) (3.9)(Nativo 75 WG)tricyclazole 0.6 g 7.3 7.0 1950(Baan 75 WP) (2.7) (2.6)isoprothiolane 30% 1.5 ml 5.3 8.8 2075(Fuji-One 40EC) (2.4) (3.0)kasugamycin 2.5 ml 15.0 16.5 1950(Kasu-B 3 SL) (3.9) (4.1)carpropamid 1.0 ml 12.5 13.8 2250(Protega) (3.6) (3.7)Untreated check 36.0 37.8 1275

(6.0) (6.1)CD (P=0.05) 0.55 1.14 367.9

*Square root transformed values

Evaluation of fungicides against blast diseaseSeven fungicide formulations viz. propineb

(Antracol 75 WP), carbendazim+ mancozeb(Companian 75 WP), tricyclazole (Dhanteam 75WP), carbendazim (Dhanustin 50 WP), mancozeb(Indofil M-45), validamycin (Rhizocin 3 L) andhexaconazole (Sitara 5 EC) were evaluated againstleaf and neck blast disease. HR 12 was used as atest variety under lowland conditions. Four sprayswere given starting from the appearance of thedisease. Three sprays were given at 10-15 daysinterval and fourth spray was given at panicleinitiation stage. Tricyclazole was foundsignificantly effective in checking the blast severityand increasing the grain yield over untreated check(Table 7).


Table 7. Evaluation of fungicides against blastdisease



propineb 3.0 g 16.3 32.0 1600(Antracol 75 WP) (4.1)* (5.7)carbendazim+ 1.5 g 16.3 29.3 1400mancozeb (4.1) (5.5)(Companian 75 WP)tricyclazole 0.6 g 4.3 3.7 1867 (Dhanteam 75 WP) (2.1) (2.0)carbendazim 1.0 g 6.7 4.0 1400(Dhanustin 50 WP) (2.7) (2.0)mancozeb 2.5 g 17.7 16.0 1733(Indofil M-45) (4.3) (4.0)validamycin 2.5 ml 31.7 38.7 1567(Rhizocin 3 L) (5.7) (6.3)hexaconazole 2.0 ml 18.0 46.3 967(Sitara 5 EC) (4.3) (6.8)Untreated check 38.7 34.7 933

(6.3) (5.9)CD (P=0.05) 0.84 1.14 255.3

* Square root transformed values

Biopesticides for management of rice blastdisease

Two botanicals viz. Biofer, Defender and twobiocontrol formulations Florezen-P and Trichozen-T along with chemical check (Bavistin) wereevaluated for management of rice blast. Four sprayswere given starting from the appearance of thedisease. Three sprays were given at 10-15 daysinterval and fourth spray was given at panicleinitiation stage. All test formulations were used asspray except Trichozen-T which was applied in soil@ 5 kg/ha. Trichozen-T was found significantlysuperior over unsprayed plots in checking blastinfection in var. HR 12 under lowland situation(Table 8).

INSECTS AND PESTS

Varietal screening against major insect pestsNine rice varieties viz. RCPL 1-113, RCPL 1-

114, RCPL 1-115, RCPL 1-116, RCPL 1-117,RCPL 1-45, RCPL 1-46, Bhalum 1 and Bhalum 2were evaluated against major insect pests of riceunder upland conditions. RCPL 1-46, RCPL 1-115and Bhalum 2 were recorded as susceptible and

RCPL 1-116 and RCPL 1-45 resistant to stem borerof rice. All the varieties under experiment wereresistant to leaf folder and none of the varietieswas found resistant to gundhi bug.

Evaluation of new insecticide molecules againstrice pests

New insecticide molecules Rynaxypyr 04% Gand Rynsxypure 20 SC were evaluated against ricestem borer, rice leaf folder and rice root aphid. Eachof the insecticides applied twice at an interval of30 days starting with 20 days after sowing.Rynaxypyr 04% G @ 3 g a.i./ha and Rynsxypure20 SC @ 30 ml a.i./ha were found significantlyeffective in controlling rice stem borer, rice leaffolder and rice root aphid.

Table 8. Management of rice blast withbiopesticides



Biofer 1.5 ml 25.3 (5.1)2 12.8 (3.6) 1725Defender 2.5 ml 27.5 (5.3) 19.5 (4.4) 1725Florezen-P 2.5 g 27.3 (5.3) 17.5 (4.2) 1725Trichozen-T1 5 kg/ha 17.5 (4.2) 14.3 (3.7) 1500Bavistin 50 WP 1.0 g 10.5 (3.3) 11.5 (3.4) 2025Untreated check 29.3 (5.4) 21.0 (4.6) 1500CD (P=0.05) 0.57 0.89 466.9

1 Soil application, 2 Square root transformed values

MAIZE

Genetic improvement of two gene poolTwo gene pool – white kernel and yellow kernel

created from the germplasm collection wereimproved through selection. The mean, range andphenotypic coefficient of variation (PVC) % fordifferent yield components are given in Table 1and 2. The range and PCV% reveals that largevariation were observed for most of the traits andfurther selection would be effective for thesecomponents.


Table 1. Range mean and PCV of different yieldcomponents of yellow gene pool

Character Range Mean± SE PCV (%)

Plant ht(cm) 215.4-314.4 275.8 ±12.3 29.6Ear ht(cm) 107.3-208.6 150.3 ±9.9 36.2Cob length(cm) 22-33 25.6 ±0.5 26.9Row/cob 14-22 15.4 ±0.9 15.6Kernel/row 20-49 32.2 ±0.8 13.2

Table 2. Range mean and PCV of different yieldcomponents of white gene pool

Character Range Mean± SE PCV(%)

Plant ht(cm) 116.5-286.50 175.68 ± 10.35 18.5Ear ht(cm) 78.00-145.23 103.25±5.6 9.6Cob length(cm) 14.5-20.15 18.05± 0.5 6.5Row/cob 10-18 14.56 ± 0.6 15.6Kernel/row 12-36 19.56±1.0 22.0Kernel yield/plant(g) 24.3-95.6 69.8±7.8 32.56

Maintenance of germplasmNinety three lines collected from Nagaland,

Sikkim, Manipur, Mizoram , RCM 1-1, RCM 1-2

and RCM 1-3 were maintained. Selfed progeny (S-2) lines from four putative QPM lines weredeveloped.

Yield evaluation trialsNine All-India Coordinated Trials from DMR

namely IET 61 Z-1, IET 62 Z-1, IET 63 Z-1, AETI 66Z-1, AET I 67 Z-1, AET I 68 Z-1, AET II 70 Z-1, AET II 71 Z-I and AET II 72 Z-I were conducted.Entries significantly higher than check wereidentified as collated in Table 3

DISEASES

AICMIPTen genotypes were evaluated for naturally

occurring diseases in 1-5 rating scale under trapnursery trial from AICMIP. The genotypes, V 346and CML 357 trapped Tucicum Leaf blight(Exserohilum turcicum) with the rating of 4.0 and3.5 respectively, Maydis Leaf Blight(Helminthosporium maydis) was recorded in V 335,V 346, CM 119 and CML 357 with rating of 3.5,4.5, 3.5 and 4.5 respectively. The seed rot

Table 3. Promising entries from AICMIP trials

Trials Entries Entries significantly higher than check Best check

1. IET 61 Full season 40+4 check JH 11693 (4.64 t/ha), PRO 373 (4.53 t/ha),Kaveri 50 Prabhat (4.21 t/ha)maturity (4.50 t/ha), MM 8255 (4.42 t/ha), OM 7676 (4.34 t/ha)

2. IET 62 Medium 35+2 Check JH 11508 (5.02 t/ha), BH 40702 (5.0 t/ha), BIO 9637(4.82 t/ha)maturity CP 828(4.96 t/ha)

3. IET 63 early 18+4check JH 3956 (51.0 q/ha), UMC 1(4.98 t/ha), X 121 Kiran (4.68 t/ha)maturity (4.86 t/ha)

4. AET I 66 Medium 3+2check NONE BIO 9637(4.96 t/ha)maturity

5. AET I 67 early 5+2 check MCH 35(5.12 t/ha) Prakash (5.02 t/ha)maturity

6. AET I 68 extra early 8+2check FH 3356 4.84 t/ha), VL 113 4.79 t/ha) HIM 129 (4.72 t/ha)

7. AET II 70 Medium 2+2check JKMH 44 (4.65 t/ha ) NAVJOT(4.58 t/ha)maturity

8. AET II 71 early 2+2check NONE X 3342( 5.0 t/ha)maturity

9. AET II 72 extra early 4+3check FH 3294(5.2 t/ha) SURYA (5.0 t/ha)


(Aspergillus spp.) was observed in V 335, CM 115and CM 118.

Screening for Turcicum leaf blight resistanceOf 81 genotypes screened, 3 (F H – 3358, F H –

3356, COMP. R - - 2005 – 5) extra early, one (M CH – 35) early, 8 (H K H 302, BISCO – 111, BIO –9637, KLM – 1, BISCO - 555, B H – 4068, BISCO– 855, BIO – 9637) medium and 16 (B H – 4065, SM H – 3904, J K M H - 502, J H – 11116, P R O –371, 22 K 40, 30 R 88, SEEDTEC - 2324, J H –11117, P A C – 740, J H – 10704, BIO - 9681), BH – 4066, M C H – 33, PRO – 365, P H S - 54) fullseason maturity, were found resistant. Three (F H- 3294, F H - 3352, F Q H – 4567) of extra early, 6(L – 229, B H – 4067, V – 37, 25K 60, L – 166, L– 230) of medium and five (30 R 77, PARBHAT,PRO - 311, B H – 4064, B H – 4070) of full seasonmaturity were moderately resistant. Rest of 39genotypes showed susceptible (2.75 to 4.75)reaction in 1-5 disease rating scale.

INSECTS AND PESTS

Biology and feeding pattern of maize stem borer(Chilo partellus)

Egg period lasts for 3-7 days; larval period 18-24 days; pupal period 7-9 days; and adult longevityranges from 6-9 days for female and 5-7 days formale. The total life cycle takes about four weeksand 4 -5 overlapping generations were observed ina season. Eggs are laid on the underside of leaf asegg mass. First instar larvae after hatching mineinto the midrib and bore into stem upon reachingit. The larvae feed internally and frass can be seenfrom the boreholes. Due to this the growing shootis severely affected and sometimes the newlyemerging leaves get disfigured and dry up.

PULSES

Five different pulse crops viz., ricebean,Urdbean and Rajmash in Kharif; pea and lentil inrabi were evaluated in various trials foridentification suitable genotypes. New crosses were

made and segregating generations advanced fordeveloping new genotypes.

Ricebean

Evaluation of fodder ricebeanAn IVT was conducted with 6 genotypes of

fodder ricebean received through AICRP. Basedon the green plant weight and green leaf weight 3promising genotypes were identified. GenotypeRB1 was the best performer. Green plant weigh(GPWT) in this genotype was 226 g/plant and greenleaf weight (GLWT) was 41.3 g/plant. Other twopromising genotypes were RB4 (196.5 g – GPWT& 42 g GLWT) and RB 7 (155g GPWT and 40.9gGLWT). Among these genotypes green leaf weight/plant was not significantly different. There was nosignificant difference in days to 50% flowering,which ranged between 100 – 102 days.

Germplasm evaluationSixty-nine core germplasm of ricebean were

evaluated in augmented design (5.25 m2 each) withRCRB 1-6 and RBS – 16 as checks. Fourgenotypes, as collated in Table 1 were superior tochecks in their yielding ability. But, the bestyielding genotype BKSB 221 was late comparedto all others.

Table 1. Promising genotypes identified fromricebean germplasm collection

Genotype DF 50% 5m2 Yield

BKSB – 221 124 771.3BKSB – 199 98 727.7BKSB – 165 80 712.7BKSB-= - 233 96 803.8RCRB 1-6 © 89 518.9RBS 16 85 678.53CV 11%

Advancement of segregating generationsOut of 68 F6 lines of photo-insensitive ricebean

crosses selected from the spring for advancementand grown in kharif, 4 lines were selected foradvancement. Out of 468 F4 lines of photo-insensitive ricebean crosses, 108 lines wereadvanced to next generation. Eight interspecific


crosses of urdbean and ricebean were made andF1 seeds obtained.

Rajmash

Sixty-three lines were evaluated in augmenteddesign with varieties Uday and Chitra as checks.Six genotypes were identified as promising ascollated in Table 2.

Table 2. Performance of rajmash genotypes atUmiam

Genotype Duration Yield(days) (g/4.m2)

Carmel 87 104.70ECAB 0524 83 73.55ECAB 0527 87 64.22Mexico 87 61.04ECAB 0621 83 59.27Mac 12-2 87 57.88Uday 87 33.00Chitra 83 51.60CV 12.8%DS – 13.8.07

Urdbean

Thirty-nine genotypes were evaluated in RBDwith 3 local checks Pahelodal 4, MZ-1 & MZ-2.Promising genotypes identified from the trial wereKU-507 (0.42 t/ha), KU 504 (0.42 t/ha), Shekhar(.40 t/ha) KU 549 (.41 t/ha) and KU 551 (.40 t/ha)compared to checks Pahelodal 4 (.37 t/ha), MZ-1(.21 t/ha) and MZ-2 (.30 t/ha). All these genotypesmatured between 74-80 days.

Pea

Two coordinated trials, AVT-1 (Tall) and AVT-2 (Tall) were conducted. Best genotype from AVT-2 tall was P7-501 (2.36 t/ha-122 days) and fromAVT-1 Tall was P7 – 526 (1.95 t/ha – 122 days). F2genotype from 22 crosses involving TRCP-8,TRCP-9, DDR – 39, DDR-60, DDR – 63, DDR –50, MNPL – 2, DDR – 64 and DMR – 50 wereadvanced to next generation. Two methods, single

pod descent and plant to row methods werefollowed.

Lentil

Seven identified genotypes were grown for the3rd year for yield evaluation. Yield and maturitydata of the genotypes are presented in Table 3. VL– 4 (2.52 t/ha) was the best genotype followed byVL – 126.

Table 3. Yield performance of selected lentilgenotypes at Umiam

Genotype Duration Yield(days) (t/ha)

PL – 639 150 1.38VL –120 133 1.62L – 414 138 .83VL –126 140 1.91L – 305 135 1.09L – 306 150 .78VL – 4 135 2.52

BIOTECHNOLOGY

PigeonpeaIn pigeonpea, 12 days old leaves when

inoculated in the callusing medium gives bettercallusing then the leaves that are younger or olderto it. Among the genotypes, TRA-1 a local genotypewas the best. The callusing percentage was morethan 95%. BAP and 2,4-D were the hormonesused for callusing. The matured callus wastransferred to the regeneration medium containingBAP and Kinetin in different concentrations. Theregenerated plants after attaining a height of about2 cm were transferred to the root inducing medium.The fully grown plants were transferred to the greenhouse for acclimatization.

Chickpea tissue culture and transformation

Induction of multiple shoots from embryosEmbryos were excised from surface sterilized-

pre-soaked seeds, sliced into two halves (Fig. 1a)


and grown on MS salts + B5 vitamins + BAP,various concentrations of glutamine and silvernitrate.

After 2 weeks of culture in presence of light,embryos with developing shoots (Fig. 1b) weretransferred for shoot elongation on mediumcontaining MS salts +B5 vitamins + BAP glutamineand 1/10th concentration of silver nitrate used inthe previous step and cultured in the light.Subculture to the same medium was done at 15days interval. After 4 weeks in the elongationmedium, shoots were transferred to root inductionmedium containing half strength MS salts andvitamins and IBA. Shoots were grown on a nutrientpad kept soaked in the medium. After about 45days, plants with well formed roots were firsttransferred to MS ½ medium without hormone for15 days and then to a mixture of autoclaved soiland cocopit. pH of all media were adjusted to 5.8before autoclaving, for semisolid media 0.8% agar

was used and 3% sucrose was used as carbonsource.

Response of embryos to different combinationsof shoot induction medium is given in Table 4. Asis evident from the table the medium combination‘SMD’ was the best and produced on an average 5shoots/ embryo slice.

Table 4. Shoot induction from embryo slices indifferent medium (cv. C235)*

Medium No. of embryo No. of shoots/ % slice slices/exp. slices responding

SM A 25 3-4 82.1SM B 25 2-4 65.6SM C 25 0-01 28.3SM D 25 4-7 89.6SM E 25 2-3 66.6SM F 25 0-3 23.3SM G 25 2-4 42.3SM I 25 0 0

* Average of 4 sets.

Fig. 1. a. Sliced embryos. b. Multiple shoots formed from sliced embryo.


For establishment in soil, it was necessary tocover the plants with plastic cups with periodicalremoval of cover. The combination of cocopit andsoil was better than cocopit alone or vermiculitealone. However, survival in soil after 45 days wasless than 1%.

Multiple shoot induction from epicotyl segmentsEpicotyl from 7-days-old seedlings were cut

into 1-2 cm segments and grown on mediumcontaining MS salts + B5 vitamins + BAP + kinetin+ glutamine + silver nitrate. After 3 weeks of shootinduction in this medium epicotyls with multipleshoots were transferred to the same medium butwith 1/10 silver nitrate. After another 2 weeks rootswere induced from elongated shoots in mediumcontaining MS salts (1/2 strength) + B5 vitamins +IBA glutamine. Rooted shoots were transferred tosoil as described before.

Callus induction and plant regeneration fromepicotyl

Epicotyl explants prepared as described abovewere cut into 3-4 mm pieces : (i) horizontal (ii)vertical or (iii) horizontal and then vertical. Calliwere induced from these pieces on mediumcontaining MS salts + B5 vitamins + 2,4-D +kinetin glutamine and silver nitrate.

After 45 days of induction calli with smallembryoids were transferred to maturation mediumwith the same composition as above but with IBAand BAP as hormone supplement. Another set wasmaintained in the medium of same composition butwith 1/10th concentration of silver nitrate. Calliwere allowed to mature for 20 days after whichthey were transferred to regeneration mediumwhich contained the same salts, vitamins glutamineand BAP as hormone supplement but without silvernitrate. Rooted plants were transferred to soil asdescribed in section 1.

Fig. 2. a. Shoots developing from epicotyls segment. b. Developed shoots rooted on rooting medium

Fig. 3 a. Nodular embryogenic calli formed in presence of glutamine and silver nitrate. b. Loose non-embryogenic calli in the control plates


Among the media compositions tested CIMDwas best for callus induction using horizontally cutepicotyls (Table 5) and subsequent plantregeneration. It was necessary to maintain calliunder diffused light as long as silver nitrate wasused. It was also necessary to reduce silver nitrateconcentration to 1/10th in the maturation medium.

Table 5. Callus induction from epicotyl indifferent medium (cv. C235)*

Medium No. of % of explant Regenerationexplant/ producing %exp. calli

CIM A 36 86.11 13.88 (5)CIM B 31 74.19 NilCIM C 30 83.33 NilCIM D 34 67.65 52.94 (18)CIM E 29 86.2 6.90 (2)CIM F 21 52.38 NilCIM G 24 50.00 12.50 (3)CIM H 35 91.42 8.57 (3)CIM I 24 87.50 Nil

* Average of 3 sets

Among three different types of explants,horizontally cut explants were better than the othertwo (Table 6).

Table 6. Callusing percentage from threedifferent types of epicotyl explants

Cut type No. of Callusing Regenerationexplants/ % %exp.

Vertical 70 64.28 35.66Horizontal 67 80.60 54.8Horizontal + 48 77.08 22.98Vertical

Agrobacterium-mediated transformation ofembryos

Explants were prepared by cutting embryos intotwo halves. Embryo pieces were plated on the shootinduction medium SMD (without silver nitrate)with 100µM acetosyringone and 5µl aliquot ofbacterial suspension (OD600 – 0.06) was added toeach of the embryo slice. Embryo slices were thenincubated in diffused light for 4 days. Aftercocultivation embryos were washed for 2 hours (3changes) in 500 mg/l cefotaxime with constantagitation. After blotting, the embryo pieces werecultured in SMD medium with 250 mg/lcefotaxime. Shoot and root inductions were doneas described in section 1 in presence of 30-mg/lhygromycin as selective agent. Rooted shoots weretransferred to soil in plastic cups.

Bacterial strain LBA4404 containing theplasmid pCAMBAC (CryIAc) was used.Transformation frequency, as calculated from theshoots rooted on 30-mg/l hygromycin, was 0.7 –3.2%.

Fig 4. Plant regeneration from epicotyls-derived calli.


Agrobacterium-mediated transformation ofepicotyl segments

Epicotyl explants were prepared from 7 day oldseedlings. These explants were infected (LBA4404,pCAMBAc) by soaking them in OD600 – 0.6bacterial suspensions for 45 minutes. Beforesoaking, the explants were pricked at several placesusing a sterile needle. Infected explants wereblotted dry and co-cultivated for 3 days on shootinduction medium without silver nitrate but with2% mannitol. After the co-cultivation period,explants were washed thoroughly, blotted dry andgrown on shoot induction medium with silvernitrate, 250 mg/l cefotaxime for 7 days and another3 weeks on the same medium but with 30 mg/lhygromycin under diffused light. Surviving shootswere rooted in root induction medium containing30mg/l hygromycin. Transformation frequencyranged from 0.5 – 1.5%.

INSECTS AND PESTS

Pigeon pea

Competitive suppression of pod boring weevildamage

Field experiments were conducted to assessyield losses due to different pod borer species inpigeon pea. During pod formation stage (March-April), three different pod borers viz. Apionclavipes, Melanagromiza obtusa and Etiella

zinckinella were recorded with dominance indexsignificantly equal, whereas during September-October, the pod borer complex was dominated byApion clavipes with negligible population of othertwo species. In the first season, the larvalpopulation peaks observed were in the last weekof March, first week of April and second week ofApril for A.clavipes, M.obtusa and E.zinckinella,respectively. During the larval counts, three kindsof pod damage were observed viz. pods withA.clavipes and M.obtusa, pods with only M.obtusaand pods with all the three larvae. The yield losswas observed 32 % due to this pest complex.During the second season, A.clavipes was thepredominat pest while the presence of other twospecies was negligible which could be due to theunfavourable weather conditions and yield lossesestimated was 86 %. In the first season, yield losswas significantly lower owing to the presence ofM.obtusa and E.zinckinella , A.clavipes whichcould not multiply unlike in the second season.A.clavipes life cycle takes longer than the othertwo species, especially M.obtusa and the podconsumption per larva was more than one in thecase of A.clavipes whereas in M.obtusa it was onlyone. A.clavipes mortality was observed morewhenever it was found in combination with othertwo species. The experiment was also conductedin the glasshouse condition and the results weresimilar to field conditions. Thus there exists a clearevidence of interspecific competition among thespecies fighting for the same niche.

Fig 5 a. Transformed plant from embryo slice growing on hygromycin. b. Transformed plant fromepicotyl growing on hygromycin.


Field pea

Insect pests of gram and peaPod borer Helicoverpa armigera, cut worm

Agrotis ipsilon and leaf miner and semilooper wereobserved as the the major lepidopteran pests ofgram and pea, respectively. On an average podborer causes 20-40% damage to gram annually.Among various botanicals and conventionalinsecticides evaluated for their efficacy on peaaphids, imidacloprid @ 0.5 ml/l was highlyeffective in controlling the aphids to the extent of95%, followed by dimethoate, achook, nimbicidine,karanjin, neem oil and anonin over control.

OILSEED CROP

LinseedSeven varieties namely FT 896, JRF 1, JRF 2,

FT 897, JRF 4, FT 895 and JRF 3 from CRIJAF,Barrackpore were evaluated in Rabi 2007-08.

All genotypes were medium in height exceptJRF 3 which was taller than others. No. of branches/ plant varied from 3 to 4. Days to flowering rangedfrom 85 to 90 days. Genotypes JRF 2 and FT 895showed higher seed yield /per plant whereas, FT897 showed higher biomass production with highyield. However, genotypes JRF 2 and FT 895 alsopossessed considerably high biomass. These threegenotypes showed potential in this region.

Table 1. Mean of different yield components of seven varieties of flax

Genotypes Plant ht Branches/ Days to 50% Seed yield Dry biomass (g) /plant(cm) plant flowering (g)/plant excluding seed

FT 896 75.43 2.73 85.00 10.13 15.75JRF 1 74.46 2.96 86.33 11.60 15.50JRF 2 87.80 3.46 87.66 14.60 16.54FT 897 80.93 2.93 84.33 13.80 19.06JRF 4 87.13 3.33 91.00 10.94 16.56FT 895 86.56 3.83 84.00 14.95 18.00JRF 3 90.96 2.86 88.00 12.41 16.73

CROPPING SYSTEMS

Crop intensification in lowland/marshy land

Evaluations of rice based cropping system forlow land on temporary raised beds

The experiment was continued for the 5th yearto find out suitable cropping sequence for lowlandarea. The data (Table 1) indicated that adoption ofvegetables in cropping system significantlyimproved system productivity, productionefficiency and benefit: cost ratio. Growing of maizeduring pre-kharif season was also beneficial ascompared to rice-fallow. However, when maize wasgrown for green cobs, the system productivity wasimproved to the tune of 20.17 t/ha. But maximumsystem productivity of 38.20 t/ha was recorded withrice-tomato followed by rice-potato and rice-capsicum cropping sequences. The performance

Table 1. Production potential of rice basedcropping system in lowland area

Cropping system Kharif Summer Totalcrop crop systemyield yield productivity(t/ha) (t/ha) (t/ha)

Rice – Potato 4.57 18.54 23.08Rice – Tomato 4.31 29.05 38.20Rice – Capsicum 4.45 12.54 25.28Rice – Frenchbean (Pole) 4.81 13.01 19.99Rice – Frenchbean (Bush) 4.90 8.54 14.86Rice–Maize (green cobs) 4.25 87.05 18.76Rice – Maize (grain) 4.17 3.54 8.89Rice- fallow 5.28 - 5.28P=(0.05) 0.11 - 0.55


rice after harvest of summer crop was also assessed.It was observed that adoption of different cropssignificantly influenced grain yield of rice (Table1). Maximum grain yield was recorded with rice-fallow system followed by rice-frenchbean (4.81t/ha). The lowest rice yield was found with rice-maize grown for green cobs or grain purpose.

Evaluation of rice based cropping system onpermanent raised bed

Upland rice based cropping systems werestudied on permanent raised bed. Twelve croppingsequences were evaluated in RBD with threereplications. It was observed that cropping intensityof 200 and 300 % markedly increased systemproductivity as compared to 100% croppingintensity (rice-fallow). Among the cropping system,rice-vegetable-vegetable and rice-vegetable basedcropping sequences recorded maximum systemproductivity. Maximum rice equivalent yield(REY) of 40.19 t/ha was registered with rice-pea-frenchbean followed by rice-toria-tomato (35.93t/ha). The rice-toria was the poor yielder recording5.40 t/ha REY, which was however, 40.12% higherover rice-fallow, indicated that double or triplecropping sequence were more productive thanmono cropping.

Effect of height and width of raised bedThe experiment was continued to work out

suitable size of raised bed for increasing land useefficiency of marshy land areas. In the firstexperiment the effect of width of raised bed andcrops was assessed in terms of growth andproductivity of lowland rice grown in sunken beds.There were four width of raises bed (1, 2, 3 and 4meter) in main plots, while four crops maize, rice,soybean and groundnut were arranged in subplot.The treatments were tested in two factors, split plotdesign with three replications. The results revealedthat width of raised bed did not exert significantinfluence on the grain yield of sunken bed rice,while the crops, grown on raised bed had significantinfluence on the yield of rice gown in sunken bed.Maximum reduction in yield of sunken bed ricewas observed with maize crop grown on raised bedfollowed by rice. Groundnut was found to exertleast influence on sunken bed rice recording

maximum sunken bed rice yield with groundnutfollowed by soybean.

The effect of height of raised beds on the growthand yield of crops was also assessed. Four raisedbed heights i.e. 10, 20, 30 and 40 cm were kept inmain plots and four crops (maize, rice, soybeanand groundnut) were arranged in sub plot. Thetreatments were tested in Split Plot Design with 3replications. The data revealed that at 10 cm raisedbed height all the crops showed lowest yield exceptrice. As the height of raised beds increased the yieldof maize, groundnut and frenchbean increased upto a raised bed height of 30 cm. The yield furtherimproved at 40 cm raise bed height but thedifference was not significant During rabi season,raised beds of 0 , 10, 20, 30 and 40 cm abovemoisture levels were kept in main plots and pea,lentil, toria, mustard and rajmash were arranged insub plots. The treatments were tested in two factorsSplit Plot Design with three replications. The yieldsof all the crops were converted in to pea equivalentyield (PEY). It was observed that at 0 cm raisedbed height, al the crops showed very poor yield,which at 30 cm, the yield was recorded maximum,The yield recorded at 40 cm was comparable with30 cm raised bed height. Amongst the crops,maximum yield in terms οf PEY was recoded withrajmash and pea. While the, lowest yield wasrecorded with toria.

Development of cole crops based intercroppingsystem

In cole crops, wide space between rows wasutilized by growing of pea, methi, coriander, radishand carrot. These crops were also sown as solecrops for comparison. The treatments were testedin RBD with three replications. It was observedthat intercropping system significantly influencedthe total system productivity of raised bed.Maximum system productivity in terms of cabbageequivalent yield (CEY) of 43.30 t/ha was recordedwith cabbage+pea, followed by cabbage+methi(419.65). Growing of radish not only decrease theyield of cabbage but total system productivity wasreduced to the tune of 8.56 per cent as comparedto sole cabbage. Amongst the cauliflower basedintercropping system, maximum cauliflowerequivalent yield of 22.56 t/ha was recorded with


cauliflower+carrot followed by cauliflower+methi.Cauliflower+radish intercropping system was thepoor yielder (15.18 t/ha) cauliflower equivalentyield (CaEY), which was 22.04% lower thancauliflower sole crops.

In broccoli based intercropping system, pea,methi, radish, mustard, lentil and carrot wereintercropped. It was observed that total systemproductivity in terms of broccoli equivalent yield(BEY) of 12.85 t/ha was recorded withbroccoli+pea followed by broccoli+lentil.Broccoli+methi intercropping system was next toit.

Evaluation of rice germplasms under rice-ricecropping system

The varieties Krishna Hamsa, IR-64, VivekDhan-82, VL Dhan-61 and Shahsarang-1 wereevaluated under rice-rice system (Table 2). It wasobserved that during pre-kharif season IR-64 andKrishna Hamsa were the highest yielder, whileduring kharif season Shahsarang-1 and IR-64registered maximum yield. The maximum systemproductivity of 8.17 and 7.99 t/ha were recordedwith IR-64 – Shahsarang-1 and Krishna Hamsa –Shahsarang-1 indicated the suitability of these cropvarieties in rice – rice cropping system under midhills altitude of Meghalaya. The productionefficiency also followed the similar pattern

showing maximum grain production of 28.17 kg/ha/day with IR-64 – Shahsarang croppingsequence, which was closely followed by 27.08 kggrain/ha/day recorded with Krishna Hamasa -Shahsarng-1. Rice fish system was alsostandardized for sunken beds. Maximum yield ofrice (5.28 t/ha) was observed with rice-fish-Azolla-food system followed by rice-fish-Azolla (Table3)a. Maximum fish yield of 470 kg/ha was recordedwith rice-fish-Azolla-food followed by rice-fish-Azolla (375 kg/ha) and rice-fish-food (375 kg/ha),while maximum fish yield of 935 kg/ha wasrecorded with fish alone when reared in sunkenbeds.

Table 3. Production potential of rice+fish systemunder mid hill altitude conditions

Treatments Rice Fish yield (kg/ha)yield(t/ha) Common Tilapia Total

carp yield

Rice – alone 4.48 - - -Rice- Azolla 4.75 - - -Rice-Fish 4.87 215 70 285Rice- Azolla -Fish 5.16 280 95 375Rice-Fish+Food 5.02 285 90 375Rice- Azolla+Fish+Food 5.28 355 115 470Fish alone - 680 255 935

Table 2. Performance of rice cultivars in rice-rice cropping sequence

Pre-Kharif Main -Kharif Pre-kharif rice Yield main Total production Production(t/ha) kharif rice (t/ha) (t/ha) efficiency (kg/ha/day)

Krishna Hamsa Shahsarang-1 3.25 5.1.5 7.99 27.08IR-64 3.4.7 6.32 22.55Vivek Dhan-82 3.69 6.53 23.75VL Dhan-61 3.75 6.59 23.79

IR-64 Shahsarang-1 3.48 5.24 8.17 28.17IR-64 4.04 6.98 25.36Vivek Dhan-82 3.76 6.69 24.78VL Dhan-61 3.81 6.74 24.78

Vivek Dhan - 82 Shahsarang-1 2.85 5.64 5.64 19.59IR-64 4.50 4.50 16.20Vivek Dhan-82 3.68 3.68 13.22VL Dhan-61 3.8.1 3.81 13.94

VL Dhan - 61 Shahsarang-1 2.94 5.53 5.53 19.07IR-64 3.88 3.88 14.09Vivek Dhan-82 3.95 3.95 14.35VL Dhan-61 3.88 3.88 14.37


Evaluation of promising maize based croppingsystem for raised bed

Permanent raised bed carved out in marshy landby cut and fill methods were used for identificationof promising cropping sequences. Twelve croppingsequences were tested in RBD with threereplications. It was observed that maize basedcropping sequences significantly improved systemproductivity as compared to maize-fallow (the mostcommon practice of the region). Maximum maizeequivalent yield (MEY) of 34.44 t/ha was recordedwith maize-frenchbean-radish followed by maize-greengram-radish (21.65 t/ha). It was observed thatadoption of vegetable (pea, frenchbean) in thecropping sequence markedly increased the MEYas compared to non-vegetable based croppingsequences under study.

ORGANIC FARMING

Network project on organic farmingUnder Network Project on Organic Farming

sponsored by PDCSR, Modipuram, following fourexperiments were undertaken-

Management of soil fertility using organicinputs in important field crop based multiplecropping systems

This experiment was set up with the objectiveto study the various on-farm and off-farm producedorganic sources on nutrient supplying capacity, soilhealth and crop yield along with economic analysisof various nutrient management options. Fourorganic nutrient souces viz. FYM, vermicompost,local compost and integrated (1/3 of each sourcewas tested on four cropping sequences (CS1:

rice+soybean (4:2)-mustard; CS2: rice+soybean(4:2) –tomato; CS3: Maize+soybean (2:2)-groundnut and CS4: maize+soybean (2:2)-Frenchbean).

Experimental results revealed that all the cropsin the cropping systems under investigationresponded positively towards the application ofFYM and integrated management that was evidentfrom the improved growth and yield parameters.Maximum yield of upland rice (2.61 t/ha), maize(3.75 t/ha), soybean (1.32 t/ha) and mustard (1.33t/ha) & tomato (9.02 t/ha) was recorded in FYMtreatment that was closely followed by integratedtreatment (Table 1).

Table1. Yield (t/ha) of crops under differentorganic management practices

Crops FYM Vermi- Integrated Local Controlcompost compost

Rice 2.61 1.88 2.23 1.80 1.44Maize 3.75 2.90 3.69 2.39 2.03Soybean 1.32 1.14 1.32 1.13 0.55Mustard 1.33 1.25 1.27 0.98 0.40Tomato 9.02 6.38 7.67 5.14 3.42

After harvest of all the crops in the sequence,soils were analysed for its chemical & biologicalproperties such as available N, P, K, pH, organiccarbon (%) and Soil Microbial Biomass Carbon(SMBC). Soil analysis data revealed animprovement in nutrient supplying capacity andsoil health due to application of organic nutrients.pH of the soil also increased upto 5.65 under FYMtreatment and 5.31 under integrated managementpractices compared to initial status of 4.50 (Table2). Likewise, OC also increased upto 2.73% and2.54% in FYM treatment and integratedmanagement respectively (initial 1.32%). AvailableN, P, K and SMBC content also exhibited an

Table 2. Changes in soil properties due to application of organic inputs

Treatment pH OC (%) AvN (kg/ha) AvP (kg/ha) AvK (kg/ha) SMBC(µg/g dry soil)

FYM 5.65 2.73 255.46 25.48 277.31 202.47Vermicompost 5.25 2.55 239.46 21.11 246.18 195.55Local compost 4.99 2.13 224.63 19.36 245.34 199.36Integrated 5.31 2.54 250.59 21.36 265.49 201.45Control 4.37 2.14 219.56 10.22 199.21 199.32Initial 4.5 1.32 185.61 10.36 165.10


increasing trend in all the treatments over initialstatus.

Quality parametersVarious quality parameters of tomato grown

under organic farming were determined at theripening stage. TSS (%), Av. juice volume (ml),total sugars & reducing sugars (%), lycopene (mg/100g) content were recorded maximum under FYMtreatment which were closely followed byvermicompost and integrated managementpractices (Table 3). On the other hand, acidity (%)and ascorbic acid (mg/100g) were found slightlymore in local compost and control treatments(Table 3).

Management of soil fertility using organicinputs in important vegetable based multiplecropping systems

Three organic sources of nutrients viz. FYM,vermicompost and integrated management (50%through FYM + 50% through vermicompost wastested on three vegetable based cropping systemsviz. CS1: maize+soybean (2:2)-French bean-tomato, CS2: maize+soybean (2:2)-radish-potato& CS3: maize+soybean (2:2)-French bean-carrot.An increase in yield of vegetables was recordedwith the application of organic nutrient. Maximum

yield of all the vegetables was recorded in FYMapplication followed by integrated managementpractices (Table 4). Improvement in nutrientsupplying capacity of soil and soil health wasobserved as the nutrient status of soils underdifferent nutrient management practices wasimproved (Table 5)

Table 4. Yield (t/ha) of crops under differentorganic management practices

Crops FYM Vermicompost Integrated Control

Maize 3.96 3.66 3.87 1.88Soybean 1.79 1.59 1.40 1.10Tomato 11.68 11.25 11.41 3.67Potato 12.61 12.96 11.33 7.56French bean 11.82 10.30 10.88 5.22Radish 44.37 45.23 43.52 41.71

Quality parametersAt ripening stage, TSS (%), Av. juice volume

(ml), total sugars and reducing sugars (%),lycopene (mg/100g) content of tomato recordedmaximum under FYM treatment followed byvermicompost and integrated managementpractices (Table 6). maximum percentage of aciditywas recorded in control treatment.

Table 3. Quality parameters of tomato fruit at maximum ripening stage under various organicmanagement practices

Treatment Av.wt Volm Sp. Av. Av. TSS Acidity Ascorbic Av. RS TS Lyco-(g) (ml) gravity length Diam. (%) (%) acid juice (%) pene

g/ml (mm) (mm) (mg/100g) (ml) (%) (mg/100g)

FYM 51.9 56 0.926 40.46 46.9 4.2 0.640 28.6 90.3 2.84 3.56 18.82V.Comp 56.9 64 0.889 45.38 47.5 4.0 0.646 28.6 84.0 2.64 3.48 19.04Integrated 51.5 60 0.858 44.49 46.2 4.2 0.640 26.3 88.0 2.40 3.55 19.35L.Comp 45.7 52 0.878 41.71 43.8 4.0 0.768 28.3 78.0 2.37 3.06 14.92Control 42.7 52 0.821 40.25 43.0 4.0 0.770 31.4 76.0 1.92 3.00 7.95

Table 5. Changes in soil properties due to application of organic nutrient sources


FYM 5.43 2.90 270.40 29.43 199.73 206.69Vermicompost 4.99 2.45 255.80 29.39 181.40 204.29Integrated 5.36 2.76 270.36 28.46 199.70 199.43Control 4.91 2.19 200.39 28.04 166.8 142.40Initial 4.80 1.80 255.61 9.19 232.10


Studies on comparative efficiency of organic,chemical and integrated nutrient managementpractices on soil health and crop productivityunder various cropping systems

In this experiment crops were grown underraised and sunken bed method of cultivation. Fourrice-vegetable cropping sequences in the raisedbeds and four rice-rice cropping sequences weretaken up in the sunken beds, along with 100%organic, 100% inorganic, integrated and naturalmanagement practices. Organic manures and rockphosphate were applied to compensate the N andP equivalent for respective crops as per thetreatments. Organic block was protected from allpossible contaminations by providing peripheraldrainage, bio-fencing, isolation distance etc. Nosynthetic chemicals including pesticides, growthhormones etc were used for organic block. The thirdyear results revealed that maximum yield of uplandrice and vegetables were recorded in integratedmanagement practices followed by 100% organictreatment followed by inorganic managementpractices (Table 7). Lowland rice varieties alsoregistered higher yield in integrated managementpractices followed by organic management practice(Table 8).

Table 7. Yield (t/ha) of vegetables as affectedby various nutrient managementpractices

Crops Organic Inorganic Integrated Natural

Tomato 23.56 18.05 23.61 5.57Potato 10.93 10.62 12.15 4.64French bean 6.95 5.90 7.21 3.44Carrot 6.21 5.9 6.39 3.62

Table 8.Yield of lowland rice varieties asaffected by various nutrientmanagement practices

Rice varieties Organic Inorganic Integrated Natural

IR-64 37.4 31.3 42.37 21.37Sahsarang-1 37.07 30.0 27.17 23.17Vivek Dhan-82 36.86 30.6 31.80 16.33Krisna Hamsa 32.63 33.06 45.26 21.53

Soil samples were collected after harvest oftomato and analysed for pH, OC, available N, P&K content. An improvement in the fertility statusof soils under various management practices wasobserved over the initial status (Table 9).

Table 6. Quality parameters of tomato fruit at maximum ripening stage under various nutrientmanagement practices



FYM 48.8 56 0.871 44.08 44.23 5.0 0.640 28.6 80.0 2.56 3.75 19.35V.Comp 43.08 56 0.769 39.69 40.24 4.8 0.512 28.6 71.0 2.43 3.59 14.67Integrated 43.40 52 0.835 42.79 43.73 4.6 0.596 28.6 93.0 2.43 3.57 17.63Control 40.51 51 0.794 40.73 42.79 4.6 0.896 25.7 65.0 1.76 3.00 13.60

Table9. Changes in soil properties due to application of various nutrient sources under raised &sunken bed situation


raised sunken raised sunken raised sunken raised sunken raised sunken raised sunken

Control 5.11 5.30 3.21 2.99 199.9 199.46 6.99 7.44 235.6 236.19 108.14 81.76100% organic 4.93 5.65 3.61 3.03 246.4 236.18 10.01 9.39 288.9 275.93 135.08 99.67100% inorganic 4.59 5.59 3.44 2.91 231.6 229.24 10.00 10.45 271.1 269.09 103.94 98.29Integrated 5.35 5.73 3.51 3.03 242.4 191.01 12.34 13.31 283.5 281.95 145.55 125.76Initial 5.1 5.1 2.46 2.01 150.5 142.17 2.96 1.90 245.1 244.61


Quality parametersSome of the quality parameters i.e., TSS (%),

Av. Juice volume (ml), total sugars and reducingsugars (%), lycopene (mg/100g) content of tomatowas determined and the maximum values for theseparameters was recorded in 100% organictreatment that was closely followed by integratedmanagement practices (Table 10).

Organic farming on rainfed dry terraceAn organic farming model involving cereals

(rice, maize), pulses (soybean, black gram),oilseeds (mustard, groundnut), fruits (lemon, peach,papaya, guava), vegetables (bhindi, french bean),spices (ginger and turmeric) along with provisionfor nutrient recycling (vermicomposting, greenmanuring, mulching) and soil and moistureconservation (terracing, growing hedge rowspecies, fodder grasses on terrace risers, mulchingetc) were developed under terraced condition.Vegetative barriers, leguminous hedge row etc.were included for fencing as well as soil andmoisture conservation. The pruned biomass from

these leguminous hedgerow species were regularlyrecycled in crop field either as mulch orincorporated into the soil as a source of nutrients.Most of these leguminous species were found veryrich in nutrient content. Some of the abundantlygrowing weeds like Eupatorium, Ambrosia etc.were also used as source of nutrient supply, as mostof them were found rich in essential nutrients (Table11). These biomasses were also used for mulchingas a measure for managing weeds in maize.

Table11. Nutrient content (%) of someimportant green leaf manures used

Species N P K Moisturecontent

Pigeonpea 3.19 0.05 1.93 78.56Tephrosia candida 3.11 0.061 1.24 73.28Crotolaria tetragona 3.50 0.327 2.38 85.25Flemingia macrophylla 5.88 0.150 0.79 70.67Indigofera tinctoria 3.67 0.100 1.95 85.92Glycine max 3.29 0.232 2.02 85.59Eupatorium adhenophorum 2.38 0.067 2.84 84.22Ambrosia artimisifolia 3.19 0.224 4.38 82.15

Table 10. Quality parameters of tomato fruit at maximum ripening stage under various nutrientmanagement practices



100% org 51.6 45.0 1.15 43.9 46.8 5.0 0.64 31.46 72.0 2.33 3.58 20.21100% inorg 50.1 47.5 1.05 43.4 45.0 4.8 0.67 31.32 73.0 1.56 3.00 19.53Integrated 51.0 54.0 0.944 43.8 46.6 4.4 0.64 28.6 77.0 1.77 3.49 19.35Natural 48.0 60.5 0.793 42.6 45.0 4.4 0.77 28.6 64.0 1.45 3.00 12.46

Fig. Ginger, Turmeric, soybean along with hedge row species on terrace risers under organic farming


DISEASES

Compatibility studiesTrichoderma viride (Meghalaya isolate), T.

harzianum (Assam isolate), Aspergillus terrus(Assam isolate) and Trichothecium roseum(Meghalaya isolate) were used in this study. Thesefour biocontrol agents were paired with B. bassiana(Meghalaya isolate) using dual culture technique.T. harzianum , T. viride, T. roseum and A. terruswere found compatible with B. bassiana since nomycoparasitism or inhibition zone was observedbetween them. The results indicated potential ofusing a combination of different fungal bio-controlagents in disease management and insect pestmanagement.

BIO-ORGANICS

Bioorganics for rice

Direct seeded riceDuring the third year of trial, 12 most promising

formulations for upland rice were tested both atBarapani and Central Upland Rice Research Stationat Hazaribagh. At Hazaribagh the formulationsRCHE 686L, RCHE 538L, RCHE 317L and RCHEC-12L gave significantly higher grain yield and theseed priming with these formulations outperformedthe current method of direct seed sowing inChotanagpur plateau. At Barapani, Rice varietyShahsarang- 1 was tested both in field and potculture with these dozen formulations. The seedtreatment with formulations helps in earlysprouting of seed and establishment of rice plant.The most promising formulations were RF 37,RCHE 686L, RCHE C-12L, RF 115, RCHE 724Land RF 84 resulted in grain yield of 2.93 t/ha 2.90t/ha 2.88 t/ha/ 2.74 t/ha/ 2.70 t/ha and 2.62 t/ha(control plot 2.38 t/ha)

Transplanted riceFourteen different formulations were tested in

transplanted rice both at Barapani and DRR,Hyderabad. Eight formulations, viz., RF 37, RF58, RF 84, RCHE584L, RF 115, RCHE 686L,

RCHE C-12L, RCHE 724L were found to be verypromising in increasing grain yield at Hyderabad.The percent increase in grain yield range from 24%to 47 %. At Barapani, nine formulations yield(RCHE C-12L, RF 37, RCHE 686L, RCHE584L,RF 115, RCHE 724L, RF 84, RCHE317L andRCHE737L) gave significantly higher. The grainyield was 5.36 t/ha 5.19 t/ha, 4.98 t/ha, 4.96 t/ha4.89 t/ha, 4.82 t/ha, 4.79 t/ha, 4.72 t/ha and 4.58 t/ha respectively (Control plot recording 4.02 t/ha).Formulation RCHE 686 L and RF 37 treated plotattained physiological maturity 8 days ahead ascompare to control plot.

Bioorganics for maizeDuring the third year of field trial, eight herbal

formulations were tested in maize crop, theformulations RCHE 620 L, RCHE 53L, RCHE326L, MF129 and MF 98 resulted in yieldadvantage of 24.5%, 22.1%, 19.4%, 23% and18.2%respectively more over control (3.56 t/ha). Theformulation RCHE 620L and RCHE 441L hadtendency to have double cobs in a plant. The plantmatured one week ahead in MF129 and MF 98formulations.

Bioorganic for groundnutDuring the third year of trial 12 different

bioorganics selected for field trial. The plantbiomass, leaf number and root volume weresignificantly higher in case of RCHE641FL, RCHE490 and RCHE 538L. The chlorophyll content was10% or more in case of RCHE 22L and 538L.However, the root nodules were highest in GF3formulation (42% more over control). The podyield 3.52 t/ha and 3.38 t/ha were recorded withRCHE538L and RCHE 641FL (control 2.71 t/ha).Groundnut treated with formulation with RCHE22L had more rat damage than any other plot.

Bioorganic for soybeanDuring the third year of trial, 10 different

formulations were selected for field trial. The seedstreated with formulations RCHE 538L and 681Lgerminated three days ahead of control plot. Theleaf number and plant biomass were 52% and 54%higher in case of RCHE 397L and SF 4formulations respectively. However, the highestroot volume and root nodules (51% and 60% over


control) were recorded in case of RCHE 538L. Sixdifferent formulations i.e., SF4, RCHE397L,RCHE 538L, GF3, RCHE 681L and RCHE 726Lrecorded significantly higher yield. The yieldadvantage were 29.5, 28.1, 27.8, 26.1, 24.2 and 22percent more over control (21.4 q ha-)

Bioorganic for wheatDuring the third year of trial, eight different

formulations were tested in wheat crop both atBarapani and RARS Shillongani, Nagaon Assam.At RARS, the experiments were carried out totallyin residual moisture and the soil moisture was only14% at 6 cm depth. Consequently the yield wasquite low in control plot (without botanicals).However, wheat seed treated with botanicalparticularly with RCHE 572L and RCHE 694L hadprofound effect in improving the grain yield(Table1). At Barapani the standing crop wasdamaged by the goat grazing therefore the data wasnot generated for the 2007 year.

Bioorganics for black gramDuring the second year of trial, seven promising

botanicals were tested. Early flowering and podformation were recorded with RCHE 726 andRCHE 596L formulations. The pod yield of 1.18 t/ha, 1.11 t/ha and 1.05 t/ha recorded with RCHE726L, RCHE 596L and RCHE 538L formulation(control .76 t/ha).

Bioorganic for mustardEight formulations were tested in both at

Barapani and RARS Shillongani, Nagaon, Assam.

However at RARS, Nagaon Assam, there wasexcessive damage of crop by insect infestation anddata was inconclusive. At Barapani seed treatmentwith formulation RCHE 583 SF with yieldadvantage of 26.3% over control. The otherpromising formulations were RCHE 377L, WHF8,RCHE 620L, RCHE 681L and RCHE 683L (24.4,23.5, 22, 21 4 and 20.2% more over control)

Bioorganic for potatoDuring the second year of trial, 10 different

botanicals were tested in case of potato. Tuber yieldwas significantly higher in RCHE 687L, RCHE694L GF3 and RCHE 79L (21.1, 19.5, 19.3, and16.2% more over control (20.3 t/ha). The potatotuber treated with GF3 and TF2 were significantlyresistant to late blight of potato.

Bioorganic for French beanIn French bean, local bush type (Meghalaya

local1) was treated with eight formulations. Seedwas treated for 4 hrs before planting. Fiveformulations (RCHE 596L, RCHE 538L GF3, SF6and RF37) gave the green pod yield of 36%, 31.9%,28.5%, 28.1% and 25.7% more over control.

Bioorganic for gingerIn ginger, seven formulations i.e., GF1, GF2 GF3,

RCHE 46L, RCHF 22, RCHE 539L, and C-12Lwere tested under field condition against soft rotof ginger. GF1 formulation was found to be veryeffective in checking the infestation of soft rot ofginger and 95% of crop was free from the diseasewhereas, in control plot the disease affected 34%

Treatment Days to Pl. Ht. No. of grains 1000Seed Grain yield % increase Biomass germinate (cm) /earhead wt. (g) (kg/plot)* over control yield(kg/plot)*

572L 6 69.3 20.1 45.8 1.38 142.1 2.27 681L 4 70.2 17.9 47.6 0.85 49.1 2.60442L 4 67.1 23.9 44.0 0.94 64.9 2.87695L 5 67.4 24.8 45.8 0.78 36.8 1.87724L 4 74.0 23.8 49.3 1.00 75.4 2.60694L 6 69.2 16.9 43.6 1.05 84.2 2.77WHF8 4 65.1 20.8 42.5 0.95 66.6 2.83RSF3 4 67.6 26.7 43.4 0.63 10.5 2.07Control 10 67.0 16.2 45.9 0.57 - 1.80

*Plot size= 7.92m2

Table 1. Effect of bioorganics on wheat


of plants. Also GF1 application increased the cropyield by 34.5% more over control.

Bioorganic for turmericIn turmeric, five formulations were tested under

field condition i.e., GF1, GF2, RCHE 46L, RCHF22 and RCHE and C-12L. The formulations, GF2,RCHF 22 were found promising in increasingturmeric rhizome yield and it was higher by 44%and 36% over control (4.6 t/ha)

OILSEEDS

Soybean

Evaluation of F4 of two crosses of soybeanFifty F4 progenies from each of two crosses

namely JS 80-21 X MACS 694 and JS 80-21 XShilajeet were evaluated The range, mean andPCV% of different yield components are given inTable 1. Mainly yield/plant, seed/ plant and pod/plant showed comparatively higher variation.Based on these components 50 superior individualplants were selected from each cross whoseprogeny will be grown next year.

Evaluation of IVT trial of soybeanAn IVT comprising 42 genotypes (39+ 3

checks) conducted in RBD with three replicationsrevealed that three genotype namely MAUS 295(22.54 q/ha) RCS 1(22.27 q/ha), NRC 76 (22.14q/ha) were superior to best check Bragg (20.03 q/ha). VLS 68 was early maturing (24 days toflowering & 75 days to maturity). Table 2represents the mean and range of various yieldcomponents.

Table 2. Range and mean of different yieldcomponents of 42 soybean entries

Characters Range Mean ±SE

Days to flowering 24-54 48.2 ±3.2Days to maturity 75-120 108.4±8.23Plant ht (cm) 28.2-98.6 60.4±2.04Yield (t/ha) 1.20-2.25 1.97 ±0.15

Multiplication and maintenance of promisinglines:

Three promising F9 lines namely RCS1, 9, 10having yield advantage 15 -20% as compared toJS 335 and JS 80-21were multiplied. RCS 9 havebeen promoted to AVT I trial 2008 for North HillZone.

Rapeseed and mustard

Development of composite variety of toriaA composite variety developed by intermating

through open pollination of progeny of 35 linesselected from germplasm collection was advancedthrough one cycle of random mating for seedincrease which would be nominated in IVT trial.Range and mean of different characters are givenin Table 3.

Table 3. Range and mean of various charactersin toria composite

Characters Range Mean ±SE

Plant ht(cm) 45.6-115.2 94.62± 4.23Primary branches /plant 2-8 4.44±0.25Total branches/ plant 6-10 7.82±0.56Siliquae /pl 35-102 55.32±2.36Seed/siliqua 7-16 8.80±0.04Seed yield/plant(g) 3.6-13.5 7.52±1.02

Table 1. Yield components of F4 population of two soybean crosses

Character JS80-21X Shilazeet JS 80-21X MACS 694

Range Mean±SE PCV% Range Mean±SE PCV%

Plant ht (cm) 77-106 88.2±4.4 9.65 63-108 79.4±2.56 8.55Cluster/plant 8-58 36.2±1.5 15.30 6-50 35.2±0.85 12.35Pods/cluster 2-7 4.01±0.4 5.36 2-8 3.02±0.3 7.45Pods/plant 27-123 60.0±4.2 29.80 22-108 57.4±3.0 22.45Seeds/plant 45-223 102.1±4.2 22.54 53-188 96.5±6.3 19.60Yield/plant(g) 10.2-40.0 18.5±1.25 35.64 11.2-52.5 17.6±2.01 30.12


Another composite line developed through openpollinated seed mixture of SCRT 1-1, SCRT1-2 andSCRT 1-3 genotypes was also maintained throughrandom mating.

DISEASES

Soybean pathologyFungal antagonists like T. roseum, T. harzianum,

Cladosporium cladosporioides and T. viride wereevaluated against soybean rust pathogen usingdetached leaf assay. T. roseum was highly effectivein parasitizing the rust pustules in both casesfollowed by C. cladosporioides. T. harzianum andT. viride did not parasitize the rust pustules.

AICRP (Soybean)

Survey and surveillance of soy bean diseases toidentify disease free areas

Collar rot (C.O. Sclerotium rolfsi) ) wasobserved in experimental plots during second weekof July 07.Disease incidence was less than 1%. Rustdisease index ranged 17.33- 66.67 %. Pod blightranged 40-87.33%.

Evaluation of breeding materials for resistantdonors against rust disease (C.O. Phakopsorapachyrhizi)

Out of 39 lines tested for resistance, only eightlines were found moderately resistant. These lineswere NSO-111, MACS-112, PS-1421, KDS-167-9, MAUS-285, MAUS-295, MACS-114 and RCS-9.

INSECTS AND PESTS

SOYBEAN

Population levels of different leaf feeders viz.Leaf folder, Nacoleia vulgalis; Grasshoppers, Hairycaterpillar, Diacrisia oblique and Ash weevil,Myllocerus subfaciatus were recorded, on weeklybasis during July to October. The peak activity ofthese four leaf feeders occurred during 3rd to 8th

week after germination of the crop. The leaf feedercomplex caused an estimated yield loss of 37 %,in which the leaf folder accounted for themaximum, in terms of causing yield loss as well asnumber per square meter area (Fig. 1).

Fig. 1



Tenth International Confectionary GroundnutTrial

Performance of 15 groundnut entries along withone check variety were evaluated. The resultrevealed that the entry ICGV 00401 recorded thehighest pod (3.35 t/ha) and kernel yield (2.08 t/ha). This was closely followed by ICGV 97079(3.02 t/ha pod yield and1.90 t/ha kernel yield). Thiswas mainly due to the better plant stand along withmedium value of pods/plant and seed index.Highest number of effective pods/plant (11.13 /plant) and seed index (86.14 g) was recorded withthe entries ICGV 99085 and ICGV 00440,respectively. The check variety ICGS 76 recordeda pod and kernel yield of 2.23 t/ha and 1.51 t/ha,respectively. The entry ICGV 00440 produced theboldest kernels with a seed index of 86.14 g thatwas 24.31 g higher than the check variety ICGS76. However, the highest shelling percentage wasrecorded with ICGS 76 (67.33%).

SOIL SCIENCE

RICE

Effect of integrated nutrient management onlowland paddy

Field experiment was conducted during Kharif,2007 (variety Shah Sarang) to study the effect of

integrated nutrient management practices on riceyield and on soil properties. The experimentconsisted of 4 levels of NPK (0, 25%, 50%, 75%,and 100% of recommended NPK) and 04 levels ofmanagement practices namely; control, cropresidue, crop residue + FYM, and crop residue +FYM + biofertilizers in 16 treatment combinationsin split plot design with three replications. Therecommended dose of fertilizer was 80:60:40(100%). Full dose of P and 1/3 of N and K wasapplied at the time of transplanting and, theremaining N and K was applied in two split dosesat active tillering and panicle initiation stage. Theresults obtained indicated that yield of paddyincreased with increasing fertilizers doses.Application of FYM, crop residues andbiofertilizers also increased the yield significantly.Among the treatment combinations, 75% NPK+FYM (5 t/ha) + crop residues (10 t/ha) +biofertilizers registered highest grain yield (41.3q/ha) followed by 100% NPK + FYM (5 t/ha) +Crop residues (10t/ha) + Biofertilizers (Fig. 1). Allthe treatments increased the grain yield of the cropssignificantly over the control. Application of FYM,crop residues and biofertilizers had significantinfluence on soil fertility. The maximum organiccarbon content was recorded in the treatmentreceiving 50% NPK + Crop residues (10 t/ha) +FYM (5t/ha). Application of crop residues (10 t/ha) along with 100% NPK recorded the highestavailable N and K2O whereas, the amount of P2O5was highest in the treatment receiving crop residues(10t/ha) + FYM (5t/ha) + Biofertilizers + 50% NPK(Fig. 2).

Crops: Grain Straw Grain Straw Grain Straw Grain StrawControl Crop residues Corp res.+FYM Crop res.+FYM+

Biofertilizer

Fig. 1 Effect of INM on yield parameters of rice


GROUNDNUT

Response of groundnut to SSP, DAP with CaSO4to delineate the role of sulphur:

A field experiment was conducted during kharif2007, for the 2nd year with SSP, DAP and DAP withCaSO4 to study the response of groundnut to thesesources. DAP and SSP were applied to supply 30,60 and 90 kg P2O5 per hectare. CaSO4 was appliedequivalent to sulphur supplied from SSP incombination with DAP. Like first year, in secondyear also, highest pod yield was recorded in thesoils treated with SSP @ 90 kg P2O5 per hectare(3.42 t/ha) where as, treatment receiving DAP @90 kg P2O5 recorded the highest straw yield (2.35q/ha) (Fig.3). Available sulphur content of the soil

as well as in the plant was more in the soils treatedwith DAP + CaSO4 as compared to control andother treatments (Fig. 4). Application of phosphatefertilizers with calcium sulphate had significantinfluence on soil N, P, K and S content of the soil.

MAIZE

Effect of different sources of nitrogen andphosphorus along with boron and zinc on maizeyield and on soil fertility:

An experiment consisting of 13 treatments withdifferent sources of nitrogen (urea and DAP) andphosphorus (DAP and SSP) along with boron and


zinc was conducted to study the effect of thesesources as well as the interaction effect of zinc andboron on the yield of maize and on soil fertility.NPK fertilizer was applied in the ratio of 80:72:40kg/ha. Zinc and boron was applied @ 20 and 40kg/ha, respectively. Lime was applied @1 t/ha inall the treatments. Application of urea, singlesuperphosphate along with boron and zinc recordedthe highest grain and straw yield (3.1 t/ha and 1.9t/ha, respectively) followed by the combinedapplication of DAP, single super phosphate andboron (Fig. 5). Application different sources offertilizers significantly influenced and increasedthe available nutrient concentration. Applicationof zinc and boron in combination with both sourcesof N and P fertilizers increased the yield. LowerpH was recorded in the treatment receiving ureacompared to DAP (Table 1).

Response of maize to lime mud and dolomiteThis experiment was conducted on an acid soil

having pH 4.8, exchangeable Al 1.8 me/100 g andexchangeable Ca+Mg 4.1 me/100 g. the calciumcarbonate equivalence (CEC) of lime mud anddolomite was 95.2% and 79.3%, respectively. Thelime requirement (LR) of soil was 18.4 t/ha. Thelime rates were 0, 10, 20, 30, 40, 50 and 100 % oflime requirement. Both sources of lime werebroadcasted in 12 m2 plot size before the sowingof maize, mixed in soil with spades and left forone month for the completion of lime reaction withsoil. The experimental design was split plot designin three replicates. After one month of limeapplication, recommended dose of fertilizers wereapplied in each plot and seeds of maize (variety(RCM-1-1) was sown in 60 cm from row to rowand 25 cm from seed to seed. All the recommended


practices were followed through the growingperiod. After the maturity of crop, yield of grainand straw were recorded. Soil samples were alsotaken for soil acidity parameters measurements.

Maize well responded to the application ofliming materials and lime mud better performedthan that of dolomite (Fig. 6). The application oflime equivalent to 30% of LR gave almost optimumyield maize. The application of lime mud increasedthe soil pH comparatively more than the limestone,mainly caused by better quality of the former.

Evaluation paper mill sludge as acid soilamendment

This experiment was also conducted on soilhaving similar properties of the earlier experiment.The efficiency of paper mill sludge was comparedwith dolomite for augmenting the maizeproductivity on acid soil. The CCE of paper millsludge (PMS) was 31.2%. There were 8 treatmentcombinations namely; T1 (no lime), T2 (10 t PMS/ha), T3 (20 t PMS/ha), T4 (Lime 10% of LR), T5(lime 20% LR), T6 (lime 40% LR), T7 (PMS 10 t

and lime 10% LR), and T8 (PMS20 t and lime 10% LR). Thesesources of liming materials alsoapplied one months before sowingof maize in 12 m2 plot size intriplicates. All the practices formaize crop raising were followedas given earlier.

The application of PMsignificantly increased the maizeyield over control and performedslightly poor as compared todolomite. The application of PMLand dolomite (10% LR) improvedthe productivity of maize ascompared to PMS alone. Itindicated that the productivity ofmaize can be enhanced furtherwhen PMS applied with lower rate

Table 1. Effect of different sources of nitrogen and phosphorus along with boron and zinc on soilfertility

Treat pH OC% N P2O5 K2O Ca Mg S Fe Mn Zn Cu(kg/ha) (kg/ha) (ppm)

T1 4.79 1.88 319.9 71 432.1 2.0 1.2 77.9 18.25 2.90 1.135 0.80T2 5.08 1.26 246.7 50.3 438.4 2.8 1.2 81.8 17.57 3.01 0.50 0.68T3 5.09 1.29 363.7 93.8 420.7 2.5 1.2 80.0 22.56 2.62 0.65 0.45T4 5.18 1.72 242.5 47.3 264.3 2.7 1.1 91.9 21.57 3.01 0.45 0.50T5 5.02 1.14 259.2 34.3 256.7 1.7 0.8 98.7 21.43 5.62 4.65 0.74T6 5.12 1.68 234.1 89.3 360.6 2.1 1.1 88.8 23.6 2.06 2.10 0.39T7 5.13 1.40 112.9 53.8 438.0 1.7 0.9 81.9 22.06 3.58 1.27 1.65T8 5.20 1.20 372.1 123.0 428.7 1.9 0.9 91.3 20.08 2.32 0.51 0.59T9 5.45 1.88 117.0 65.5 420.2 2.8 1.5 99.5 25.55 2.48 1.07 0.46T10 5.13 1.19 142.1 63.5 432.3 2.7 1.1 104.7 19.32 2.68 2.35 0.72T11 5.20 1.20 234.1 125.1 520.7 3.0 1.3 109.5 21.72 2.85 2.60 0.69T12 5.35 1.89 309.4 70.2 210.0 1.6 0.7 108.2 22.57 2.75 0.44 0.59T13 5.29 1.87 238.3 128.8 528.6 2.2 1.3 112.5 19.99 2.2 1.66 0.63


of dolomite and was significantly higher than thealone 10% LR dolomite application.(fig. 7)

Development of on farm diagnostic kit for rapidassay of soil health

Soil test kit is developed and to make a soilhealth card based on the tested parameters for rapidsoil health test kit specially suited for the acid soilsof North eastern hill region. The kit contains a kitbox made up of wood with several plastic bottleshaving reagents of specific determination whichare marked by numerical numbers. It also containsscoop, syringe, beaker, graduated test tubes, filterpapers, funnel, droppers, spoon, etc. The kit hasbeen designed for on-form testing by a semi-skilledperson who can test his own soil as often and in asmany places as he feels necessary to apply the limeand fertilizers. The present soil test kit can easilybe transported to the field. Rapid test methods canassess following parameters.

A. Physical1. Percent moisture content in soil2. Weight of water present in soil3. Dry weight of the soil4. Volume of the soil5. Bulk density of soil6. Soil water content7. Volumetric water content8. Percent pore space in soil (% porosity)9. Volume of total pore space10.Soil dispersibility and slaking11.Consistence of soil12.Soil texture analysis (feel method)

B. Chemical

1. Soil pH assessment2. Exchange acidity determination in soil.3. Exchangeable Aluminium determination in

soil

C. Soil fertility1. Organic carbon/matter determination2. Available ammonium status assessment3. Available phosphorus status assessment4. Available potassium status assessment5. Available calcium and Magnesium status

determination6. Available sulphur status assessment.

D.Biological1.Soil respiration health determination.

E.Miscellaneous parameter which will beestimated based on the tests carried outs

1. Percent organic matter status2. Percent total Nitrogen content of soil3. Potential amount of Nitrogen mineralized

from organic matter decomposition.4. Lime potential of soil (Approximately)5. Lime requirement of soil (Approximately)6. Approximate Nitrogen, Phosphorus and

Potassium requirement and fertilizerrecommendation.

7. Approximate cation exchange capacity ofsoil.

8. Approximate percent base saturation of soil9. Approximate Nutrient/Fertility index of soil10.Sulphur availability index of soil


FRUITS

CITRUS

Physico-chemical attributes of grafted plant ofKhasi mandarin

Yellow coloured mature fruits were harvestedfrom 4 years old plants of Khasi mandarin graftedon different rootstocks viz. C. volkamariana, C.latipes, C. taiwanica, C. reshni and C. jambhirifor evaluation of physico-chemical parameters.Maximum fruit weight (130 g), seeds/fruit (25.5),TSS: acid ratio (9.33) and minimum acidity (0.9%)was recorded under C. volkamariana rootstock.Fruit length (55.65 mm), fruit diameter (70.98 mm),specific gravity (0.94) and pH (3.7) were foundhighest under C. taiwanica. The highest TSS(10.4oB) and ascorbic acid (38.3 mg) was recordedunder C. reshni and C. latipes, respectively.

Studies on intercropping with Khasi mandarinSix crops namely French bean (RCFB-1),

cowpea (RCCP-1), groundnut (ICGS-76), soybean(JS-335), rice bean (RCRB-1-6) and urd bean (T-9) were grown as intercrops in two years old Khasimandarin orchard during Kharif season. All thecrops performed well except French bean andcowpea. Maximum yield was recorded ingroundnut (1.7 t/ha) followed by rice bean (1.18 t/ha), urd bean (7.3 t/ha) and soybean (5.8 t/ha).

Effect of mulching on plant growth, weedpopulation and soil moisture status

An experiment on mulching viz., blackpolythene, pine tree leaves, farm grass, leaves ofrice bean, Flemenzia, Crotolaria and Tefrosia alongwith control (without mulch) was conducted on 2years old Khasi mandarin. The leaves and grasswere applied @ 2 kg/m2 twice in a year i.e. Julyand November. Maximum stem diameter (86.94%),number of branch (214.72%) and canopy spread(north-south) was recorded under Tefrosia leaves,while, plant height (61.07%) under rice bean andcanopy spread (east-west) (160.08%) under blackpolythene mulch was recorded over last yeargrowth. Minimum weed density was found underblack polythene mulch (6.67 g/m2) followed by pine

leaves (43.3 g/m2) and maximum in control (633g/m2). Whereas, soil moisture content was foundmaximum under Flemenzia leaves mulch (19.06%)and minimum under control (15.44%).

Evaluation of lemon cultivars for growth andyield

Four cultivars of lemon namely Assam lemon,Gandhraj, Pant lemon and Ureka lemon wereevaluated for growth and yield parameters.Maximum plant growth in terms of plant height(137.2 cm), stem diameter (28.71 mm) and numberof branches/plant (5) in ‘Gandhraj’ was recordedin two years old plant. The number of fruits/plant(7) was also highest in ‘Gandhraj’ followed by‘Assam lemon’ (5) and ‘Pant lemon’ (2).

Evaluation of citrus speciesOut of 19 citrus species planted during 2006,

Rangpur Lime attained maximum height (179 cm)followed by Citrus medica (139.6 cm) Poncirustrifoliata (134.1 cm), Citrus taiwanica (134 cm),and Citrus jambhiri (127 cm). Rangpur Lime (11.30cm), Citrus medica (10 cm) and Citrus taiwanica(9.3 cm) had higher stem circumference comparedto other species. Citrus medica had maximumcanopy spread (107 x 98 cm) followed by Citrusjambhiri (85 x 75 cm), Citrus taiwanica (83.3 x76.3 cm) and Citrus karma (71.6 x 67.6 cm).

GUAVA

Growth, yield and quality attributes of differentcultivars

Three years old eight cultivars of guava viz.Allahabad Safeda, L-49, Lalit, Sangam, RCG-11,RCGH-1, RCGH-4 and RCGH-7 were evaluatedfor growth, yield and fruit quality parameters.RCGH-1 and RCGH-4 recorded vigorous growthand yield among all genotypes. The maximum fruitweight (225 g) was recorded under RCGH-4 andthe fruits of RCGH-7 recorded higher TSS (13%).

PASSION FRUIT

Yield and physico-chemical parameters ofpassion fruit

Three species (Passiflora edulis, P. edulis f.flavicarpa, P. alata) of passion fruit comprising


nine genotypes viz. Meghalaya purple, Nagalandpurple, Kerala yellow, RCPS-1, Panama yellow,DPI, EC-1 and EC-2 were evaluated for fruit yieldand physico-chemical parameters of three years oldplants. The number of fruits/plant varied from 85-145 in Passiflora edulis, 105-120 in P. edulis f.flavicarpa and 12-20 in P. alata. Physico-chemicalattributes of passion fruit showed the great variationin their fruit weight, size, juice % and quality traitslike TSS, acidity, ascorbic acid and sugars due togenotypes of different species.

UNDERUTILIZED FRUITS

Standardization of propagation techniques forSohiong (Prunus nepalensis)

Wedge and tongue grafting were performed onone year old seedling of sohiong rootstock duringOctober. Graft success was found to be higher intongue grafting (70 %) than wedge grafting (60%).

Studies on physico-chemical properties ofdifferent underutilized fruits

Fruits of six genotypes of Elaeagnus latifolia(Soh-shang) were evaluated. Fruit weight rangedfrom 6.73 to 22.94 g with an average fruit weightof 14.06 g. Pulp recovery from fruits ranged from58.40 to 74.69% with average of 70.24%. TSSranged from 8.8 to 11.20B, acidity 1.96-4.03%, pH3.1-3.3, ascorbic acid 4.8-7.2mg/ 100g pulp and

TSS: acidity ratio from 2.23 to 5.71 in differentgenotypes.

MyricaThe fruits of Myrica (Green and partially pinkstage) were evaluated. Fruit weight ranged from9.75 to 15.25 g and 7.75-11.35 g, TSS 6.6 and 8.8%in green and partially pink fruits, respectively.

STRAWBERRY

Standardization of NPK doses and spacingNitrogen ( 60, 80, 100 kg/ha), phosphorus (60

kg/ha) and potash ( 80, 100, 120 kg/ha) was appliedas basal dose to all the plants under three differentspacing i.e. 30 x 30 cm, 30 x 20 cm and 20 x 20cm. Maximum plant height (19 cm) and plantspread (east-west) (21.2 cm) was recorded under80:60:120 kg NPK/ha, while, in north-southdirection it was maximum in 80:60:140 kg NPK/ha. Maximum fruits/plant (21.6), yield/plant (250.7g), acidity (1.45%), total sugars (7.8%) andascorbic acid (92.7 mg/ 100 g pulp) was recordedunder 100:60:120 kg NPK/ha while higher fruitweight (12.8 g) and TSS (10o Brix) was recordedunder 60:60:120 kg NPK/ha.

Higher plant height (19.5 cm), plant spread(22.7 x 22.7 cm), number of fruits/plant (23.3), fruitweight (12.6 g), yield/plant (292.8 g), TSS(10.1oBrix) and total sugars (8.9%) were foundunder 30 x 30 cm spacing. A fertilizer dose of100:60:120 kg NPK/ha at a spacing of 30 x 30 cm

Table1. Physico-chemical parameters of Passion fruit genotypes/species

Genotypes Fruit wt. Juice TSS Acidity pH Ascorbic acid Total(g) (%) (0B) (%) (mg/100 ml juice) sugar

(%)

Passiflora edulisMegha Purple 41.0 28.5 15.8 2.8 4.1 48.8 14.6Nagaland purple 43.0 30.9 15.0 3.3 4.8 41.3 18.1P. edulis f. flavicarpaKerala yellow 114.2 36.3 16.4 4.9 6.0 22.8 16.6RCPS-1 133.8 40.8 16.8 4.4 6.0 31.5 15.4Panama Yellow 112.4 38.2 17.4 3.5 6.1 22.5 13.3DPI 95.6 32.7 16.2 3.8 6.1 26.5 10.0P. alataEC-1 192.9 22.4 19.0 1.4 6.0 30.8 13.5EC-2 123.3 16.2 22.0 1.4 6.0 14.4 12.9


were found better with respect to growth and yieldof strawberry cv. Ofra.

PEACH

Effect of pruning severity and time on earlyflowering

Peach cv. TA-170 was pruned on 30th October,15th November and 30th November (normal pruningtime) with 50% and 75% pruning severity. Earliestshoot emergence was recorded in 30th Octoberpruned trees. 12 days early fruiting was recordedin the trees pruned on 30th October with 75%severity than normal pruning date (30th November.

PLUM

Evaluation of low chilling plums for vegetativecharacters

‘Kala Amritsari’ attained maximum plant height(1.78 m), trunk cross sectional area (23.34 mm)and plant spread (east-west) (1.54 m), whereas,‘Satluj Purple’ recorded highest number of primarybranches (3.34) and plant spread (north-south) (1.2m) as compared to ‘Santa Rosa’, ‘Doris’ and‘Japanese plum’ after three years of planting.

KIWIFRUIT

Antioxidant and mineral contents of kiwifruitcultivars across locations

Antioxidant and mineral contents of kiwifruitcultivars were evaluated across different locationslike Barapani, Upper Shillong (Meghalaya),Gangtok (Sikkim) and Dirang (Arunachal Pradesh).Cultivar ‘Hayward’ under Dirang conditionsrecorded highest Vitamin C (103.62 mg/100g), â-Carotene (1.37 mg/100g), P (35.1 mg/100g), K (285mg/100g) and Ca (31.2 mg/100g). Total phenoliccontent ranged from 85.5 mg/100g in ‘Hayward’under Upper Shillong to 137.0 mg/100g in ‘Allison’under Dirang condition. Minimum vitamin C(74.23 mg/100g) in ‘Monty’, Ca content (14.3 mg/100g) in ‘Abbot’, P (20.5 mg/100g) and K (192mg/100g) in ‘Bruno’ was recorded under Barapanicondition.

DISEASES

PAPAYA

Screening of papaya cultivars against majordiseases

Seven varieties of papaya viz. Pusa Nanha,Ambasa Local, Selection 1, Pusa Dwarf, PusaDelicious, CO2 and Local cultivar (Nongpoh) wereevaluated against Powdery mildew, Ascochytablight and Papaya ring spot virus (prsv-p) diseases.Pusa Nanha and Ambasa Local showed resistantreaction against all the three diseases. All the testedvarieties appeared to be resistant against Ascochytablight. Local (Nongpoh) var., Selection 1 and CO2were found to be highly susceptible to (prsv-p).

Occurrence of hyperparasite on powderymildew pathogen of papaya

In northeastern region powdery mildew causedby Oidium caricae occurs in devastating form onpapaya. During a general survey at Barapani,Meghalaya, a hyperparasite was found to beassociated with O. caricae. It was identified asCladosporium cladosporioides causing lysis ofmycelium and conidiophores of O. caricae.

CITRUSDiseased samples of citrus scab were collected

from ICAR farm (Entomology, Horticulture);Farmers’ Orchards at Ranibari (Ri-Bhoi), Umsning(Ri-Bhoi), Cheruphi (Jaintia Hills) villages andState government orchard and nursery at Mynkre(Jaintia Hills). The samples were also collectedfrom Sikkim (Saramsa KVK farm and horticulturefarm). The pathogen was isolated and identified(Elsinoe spp.). Ten citrus species were planted andare maintained at Plant Pathology farm.

INSECTS AND PESTS

CITRUS

Management of major citrus insect-pestsEvaluation of different biopesticides and

conventional insecticides showed that karanjin @


2 ml/l was at par with monocrotophos @ 2ml/ l incontrolling the aphids, leaf miners and scales.Monocrotophos @ 2 ml/hole was found effectivein controlling citrus trunk borer.

VEGETABLES

TOMATO

Screening of cultivars/ lines against bacterialwilt

Ten lines were evaluated against bacterial wiltunder field condition. Four lines namely, BT-1, LE-1-2, Megha Tomato-1 and Megha Tomato-2 wererecorded as highly resistant to bacterial wilt withyield potential of 32.5, 29.8, 35.2 and 31.0 t/ha,respectively.

Off Season production under low-costpolyhouse

Six varieties including two hybrids wereevaluated under low-cost polyhouse. Hybrid Rockyhad the highest yield per plant (1845.60 g) with anaverage fruit weight of 115.35 g/ fruit. TSS (9.0ºB) and ascorbic acid (25.2 mg/100g,) content werehighest in the variety ‘Megha Tomato-2’ with anaverage yield of 942.08 g/ plant, while lycopene(37.76 mg/100g) was found highest in ‘Selection-2’ with an average yield of 1104.89 g/ plant.

BRINJAL

Evaluation studies (long type)24 lines were evaluated for yield and yield

attributing characters. Megha Brinjal-2 recordedthe highest yield (41.0 t/ha) followed by BCB-11.Megha Brinjal-2 has been included in InitialEvaluation Trial (IET) under All India CoordinatedResearch Project on Vegetable Crops formultilocational field trial.

Screening against bacterial wiltFifteen genotypes were evaluated for screening

against bacterial wilt under field condition.RCMBL-3 recorded 1% mortality with averageyield of 38.9 t/ha. Susceptible check variety PusaPurple Long (PPL) recorded maximum wilting(71.2%). The resistant check ‘SM-6-6’ and ‘ArkaNidhi’ recorded 29.9 t/ha and 31.3 t/ha yield,respectively. ‘Singh Nath’ and ‘Bhola Nath’ alsorecorded less wilt with good yield.

Table 2. Performance of brinjal genotypesagainst bacterial wilt

Entries Fruit length Yield Mortality(cm) (t/ha) (Wilt %)

RCMBL-3 21.5 38.9 1BB-54 14.5 30.4 5Singh Nath 18.5 30.7 1Bhola Nath 13.8 30.0 2SM-6-6 (c) 14.5 29.9 3Utsav 16.5 22.4 5PPL - (SC) 20.8 6.1 71.2Arka Nidhi (c) 17.5 31.3 3.5CD (%) 2.5 2.27 1.5

Table 1. Physico-chemical parameters of tomato varieties under low-cost polyhouse

Varieties Fruit Fruits/ Yield/ TSS Ascorbic Lycopeneweight (g) plant plant (g) (ºB) acid (mg/100g)

(mg/100g)

Selection –2 (Manileima) 67.66 16.33 1104.89 6.6 16.80 37.76Megha Tomato –2 57.69 16.33 942.08 9.0 25.20 24.65Megha Tomato –1 71.12 16.00 1137.92 8.4 21.60 29.96Megha Tomato 1-1 89.06 17.76 1573.69 7.6 22.80 33.39Rocky 115.35 16.00 1845.60 7.4 16.80 20.13Cheeranjeevi 82.93 13.67 1133.65 8.0 15.60 22.78


CHILLI

Evaluation for quality charactersSixty three varieties/lines were evaluated for

quality characters. Colour value estimate rangedfrom 28.86 ASTA unit (RCC-04-24-1) to 135.75(RCC-04-7) ASTA unit. The ascorbic acid rangedfrom 30.80 to 174.22 mg/100 g. The ascorbic acidcontent in local genotypes like ‘King Chilli’ and‘Bird Eye Chilli’ (BEC) was also recorded to be139.62 and 112.32 mg/100 g, respectively.

Table 3.Chemical parameters of important chilligenotypes

Varieties/lines ASTA Ascorbic acidcolor values (mg/100g)

RCC-04-2 82.98 158.40RC C-04-05 70.36 174.22RCC-04-07 135.75 112.00RCC-04-7 101.97 110.1RCC-04-16 47.44 27.50RCC-04-23-1 45.84 156.67RCC-04-24-1 28.86 30.80RCC-04-24-2 46.69 150.10RCC-04-29 150.95 145.6RCC-04-81 104.02 92.40Megha Chilli 74.80 67.10KA2 72.28 142.80King Chilli-1 45.84 139.62Bird Eye Chilli (BEC) 59.94 112.32

TUBER CROPS

Evaluation studies on colocasiaTwenty-nine varieties/genotypes of colocasia

were evaluated for yield and yield attributingcharacters. Maximum plant height was recordedin CO-3 followed by TVM-293. Mother cormlength was highest in CO-3 (17.70 cm), howeverhighest cormel length was recorded in ML-2 (7.23cm). Among all genotypes, highest yield wasrecorded in ML-1 (26.6 t/ha) followed byMeghalaya Collection –1 (21.3 t/ha), ML-9 (19.1t/ha) and BCC-1 (18.0 t/ha).

Quality parameters of important sweet potatovarieties/lines

Fifteen varieties/lines were evaluated for theirquality characters. ST-14 recorded maximum β-

carotene (18.88 mg/100g). However, maximumstarch (17.50% ) and total sugars (18.20%) wererecorded in ‘Sree Bhadra’.

Table 4. Quality attributes of important sweetpotato genotypes

Varieties/lines Starch βββββ-carotene Total(%) (mg/ 100g) sugar

(%)

ST-14 15.96 18.88 14.29(orange fleshed)Meghalaya Local 13.25 5.46 15.80(yellow fleshed)Sree Bhadra 17.58 1.60 18.20Kokrajhar Red 12.50 1.30 15.33Kokrajhar Local 8.98 1.84 15.30187017-1 14.7 5.22 14.80(orange fleshed)

CAULIFLOWER AND BROCCOLI

Standardization of seed production techniquesThe cauliflower ‘Meghalaya Local’ and

broccoli ‘Palam Samridhi’ were planted in Augustand September, respectively for seed production.The Meghalaya Local curd matured in January andafter that the whole plant was removed andreplanted at a spacing of 60X60 cm. In broccoli,the head matured in mid December and replantedat December end at a spacing of 45 x 45 cm. Theplants came to flowering after 15-20 days. At thetime of flowering individual plants were coveredwith nylon bags to avoid cross pollination betweencrops. In April, seeds were harvested before rainfallstarts. Higher seed yield was obtained through seedto seed method as compared to head to seedmethod.

Table 5. Seed yield (t/ha) of cauliflower andbroccoli

Crop Seed to Head to seedseed method method

Cauliflower 25.3 t/ha 18.7 t/ha(Meghalaya Local)Broccoli 11.2 t/ha 7.9 t/ha(Palam Samridhi)


DOLICHOS BEAN

Identification of photo insensitive and shortduration genotype (s)

Twenty genotypes were sown during April, Juneand August for identification of photo insensitivelines. In April and June sowing, only one genotypei.e. RCDL-10 came into flowering and pod formedsuccessfully. Rest of the genotypes did not comeinto flowering. All the genotypes came intoflowering in the month of November. It can be sownfrom April to November at a spacing of 80x40 cm.Ist harvesting can be done after 75 days of sowing.Average pod weight is 4.0- 4.5 g and pod/plantvaries from 95-100 g. About 140-150 q green podyield can be recorded from one hectare. It is foundto be tolerant to aphids, leaf spot and powderymildew disease.

SWEET GOURD (Momordica cochinchinensis)

Evaluation for yield and quality charactersForty genotypes were evaluated for quantitative

and qualitative characters. The earliest flowering(41 days) was observed under RCSG-15 andRCSG-16. However, earliest harvesting (74 days)was recorded in RCSG-17 followed by in RCSG-25 (75 days). The highest fruit length (8.9 cm) wasmeasured in RCSG-26 followed by 8.36 cm underRCSG-23. However, maximum fruit diameter (4.5cm) was observed in RCSG-6. The maximumnumber of fruits per plant (33.5) was noted underRCSG-18. The RCSG-26 was noted for maximumfruit yield per plant (2665 g) followed by 2249 gunder RCSG-18. The average fruit weight wasmaximum (67.8 g) under RCSG-42 followed by67.13 g in the RCSG-18. Ascorbic acid was highest(88.2 mg/100g) in RCSG-16 followed by RCSG-2(84.24 mg/100g).

INSECTS AND PESTS

CABBAGEToxicity of different botanicals and biorationalinsecticides against third instar larvae ofcabbage butterfly Pieris brassicae

Five different botanicals and biorationalinsecticides viz., spinosad 2.5 SC, novaluron 10

EC, anonin 1 EC, karanjin 2 EC and nimbicidine0.03 EC were tested for their toxicity against thirdinstar larvae of cabbage butterfly Pieris brassicaeunder laboratory conditions. It was found that,among five biorational insecticides evaluatedanonin was found to be more toxic and novaluronleast toxic to third instar larvae of P. brassicae.Anonin was 57.20 times more toxic followed byspinosad 28.33, kranjin 1.28 and novaluron 0.024times toxic as compared to nimbicidine .

Toxicity of two new insecticides novaluron andspinosad against different instars of cabbagebutterfly Pieris brassicae

Toxicity of two new “reduced risk” insecticidesviz., novaluron 10 EC and spinosad 2.5 SC wereevaluated against different instars of cabbagebutterfly Pieris brassica and it was found that firstinstar larvae was most susceptible and dosedependent mortality was observed for both the newinsecticides. The LC50 values for spinosad was0.0068, 0.01167, 0.08967 and for novaluron it was42.94, 61.85, 102.9 ppm against first, second andthird instar larvae of P. brassicae, respectively.Based on LC50 values spinosad, a soil originmicrobial insecticide derived from fermentation ofthe soil actinomycete, Saccharopolyspora spinosawas very much toxic to larvae of P. brassicae atvery low does.

TOMATOPlant extracts and their role in management ofroot knot nematode

The crude leaf extracts of lemon, banana, guavaand neem at 5%, 10% and 15% concentration werescreened against the second stage juveniles ofMeloidogyne incognita under laboratoryconditions. Neem leaf extract at 10% concentrationin 24 hrs exposure and at 5% concentration in 48hrs exposure gave 100% mortality of the nematode.

Powder of pine-needle, tithonia leaf, ja-mardohleaf at three dosages (0.5, 1 and 1.5 g/kg soil) andcarbofuran (16.5 mg/kg) as standard check wereevaluated against M. incognita (1000 J2/kg soil)inoculated tomato variety KS 227 under potconditions. Ja-mardoh leaf powder @ 1.5 kg/kg soilwas found significantly effective resulting 80%reduction in nematode population and increase ingrowth parameters of tomato.


FLORICULTURE

GLADIOLUSEvaluation for flowering and corm characters

Six varieties i.e. Fidelio, White Friendship, Spic& Span, Casa Blanca, Golden Goddess and RosibeeRed were introduced and evaluated during summerseason. Maximum plant height (118.22 cm), spikelength (98.07 cm), rachis length (51.10 cm) andnumber of florets per spike (15.22) were found in‘Casa Blanca’. Largest (4.83 cm) and heaviest corm(42.50 g), maximum polar (2.03 cm) and equatorial(1.73 cm) diameter, weight of 20 cormels (14.74g) was produced in ‘Spic & Span’.

Effect of substrate mediaTen substrate media (v/v) i.e. soil (1), soil +

FYM (1:1), soil + leaf mould (1:1), soil + cocopeat(1:1), soil + vermicompost (1:1), soil + sand (1:1),soil + sand + cocopeat (1:1:1), soil + sand+ FYM(1:1:1), soil + sand +leaf mould (1:1:1) and soil +sand + vermicompost (1:1:1) were used to improvethe quality of ‘Jester’ cormels. Substrate mediaconsists of soil + cocopeat (1:1) producedmaximum roots length (24.33 cm), number of roots(3.85) per cormel and length of contractile roots(11.18 cm). However, maximum cormel diameter(14.48 cm), weight (7.80 g) of five cormels andpropagation coefficient (359.44%) was recordedunder soil + sand + vermicompost (1:1:1), whilemaximum number of contractile roots per corm wasfound in soil + vermicompost (1:1).

Effect of Benzyl AdeninePre-planting soaking of ‘Candyman’ corms with

benzyl adenine (BA) with different concentration(ppm) i.e., 25, 50, 75, 100, 150 and tap water for24 hours was done to observe its effect on cormelproduction. Corm soaking with BA (50ppm)increased contractile roots (22.86) and daughtercormels (23.25) per plant. However, maximumnumber (5.73) of shoots per plant was found inBA (100ppm).

GERBERAEvaluation for flowering characters

Among the 21 cultivars evaluated under openconditions, cv. Nebulusa produced maximum

number of leaves (34) and flowers per plant (8.80).Longest stalk (45.20 cm) was produced in ‘BlackHeart’. Significantly maximum stalk diameter(4.60mm) was produced in ‘Yellow Queen’, while,maximum flower diameter (10.30 cm) was foundin ‘Divas Memory’

Among the 32 genotypes hybrids/genotypesevaluated under open conditions, maximumnumber of leaves per plant (29.31) and flowerdiameter (11.50cm) was recorded in RCGH-226.However, longest stalk (42.73 cm) was measuredin RCGH-32 and maximum stalk diameter (5.58mm) was found in RCGH-65, while more numberof flowers per plant (9.16) was produced in RCGH-6.

Effect of shade net on floweringTwo varieties i.e, Black Heart, Alsmeera and

one hybrid RCGH-117 were evaluated under 50%and 75% shade net. 50% light intensity shadenetresponded better than the 75% for flowering.Maximum flowers/plant (7.20), flower diameter(9.00cm) was recorded in RCGH-117 under 50%shade net, while longest stalk (38.00cm) wasnoticed in Alsmeera under 50% light intensityshadenet.

ORCHIDSAltogether, 40 orchid species were collected

from different locality of Meghalaya for evaluationin pots kept under 75% shade net.

WILD ORNAMENTALSAn exploration was done to collect the wild

species of ornamental species from differentlocalities of Meghalaya for commercial utilization.Collected species were planted in pots and onground under partial shade for evaluation.

DISEASES

GERBERAScreening against powdery mildew

Fifty-seven gerbera lines/germplasm werescreened against powdery mildew disease causedby Golovinomyces cichoracearum using 0-9 scale.RCG 3, 9, 19, 21, No. 2, 7, 12, 127 and 108 were


found to be moderately resistant. All otheraccessions were found to be highly susceptible.RCG 6 and 16 had heavy infection on flower stalk.

Table 9. Wild ornamental species collected from different sources

Area explored Species collected

Sohra (Cherrapungi),alt. 1795m) Hedychium spicatum, Prunella vugaris, Cobra lily, Hedychium orange flower,Cestrum aurentiacum, Epremnum, Calanthe orchid, Bamboo orchid, Vanda,Strabilanthus, Dendrobium

Mawngap (Cherrapungi) Begonia rex, ferns, Fressia sp.Pynursla (Way to Dawki),alt. 1828m Hedychium sp.Nongstoin, alt. 1715m Hedychium coronarium, Chlorophytum sp., Hedychium coccineum, Asplenium sp.Nongpoh Hedychium (2 species), Caladium, Heliconia, Hedychium thrysiformeMawyong (Near Nongpoh) Heliconia sp.Jowai, alt. 1358m Hedychium sp. Vanda, Hedychium coronarium, bamboo orchidNongthynai (Jowai area) Orchids

POST HARVEST MANAGEMENT

Effect of slice thickness and blanching time onquality of osmotically dehydrated Chow-chowtooty fruity

The osmotic dehydrated chow chow tooty fruitywere prepared with different slice thickness (2-10mm). The process parameters were slice thickness(2-10 mm) and blanching duration (0-20 minutes)followed by immersion of slices to 40ºB andsubsequently at 70ºB sugar solutions containing0.05% Potassium meta bisulphate and 0.1% citricacid for 1-2 hours at warm condition (80ºC).Response surface methodology (RSM) design wasused for this experiment and final products wereevaluated for nutritive value and organolepticquality. Minimum loss in ascorbic acid (18.18%)was recorded in slice thickness of 10 mm withoutblanching. However, maximum overallacceptability score was recorded in slice thicknessof 6 mm followed by 15 minutes blanchingtreatment.

Effect of pulp content and total soluble solids(TSS) on sensory quality of peach nectar

An experiment was conducted on peach fruitcv. TA-170 for preparation of nectar. RSM wasapplied to design the experiments considering pulp

content and TSS as response variables. Sensoryquality parameters considered for thisexperimentation were appearance, flavour, texture/body, taste and overall acceptability. Optimumnectar (desirability value of 0.812) was obtainedin the product having pulp and TSS content of47.86% and 32.00%, respectively.

Effect of pre-harvest treatment on post harvestquality and shelf life of strawberry

CaCl2 (1 & 2%), Ca (NO3)2 (1 & 2%), potassiumsulphate (1 & 2%) and boric acid (0.2 and 0.4%)were sprayed thrice starting from flowering to 10days before harvesting. Plant sprayed with CaCl2(2%) recorded minimum weight loss and decay lossfollowed by boric acid (0.4%), whereas, highestTSS, total sugars and ascorbic acid was recordedin plants sprayed with potassium sulphate (2%).

Studies on effect of different botanical onphysiological loss in weight and number ofsprouts during storage of fresh ginger

Thirty different botanicals (30 botanicals + 1plain water dip + without any dip) were used toevaluate their effects in reducing the physiologicalloss in weight (PLW) and inhibiting the number ofsprouts during storage of fresh ginger at ambientcondition. 500g of rhizomes were dip for 30minutes in 1 liter of solution followed by surfaceremoval of moisture under shade. All the sampleswere then placed into the plastic crates with singlelayer and kept at ambient condition. Qualityparameters i.e., PLW and numbers of sproutsinitiation were recorded at 15 days interval for totalperiods of 75 days. Minimum PLW (16.40%) wasrecorded in botanical coded as 666L while,


maximum PLW (38.75%) was recorded in plainwater dip treated sample up to a total periods of 75days of storage. However, minimum numbers ofsprouts initiation were recorded in samples codedas 538L (5 nos.) followed by 780L (6 nos.); 524,813L and 683L (7 nos.) up to a total periods of 75days of storage.

Evaluation of leafy vegetables for qualityparameters

Three commonly used leafy vegetables i.e.,mustard yellow, mustard black and Chinesecabbage were used for evaluation at different stagesof maturity. Leafy vegetables samples werecollected at 10 days interval after the emergenceand different quality parameters were evaluated.Maximum total carotenoid content of 91.21 µg/g,75.38 µg/g and 95.11 µg/g in mustard yellow,mustard black and Chinese cabbage was recordedat 20th, 40th and 30th days after emergence,respectively.

Standardization of packaging material forincreasing the shelf life of broccoli

Different packaging materials were used forincreasing the shelf life of broccoli hybrid ‘Pushpa’under room temperature. Two packaging materialsi.e. poly propylene (PP, 100 gauge) and Lowdensity poly ethylene (LDPE, 200 gauge) with orwithout perforation were used. With the increaseof perforation, the physiological weight loss inweight was also increased. The minimum weightloss (0.97%) after eight days was recorded in LDPEwithout perforation followed by PP withoutperforation (1.66 %). After eight days, more than50% weight loss was recorded in control.

Effect of chemicals on vase life of gerberaMaximum vase life (7.86 days) and total water

uptake (15.04 ml) was measured with sucrose (2%)+ Al2SO4 (300ppm) when used as holding solutionin ‘Black Heart’.

INSECTS AND PESTS

Post harvest management of insect pests instored grains

Survey of insect pests of stored grainsA systematic survey was carried out in different

places of Meghalaya during different croppingseasons. During survey randomly, 250-500 gmssamples of different food grains viz., cereals (paddyand maize) and pulses were collected immediatelyafter harvest and from the storage structures orgodowns which were kept for a period of 3- 9months of storage from farmers store. The grainsamples collected were grouped commodity wisein polyethylene bags and were tightly closed toavoid change in moisture content and escape ofinsects. These samples were analysed forinfestation and insects causing damage wereidentified as major and minor on the basis of totalno of insects present in the samples in stored paddy,maize and pulses. The results indicated that all tenspecies of storage insects pests, were commonlyfound infesting the stored garins, but out of these,only eight were found as major pests (Table 1). Itwas also observed that these insects were morecommon on husked and milled products, whichmay be due to prevalence of high moisture andrelative humidity round the year.

Table 1. Major storage insect pests associatedwith stored cereals and pulses

Crop Major Insect Pests

1. Paddy Rice weevil (Sitophilus oryzae), Rice Moth(Corcyra cephalonica)Rust Red flour beetle (Tribolium castaneum),Angumois Grain Moth (Sitotroga cerealla)

2. Maize Maize weevil (S. zeamays ), Angumois GrainMoth (Sitotroga cerealla), Meal Moth (Plodiainterpunctella), Carphophillus spp.

3. Pulses Pulse beetle (Callosobruchus spp.)

Table 10. Physiological weight loss in weight (%)of broccoli under different packaging material

Treatments 2 DAS 4 DAS 6 DAS 8 DAS

PP 0% perforation 0.35 0.69 0.90 1.66PP 0.5% perforated 1.53 3.20 4.50 5.09PP 1.0% perforated 2.35 4.97 6.90 7.95PP 1.5% perforated 5.77 12.30 16.90 19.24LDPE 0% perforation 0.33 0.65 0.89 0.97LDPE 0.5 % perforated 1.50 3.04 4.06 4.65LDPE 1.0 % perforated 4.35 9.00 12.28 13.94LDPE 1.5 % perforated 5.58 11.27 15.41 17.74 Control 24.20 41.40 51.68 55.47


Studies on incidence of stored insect pests ondifferent commodities

The grain samples collected during surveyswere analysed for incidence and abundance ofinsect pests on different commodities of paddy,maize and pulses with in a period of 2-3 weeks ofcollection. Results revealed that several insect pestsare associated with these commodities and theirincidence and abundance was relatively differentin different commodities (Table 2). The insectscollected were preserved and catalogued for theiridentification at species level.

Table 2. Incidence of insect pests in commonly stored food grains in Meghalaya.

Insect Pests Paddy Paddy Maize Unmilled Milledwith husk without Pulses Pulses

husk

Rice weevil (Sitophilus oryzae) xx xxx xx - -Rice Moth (Corcyra cephalonica) xxx xx - - -Rust Red flour beetle Tribolium castaneum, x xx xx x xxAngumois Grain Moth(Sitotroga cerealla) xxx xx xx- - -Maize weevil (S. zeamays ) - x xxx - -Meal Moth (Plodia interpunctella) - - xx - -Died fruit beetle (Carphophillus spp.) - xx xxx - xxPulse beetle (Callosobruchus spp.) - - - xxx xxx

xxx = High, xx =medium, x = low, and - = nil

SPICES

TURMERIC

Stability analysis for yield and yield attributesForty two turmeric genotypes were evaluated

for three consecutive years for primary rhizomes/plant, secondary rhizomes/plant, weight of primaryrhizome, weight of secondary rhizome and totalrhizome yield. Pooled analysis of variance revealedpresence of wide range of variability among thegenotypes for all the characters. The significantmean square due to genotype x environmentinteraction indicated that the genotypes interactedconsiderably with environments for expression ofall characters and showed variable response to

change environment. Based on individualparameters of stability (Xi, bi and S2di), genotypeCLI Jyoti was found stable in performance overthe years. The genotype Manipur Local hadsignificantly higher regression coefficients alongwith mean values above general mean for totalrhizome yield indicating the scope for improvedperformance under favourable environment.Megha Turmeric- recorded highest yield potentialin all the three environments but was found unstablebased on stability parameters.

Collection and evaluation of turmeric genotypesfor higher yield and curcumin content

Eight genotypes of turmeric were collected fromnortheast region during 2007-08. The genotypeRCT-2 was identified for higher curcumin content(4.50%). The total curcuminodes of genotype RCT-2 varied from 10.6 % (HPLC) to 11.2%(Spectrophotometer).

Fig. 1. Typical HPLC chromatogram of turmericgenotype RCT-2 showing highest curcumin content


Table 1. Classification of turmeric genotypes for stability

Characters Genotype identification

General adaptability Specific adaptabilityS2

di=0, X>µ,Bi=1

Better environment Poor environmentS2

di=0, X>µ,Bi>1 S2di=0, X>µ,Bi<1

No. of primary Duggiralla, PCT-14, CA-1/146/4, PTS-9, CLI-315, PTS-11, VIK-324, Kasturi Joyotirhizome/ plant PCT-10, PCT-13 Kasturi Janaka, Lakadang Pody, VK-17, KuchipudiNo. of secondary TC-17 (RCT-1), PCT-13 Meghalaya Local-2, PCT-10, CA-1/146/4, PTS-11,rhizome/plant Manipur Local, TC-36,TC-37, Sugandham

Jorhat Local, Lakadang,VIK-145

Weight of primary TC-17, PCT-10, PCT-18, Duggiralla CLI-339rhizome/plant (g) CLI-370, Kasturi Avedi,

GL-Puram, TC-36,Sugandham, CLI-367

Weight of secondary _ _ _rhizome/plant (g)Total fresh rhizome CLI Jyoti Manipur Local _yield (t/ha)

Table 2. Total curcuminoids content of different genotypes of turmeric

Varieties Curcumin Demetho- Bismetho- Total Totalcontent (%) xycurcumin xycurcumin Curcuminoids Curcuminoids

content (%) content (%) (%) by UV (%)

Megha Turmeric-1 3.50 1.60 0.44 6.53 6.95Lakadong 3.39 2.10 1.32 6.82 7.73RCT-2 4.50 2.40 3.70 10.60 11.20

MUSHROOM

AICRP (Mushroom)

Strainal evaluation of oyster mushroom (P.sajor-caju)

Of 5 strains tested the highest yield wasrecorded in PSC- O5 (73.8 g/ kg straw) followedby PSC- O1 (68.6 g/ kg straw), PSC- O2 (67.6 g/kg straw) and PSC- O3 (54.1 g/ kg straw). Thelowest yield was recorded in PSC- O4 (41.3 g/ kgstraw).

Strainal evaluation of oyster mushroom (P.florida)

P. florida strain code 01 recorded 46.9 kg, straincode 02 recorded 42.6 kg , strain code 03 recorded

46.2 kg and strain code 04 recorded 54.3 kg freshmushroom yields per 100kg of dry paddy straw.The strain code 05 gave very poor yield i.e.6kg/100kg straw).

Evaluation of the yield potential of P. fossulatusand P. florida.

P. florida recorded 63.6 kg/100kg paddy strawwhile P. fossulatus gave average yield of 21 kg freshmushrooms /100kg paddy straw.

Strainal evaluation of paddy straw mushroom.The strain VV2 recorded (2.78 kg), VV6 (4.58

kg), VV8 (1.36 kg) and VV11 (6.17 kg) per100kgpaddy straw. Poor yield was due to unfavorableclimatic condition.


Effect of chemical spray on yield on P. sajor-caju

P. sajor-caju recorded poor yield.31.1-37.8 kg/100kg straw. No significant difference wasobserved among various chemical sprays (viz. 100,200 ppm urea and 0.1 M K2HPO4.

Effect of chemical sprays on yield P. floridaThere was no significant difference between the

treatments. Urea 100ppm recorded 44kg, urea200ppm 46.2 kg and K2HPO4 41.1 kg/100 kg straw.

Evaluation of Hypsizygus ulmarius on differentsubstrate

Paddy straw recorded 66.1kg/ 100kg straw andpaddy straw + wheat straw recorded 63.9kg/100kg straw.

WATER RESOURCES

Characterization of water quality from varioussources for its suitability in agricultural use

In the present study, water samples werecollected from different sources located at variousdistricts of Meghalaya and Tripura and analyseddifferent elements to assess the quality parameterof water resources. Most samples collected fromMeghalaya were acidic or neutral in reaction (pH3.93 to 6.91). All the samples had very lowpotassium, sodium, sulphur, calcium andmagnesium content. Phosphorus content werecategorized mostly under high and medium. Thenitrate-N content ranged from 11.2 to 30.8 ppm,mostly categorized under low and very low group.The carbonate content of the samples classifiedunder none which had no toxic effect for irrigationuse. However, bicarbonate contents ranged from2.3 to 6 meq/1000 ml. Based on the relative statusof the bicarbonate content, most of the sampleswere classified under high to severe toxicity levels.Similarly, the residual RSC values fluctuated inbetween 2.22 to 12.24, broadly classified under

high to severe toxicity level. Based on the SARvalues, the water samples were categorized undernone/no-toxicity level. The pH of water samplescollected from Tripura showed a variation from6.11 to 7.68 and the maximum permissible pH isaround 6.5 to 8.5. So, pH of drinking water insome places was not up to the permissible limit.Concentration of nitrate, phosphate, potassium andcalcium in water samples varied from 1.0 to 7.2mg/L, 0.04 to 1.43, 0.09 to 2.24 and 0.64 to 11.48mg/L, respectively. Nitrate contamination may turnout to be problematic if the concentration is above10 mg/L NO3-N or 45 mg/L NO3. Contents of Zn,Cu, Mn and Fe varied from trace to 129, trace to11, trace to 990 and trace to 4205 µg/L. Some ofthe water samples analysed had a high content ofiron contamination.

Long-term pastoral effect on soil quality in acidsoil

Soil quality was examined after 15 croppingcycles of a long-term perennial pasture with variousgrasses maintained at a permanent fodder block ofthe institute. The aim was (i) to ascertain whetherperennial grass primarily maintained as foddersource for ruminants could conserve resources andimprove soil quality in the hilly ecosystem ofnortheast India, and ii) to select a suitable perennialgrass, which would minimize land degradation,restore soil organic carbon (SOC) and improve thesoil quality. Perennial grasses were Setariasphacelata (Setaria), Brachieria rosenesis(Congosignal), Thysanolaena maxima (Broom),Panicum maximum var. Makunia (Guinea)Panicum maximum var. Hamil (Guinea),Pennisetum purpureum (Napier), Paspalumconjugalum (Paspalam) and Arachis pintoi (wildgroundnut). In general, long-term pastural effectincreased SOC by 30 %, water stable aggregateby 40 %, mean weight diameter by 70 %, availablesoil moisture by 20 %, soil microbial biomasscarbon by 10 %, over no grass cover (control).Among grasses, soil under Setaria, Congosignaland Makunia had higher value of these attributesover other species because of their better soilbinding effect through extensive root system. Suchimprovement of soil physical properties andprocesses such as aggregation, water holdingcapacity, hydraulic conductivity under these


grasses coupled with complete ground coverreduced soil erosion ratio to the extent of 33% andalso signified the ecological importance throughC-sequestration which has a direct bearing on long-term sustainability, soil erosion and soil quality incomplex, diverse, risk-prone, fragile hillyecosystem.

Soil moisture regimes and phosphorusinteraction in groundnut

Field study was continued for third year withthree moisture regimes as main plots (Beds with30 cm bunds around the plots, Flat beds withoutbunds and 15 cm raised beds without bund) andfour phosphorous dose as sub-plot (0, 50, 100 and150 % of the recommended P dose). Availablewater content in different treatments variedmarginally from 0.188 to 0.212 cm3cm-3. There wasa significant variation in profile soil moistureamong moisture regimes, highest being in raisedbed (22.36 cm/ 60 cm soil profile) and lowest inflat bed with side bunds (19.55 cm). Interactiveeffect of phosphorous and moisture availabilityunder different land treatments revealed that underboth raised bed and flat bed (control) groundnutresponded up to 100% P, though highest groundnutyield was recorded with 150 % P under raised bed.In general, pod yield of groundnut under raised bedwas 73 and 95 % higher than yield obtained underflat bed with 30 cm side bunds (Table 1). Higherper plant (34.52 g), root biomass (2.11 g), andchlorophyll content resulted in maximum no. ofpod per plant (23.95) and higher pod yield (2.85 t/ha) of groundnut under raised bed planting. Plotswith side bunds recorded lowest above groundbiomass (16.77 g), root biomass (1.33 g), andchlorophyll content resulted in lowest no. of pod

per plant (12.36) as well as lowest pod yield (1.28t/ha). Thus it appears that raised bed in alfisolmaintained optimum soil moisture, which couldmake favourable environment to respond the cropto phosphorus.

Table 1. Interaction effect of moisture regimesand phosphorous on pod yield ofgroundnut

Treatments Pod yield (t/ha)(% ofrecommended Raised Flat Flat Meandose) bed bed bed with

(15 cm) side bund(30 cm)

P 0 2.52 1.46 1.22 1.73P 50 2.88 1.55 1.40 1.94P 100 2.95 1.81 1.57 2.11P 150 3.03 1.75 1.64 2.14Mean 2.85 1.64 1.46CD (P =0.05) 0.19 0.17 0.11

Note : Recommended dose of P was 26.2 kg/ha

Effect of raised-sunken bed systems on wateruse efficiency of common vegetables

A study was continued to evaluate theperformance of different crops in standardraised:sunken bed system in dry season and alsoto estimate water use efficiency using suitablemanagement practices under limited wateravailability. Three water management practices(adequate water supply, limited water supply andno water) in combination with two mulchtreatments (straw mulch @10t/ha and no mulch)were tested in a factorial RBD. Study revealed thatmaximum moisture extraction was obtained (32.2to 41.3 % in case of potato and 35.3 to 44.5 % in

Photo plate 1a. Crop performance Photo plate 1b. Crop performance Photo plate 1c. Crop performanceunder flat bed with side bund under flat bed under raised bed


case of tomato) from 0-15 cm soil depthirrespective of crop combinations, irrigationschedule and mulch treatments and it decreasedwith soil depth. It appears that almost 65-75% soilwater was extracted by the crop from the top 30cm soil depth. On an average, 24 % higher potatoyield was recorded under mulch over no-mulchplots. In case of tomato, both water supply andmulch treatment influenced growth of tomato. Ingeneral, under mulched plots there was 92 and 43% increase in fruit yield owing to limited irrigationand adequate irrigation over no irrigation.However, such water saving effect with limitedirrigation was not observed under no mulch plots.

Effect of in-situ residue management on carryover soil moisture conservation and crop growthunder hill agricultureA simple technology of in-situ residue managementhas been developed with the objective of takingmustard crop on completely residual moistureduring rabi season. Treatments comprising sixcombinations of residue management in main plot,viz. M0– control, M1 – Maize stalk cover (MSC),M2 – MSC + Ambrossia sp. @ 5t/ha, M3 – MSC +Ambrossia sp. @ 10t/ha, M4 – MSC + poultrymanure + Ambrossia sp. @ 5t/ha and M5 – MSC +FYM @ 10t/ha and two tillage (conservation tillageand conventional tillage) as sub plot was tested in

Potato Tomato

Fig. 1. Soil moisture extraction (%) pattern by potato and tomato crop under various treatments


a split plot design. Study revealed that through outthe growth period of mustard, water storage (cm/90cm) of the profile was the highest in MSC +poultry manure + Ambrossia sp. @ 5t/ha (M4).Moisture-extraction pattern showed thatirrespective of tillage and residue management, itwas maximum (38.7 to 58.8%) at 0-30 cm soildepth, and decreased with soil depth. The moistureextraction (%) in the first 30 cm soil depthincreased with maize stalk cover as well as withother organic sources of nutrient. The crop evapo-transpiration (ET) increased steadily fromgermination stage onward in all the residuemanagement treatments, reaching its peaksomewhere between 60 and 75 days after sowing.However, ET in the control plot reached its peakearlier (between 45 and 60 DAS) than treated plots(between 60 and 75 DAS). Among the variousresidue management treatments, M5 had the

maximum ET rate throughout the crop seasonfollowed by M4. M5 contributed almost 78 and 75% higher ET throughout the crop season than thatunder M0 in conservation and conventional tillagepractices, respectively (Fig. 2).

In general, all the residue management practicesrecorded good seed yield of mustard which wasmany fold higher than control (M0), where onlynegligible yield was observed (Table 2). Thetreatment MSC + Poultry manure + Ambrossia @5 t/ha (M4) recorded highest yield (556.2 kg/ha),which is almost 10 fold higher than the mustardyield under control plot (51.3 kg/ha). Among thevarious residue management treatments, the highestwater-use efficiency (14.59 kg/ha-mm) wasobserved under MSC + poultry manure +Ambrossia sp. @ 5t/ha (M4) followed by M2 (11.86kg/ha-mm), M3 (11.18 kg/ha-mm), M1 (9.46 kg/ha-mm), M5 (6.33 kg/ha-mm) and M0 (2.41 kg/ha-mm)irrespective of tillage practices.

Fig. 2. Seasonal variation of evapo-transpiration of mustard as affected by various residue managementpractices under conservation and conventional tillage

Conventional tillageConservation tillage

Table 2. Seed yield and water-use efficiency of mustard as affected by various residue managementand tillage treatments

Residue Tillage treatments (T)managementtreatments Conservation Conventional Mean Conservation Conventional Mean

tillage tillage tillage tillageSeed yield (kg/ha) Water-use efficiency (kg/ha-mm)

M0 39.50 51.30 45.4 2.17 2.65 2.41M1 164.80 225.00 194.9 8.23 10.68 9.46M2 225.70 312.70 269.2 10.48 13.23 11.86M3 242.80 334.80 288.8 9.46 12.90 11.18M4 363.00 556.20 459.6 11.88 17.30 14.59M5 201.50 218.50 210.0 6.21 6.45 6.33CD (P = 0.05) T = 68.72 M =56.48 T x M = 86.16 T =3.63 M = 2.11 T x M =3.12

T, Tillage treatments: M, residue management treatments; T x M, Tillage x residue management interaction


Selection and evaluation of water-efficientcropping systems for terraced situation offoothill

An experiment was conducted with two mainplot tillage treatments (T1 – Conventional tillagewithout crop residue and T2 – Conservation tillagewith residue incorporation) with eight croppingsystems as sub plots. There were 4 kharif crops(rice bean, maize, upland rice and soybean) and 2rabi crops (mustard and pea). The main objectivewas to find out water efficient cropping system bothfrom traditional and non-traditional croppingsystem. The respective varieties of the crop were:rice bean (RCRE-1-6), maize (Vijaya composite),upland rice (Bhalum-I), soybean (JS 80-21) andmustard (TS-36), pea (Sultan). The 50% depletionof available soil moisture was calculated based onthe initial soil moisture with relation to theperiodical soil moisture status. During sowing ofthe kharif crop, soil profile moisture content (Fig.3) varied between 34.4 to 38 % (v/v), whereas atthe end of cropping season, the moisture contentfluctuated from 13.9 to 20.2 % (v/v). Among allthe cropping systems, maize-mustard and uplandrice-mustard were found to be most water efficientcropping system as in these systems profile soilmoisture never reached to below 50% of the initialvalue. In other cropping systems, profile moisturecontent comes to 50% of their initial moisturecontent during 120-150 days after sowing. In ricebean- pea cropping system, soil moisture goesbeyond 50% of its initial value during 90 DAS.

Fig. 3. Seasonal soil profile moisture status undervarious cropping system

The crop yield under conventional tillage wassignificantly higher than that under conservationtillage irrespective of crop combination. However,

in case of upland rice, the crop growth was superiorin conservation tillage as compared to that underconventional tillage (plate 2). The rabi crops i.e.mustard and pea yield showed that conservationtillage contributed significantly higher yield underboth the crops (41 and 36 %, respectively) ascompared to conventional tillage.

Plate 2. The difference in upland rice crop underconservation and conventional tillage

Externally funded projects

Farmers’ Participatory Action Research ProjectIn a bit to enlighten the farmers about the low

cost water harvesting structure, i. e. Jalkund andin-situ soil moisture conversation in terrace land,ICAR, Umiam organised a one day training atICAR complex to some of the selected farmers inthe four districts of Meghalaya. The response fromall the farmers was convincing. Most of the farmersurged the concern institute for providing more andmore number of LDPE polythene.


NABARD funded ProjectForty farmers were selected to popularize

innovative low-cost rain water harvesting structureJalkund among the farming community of the fourstates which includes Nagaland, Tripura, Manipurand Meghalaya. As per the plan of implementation

of the Jalkund project, Training Cum AwarenessProgramme was conducted on 11-12th

October,2007 at ICAR Research Complex, Umiam,Meghalaya, leaflet on Jalkund was translated intothe five local languages, finalized the constitutionof Project Monitoring and Review Committee for

Jalkund at farmers field, Ri-Bhoi District,Meghalaya

Jalkund at farmers field, East Khasi Hills District,Meghalaya

Jalkund at farmers field, Janintia Hills District,Meghalaya

Jalkund at farmers field, West Khasi Hills District,Meghalaya

Jalkund at farmers field, Tura Jalkund at farmers field, Wokha, Nagaland


each centre. Construction of 40 Jalkunds had beenfinished, So far the progress has been good andthe farmers are happy about the technology.

Project on scaling up of water productivity forlivelihood and agriculture

So far four training programmes have beenconducted for the farmers on “Scaling up of Water

Jalkund at farmers field, B. Manu, Tripura Jalkund at farmers field, Churachandpur,Manipur

Productivity in agriculture for livelihoods throughteaching cum demonstration” by ICAR,Umiam.Farmers are enlightened by the lectures given bythe Resource persons and many farmers have comeup with their quiries.Its been very great time forthe farmers to get this kind of opportunity to getdemonstration as well as lectures on new trendsin farming.

Farmers’ training on “Water management in rice under different land use systems” at ICAR RC (NEH),Umiam, Meghalaya from 24th to 30th March’ 2008

Farmers’ training on “Watershed approach for sustainable development” at ICAR RC (NEH), Umiam,Meghalaya from 11th to 17th March’ 2008


Farmers’ training on “Scaling up of Water Productivity in horticultural crops” at KVK, Tura,Meghalaya from 11th to 17th March’ 2008

AGROFORESTRY

Studies on intensive integrated farming system

(a) Cropping and land use systemsThe most beneficial land use system in the IIFS

was maize based cropping system from the edaphicsuitability, productivity (37.5q/ ha) as well as utilitypoint of view. Cereal- legume cropping systems(viz., maize-rice bean and maize–mung bean andmaize-mustard) are being tried successfullyconsidering crop productivity as well as soilfertility. Six species of hedge plants viz., Crotolariatetragona, Flemingia macrophylla, Indigoferatinctoria, Desmodium rensonii, Cajanus cajan andTephrosia candida have been establishedsuccessfully in the risers of the terraces developedin the sloppy land of the IIFS area.

(b) Performance of fodder oat in IIFSAn experiment was conducted to evaluate the

performance of oat for fodder production in theIIF System. Ten treatments comprised of differentmanures either alone or in combination withfertilizers were evaluated against control and 100%NPK through inorganic fertilizer. Among all thetreatments maximum green fodder yield 26.5 t/hawas recorded under 100% NPK while controlrecorded lowest fodder yield (7.9 t/ha)

Table 1. Crops grown and their productivity inthe IIFS

Crops grown Productivity(t/ ha)

A. Summer (March-April)Ginger 13.71Turmeric 18.19B. Pre-Kharif (May-Mid June)Sole maize as food (Feed) 3.75Mung 0.90Upland paddy 2.75Colocasia 13.75Brinjal 11.35French bean 6.30C. Kharif (June- August)Groundnut 2.31Rice bean 0.81Soybean 1.57Lowland paddy 4.00Buckwheat .95Pigeon pea 1.60D. Rabi (Mid October- December)Mustard 0.85Cabbage 12.51Cauliflower 8.15Knol khol 8.30Tomato 13.50Radish 8.05

(c) Fodder production in IIFSA total of 45t of green fodder was produced in

all the system. Different fodder grasses viz.paragrass, congo signal, hybrid napier, fodder oats


were grown in the IIF System. The productivity ofdifferent fodder grasses were found to be 30, 45,40 and 20t/ha respectively.

Performance of oat in IIFS

(d) Effect of different hedgerow leavesincorporation on productivity of Pahlu Dal

Field experiment was conducted during preRabi season to study the effect of differenthedgerow leaves incorporation on growth and yieldattributes of Pahlu Dal. Seven treatments comprisedof leaves incorporation of Fleminggia macrophylla,Indigofera tinctoria,Crotolaria tetragona,Tephrosia candida and Cajanus cajan @ 2t/ha dryweight basis along with recommended dose offertilizer application (25:60:30 kg NPK/ha) and acontrol. Maximum seed yield 1.06 t/ha wasobtained with application of recommended doseof fertilizer application followed by incorporationof leaves of Idigofera tinctoria (0.91 t/ha) andTephrosia candida (0.90 t/ha).

Performance of pahlu dal under different hedgerowleaves incorporation

Performance of turmeric in IIFS Performance of mustard in IIFS

Performance of radish in IIFS


(e) Effect of different rate of lime applicationon growth and yield of groundnut

An experiment was conducted to evaluate theperformance of groundnut under different rates oflime application. The initial soil pH was 4.9. Thetreatments comprised of 0, 0.5, 1.0, 2.0, 2.5 alongwith lime dose calculation as per softwaredeveloped in the institute (1.72 t/ha). A uniformrate of FYM @ 10 t/ha was applied in all thetreatments. The data revealed that maximum podyield 23.10 q/ha was recorded with application oflime @ 2.5 t/ha followed by lime @ 1.72 t/ha (22.75q/ha) and lime @ 2.0 t/ha (22.6 q/ha). The lowestpod yield 16.0 q/ha was recorded under no limecontrol.

Performance of groundnut under different rate oflime application

(f) Biomass production under differenthedgerow species

Data on biomass production of differenthedgerow species has been collected and presentedin table. Maximum fresh weight (175 t/ha) and dryweight (38 t/ha) was recorded with Indigoferatinctoria with four prunings.

Table 2. Biomass productivity of differenthedgerow species in the IIFS

Species No. of Fresh Drycuttings weight weight

(t/ha) (t/ha)

Clotolaria tetragona 3 80 22Tephrosia candida 4 100 26Indigofera tinctoria 4 175 38Flemingia macrophylla 3 150 28

(g) Effect of different rates of lime applicationon growth and yield of turmeric under Micheliachampaca based AFS.

An experiment was conducted to evaluate theperformance of turmeric with different rates of limeapplication under Michelia based agroforestrysystem. The initial soil pH was 4.8. The treatmentscomprised of, 0.5, 1.0, 1.5, 2.0, 2.5 t/ha along withlime dose calculation as per software developed inthe institute (1.87 t/ha). A uniform rate of FYM @15 t/ha was applied in all the treatments.

Maximum rhizome yield 25.6 t/ha, number offingers (10.6) and clump weight 510 g was recordedwith application of lime @ 2.5 t/ha followed byapplication of lime @ 2.0 t/ha (25 t/ha) and lime@ 1.6 t/ha (24.7 t/ha). The lowest yield (16.5 t/ha)was recorded under no lime control.

Performance of turmeric under Micheliachampaca based AFS

Hedge row planting in IIFS


(h) Effect of different rates of lime applicationon growth and yield of ginger under Alder basedAFS.

An experiment was conducted to evaluate theperformance of ginger with different rates of limeapplication under Alder based agroforestry system.The initial soil pH was 4.9. The treatmentscomprised of, 0.5, 1.0, 1.5, 2.0, 2.5 t/ha along withlime dose (1.72 t/ha) calculation as per softwaredeveloped in the institute. A uniform rate of FYM@ 15 t/ha was applied in all the treatments.

Maximum rhizome yield 22 t/ha was recordedwith lime @ 2.0 t/ha followed by application oflime @ 1.72 t/ha (21.3 t/ha). The lowest rhizomeyield (15 t/ha) was recorded under no lime control.

(i) Analysis of soil samples of the pond in IIFSThe soil of the fish-pond is generally acidic (4.8-

6.21) and it was rectified with the application oflime on the basis of pH. The organic carbon contentin the soil of integrated fishpond was found to behigh (0.75– 3.44%) but it is within desirable range.In the integrated pond nitrogen (165.28-416.42 kg/ha) content was found to be high due to continuousapplication of organic nitrogen in the form ofmanure. The phosphorus level (6.81-17.04 kg/ha)in the soil of integrated pond was found withinsatisfactory range for higher primary productivity.Potassium content of soil was found to be 1.18 to1.70 fold higher than control.

Fish production in the IIFS

(k) Animal componentThe growth performance of ducks Khaki

Campbell 0.0040kg/ day was recorded in IIFS at adensity of 500 ducks for 1ha pond area. The

performance of broiler birds reared in IIFS showedbetter growth rate (0.034 kg/day) and its droppingshelped in increasing primary productivity. Amongvarious livestocks, the daily weight gain (0.342kg/day) of pig was found to be maximum and optimumprimary productivity of fish pond was found betterwhen reared with a stocking density of 30 nos/hapond area. Integrated fish farming showed thepromising results. Fish fingerlings at a stockingdensity of 9000 nos/ha recorded maximum fishproductivity and it was found to be 1.59, 1.38, 1.24and 1.20 t/ha, when integrated with cattle, pig,duck, poultry and goat respectively with the abovementioned stocking density of livestock/ birds asagainst control without integration (0.81 t/ha) andconcentrated feeding with productivity of 1.75 t/ha.

Broiler bird in IIFS

Integrated approach of land use throughagroforestry interventions

Agri-horticulture AFSAmong different fruit tree species maximum

plant height (4.92 m) maximum collar diameter(37.6 cm) and canopy width (5.62 cm) was recordedwith plum, while maximum number of branchesper plant (8) was recorded with Peach. In caseof crop performance maximum yield of maize wasrecorded in sole crop (4.10 t/ha) while amongcombinations maximum yield (3.23 t/ha) wasrecorded with Orange + maize combination.Maximum turmeric yield (25.0 t/ha) was recordedas sole crop while among the combination with fruittree species maximum yield (21.0 t/ha) wasrecorded with pear + turmeric combination.


Table 4. Performance of different fruit trees

Fruit tree Plant Collar No. of Canopyheight diameter branches width(m) (cm) /plant (m)

Sweet orange 1.95 15 5.4 1.42Guava 2.40 17.0 3.0 2.38Peach 4.92* 37.6* 4.6 5.62*Plum 3.46 23.8 8.0* 2.14Pear 4.06 9.0 4.4 1.0Orange 2.56 13.2 2.8 0.86Assam lemon 1.55 16 4 1.96

Table 5. Performance of different crops incombination with different treespecies

Fruit tree and crop Scale Crop Fruit yieldcombination (sq. m) yield t/ha

t/ha

Sweet orange + maize 468 1.45 Yield yet torecorded

Guava + maize 1575 2.85 5.06Assam lemon + maize 300 3.03 2.55Peach + maize 275 2.59 5.26Orange + maize 270 3.23* Not in floweringPlum + turmeric 248 19.0 Not in floweringPear + turmeric 620 20.0 Not in floweringMaize + turmeric 900 17.5 -Turmeric 690 25.0 -Ginger 900 21.0 -Groundnut 400 2.20 -Maize alone - 4.10 q-

Evaluation of MPT for growth and biomassperformance

Different tree species have varied canopyarchitecture, which makes variation in the lightinterception or quantum of light available to cropsgrown in association with tree species. Theperiodical growth observation and canopyarchitecture of different agro-forestry tree specieslike teeta champ (Michelia champacca), poma(Chukresia tabularis), ghamar (Gmelinea arborea),litsea (Litsea poliantha) and alder (Alnusnepalensis) were studied after five years ofplantation under hilly condition of Meghalaya.Different intercrops viz. maize, rice mustard andother vegetable crops were also grown successfullyunder the canopy of above mentioned tree species.The data on yield and biomass of associated cropswere also recorded.

Selection and evaluation of multipurpose treespecies (MPTs) for agroforestry systems

Tree growth and crop yieldThe periodical growth observation of ten

already existing multipurpose tree species (MPTs)in the arboretum block were recorded and observedthat Parkia roxburghii attained the highest growth(28.71 m) among various tree species, whereas,DBH was highest in Gmelina arborea (34.66 cm)after 20 years of plantation. The maximum timbervolume were recorded in case of M. oblonga(278.29 m3/ha) followed by P. roxburghii (277.77

Table 3. Productivity and stocking density of animal/birds and fishes of different IIFS

Sl. IIFS Area Productivity/yr Stocking density of animals/No. (ha) birds and fishes

1 Chicken -crop- fish-duck-horticulture 1.05 Duck meat- 54 kgFish-1.0 q Duck- 500 nos./haFish-9000alongwith hedgerow on contour bunds. fingerlings/ha

2 Crop-fish-poultry--multipurpose trees 0.97 Live chicken- 8.82qFish-0.9 q Broiler birds 200/batchFish-9000 fingerlings/ha

3 Crop- fish-goat -multi purpose trees 1.04 Meat-1.0qFish-0.9 q Goat- 55 nos./haFish-9000 fingerlings/ha

4 Crop- fish-pig - vermicompost-bamboo- 1.04 Pork- 1.0qFish1.1 q Pigs- 30 nos./hamultipurpose trees hedgerow-broom Fish-9000 fingerlings/ha

5 Crop- fish-dairy - mushroom- 1.17 Milk- 5833 liters Fish-1.3 q Cattle-5nos./haFish-9000vermicompost - horticulture-hedgerow fingerlings/ha

6 Crop-fish without integration (control) 0.95 Fish--0.50q; Fish-9000 fingerlings/ha7 Concentrate feeding Fish- 1.5 q


m). The yield of shade loving crop (ginger andturmeric) were recorded under each tree speciesand observed that there was a drastic reduction incrop yield. Maximum turmeric yield (189.2 q/hawas recorded under control and amongcombination with tree species maximum yield(153.40 q/ha) was recorded under Pinus kesia.While in case of ginger reduction in yield was moresevere and maximum yield (90.67 q/ha) wasrecorded in combination with Parkia roxburghiias against a yield of (231.00 q/ha) in control withouttree combination.

Performance of three maize varieties underdifferent fruit trees

In continuation of third year experimentationthree maize varieties are RCM-1-1, RCM-1-3 andVijaya composite were taken under fruit three fruittrees viz. guava (Psidum guajava cv. AllahabadSafeda). Assam lemon (Citrus lemon cv. Local) andpeach (Prunus persica cv. TA 170). Grain yield(average of tree years) of all the three maizevarieties were recorded highest (4.0 t/ha) in controlplot (without tree) than in understorey of fruit trees.Among the fruit trees species average grain yieldof RCM-1-1 was highest under Assam lemon (3.47t/ha) followed by guava and peach. Average fruityield was 5.81, 2.02 and 4.72 t/ha respectively, topeach Assam lemon and guava.

Evaluation of multistoried AFSIn continuation of experimentation in

multistoried agroforestry system, the existing tea

plant are heavily pruned and side branches of aldertrees were also pruned up to 50% of tree height inthe month of April 2007 under intensivemanagement practices. After heavy pruning therewas significant improvement in the emergence ofnew shoot with leads to produce new fresh buds ina per unit area. Now it is flourishing well underthe partial shade of alder as it provide favourablemicroclimate to understorey crops. Thus, theaverage yield of tea (fresh buds) was recorded 7.0– 8.5 t/ha whereas, in case of black pepper (dried)the yield was 650 g/plant. The timber volume wasrecorded to be 215.78 m3/ha for Alnus nepalensis.

Black paper based AF System

Studies on silvi-horti-pastoral systemsTo study the performance of silvi-horti-pastoral

AFS pineapple (var. Kew) was planted beneath thecanopy of silver oak (Grevillea robusta) and som

Table 6. Growth and yield performance of trees (20 years old) and crops in AFS

Tree species Height DBH Timber volume Crop yield t/ha(m) (cm) (m3/ha)

Turmeric Ginger

Alnus nepalensis 24.24 30.39 191.57 12.57 8.80Prunus cerasoides 18.78 25.45 87.12 12.60 7.96Symingtonia populnea 19.13 31.65 159.67 13.00 8.07Parkia roxburghii 28.71* 32.19 275.77 14.36 9.07*Michelia oblonga 27.12 30.88 278.29* 13.93 8.44Gmelina arborea 22.02 34.66* 254.13 13.48 8.50Cryptomeria japonica 15.38 22.48 65.72 9.85 7.08Cupressus torulosa 14.57 21.05 55.95 9.00 7.46Pinus kesiya 20.45 27.59 136.74 15.34 7.21Control (no tree) - - - 18.92* 23.10


(Machilus bambicina) across the steep slope (25-30%) with 50 x 80 cm spacing. In third year ofexperimentation the average yield of pineapple wasrecorded highest in the understorey of G. robusta(16.5 t/ha). After 14 years of plantation G. robustaattain an average height and dbh of 12.21 m and12.98 cm, respectively, Similarly, M. bombicinaattained 12.58 m height and 19.12 cm dbh. Onterrace risers, grasses like congo and guinea wereplanted as a vegetative barrier. The averageproductivity of congo and guinea grass was 27.15and 28.18 t/ha respectively.

Pineapple based multistoried AF system

Table 7. Tree growth and crop yield under onsilvi-horti-pastoral systems

Tree species Tree DBH Cropsheight (cm)(mt)

Pineapple Guinea Congo t/ha grass grass

t/ha t/ha

Grevillea robusta 13.17 17.59 1.65 2.93 2.93Machilus bambicina 12.26 21.82 1.43 2.50 2.71

Development of agroforestry models in hillyecosystems

One year old healthy seedling of peach, pearand guava with 50 nos of species were planted inalternate terraced with two spacing i.e. 5 x 5 mand 5 x 6 m (plant to plant and row to row)following the standard planting procedure duringthis year. After six months of plantation the survival

percentage of peach, pear and guava showed 95,92 and 90% respectively. The interspaced area wasutilized for intercropping of maize followed bymustard whereas contour bunds were coveredunder congo and guinea grass to check erosion andeffective utilization of land.

Agri horti system

Table 8. Performance of fruit plant and crops

Tree species Tree DBH Cropsheight (cm)(mt) Maize Mustered

t/ha t/ha

Guava (2 year old) 13.17 17.59 1.84 1.03Peach (2 year old) 12.26 21.82 2.05 1.25Pear (2 year old) 12.26 21.82 1.90 1.30

Evaluation of superior planting material ofJatropha (seedling/cuttings) from different partof Meghalaya sponsored by NOVOD R & DNetwork Programme

Studies on Jatropha seed viability and time ofsowing

Seeds collected from different provenances viz.Mendipathar, Tura, Dimapara and Mawhati weresown during pre-monsoon and winter seasons. Theseeds sown during pre-monsoon showed bettergermination percent (97.4%) as compared to seedsown in winter (67.0%). Collar diameter (2.19 cm)and plant height (52.5 cm) was also recordedmaximum during pre-monsoon period andminimum during winter.


Establishment of Jatropha blockBesides the research activities, the Jatropha

planting materials collected from various parts ofMeghalaya tested under field trial for screeningout the superior materials on the basis ofmorphological and phonological behaviour. Theseseeds and cuttings were raised in the nursery andfive months old seedlings were planted in Jatrophaplantation block. Further morphologicalobservation and routine management practices inthe established Jatropha plantation block werecarried out.

Jatropha block

Provenance variability of Jatropha curcasThirteen provenances of Jatropha curcas were

collected from all over India evaluated during 2007-2008. Wide ranges of variation were observed ingrowth of Jatropha in the field. Maximum plantheight (197 cm) was recorded with PJS-2.Maximum collar diameter 5.4 cm, maximumnumber of secondary branches 1.8/plant andcanopy diameter 88 cm was recorded with

genotypes Mawhati, while maximum number ofprimary branches (6.8/plant) was recorded withTura provenances. The plantation has not yetstarted bearing. Planting of another 3 promisinggenotypes has been initiated.

Jatropha provenance trial

Provenance variability of Parkia roxburghiiSeven provenances of Parkia roxburghii were

selected from different part of northeast regionwere raised and evaluated for growth performancesduring 2007-2008. Wide variations were observedin growth parameters of different provenances ofP. roxburghii in the field (Table 11). The plantationhas not yet bearing. Maximum plant height (215cm) and maximum number of primary branches(2.33/plant) was recorded with Kanpokpi. Whilemaximum collar diameter (3.93 cm) and numberof secondary branches (0.33) was recorded withBilkhawthlir provenances. Maximum canopydiameter (143.33 cm) was recorded withKezanglwa provenances.

Table 9. Germination and growth performance of different provenance of Jatropha in two seasons

Provenances Germination% Plant height (cm) Collar diameter

Pre-monsoon Winter Pre-monsoon Winter Pre-monsoon Winter

Mendipathar, 90.0 65.0 50.1 45.3 2.00 1.55Tura, 97.4 67.0 52.5 40.2 2.19 1.53Dimapara 88.46 66.4 49.8 45.67 1.89 1.7Mawhati 92.3 63.0 51 42.0 1.58 1.6


Establishment of medicinal and aromaticgarden

Thirty five medicinal plants (Table 12) wereestablished in the medicinal garden of the Institute.The collection and plantation of aromatic plantsare under progress.

Table 10. Growth attributes of Jatropha curcas

Provenances/ Plant height Collar Primary Secondary CanopyGenotypes (cm) diameter (cm) branches branches length (cm)

Rahuri 150 3.94 3.6 0.6 80

TFRI-2 125 3.77 3.0 0.0 72.5

TFRI-1 146 4.96 4.8 1.0 72.0

PDKV Akola-2 126 3.23 3.0 0.0 58.33

PJS-2 197* 5.04 5.2 0.80 74

PJS-1 176 4.26 6.0 1.8* 85

Nagpur 132 3.96 5.2 0.4 68

Byrnihat 109 3.86 3.2 0.6 67

Mawahati 186 5.4* 6.2 1.8* 88*

Molasnai 108 3.72 4.2 0.2 64

Tura 147 4.88 6.8* 0.6 71

Mandipathar 140 4.38 4.2 0.2 61

Dimapara 127 4.24 5.6 0.6 71.4

Table11. Growth performance of Parkia roxburghii

Provenances/ Plant height Collar Primary Secondary CanopyGenotypes (cm) diameter (cm) branches branches length (cm)

Bilkhawthlir 196.67 3.93* 1.33 0.33* 133.33

Kanpokpi 215.00* 2.93 2.33* 0.00 136.67

Kawnpui 140.00 2.20 0.67 0.00 88.33

Kezanglwa 196.67 3.07 0.00 0.00 143.33*

Khaibung 165.00 2.37 2.00 0.00 98.33

Thingkhang 150.00 2.33 0.67 0.00 126.67

Mawkiang 135.00 2.17 0.67 0.00 83.33

Parkia roxburghii provenances


Table12. Medicinal and aromatic plants in the medicinal garden at ICAR Research Complex,Umiam, Meghalaya

Sl. Botanical name Common name Parts used UsesNo.

1. Ocimum sanctum Tulsi leaves, seeds Treatment of bronchitis, catarrh, digestivecomplaints, common cold and urinary infection.

2. Ocimum basilicum Bantulsi leaves , seeds Treatment of dysentery and chronic diarrhea.3. Lepidium sativum Chansur leaves, seed Antibacterial activity. Milk enhancement4. Cybopogon flexuosus Lemon grass leaves Pharmaceutical preparations, disinfectants,

perfumery and cosmetics.5. Eucalyptus citriodora Odomos leaves Essential oil used in perfumery and a source of

citrionellol and menthol.6. Andrographis paniculata Kalmegh stem, leaves Treatment of fever, worms, dysentery, liver and

digestive complaints.7. Taxus baccata Common yew shoots Cabinet work, furniture, paneling. Treatment of

headache, giddiness and diarrhea.8. Curcuma caesia Black turmeric rhizome, roots Antipyretic and treatment of asthma, bronchitis,

tumour and enlargement of spleen and foul breath.9. Curcuma longa Common rhizome Rhizome is a laxative, anthelmintic, tonic and useful

turmeric in blood disease, leucoderma, scabies, urinaryinfection, inflammation, smallpox, etc.

10. Mucuna prurita Kiwach seeds, roots Used as nervine tonic and treatment of cholera.11. Ocimum gratissimum Ramtulsi leaves,seed Used as mosquito repellent.12. Ocimum americanum Kalitulsi leaves, seeds Used as flavouring sauces, soups and salads. Seeds

are considered as diuretic and tonic. Leaves also usedfor dysentery, mouth wash and relieving toothache.

13. Asparagus adscendens Satavar roots Used as demulcent, diarrhoea and dysentery.14. Bacopa sp. Brahmi leaves, stem Used as tonic and treatment of nervous disorders,

leprosy, tubrculosis, anaemia and smallpox.15. Rosmarinus officinallis Rosemary leaves, entire Used in perfumery, scenting soaps, hair lotions, room

plant sprays. Entire plant is astringent and is used forstomachache, rheumatism, paralysis and dry leaves aresmoked in asthma.

16. Plantago major Isabgol seeds Seeds used in inflammatory conditions of mucousmembrane of gastrointestinal and genitor-urinarytracts.

17. Houttyunia cordata leaves, roots Leaves used in medicine for dysentery, gonorrhoea,eye troubles and an extract of roots is diuretic.

18. Fagopyrum cymosum Buckwheat leaves, flowers Leaves used as vegetables. Treatment of capillaryfragility and other haemorrhagic conditions.

19. Oxalis corniculata Amrul leaves The plant possesses astringent and anticepticproperties. Fresh juice of plant cures dyspepsia, pilesand anaemia.

20. Cinnamomum camphora Camphor, wood Oil from wood gives high yield of camphor and mushkapur safrole. Perfumes and treatment of inflammation,

rheumatic pains, diarrhoea and cardiac stimulant.21. Rauvolfia serpentina Sarpagandha roots Used as antihypertensive, sedatives and treatment of

insanity, insomnia, epilepsy and intestinal disorders.22. Bixa orellana Sinduri seeds Used in ice-creams,bakery products and edible oils.

Also used in floor wax, shoe polishes, nail gloss andhair oils.

23. Apium graveolens Ajmod seeds Seeds are used as stimulant, carminative, nervinesedative and tonic.leaf-stalks are consumed as saladand vegetable. Seed oils used as fixative and perfumesand soups. Dried ripe fruits are used as spice.

Contd.....


Sl. Botanical name Common name Parts used UsesNo.

24. Alpenia galanga Sugandhbach rhizome Treatment of bronchitis and catarrh.kulanjan

25 Chlorophytum sp. Safed musli26 Cassia occidentalis Kasamdhi27 Stevia28 Nigella sativa Kalonji29 Emblica officinalis Amla30 Tree tomato31 Aloe vera Aloe vera33 Withania somnifera Ashwagandha34 Alpinia officinarin Kulanjan35 Nepenthes khasiana Pitcher plant

AGRICULTURAL ECONOMICS

Economics of ornamental fish production inMeghalaya

Northeastern states produce bulk of the India’sornamental fish exports; however, still the regionremains relatively untapped for the developmentof ornamental fisheries. Also, raising and supplyingof exotic ornamental fish under captive breedingwould reduce the pressure on volume of wild catchand therefore, would complement the conservationefforts of native ornamental fish species. It has beenestimated that a total of Rs. 1,31,500 was requiredas capital cost to establish an ornamental fish-rearing unit, which is sufficient for rearing multipleornamental fish species. Present estimation hasbeen made considering three popular exoticornamental fish, namely, gold fish (Carassius

auratus), platy fish (Xiphophorus maculates) andangel fish (Pterophyllum scalare).

Annual costs and returns of these threeornamental fish (gold, angel and platy) has beencalculated and observed to be a highly profitablebusiness. Average net return was calculated to beRs. 103333 per year for these exotic fish species(Table 1). Combined profitability was estimatedto be Rs. 205600 per year. Rearing of gold fishwas observed to be most rewarding with an annualnet return of Rs 111600 followed by angel fish (Rs98000 per year) and platy fish (Rs 96000 per year).

Financial viability of ornamental fish farm unitAll the financial viability criteria namely, IRR,

NPV and BCR were estimated to favourable forinvestment on ornamental fish farming (Table 2).The profitability of the investment in terms of NPV

Table 1. Annual costs and returns of exotic ornamental fish production (2006-07 prices inMeghalaya)

(in Rs./ year)

Sl no Particulars Gold fish Angel fish Platy fish Average Combined

A. Costs1 Cost of Brood fish (Rs. 500 / pair) 2500 5000 5000 4167 125002 Feed 10000 10000 9000 9667 290003 Chemicals, medicine, polythene, bags 3000 2000 2000 2333 70004 Electricity and maintenance 3000 4800 4800 4200 126005 Labour charges (Rs. 50 / man-day) 18000 18250 18250 18167 545006 Miscellaneous 1000 1000 1500 1167 3500

Total Cost 37500 41050 40550 39700 119100B. Returns1 Sale of fish 111600 98000 96000 103333 205600C Net returns 76500 54950 53450 61633 86500


was observed to be higher (Rs. 319897) when allthe three fish species were considered together.Payback period was calculated to be 1.72 yearsunder gold fish unit followed by angel fish (2.39years) and platy fish (2.46 years). The NPV wasestimated to be Rs. 172884 under gold fish unitfollowed by angel fish (Rs. 76483) and platy (Rs.70413). Similarly, IRR and NPV was calculated tobe higher under gold fish (42 per cent and 1.52respectively) as compared to angel (27 per cent and1.22 respectively) and platy fish (26 per cent and1.20 respectively). The investment analysisindicated that the establishment of such fishery unitis not only financially viable but also a highlyattractive proposition for the entrepreneurialdevelopment.

Production and marketing of selected high valuecrops through self help groups in Meghalaya

Diverse agro-climatic condition of Meghalyais highly suitable for growing a number of highvalue horticultural crops. Key institutions andorganizations such as State Government, NationalBank for Agriculture and Rural Development(NABARD) and Non Governmental Organizations(NGOs) are taking active participation to facilitatethe functioning of self help groups (SHGs) at grassroot level. So far the total of 4843 SHGs has beenformed in the state covering 52910 members. Outof which 42 per cent SHGs are run by femalemembers only. In Ri-bhoi District, so far 426 SHGshas been formed with a total membership of 4467among which nearly half of the SHGs are operatedby female members only. A study to analyze thefunctioning of such SHGs in Ri Bhoi District ofMeghalaya focusing on some of the important highvalue crops namely, ginger, capsicum, tomato,turmeric, broccoli, strawberry, anthurium, rose,lilium etc. indicated that the SHGs have motivatedthe farmers/growers to grow existing high value

crops and also encouraged to introduce new crops.However, increase in terms of net income due toformulation of SHGs was not observed to besignificantly different from the growers withoutbeing a member of SHGs. Also farmers wereuncertain whether or not to continue newlyintroduced crops (such as Broccoli) when theGovernment support (for example, DHO supportedthrough providing seeds and ensuring price to buyback the products) is being withdrawn.Notwithstanding with these weaknesses, in general,it has been observed that the formation of SHGshave been articulating desired enthusiasm andencouragement among the primary producers andgradually they are willing to take up new cropenterprises. Under this process Government maytake up initiative to encourage private investmentthrough introducing incentives for their activeparticipation in various marketing functions likegrading, processing, storage, packaging, brandingand transportation particularly for the exportpromotion of high value crops such as organicspices, fruits and vegetables and also flowers.

Economic analysis of gastrointestinal parasiteinfection in cattle in Meghalaya

In Meghalaya, the GIP infection is common inall the important livestock species, such as, cattle,buffaloes, pig, and poultry. Prevailing weatherconditions (humid and high rainfall) particularlyduring rainy season is highly favourable forparasitic infection build up and possess major riskto animal health management and accounted forsubstantial economic loss. However, usually therisk and economic loss due to GIP infection inlivestock remain unobservable due to lack ofknowledge and poor awareness level. There is lackof adequate systematic study available in the state(also at country level) to estimate the possible

Table 2. Financial viability of establishment of ornamental fish rearing

Sl no Investment Criteria Gold fish Angel fish Platy fish Average Combined

1 Payback period (years) 1.72 2.39 2.46 2.13 1.522 Net Present Value (NPV in Rs) 172884 76483 70413 106593 3198973 Internal Rate of Return (IRR in %) 42 27 26 32 324 Benefit Cost Ration (BCR) 1.52 1.22 1.20 1.31 1.31


production risk and economic loss due to the GIPinfestation in livestock. The economic gain due tostrategic treatment for gastrointestinal parasite hasbeen estimated and observed to be positive overthe control group irrespective of various groupsunder consideration during the experimental year.Productivity of cattle in terms of milk yield wasestimated to be considerably higher due toanthelmintic treatment of the cattle. Total milkproduction during 1997-98 was estimated to be3715 l, 3590 l and 3154 l under Group A, B, & Crespectively which were much higher than controlGroup D (2928 l). Similar trend was observedduring 1998-99 also (3264 l, 3134 l, 3045 l & 2893l under Group A, B, C & D, respectively). The costof anthelmintic treatment was calculated to beranging in between Rs. 144 to 238 only. However,the magnitude of economic gain (in terms ofincrease in value of milk production) was estimatedto be higher during 1997-98 (Rs. 927, 779 & 256per month per animal, under Group A, B, & C,respectively) than 1998-99 (Rs. 525, 333 & 201per month per animal, under Group A, B, & C,respectively). Possible reason might be due to thefact that the strategic treatment was given for alonger period during 1997-98 as compared to 1998-99. However, there may be several other factorattributing to effect the milk production, such as,feed mix given to cattle, calving period (advancepregnancy stage reduces the milk yield), age of theanimal etc that could not be incorporated in thepresent analysis due to non-availability of requireddata set. Weather parameters such as temperatureand rainfall directly and significantly increase theparasitic infection in cattle and therefore, thepasture management become important for whichthe awareness level among the cattle farmers needsto be increased and available options should besuggested.

Managing rice landscapes in marginal uplandsfor household food security and environmentSustainability

In order to achieve the household food securityand environmental sustainability there is an urgentneed to improve the livelihood of upland farmerswith conserving fragile natural resources throughidentifying, validating and disseminating improvedagricultural technologies. The experiment was

conducted in upland as well as in low land in threevillages, Saiden and Kyrdemkulai (Ri BhoiDistrict) in Meghalaya and Nhainantsi (PerenDistrict) in Nagaland. Major findings aresummarized as

Rice variety Bhalum I & Bhalum II were foundto be suitable for mid-altitude both inMeghalaya and Nagaland if it is sown duringin 3rd week of June. The average yield wasobtained around 3.0 t/ha with a range of 2.8-3.2 t/ha. Whereas the average yield of localcultivars were observed to be 1.8 – 2.2 t/ha.Early sowing during the month of May was notfound suitable since this variety matures 20-30days early as compared to the normal varietygrown in uplands/jhum conditions and thereforeinviting more bird problem.Higher net income of Rs 4240 was realizedunder full package of improved technology ascompared local cultivars (Rs 1100 only).Replacement of the HYV in upland underBhalum I & Bhalum II could provide additionalyield increase in the range of 33 - 41 per centand higher income in the range of Rs. 2230 –2790 as compared to income received from localcultivars (Rs. 1000 only).RCPL1-129 variety was found to be moresuitable in jhum land because of its higher weed-suppressing characteristic and yield 3.04 t/haas compared to the local variety (1.7 t/ha) inMeghalaya. Single weeding was necessary at30 DAS.Intercropping of rice with soybean (4:2) ratiowith Groundnut-Soybean was found moreprofitable crop combination in rice base farmingsystem. Among the intercropping system Paddywith Soybean gave an additional income Rs19280 in Meghalaya and Rs 16445 fromNagaland. The additional income obtained fromintercropping with groundnut over solecropping range Rs.9562 to Rs.23155/ha.In Bun cultivation to optimize the profitability,where rice is grown in second year after ginger,the varietal replacement in first year in the cropsgrown viz ginger and turmeric gave anadditional income in the range of 25550 to42000/ha only by replacing ginger variety withNadia and turmeric variety RCT-1.


In lower altitude (800m), under lowlandcondition, variety Ranjit, Pankaj, Shahsarangand Lampnah were found suitable and yieldincreased in the range of 30 to 54% over localvariety only by replacing the variety inMeghalaya. In Nagaland, the increase in yieldwas 31%. The average yield of local varietyranged 2.25 to 2.8 t/ha in Meghalaya whereasin Nagaland it was found to be 3.51 t/ha.By adopting full improved technology package,the increase in yield ranged 33 to 52% inMeghalaya with the net income in the range ofRs 7610 to Rs 12375, whereas in Nagaland itwas in the range of 34-44% in yield increaseand in income in the range of Rs 10050 to 11950.Under low management input (NPK 30-20-20kg/ha), variety JR-2, Shahsarang, Pankaj, Ranjitwere found promising variety and yield ranged3.08 t/ha to 3.54 t/ha was obtained. In Nagaland,the same management of inputs, yield fromShahsarang was as high as 4.5 t/ha as comparedto the local variety (2.9 t/ha) in lowlandcondition.Under lowland condition, the application ofweedicide 2-4-D along with one manualweeding was found more appropriate andeconomical. In Meghalaya the additional yieldreturn Rs 3837 was recorded and it was foundmore effective since the labour cost is very high(Rs.80 to 120/day) in Meghalaya.In IPM in lowland in Meghalaya and Nagalandindicated that by applying the bio-agentTricogramma 50000/ha was found more costeffective to control stem borer

Factors affecting growth of horticultural sectorin the north east region of India

Viewing the importance and growth potentialof the horticulture sector, planning commission hasgiven special focus to this sector for its holisticdevelopment and considerable investment has beenmade during Tenth Five Year Plan (2002-03 to2006-07). Key factors influencing the developmentof horticultural sector is described in the followingsection.

Distribution of farm landsOperational holding is an important factor to

affect the production of horticultural crops

particularly fruits and vegetables. The north easternstates are dominated by the marginal and smallfarmers categories of farmers except ArunachalPradesh and Nagaland where medium farmersconstituted almost half of the total farm households.Overall, Nagaland and Arunachal Pradesh have thehigher operational holding size (4.82 ha and 3.31ha, respectively), as compared to all India level(1.41 ha) followed by Sikkim (1.65 ha), Meghalaya(1.33 ha), Mizoram (1.29 ha), Manipur (1.22 ha),Assam (1.17 ha) and Tripura (0.60 ha). Higheroperational holding size in Nagaland probablyfavours the production of fruit crops in the state.Usually large farmers are likely to put more areaunder fruits and plantation crops rather than smallfarmers because these crops have longer gestationperiod, which may not be favourable for small andmarginal farmers as they prefer crops giving quickreturn. However, this may not be always be truefor the north eastern states particularly in the hillytract of the region where still land abundantsituation prevails and mostly the fruits and spicesare being grown naturally without taking much careand management. However, growing vegetablesrequires special care, management and technicalknow-how, which is lacking among the north eastfarmers, is probably the reason for slow growth invegetable sector.

Area allocation for horticultural cropsThe cropping pattern of the north eastern states

is predominated by the foodgrains crops (mainlyrice) covering almost around 60-70 per cent of thenet sown area. The farming system is characterizedby subsistence agriculture where shiftingcultivation still plays major role and meetinghousehold level food security is the primaryobjective of the farming. Around 84 per cent ofthe farm land is cultivated depending on rainfallonly and thus, monocropping prevails in almostall the states (cropping intensity range between 100–140 per cent only). Kharif is the main croppingseason and dominated by cereals accounting formore than 90 per cent of net sown area in Asaamfollowed by Manipur (89 per cent), Tripura (84per cent), Nagaland (75 per cent), Nagaland (66per cent), Arunachal Pradesh (65 per cent),Mizoram (54 per cent) and Meghalaya (40 percent). Area allocated to vegetables are quite low


accounted for nearly 11 per cent of net sown areain Meghalaya followed by Manipur (8 per cent),Nagaland (6 per cent), Assam (4 per cent), Sikkim(3 per cent) and other sates covering less than 2per cent. Similarly, for orchards, in Mizoramaround 5 per cent of the net sown area is underthese crops followed by Meghalaya (3 per cent)and other states accounted for less than 2 per centof area. Considerable area has been covered by theplantation crops in the states, namely, Meghalaya(38 per cent of nest sown area), Nagaland (18 percent), Mizoram (16 per cent), Sikkim (12 per cent)and Tripura (3 per cent). Other states accountedfor less than 2 per cent of net sown area underplantation crops. In contrast to Kharif season, morearea has been utilized for cultivation of vegetables(around 4-35 per cent of the net sown area acrossthe states) and this shift in area has occurred mainlyfrom the crop area under cereals. However, it isimportant to mention here that cropped area duringRabi season is quite low due to the lack of assuredirrigation facilities and the volume of productionis small as compared to Kharif season.

Resource use efficiency of milk production inMeghalaya

Survey was conducted in Umsning block of Ri-bhoi district and Myllium and Nonmysong blocksof East Khasi Hills district of Meghalaya to findout the resource use efficiency of milk productionin sample households.

Umsning blockThe explanatory variables considered for the

study explained 67.0 per cent of variability in milkproduction. This indicated that about 67 per centof total variation in milk production was explainedby the independent variables included in the modeland rest 33% by variables were not considered inthis study. Regression coefficient for green fodderwas found to be significant at 5% levels ofsignificance. The value of –0.318 as regressioncoefficient of labour and –1.021 as that ofveterinary expenditure implied that with onepercent increase in labour and veterinary chargeamount received from milk production withdecrease by 0.318 and 1.021 percent, thus denotingthe over utilization of these two sources. Labourwas used in access due to availability of labour

and non availability of other employment sources,significance of coefficient of green fodder clearlyindicated the importance in milk productioncoefficient of –0.296 of dry fodder is clearlyindicated the over utilization of dry fodder.

Table 3. Elasticity of production and coefficientof determination (R2) in different Blocks

Umsning Mylliem Nongmynsong Overall

Constant 3.815 -1.666 2.371 1.204Dry Fodder -0.296 0.506* 0.072 0.237

(0.249) (0.196) (0.156) (0.134)Green 0.641* - - 0.196*Fodder (0.25) (0.078)Concentrate 0.551 1.109** 0.435** 0.450**

(0.334) (0.355) (0.103) (0.12)Labor Cost -0.318 0.145 0.224 0.217

(0.361) (0.195) (0.137) (0.153)Veterinary -1.021 -0.074 -0.039 -0.077Cost (0.44) (0.237) (0.034) (0.045)R2 0.67 0.487 0.606 0.76

*Significant at 5% levels of significance**Significant at 1% level of significance***Figures in the parenthesis denote standard error

Mylliem blockIn Mylliem Block regression coefficient for dry

fodder is significant at 5% level of significancewhereas it is highly significant for concentrate. Thisclearly indicated that with increase in these qualityincome from milk would increase. The value of –0.074 as regression coefficient of veterinary costwill decrease the income from milk production by0.074 per cent. This clearly indicated the overutilization of the money on veterinary cost. Thesignificant value of 1.109 of regression coefficientof concentrate clearly indicated that with one percent increase in amount of expenditure inconcentrate would increase the return from milkproduction by 1.11%

Nongmynsong BlockIn Nongmynsong Block the explanatory

variables considered for the study explained 60.6per cent of variability in milk production. Theregression coefficient for concentrate is significantat 1% level of significance. This clearly indicatedthat more expenditure on concentrate wouldincrease the milk production. Regressioncoefficient for veterinary cost was negative. This


indicates that veterinary cost is over utilized andthere is need to control unnecessary veterinary cost.

The overall data from the three blocks showedthat 76 percent variability in the milk productionwas explained by explanatory variables. All theregression coefficients excluding veterinary costwere positive. This indicates that these variableshave direct effect on the milk production in thesample households. The regression coefficient forgreen fodder was 0.196 and was significant at 5percent level of the significance. The coefficientof expenditure on concentrate was highlysignificant (P= 0.01). This clearly indicates the roleof concentrate in increasing the milk production.

Growth modeling of rice production in MizoramThe description about the growth pattern of rice

production in Mizoram from 1980-81 to 2005-06using different nonlinear models is given below.

Logistic, Gompertz and Monomolecular modelsfitted very well to the rice production data ofMizoram. There was not significant difference inperformance of the models. All the modelsdescribed very well the production of rice inMizoram (Table 4). However on the basis ofgoodness of fit tests we conclude that Logisticmodel was the best model for the set of the data. Inour case correlation coefficient between theparameters is less than 0.999 for all the threemodels considered. Hence we can conclude thatall the models describe very well the data. Furtherwe have examined whether the assumptions aboutthe residuals are satisfied for this model or not.The run test |Z| value to check the randomnessassumption of the residuals are very below thecritical value 1.96 of the normal distribution at 5%

level of significance ensures the suitability of themodel. Durbin Watson test was also carried out tocheck the presence of autocorrelation and Statisticvalues are not close to zero and 4, which revealsthe absence of autocorrelation. Thus the mainassumptions about the residuals are satisfied (Table5).

Table 5. Test of randomness, normality andautocorrelation of residuals

Models Logistic Gompertz MonomolecularTest Statistics Model Model Model

Run test |Z| 2.202 2.184 3.002(0.028) (0.029) (0.003)

Kolmogorov 0.122 0.135 0.147Smirnov (KS) (0.200) (0.200) (0.158)testShapiro-Wilks 0.981 0.956 0.933(SW) test (0.903) (0.319) (0.092)Durbin- 1.21968 1.0413 0.880409Watson (D-W)test

Note: Figures in the parenthesis denote the level ofsignificance of the statistic

Economic viability of Jalkund in MeghalayaEconomic viability of the Jalkund was assessed

through estimating various financial viabilitycriteria such as Internal Rate of Return (IRR),Benefit Cost Ratio (BCR) and Net Present Value(NPV). Since economic viability indicates theviability of the project from social point of view,therefore, besides estimating the financial viabilitycriteria, the acceptability (or adoptability) andscope for replication of Jalkund was also assessed.

Table 4. Summary statistics of the fitted models

Model R Square Parameter Asymptotic MSE RMSE MAEestimated S.E.

Logistic Model 0.92685 A=0.2080 0.0303 76.04107 8.2016 5.6842B=5.5325 1.1535C=113.4927 5.2710

Gompertz Model 0.91224 A=0.1286 0.0258 91.2485 8.9844 7.7138B=2.0946 0.2642C=121.3285 9.3305

Monomolecular 0.89286 A=0.0536 0.0226 111.3699 9.9257 8.6838Model B=0.9261 0.04543

C=149.3155 0.2872


Discounted criteria for financial viabilityanalysis capture the time value of money which isimportant under such investment where the costand returns are distributed over a considerableperiod of time. The proposed investment is said tobe financially viable, if IRR is greater than thediscounted rate of interest (12% under presentcase), if the estimated NPV is positive and BCR isgreater than 1. The rationale behind considering12% interest rate is that this is the maximuminterest charged by the bankers for lendingagricultural loan. Prevailing lending interest rateis taken as the proxy for the discount rate as thisrate is likely to take care of the time value of money.

The total cost of construction of Jalkund wasRs. 6820/ per unit. It has been assumed that the netreturn will be realized from the second year afterconstruction of the Jalkund. IRR has beenestimated to be 31%, which is greater than thediscount rate (12%), therefore favours theinvestment on construction of Jalkund. NPV hasbeen estimated to be Rs. 4096 which also indicatedthat investment on Jalkund is favourable BCR hasbeen estimated to be 1.62 which also favours theinvestment on Jalkund. Therefore, all theinvestment criteria namely, IRR, NPV and BCRwere found to be favourable for investment onconstruction of Jalkund. In addition, theconstruction of Jalkund involves low cost andsuited to the existing socio-economic condition ofthe resource poor farmers. This favours the easyadoption and replication of the technology by otherfarmers.

ANIP ON RODENT CONTROL

Rodent species composition and their activitiesin different months

Survey conducted in different areas ofMeghalaya states revealed that the rodentpopulation reached its peak during July-Octoberand showed a decline from November onwards andwas least in the months of February and March.

Nine rodent species were identified and Bandicootabengalensis was found to be the most predominantone (Table 1). Mass bamboo flowering (Fig 1) wasobserved in Garo Hills and sporadic flowering inother districts of Meghalaya.

Table 1. Rodent species composition

Species Composition (%)

Bandicoota bengalensis 37.51Rattus rattus 33.52Rattus norvegicus 0.69Rattus nitidus 11.09Berylms Mackenzie 1.84Canomys badius 0.57Niniventer fluvescens 1.73Albino rat 0.52Mus musculus 12.48

Fig 1. Flowering of Melocanna baccifera

Damage assessment of different cropsRodent damage to rice (upland and low land

conditions), maize, pineapple, broccoli andgroundnut were recorded at different locations ofMeghalaya. Rodent damage to rice varied between0.86 - 9.86% and 1.11 - 10.50% in upland and lowland, respectively. The early maturing rice varietiesrecorded high losses due to rodent. In maize, rodentdamage to the cobs started at the grain formationstage (5.0%), which reached to 8.69% at maturity.


Damage recorded on pineapple and groundnut were12.69% and 10.42% at fruit ripening and cropmaturity stage, respectively.

In the crop fields where regular controlmeasures were taken before the sowing/transplanting of crops, the damages werenegligible. The control operations at different cropstages by using traps or rodenticides or both provedeffective in minimizing the damages by controllingthe rats.

Evaluation of rodenticidesZinc phosphide, bromadiolone and

coumatetralyl were evaluated for their efficacy indifferent locations by burrow placement and fieldplacement methods in different combinations andindividually. By burrow placement method,coumatetralyl reduced the number of activeburrows ranging between 78.00-81.01% indifferent crop fields followed by Zinc phosphide(79.17 - 81.00%). Least reduction was bybromadiolone ranging between 30.50-40.20%.Rodenticides used in combinations proved veryeffective in the control of rodents than usedindividually. By field placement method, theconsumption of coumatetralyl was highest (40.02- 52.40%) followed by bromadiolone (26.01 -38.51%) in three days treatment, while Zincphosophide proved effective even in one-daytreatment with an average consumption of 18.05%.Houses, shops and godowns at different locationstreated with different rodenticides showing that in3 days treatment, the consumption of anti-coagulant, coumatetralyl was highest (30.98 -50.00%) followed by bromadiolone (23.00 -36.00%). The consumption of anticoagulantsgradually increased from the first day to the thirdday while treatment with acute poison (Zincphosphide), reduction in rodent population wasachieved in one day treatment itself with an averageconsumption ranging between 16.05-17.80%. Theconsumption of ropdenticide baits was higher whenplaced in bamboo bait station than when placed inplant leaves. Use of bait stations reduced thecontamination of soil and water caused byrodenticides as well as protects non-target species.

AGRICULTURAL ENGINEERING

FARM MACHINERY AND POWER

Evaluation of light weight power tillerLightweight power tiller holds promise for

agriculture in the hilly region where big machineslike tractor cannot be taken. Therefore, variousattachments for performing different operations likeploughing, sowing, interculture, etc. with this machineneed to be developed. A rotavator attachment for fieldpreparation already exists, which was tested and foundsuitable for hilly terraces in the region

Specifications of power tillerEngine Diesel (Air Cooled)Power 3.7 kWOverall dimension 175 x 61 x 112 cmWheel Base 50 cmWeight 172 kg

(Engine- 59,Main frame & wheel- 70,Rotavator with drivemechanism- 43)

Turning radius 70 cmField capacity 0.06 – 0.08 ha/h

Evaluation of 4-row pre-germinated paddy seederfor hilly region

The results of the field performance testing of the4-row pre-germinated paddy seeder are given in Table.It was observed that the paddy seeder has the


advantage of line sowing in hilly areas with narrowterraces having widths up to 1m. The main advantageof the paddy seeder is that it reduces the seed rate byalmost half from about 125 kg/ha required forbroadcasting in dry cultivation to about 60-80 kg/hafor line sowing using seeder.

The seeder can be pulled by a single person withthe help of a handle provided on the shaft. However,two persons are actually needed in the field forcarrying the machine and turning at the row end. Itcan cover up to 0.3-0.5 ha area in a day and the seedrate is about 60-80 kg/ha. By using this equipmentthe cost of paddy cultivation can be reduced byeliminating the labour requirement for nursery raisingand transplanting. At the time of sowing a thin filmof water should be maintained and the field levelingshould be extremely good. The drawback of thisseeder is that it suits only when there is no sign ofheavy down pour within next 48 h. If rainfall occursimmediately after seeding, the seed get dislocated andhence is a problem.

Field performance of 4-row paddy drum seeder

Parameters Paddy Manualseeder transplanting

Effective field 0.04 – 0.06 0.005 – 0.010capacity, ha/hCost of operation, Rs/ha 500 1000Seed rate, kg/ha 60-80 30-35Labour requirement 30-40 300-400for nursery raising/sowing/ transplanting,man-h/haLabour requirement 200-300 200-300for weeding and interculture, man-h/ha

Specifications of the 4-row paddy drum seeder

Particulars Details

Seed drums Numbers: TwoMade of: 26 gauge GI sheetSize:200 mm diameter x 265 mmlengthCapacity: 3 kg of pre-germinatedpaddy seeds

Seeding type: Gravity flowthrough metering orificesOrifice size: 8 mmOrifice-to-orifice spacing: 18mmRow-to-row spacing: 200 mm

Shaft Length: 940 mmMade of: 20 mm GI pipe

Ground wheel Diameter: 600 mmMade of: 10 mm MS rod

Lugs Size: 40 x 60 mmMade of: 10 gauge MS sheet.

Floats Size: 600 x 10 mmMade of: 16 gauge GI sheet

Handle Length: 1300 mmMade of: MS conduit pipe

Overall dimensions 1700 x 940 x 600 mmDead weight 15 kgPrice Rs. 2100/-

Energy evaluation of locally available agriculturaland forest residues for producer gas throughgasifier

Locally available agricultural & forest residueswere identified for gasification trials to obtainproducer gas. These include fire wood, pine needles,paddy straw, rice husk, maize cob, maize stalk, pulseswaste, groundnut shell, pine apple stalk, banana stalketc. The calorific values of some of these forestresidues are given in the Table below:

Calorific value of some of the forest residuesFuel kcal/kgFire wood 4708Paddy straw 3000Paddy husk 3440Maize stalk 4700Groundnut shell 4200Coconut shell 4350Coal 6930

Feasibility testing of manual paddy transplanterManual paddy transplanter was tested and found

suitable for transplanting wetland paddy. Thetransplanter requires good uniform puddling with thehelp of power tiller or animal drawn puddler to ensureproper fixing of the seedlings and reduced missing.Seedlings have to be grown in a special mat typenursery. These two prerequisites of the machine has


prevented its large scale popularization among northeast farmers. The field capacity of this transplanterwas recorded as 0.015 to 0.08ha/h with plant-to-plantspacing of 20cm.

Feasibility testing of manual chaff cutterManual chaff cutter was tested for feasibility in

the region. It was found to be suitable for choppingdry paddy straw used for mushroom cultivation aswell as dry and green fodder. The capacity of themachine was observed to be 50-60 kg/h for dry fodderand 100-110 kg/h for green fodder. It requires twomen to operate the machine- one for operating theflywheel and another for feeding the material. Farmersshowed keen interest in the machine and expresseddesire to purchase it.

Front line demonstration

Machine/Implement Power AreaSource covered

Wire loop thresher 2 hp motor 5 tSelf propelled vertical Diesel 2 haconveyor reaper engine 5 hp(walk behind)Cono weeder Manual 1 haPost hole digger for Petrol 50 pitsplantation crops engine 2 hpHorticultural Tools Manual 20 demosHand Winnower Manual 100 hPre-germinated Manual 0.5 hapaddy seeder

Custom hiringThe custom hiring of power tiller with attachments

and improved implements like plough, puddler, selfpropelled Vertical Conveyor Reaper, paddy thresherand winnower has been started for the farmers ofnearby villages. The power tiller with rotavatorattachment is in very much demand for ploughingpurpose. Now the farmers are getting initiated topurchase a power tiller and start custom hiring ontheir own.

Custom hiring of power tillers was observed to beone of the additional sources of income for the ownersbelonging to the medium and small land holdingcategory of farmers. However, farmers having largerland holdings were reluctant to lend their power tillersfor custom hiring, because they do not find time to do

so and mostly they use their power tillers at their ownfarm. Data revealed that 62.5% farmers used powertillers for self-use only and rest 37.5% respondentsinformed that they use power tillers for self-use aswell as for custom hiring purpose. Hiring of powertillers were observed only for the ploughing andpuddling operations.

Prototype manufacturingUnder AICRP on FIM and the Revolving Fund

Scheme on ‘Commercialization of farm tools andmachinery for hill agriculture’ implementsWorth Rs. 2, 12, 190/- were fabricated and sold tofarmers and various organizations in all thenortheastern states of the country.

Name of the prototype No.manufacturedduring 2007-08

Tubular maize Sheller 500Pedal Thresher 10Manual Grass Slasher 200Manual Weeder 200Hand Fork 200Garden Rake 200Adjustable Row Marker 50Wheel Hoe 25Rotary Paddy Weeder 25Hand Winnower 20

Large cardamom dryerDrying of large cardamom, by and large is the most

important operation in the processing. The inabilityto adequately dry the produce will at the very leastslow downs the whole process and possibly lead tomould growth. Traditional drying of the crop is crudemethod and mostly the dried product looses value in


the market. Proper drying decides the quality ofproduct and fixes the price in the market. Gray andpink dried cardamom receives a premium price in themarket hence drying has to be done in such a way asto preserve the colour of husk and maintain the qualityof cardamom kernels. Attempts were made to developa commercial dryer suitable for large cardamom. Abatch type tray dryer having about 600kg capacitywas designed and developed in collaboration withCentral Institute of Agricultural Engineering, Bhopal.The dryer was installed and evaluated at ICARResearch Complex, Sikkim Centre. The dryingcharacteristics of large cardamom were studies. Ittakes about 12h to bring down the moisture contentof cardamom fruit from 625% (db) to 50% (db). Aheat exchanger based on diesel fuel was designed anddeveloped as source of energy to drying equipment.The best temperature for drying the cardamom fruitwas 55-60 °C. Overall quality of the dried productwas very good, without any loss in colour, flavourand aroma.

Agro processing complexAgro Processing Complex is being established in

collaboration with Central Institute of Post HarvestEngineering & Technology (CIPHET), Ludhiana forprocessing of ginger, turmeric, pineapple and orange.

SOIL WATER CONSERVATION

Performance of Bhalum-1 and Bhalum-2 ricevarieties in coal mine affected rice soils of JaintiaHills district

Bhalum-2 produced significantly higher numberof grains per panicle (77.58 numbers/plant) ascompared to Bhalum-1 (69.4 numbers/plant) andKhaw Saw, a local variety, (62.9 numbers/plant).Grain yield of Bhalum-2 was highest (5.6 t/ha)followed by Bhalum-1 (4.6 t/ha) and Khaw Saw (3.3t/ha) under application of lime and organic matter (@10 t/ha).

Hence, Bhalum-2 and Bhalum-1 upland ricevarieties may be recommended for cultivation in coalmine affected rice soils with suitable soil ameliorationmeasures to enhance total production level.

Development of a Visual-Basic based forewarningsystem for maize cob borer (Stenachroia elongellaWalk)

A study was conducted (2004-2008) incollaboration with Division of Entomology toformulate a forewarning system for maize cob borer.Five maize varieties (Local Yellow, Pop Corn, babyCorn, RCM 1-1 and RCM 1-3) were grown with twodifferent dates of sowing. It was found that RCM 1-1and Local Yellow had high degree of tolerance to cobborer damage. Again, early sown crop (March) wasleast subjected to borer damage in comparison to latesown crops (April-May).

The forewarning system was developed for themost susceptible variety among them i.e. Pop Corn.The following environmental conditions were foundhighly congenial for heavy cob borer infestation:

A. Temperature: Mean weekly temperatureduring April and May should be d” 22 0C.(Probable range: 16-26 0C)

B. Relative Humidity: Mean weekly relativehumidity during April and May should be d”75%. (Probable range: 65-90 %)

C. Rainfall: Mean weekly rainfall during June,July, August and September should be >80mm/week.


Pest Intensity rating based on above three boundaryconditions:Mean Mean Mean Pestweekly weekly weekly IntensityTemperature Relative Rainfall(0C) humidity (mm)(April-May) (%) (June-

(April-May) September)

(A) (B) (C)

√ √ √ Hx x √ H√ x √ Hx √ √ M√ √ x Mx x x L

H: High (>10%) M: Medium (5-10%)L: Low (<5%)

Evaluation of mulch materials for vegetablecultivation

Evaluation of mulch materials (BiodegradableBlack Poly mulch, Paddy Straw mulch and Grassmulch) for vegetable cultivation, namely, broccoli(Var. Aishwarya) and tomato (Var. SG-017) undermid-hill conditions of Meghalaya was carried outduring rabi, 2007-08 and pre-kharif 2008.

In general the trends of morning soil temperaturerecorded at 5, 10 and 20 cm depths for both thebroccoli and tomato crops indicated that thebiodegradable black poly mulch maintained highersoil temperature as compared to the straw, grass andcontrol (no mulch) treatments. This may probably bedue to higher absorption of solar radiation by the blackpoly mulch during day time and correspondinginsulating effect during night time. Afternoon soiltemperatures were higher in case of poly mulchedand control plots as compared to straw and grassmulched plots. The soil moisture content in the 0-60cm profile was highest in straw mulched plot whilethe lowest values were observed in case of control.Significantly higher yields were recorded in case ofpaddy straw mulch (broccoli – 15.9 t/ha-1, tomato –40.5 t/ha-1), grass and poly mulch. as compared tocontrol (broccoli – 13.2 t/ha-1, tomato – 38.0 t/ha-1).Poly mulch treatment gave relatively lower yields(Table 1) which may be due to the burning effect ofhigher ambient temperatures on young seedlings atthe time of transplanting. It was observed that the plantparts which touched the edge of the plastic holes werescorched which even resulted in the death of someplants.


The evaluation parameters for biodegradable polymulch are presented in Table 2. Significantdegradation of the biodegradable poly mulch wasobserved only at the time of harvest of the secondcrop (tomato) at around 32 weeks after the laying ofpoly mulch (Plate 4).

Table 2. Evaluation parameters of biodegradableblack polythene mulch

Weeks Assessment Scale*afterlaying Degradation Degradation Lesions3 Tear

of exposed of buried strength4

film1 film2

1 9 - 9 95 9 9 9 97 9 - 9 99 8 9 8 8

13 8 8 7 818 6 - 5 623 5 7 4 425 4 6 4 432 3 5 2 2

1: 9 = 100% soil covered; 1 = 0% soil covered2: 9 = new film; 1 = film totally disappeared3: 9 = no lesion; 1 = high number of lesions4: 9 = very strong; 1 = extremely brittle*Laying damage: Laying was done by hand, no damage occurred.

Table 1. Yield of broccoli and tomato under different mulching treatments

Crop Yield (t/ha-1) (P=0.05)

Control Biodegradable Paddy straw Grass poly mulch mulch mulch

Broccoli (Aishwarya) 13.2 14.6 17.6 15.9 4.26Tomato (SG-017) 38.0 40.0 41.5 40.5 10.43

Figure 1. Variation of morning soil temperature at 5cm depth in broccoli crop



Figure 4. Variation of profile soil moisture (0-60 cm)in broccoli crop at different days after transplanting

(DAT)


Study on effect of land slope on uniformitycoefficient and water application throughsprinkler

A study on variations in uniformity coefficient,discharge and area covered by sprinkler irrigationsystem on hill slope was conducted. The sprinklerirrigation system was laid in our research farm on41% slope with two laterals having three sprinklersin each lateral. All the three sprinklers in a lateralwere on same elevation. The source of water washarvested rainwater in a LDPE lined pond. Theelevation difference between two laterals was 3.5 andwater source to first lateral was 4.5 m. Plasticcontainers having 6" diameter were placed in astaggered manner for first and last sprinkler. Theirrigation system was operated three times with eachoperation for one hour each. Radius of throw andwater collected in containers was measured.

A significant decrease in area covered by firstsprinkler (nearest to the water source) and last

sprinkler (farthest from the water source) wasobserved. The area covered by the 1st sprinkler was254 and 6th sprinkler was 113 m2 i.e. a reduction of55% was observed. The discharge of 1st sprinklerand 6th sprinkler was 1.94 and 1.25 l/m2/h,respectively recording a reduction of about 35%. Thevalues of uniformity coefficient were 0.71 and 0.67for 1st and 6th sprinkler. Though the area coveredand the discharge from the sprinklers variedconsiderably, there was not much difference inuniformity coefficient between the sprinklers.

The irrigation covered five terraces (Fig.1). Theinitial soil moisture content in 0-15 cm depth of thefirst, third and fifth terraces were determined throughgravimetric method. Two hours after application ofirrigation, soil moisture content of these terraces wereagain determined. The initial soil moisture content ofthe first, third and fifth terraces were found to be 28.60,28.37, and 27.04 %, respectively. After applicationof irrigation the moisture content of these terraces

Plate 1. Freshly laid plastic mulched plot Plate 2. Status of biodegradable polythene mulchafter 23 weeks of laying

Plate 3. Tomato crop in degraded poly mulch Plate 4. Status of biodegradable polythene mulchafter 32 weeks of laying


rose to 34.13, 33.75 and 31.92 % registering anincrease by 5.53, 5.38 and 4.88 % respectively, overthe initial values.

Polyhouse for production of seedlingsThe farmer of Umdohbyrthih village raised the

nursery of tomato and brinjal inside the polyhouse.Seeds of both the crops were sown in first week ofApril inside the polyhouse. The farmer also placedthe seeds in open area on same date on our advice forcomparison. The variety sown was Rocky for tomatoand RCMB-6 on brinjal. The tomato seedlings growninside the polyhouse were ready for transplantationin 6th week whereas seedlings grown in open wereready for transplantation in 8th week i.e. almost 10days later than the seedlings grown inside thepolyhouse. On an average 1540 healthy seedlingsper m2 of tomato were obtained from the polyhousewhereas from open area 1120 healthy seedlings perm2 were obtained i.e. growing seedlings inside thepolyhouse fetched 28% more as compared to the openarea. In case of brinjal also same trend was observed.Seedlings attained transplanting stage in 5th weekinside the polyhouse and in 7th week in opencondition, almost 12 days later in open condition ascompared to the polyhouse condition. About 1610healthy seedlings per m2 of the brinjal variety wereobtained in the polyhouse whereas from open area1220 healthy seedling per m2 were obtained recordinga survival percentage of 24% more inside thepolyhoue. Comparatively less temperature and frostmight be the reason for slow growth and less survivalpercentage in open condition.

Protected cultivation

Okra: Arka Abha variety was sown in side thenaturally ventilated polyhouse (Fig. 2) in the month

of April. Seeds were sown on raised beds. Beforesowing the seeds well-rotten cowdung was mixed inthe soil @ 25 t/ha. The spacing between row-to-rowwas kept as 45 cm and plant-to-plant as 30 cm. Averagedays of emergence was observed as 4.7. Profused andvigorous growth of plants were observed. Averageplant height was 172 cm. No incidence of diseaseand pests was observed. Therefore, no chemical plantprotection measures were adopted. Average fruitlength and number of fruit per plant was 18.7 cm and26, respectively.

Fig 2. Okra crop in the polyhouse

The average yield obtained was 18.7 t/ha. Benefitcost ratio for the current year including the cost ofpolyhouse was calculated as obtained as 3.1 followingthe discounting technique.

Tomato: In karif season tomato crop (Fig. 3) wascultivated in the naturally ventilated polyhouse.Continuous long wet spell during kharif season andhigh incidence of insects and pests during the periodspoil the crops. Tomato is one of the high valued cropsin the region and is mainly attacked by wilt and fruitborer. Protected cultivation of tomato eliminated theproblems. Tomato seedlings of Rocky variety werepanted in the polyhouse in the last week of June. Row-to-row and plant-to-plant distance were kept as 60and 45 cm. Farm yard manure @ 25 t/ha wasincorporated in the soil before transplanting theseedlings. Vigorous growth was observed. Due toprofused growth plants were supported with bamboo

Fig 1. Sprinkler irrigation system in operation on hillslope


frame. On an average 33 fruits per plant was obtained.Per plant yield recorded was 1.130 kg. The yieldrecorded from 30 m2 area was 123 kg, which isequivalent to 41.0 t/ha. Occurrence of bacterial wiltwas observed after 40 days of transplanting. Theaffected plants were uprooted and burnt out side. Toprevent the occurrence of the disease in future,Steptomycine Sulphate @ 200 ppm was applied twiceat an interval of 15 days which prevented theoccurrence of disease again. The cost of cultivationincurred was Rs. 430 for 30 m2. The cultivation oftomato crop inside the polyhouse gave the B: C ratioof 2.6: 1.

Fig 3. Tomato crop cultivation in polyhouse by afarmer

Strawberry: Entire northeastern hill regionexperiences high rainfall from May to mid Octoberand intermittent rain during winter season socultivation of strawberry in open condition is aproblem and challenge. A bamboo framed rain shelterwas constructed in farmer’s field to study thefeasibility of protected cultivation of strawberry.Polythene sleeves of 9" diameter was used for plantingthe strawberry seedlings. Well rotten cowdung andsoil in ratio of 3:1 and one table spoon of ground cowbone was mixed properly and filled in sleeves. Theseedlings were planted in the sleeves in the month ofSeptember. When plants were established DAP wasapplied. Fruiting started in the month of Decemberand was continued upto April. DAP was again applied@ about 10 g in each sleeves in the month of February.Irrigation and weeding was done as done as and whenrequired. Rise in the air temperature inside thestructure was about 3-40C. About 12 to 15% fruitsobtained from open area were damaged either bydisease, bird bite, black spot or frost. Vegetativegrowth of the plants inside the structure was morevigorous. The average number of fruits per plant insidethe rain shelter was recorded as 47 whereas in open

areas it was 41. The size of fruit was also bigger incase of rain shelter. The average weight per fruit fromthe rain shelter was 14.5 g while 11.3 g from the openarea. On an average form the entire fruiting periodfrom December to April, about 682 g of fruits perplant were obtained from the rain shelter which isabout 47% more as compared to open area. The costof construction of the rain shelter was Rs 146 per m2which increased the yield by 1.10 kg per m2. Thestudy showed that rain shelter enhances yield and ofstrawberry and economically feasible (Fig. 4).

Fig 4. Strawberry crop cultivation in polyhouse by afarmer

Round-the-year-utilization of polyhouseAs vegetable is considered as high valued crops

in the entire NEH region, cultivation of vegetablesinside the polyhouse may fetch handsomeremuneration to the growers by way of round-the-year cultivation of good quality produce. Threecropping sequences viz; tomato-french bean-cabbage,capsicum-tomato-cabbage, and capsicum-tomato-lettuce were tried to ascertain the better one to fetchhigher income to the farmer. As per the farmers’practice only FYM @ 25 t/ha was applied beforesowing of each crops. The cost of cultivation wasestimated by taking into account the cost of labour,seed, FYM, etc. The market price existing at the timeof harvesting of crop was taken into account forestimation of financial benefit. The cost ofconstruction of low-cost polyhouse including cost ofbamboo and labour was worked out as Rs 156.40 /m2

of covered area. Two cropping sequences werefollowed in the polyhouse. They were capsicum-tomato-lettuce and tomato-French bean-cabbage.Polyhouse was divided into two halves eachcomprising of 18 m2 area. In one half one sequencewas practiced while other half was assigned for othersequence. Total value of produce from capsicum-tomato-lettuce was calculated as Rs. 1964 and Rs.


1368 from tomato-French bean-cabbage. The netannual income for capsicum-tomato-lettuce sequencewas worked out as Rs. 109.10 per m2 of land areawhereas for tomato-french bean- cabbage sequencenet annual return per m2 land area was calculated asRs. 76.0. Overall Benefit: Cost (B: C) ratio of theproduction system was calculated by followingdiscounting technique. For the analysis cost ofconstruction of low-cost polyhouse, its annualmaintenance cost, and cost of crop cultivationincluding labour and inputs costs, and net return basedon prevailing market price of the produce wasconsidered. The service life of the polyhouse wasconsidered as 5 years with one major repairing in 3rdyear. The B: C ratio for capsicum-tomato-lettucesequence was calculated as 2.1 and 1.7 for tomato-French bean-cabbage.

AGRICULTURAL EXTENSION

The Agricultural Extension Division has laidemphasis on research, training and extension forthe development of various stakeholder duringreported year. This division has worked on needbased research projects to find out the potentialityof different social systems in accepting/adoptingmodern agricultural and related practices. This hashelped the farmers of the adopted villages totransform the existing cultivation and animalrearing practices into a scientific one to gainnoticeable profit. Besides this, a number of trainingprogrammes were conducted for the improvementof knowledge and skill. The sponsored trainingprogrammes were conducted for the stategovernment official and KVK SMS. The divisionalso participated on behalf of the institute in variousexhibitions to showcase the technologies developedby this institute for the benefit of the farmingcommunity. The farmers, students, entrepreneursand others were entertained during their visits tothis institute, and given exposure of scientificfarming and animal rearing.

(A) Research

The following research projects were handledduring the year(1) Assessment of Watershed Development

Technology at Farmers Field.(2) Development of Extension modules for

production of demand driven commodities(3) Gender based technological options and their

characterization in agriculture and alliedsector

(4) Collection, Documentation and Validation ofIndigenous Technical Knowledge forsustainable Agriculture in NEH Region

“ Assessment of watershed technologies atfarmers field”

1. Selection process for watershed project byimplementing agency

The watersheds were selected on the basis ofhuman and livestock population, survey ofvegetation area, present yield, varieties, andagronomical practices followed by the farmers. Soilcum land capability survey was carried to knowthe chemical and physical properties of soil anddrainage system. Engineering cum topographicalsurvey was done for the demarcation of hillocks.The information was also collected on existingwaste land, silt yield index, water quality,employment opportunities, availability of basicamenities in the village, and lastly willingness ofcommunity people in the watershed programme.The headman and other executive members ofdurbar were taken in to confidence for successfulimplementation of project. The most of theinformation were collected through PRA surveyand group discussion.

2. Methodology adopted by PIs to increase theparticipation level of farmers in the watershedareas.

The PIs of different watershed informed thatthe all the interventions were prepared inconsultation of durbar executive committee andsome progressive farmers. The participatoryapproach was applied to finalize the site andinterventions. The inputs were provided free of costand in time. Financial help and skill guidance were


provided time to time, trainings were organized toupgrade the knowledge and skill. Male and femalefarmers were given due consideration. Most of thesocial institutions restriction, respect empowermentand needs were taken in to consideration duringthe programme.

(a) MeghalayaA study in ICAR managed watershed indicated

that the 48% farmers belonged to the more than 40years age group having medium family size withprimary level education. The main occupation ofall the farmers is farming growing paddy, maize,vegetables and rearing pig and poultry. Crop andhorticulture based systems were found sustainable.All the farmers were the members of the farmersassociation.

The watershed programme implemented by theState Govt. indicated that the old people, withmedium family size, had farming as occupation.Paddy, maize, broomstick, vegetables, pig, poultryand livestock components were found in thewatershed. DHOs and DAOs were the main sourceof information. The participation of farmers wasmaximum in the durbar and church.

(b) MizoramThe majority of farmers belonged to medium

age group, having medium family, high school leveleducation, farming as main occupation, growingpaddy, maize, vegetables, rearing pig and poultry.Crop and horticulture based systems were common.Majority of the farmers were members of the clubhaving poor information network.

(c) NagalandThe majority of farmers in ICAR watershed

belonged to the old age group having mediumfamily size with primary level education. The mainoccupation of all the farmers is farming growingpaddy, maize, vegetables, rearing pig, fish andpoultry. All the farmers were the members of thecooperative society.

3.Participation level of farmers andimplementing agencies in watershedmanagement.

It revealed from following tables that almostall the farmers participated in the land preparation,

seed arrangement and marketing of produce all theselected watersheds. The minimum participationwas observed in use of fertilizers, pesticides,horticultural crop etc. This may be due to thedependency on the implementing agencies forseedlings and other inputs.

4. Peoples participation in crop productionactivities

It was noted that the majority of farmers inwatershed were fully participating in theprogramme, 72% farmers were fully participatingin deciding of need based crop. Similarly, 36%farmer of state department’s watershed were fullyparticipating in programme and deciding ofcropping system for sustainability. It was due tothe need of farmers as per their economicconditions. In Nagaland, 73% farmers weresupporting fully for crop production technologies.They felt that scientific package of practice wouldhelp in increasing of production.

5. Peoples participation in livestock rearingactivities

It was found that the majority of farmers (75%)were partially participating in the watershedprogramme for increasing production andproductivity of pig,56% adopting the recommendedpractices and 93% agreed for fully participating inthe management of livestock. Mizoram farmersagreed to participate in taking care of livestock.87% farmers of Nagaland taking care of livestockthemselves and 60% farmers partially participatedin establishment of livestock unit in watershed.There is need to motivate farmers of Mizoram toparticipate more in the watershed activities.

6. Peoples participation in soil and waterconservation activities

The research revealed that the majority offarmers were partially participating in the soil andwater conservation activities, planning anddesigning of programmes related to soil and waterconservation. The participation of farmers in soiland water conservation was very poor. So there isneed to motivate the farmers for activeparticipation.


7. Use of soil and water conservation practicesThe study showed that 92% users group adopted

intercropping followed by 69% contour farmingand 65% cover crops in the watershed area. Non-users group was practicing intercropping (80%) andother measures were not seen. The same findingswere found in other states. It showed that thewatershed programme has motivated all thebeneficiaries and need to be implemented in otherplaces also.

8. Participatory decision makingIt is seen that ICAR implementing agency is

using more participatory approach in comparisonto the state department.

9. Views of farmers toward watershedprogramme

64% farmers were of the opinion that traditionalfarming system was given low consideration byimplementing agencies. Farmers said that highlevel of awareness was created among thebeneficiaries and 82% accepted as aware about theprogramme. 72% farmers expressed their viewsthat women were given due consideration. It ishelpful in conservation of soil and water. However, non beneficiaries were of the opinion that highlevel of attention has been given towards thenumber of crops, technologies suitable for thefarming in the Meghalaya. Further informed thatbeneficiaries of Mizoram were less aware aboutthe programme 42% non beneficiaries informedthat traditional system was taken into consideration.In Nagaland, a high level of awareness was created.60% farmers were in the opinion that traditionalfarming system was not taken into considerationwhile implementing the watershed programme. Thesame reply was given by the non beneficires.70 %farmers agreed that flexibility was of theprogramme. It has increased the income andemployment. 80% farmers were of the opinion thatproductivity and production has increased byintroduction of programme.

10. Benefits provided to the users group and notusers group

Results indicated that ICAR imparted trainingon soil and water conservation to 86% users groupand 12% non users group. 90% users group and

30% non users group were provided training onpackage of practices of different crops. The statedepartment provided training to 62%users groupand 2% non users group on soil and waterconservation and 80%users group and 15% nonusers group on package of practices. The seed wasprovided to all the beneficiaries but only 20% nonbeneficiaries were covered. The same trend wasobserved in other states also. The results indicatethat watershed programme should be extended.

11. Withdrawal effects of watershed programmeFarmers of all the selected state were continuing

the programme with the same tempo created duringthe programme. All the farmers have shown theirhappiness and satisfaction towards the programmein the Meghalaya and Nagaland. It was observedthat happiness and satisfaction was low in the statedepartment watershed programmes. Most of thefarmers were in favour of continuing of theprogramme.

12. Management of watershed after withdrawalby implementing agency

The results indicated that 76% farmers weremanaging the fund by themselves for continuingof all the components in ICAR watershed inMeghalaya. But in Nagaland this response was verypoor. In case of state watershed programmes, 50-90% farmers were managing the watershedcomponent by themselves.

Farmers were very much confident about theICAR implementing agency that inputs providedeither free of cost or purchased by the farmers evenafter the withdrawal of programme. This may bedue to the nearness of ICAR. Farmers (70%) fromstate department watershed replied that inputs werepurchased from market. Regarding trainingprogrammes, farmers of ICAR (96%& 82%) andstate department (80% & 90) informed that it isbeing provided time to time on different aspect ofcrop, horticulture, entrepreneurship and livestockmanagement. Most of the farmers were selling theirproduce in the rural markets.

13. Achievement after implementing ofwatershed programme

It was seen that project had‘ more impact in theNagaland in comparison to Meghalaya and


Mizoram. In general crop production andproductivity, income increased and socio economiccondition and living standard improved. The soilerosion was checked by adopting various measures.

14.Constraints perceived by the farmersThe Meghalaya farmers perceived first and

foremost problem in timely arrangement of seedfollowed by livestock related problem, onavailability of FYM, training need and nonavailability of piglets. In case of Mizoram, farmersperceived water problem followed by roaddevelopment, information regarding agriculture.Farmers of Nagaland faced the problem of roaddevelopment followed by seed arrangement,profitable system, non availability of inputs, timelyand information related to agriculture. The overallproblems were road development; livestocktechnologies, information regarding variousprogrammes, seed arrangement timely and needbased training programmes.

Strategies for effective implementation ofwatershed programme.

On the basis of results obtained in Meghalaya,Mizoram and Nagaland some strategies are beingsuggested for improvement of the watershedprogramme given below:• All the farmers of village/watershed should be

involved in the programme rather thanemphasizing only on few progressive farmers.

• The potentiality of traditional farming systemmust be assessed before implementingwatershed programme because that issustainable system.

• Participatory approach should be applied toassess the natural resources and to evaluate theprogramme.

• Gender based intervention should be preparedthrough participatory mode in the presence ofwomen and men.

• Implementing agency should maintain therelation after the withdrawal of project.

• Training component needs to be emphasizedtime to time.

• Information has to be provided time to time tothe farmers regarding the new developmentprogrammes.

• The input agencies should be introduced withthe farmers for timely supply of inputs.

• Linkages should be developed with themarketing agencies for remunerative process.Generally it has been observed that theimplementing agency emphasize on productionof various crop, but they never bother for themarketing of produce.

• Implementing agency to stick with decisionstaken during the meeting.

(2) Development of extension modules forproduction of demand driven commodities

Socio economic profile of vegetables growersof Meghalaya

It was found from the table 1 that majority ofvegetable growers belonged to the middle agegroup having medium size family, medium level

Table 1. Socio economic profile of vegetablesgrowers of Meghalaya (N=120)

Varaibles Categories F P

Age Young (Up to 40) 32 26.67 Middle (41-50) 62 51.66Old (51 and above) 26 21.67

Family Size Small 33 27.50Medium 61 50.83Large 26 21.67

Education Low 42 35.00Medium 57 47.50High 21 17.50

Land Holding Small 60 50.00Medium 40 33.34Large 20 16.67

Vegetables Tomato 160 83.34Capsicum 60 50.00French Beans 111 92.50Chillies 40 33.33Cauliflower 35 29.16Cabbage 35 29.16Ginger 119 66.16Turmeric 52 43.33

Marketing Local Market 78 65.00Weekly Market 75 62.50Shillong Market 120 100.00Regulated Market 40 33.33

Market Supplier Small 72 60.00Medium 20 16.66High 20 16.66

Prices Low 67 55.83Medium 28 23.33High 25 26.83

Social Participation Low 31 25.83Medium 62 51.66High 27 22.50

Mass Media Low 51 42.50Medium 48 40.00High 21 17.50


education, small size land holding. Majorvegetables grown were tomato, capsicum, Frenchbean sold in local market with the less remunerativeprices. They have medium social participation andlow mass media exposure.

Major crops grownThe farmers were growing tomato, capsicum

tomato , capsicum, French beans, chillies, ginger,turmeric, cauliflower, pumpkin, brinjal. andcabbage for selling in the different markets. Beans,tomato and ginger were the major crops grown bymore that 90 percent farmers given in the table 2.

Table 2. Major vegetables grown by the farmers(N=120)

Categories F P

Tomato 80 83.34Capsicum 62 50.00French Beans 87 92.50Chillies 51 33.33Ginger 93 77.50Turmeric 48 40.00Cauliflower 20 66.66Pumpkin 36 30.00Brinjal 24 20.00Cabbage 25 20.83

Major markets for selling of produce by thefarmers

The information presented in the table 3indicated that the small and medium farmers wereselling their produce in the local markets followedby Bara Bazar , Bhoirymbong markets. The largefarmers were selling their produce in the BaraBazaar, Bhoirymbong and some time in regulated

market also. This was because of low productionin case of small farmers and high production incase of large farmers and more accessibility to themarket.

Table 3. Major markets for selling of produceby the farmers (N=120)

Small Medium Large

F P F P F P

Local Market 101 84.16 98 81.66 10 8.33Field 30 25.00 20 16.66 0 0.00Bara Bazar 70 58.33 80 66.66 104 86.66Umsung Market 10 16.66 30 25.00 40 33.33Mawlasnai Market 20 16.66 30 25.00 40 33.33Bhoirymbong Market 50 41.66 80 66.66 80 66.66

Mode of marketing Most of the farmers were selling their produceindividually in local market or in bara bazaar. Somefarmers have made a self help group for sellingtheir produce. Some farmers sell their produce tothe collection center in the village. It can be saidthat there were changes in the marketing ofproduce.

Table 4. Mode of marketing (N=120)

Group 10 8.33Individual 90 75.91Seller in village 20 16.66

Training organizedTraining programmes organized on different

aspect of agriculture for farmers, NGOs,entrepreneurs, state government officials and otherline departments.

Name of training Date No. ofParticipants

Training programme on rapid rural market survey 21 May 2007 32Training programme on horticulture for 14&15,2007 40Tripura farmersTraining programme on horticultural crops and 19-22 May 2007 43post harvest managementVisit cum training programme on crop production 31.July 2007 64for Tripura farmersTraining programme on biotechnology for students 8-12 October 2007 11


Sponsored training programmes, summer school/winter school / seminar/congress organized

Name of sponsored programmes Date No. ofparticipants

Course was designed and taught to the B.Sc. students 24th March 2007 to 20from College of forestry and Horticulture Pashighat, 1st April 07Arunachal Pradesh, CAUOrganized model training course on integrated 17-24 July 2007 27farming system for hill agriculture for state Govt.Officials sponsored by Directorate Of Extension ,New DelhiOrganized orientation programme for SMS of 21-28 August 2007 31KVK sponsored by ZC Unit,Zone—IIIOrganized Training programme on development 03-06October 2007 33of soil testing skills for educated rural youth forgeneration of income and employment sponsoredby NABARD,ShillongOrganized Training programme on Advanced 20-27November 2007 23technology for off season vegetables under protectedconditions sponsored by Directorate of Extension ,New DelhiProvided assistance in organizing of 2nd Horticulture 18-21 April 2007 250congress2007 held at ICAR Research Complex,Umiam, Meghalaya

FEED AND FODDER

Annual legume fodderTwo annual legume fodder viz. rice bean (Vigna

umbellata) cultivar RCRB-10 and soybean (Glysinemax) cultivar MOUS-98-2 were grown in acidicsoil at mid altitude. The fodder yield of rice beanand soybean was 20.50 and 15.42 t/ha, respectivelywith 16.65 and 19.00 percents dry matter in 70 and60 days of cropping periods. Both the fodders werevery much palatable amongst ruminant animals andcontained protein content more than 15% on DMbasis with good amount of mineral content.

Annual winter fodderOats (var. Cant) was grown as winter annual

fodder under rain-fed condition at mid altitude inacidic soil. Fodder was harvested after 70 days andan yield of 19.25+ 3.06 t/ha was recorded with13.80% DM. The second cut of fodder was taken

after 50 days of first cut and fodder yield was18.50+2.50 t/ha with 20.70% DM. Fodder yield inthe current year was lower than previous year andit might be due to very less rainfall during winter.Even at this level of production, oat fodder can bea successful alternative winter fodder in the regionfor ruminant feeding to sustain the green fodderrequirement for the lean season.

Perennial winter fodderParari (Schefflera wallichiana) fodder tree block

was developed on foothills at zero percent slopesat mid altitude with planting density of 2500/ha.Similarly, another fodder block of broom(Thysanolaena maxima) was developed in redlateritic brown hill soil with big rock fragmentsand variable soil depth at mid altitude on 10-20percent slopes. The soil is practically not suitablefor agricultural crops. Thus, broom was planted asa winter fodder crop for feeding to ruminants. Thefodder yields and other characteristic features wererecorded and presented in Table 5. The palatability


and DM intake of broom and Parari fodder in goatswas good and it was observed that 30-85 goats canbe maintained/ha during winter season (December– March) by planting these perennial fodders (Fig.5) depending upon soil structure and types of fodderplanted.

Broom Parari

Fig. 5. Winter fodder production in different landuse system

Table 5. Yield performance of Broom and Pararifodder

Types of fodder Fodder DM Nos. of adultYield Yield goat maintained/(t/ha) (t/ha) ha during winter

season

Pararii. 3-4 years old 10.84 2.70 30ii. More than 5 29.62 7.37 85

years oldBroom

i. 3-5 years old 20.25 5.63 65

Sweet potato tuber as energy feedThree types of sweet potato cultivars (Kokrajhar

red, Pusa safed and Sankar) were grown in acidicsoil at mid altitude of Meghalaya to study theirproduction potential. The stem slips weretransplanted in the month of July in raised bedsand tubers were harvested after 140 days cropduration. The yield attributes and characteristicsof tubers are given in Table 6 and it revealed thatSankar cultivar was better in terms of dry matter,

digestible energy (DE) and protein yields and itcan be used as good energy resource for animalfeed in the region.

Table 6. Yield performance of different sweet potato cultivars

Sweet potato cultivar Tuber yield DM CP value DM Yield Protein yield DE yield(t/ha) (%) (g/100g DM) (t/ha) (q/ha) (Kcal/ha)

Kokrajhar red 30.20 29.50 3.79 8.91 3.37 28x106

Pusa Safed 19.40 33.76 5.87 6.55 3.84 21x106

Sankar 34.20 27.25 5.65 9.32 5.26 30x106

APICULTURE ANDVERMICOMPOST

Apiculture

Pollination efficacy of Apis cerana indicaPollination efficacy of Apis cerana indica,

pollinated radish and brinjal showed 705.79% and34.9% increase in seed yield as compared to beeun-pollinated crop (control). It was also recordedthat there was 8.3% increase in fruit setting in A.cerana indica pollinated tomato crop.

VermicultureOut of five indigenous earthworm species,

Eisenia foetida and Perionyx excavatus wereevaluated for their efficiency in decomposingcowdung, kitchen waste, forest liter, waste paperand vegetable waste/ crop residue. It was observedthat Eisenia foetida decomposed all the wastesunder experiment faster than Perionyx excavatus.Eisenia foetida completely decomposed thecowdung and kitchen waste in 90 days, whereas,Perionyx excavatus took 115 days. Both theearthworm species required more time fordecomposing forest litter and waste paper. Themultiplication rate of Eisenia foetida was higherthan Perionyx excavatus in all the wastes underexperiment. Multiplication of Eisenia foetida was5.8 times on cowdung and 4.6 times on kitchenwaste. Perionyx excavatus multiplied 2.8 times onvegetable waste and 2.1 times on waste paper. Boththe earthworm species produced 100 kg ofvermicompost from the waste of 15 kg forest literalong with 100 kg cowdung.


ANIMAL SCIENCE

DAIRY

Nutrition

The data collected for the last eight years fromthe dairy unit of Animal Nutrition Division wascompiled for assessing the performance of dairyunit under the institutional set-up. The dairy unitcomprised of HF crossbred cattle having around75% HF blood. In the herd, the cows were offeredhybrid perennial grasses, paddy straw andconcentrate mixture to meet the animalrequirements as per the availability depending onthe season. The concentrate mixture comprised ofmaize, wheat bran, mustard oil cake, ground nutcake, mineral mixture and salt. During the monthsfrom May to November, around 90% of theroughage DM was met through perennial grassesin cut and carry system and the remaining throughpaddy straw where as during the lean season i.e.from December to April, paddy straw formed thesole source of roughage. Six kg concentrate feedwas offered per animal per day to meet themaintenance as well milk yield requirements up to10 liters per day. Above 10 liters of milk yield, 1.0kg concentrate was offered for every 3 kg milkyield.

The productive and reproductive performanceof crossbred HF dairy herd over a period of eightyears under institutional conditions is given inTable 1 and Fig 2. The results indicted that theclimatic conditions in the northeastern region arefavorable for rearing of HF cross bred.

HEALTH

Surveillance, monitoring and investigation ofdiseases outbreaks in the region

BrucellosisA cow at a dairy farm in Meghalaya exhibited

the clinical symptoms of brucellosis like hygroma,foul smelling and turbidvaginal discharge. TheBrucella organism wasisolated. The cattle farm fromwhere this cow was transferredwas seroscreened forbrucellosis and 2 (14.3%) outof 14 cows were foundseropositive. Besides this farm,seroscreening of 130 serumsamples collected from cows indifferent parts of regionrevealed 3 (2.3%) samples tobe positive for Brucellaantibodies.

Table 1. Productive and reproductiveperformance of dairy herd

Particulars Nos. of Mean ± SEobservation(n)

Milk yield / lactation (l) 44 3423 ± 134Lactation length (d) 44 390 ± 16Milk Yield per day (l) 44 9.2 ± 0.43Milk Yield /day 44 11.7 ±0.45in first 300 days (l)Age at first calving (d) 15 811 ± 29.7Calving interval (d) 30 437 ± 19Dry period (d) 34 50.4 ±4.14Days open (d) 29 155 ± 18.15

Fig 2: Milk yield pattern after calving in crossbred HF cows


PIG

PRODUCTION

Analysis of Bio-resource inflow and outflow inthe smallholder low input pig production system

Four villages were selected and a total numberof 40 farm households were selected randomly (10households from each village) to study the patternof management of local resources undersmallholder pig production system. The productionsystem was assessed based on interview andpersonal observations. All the farmers practicedsmallholder low input pig production system.Invariably all the pigs were reared under intensivesystem and housed in small pigsty made up of woodand bamboo. Pigs were fed with crop residuesobtained with in the farm and some specific plantsharvested from the common property resources(forest) besides kitchen waste. Pig feed was usuallycooked. The average ration comprised of 0.7-1.5kg local plants, 1.5-3.2 kg kitchen waste and 150-250 g rice/wheat bran. The local plants comprised

mainly of Spilantus sp, Conyza sp, Amaranthus sp,Bidens sp and Mikania sp. Leaves and stems ofcolocasia, leaves and vines of sweet potato andleaves of tapioca were also fed to the pigs,sometimes along with tubers and roots, dependingupon the availability. All the villages showed acommon pig feeding system. Bio resource inflowand out flow of the smallholder pig productionsystem represented a mixed crop-pig productionsystem (Fig. 1).

A practice in this area was that dried grass,obtained from forest, was provided as beddingmaterial for pigs and left in place as such for atleast one week. The dung and urine of the pig gotmixed with the grass and the soiled beddingmaterial was collected and heaped on the groundor kept in a pit for 45-60 days. Once the materialbecame compost like, it was applied in the fieldfor crop production.

Mineral profiling of local pig-feeds and pigsreared under resource driven production systemin northeastern India

Mineral deficiency has been demonstratedrepeatedly as a cause of low productivity and it is

Fig 1. Bio resource inflow and out flow in smallholder resource driven pig production system


generally recognized that quantitative variations ofthese elements in feed are important factors ingrowth, health and reproduction of animals. Thepresent study assessed the mineral status of the pigsfed with local resources. The commonly used plantsfor feeding pigs were collected, dried in an oven at70o C for 48h and ground to powder. Blood sampleswere collected from Hampshire, Large WhiteYorkshire and indigenous pigs reared underresource driven low input production system, serumwas separated and analyzed for total protein,albumin and cholesterol levels. Processed plant(each one gram) and serum samples (1 ml) weredigested with diacid mixture (HNO3:HClO4; 10:4)using wet acid digestion method and macro(calcium, phosphorus, magnesium, sodium andpotassium) micro (copper, cobalt, manganese, ironand zinc) minerals were estimated. The extent andincidence of mineral deficiency in pigs wasquantified.

Results of serum biochemical analysis revealedno significant difference in total protein andalbumin levels between any two breed/types ofpigs. However, the blood serum of indigenous pigsshowed significantly (P<0.05) higher cholesterollevel compared to other two breeds (Fig. 2). Amongdifferent plants, Spilanthus sp had majority ofmacro and micro nutrients in high levels. Regardingincidence of mineral deficiency in pigs, it wasobserved that 90, 67.1, 61.4, 48.6, 95.7% of the

pigs were deficient in calcium, phosphorus,sodium, magnesium and potassium. An interestingfinding was that all the pigs (100%), utilized in thestudy were deficient in zinc. Similarly, 94.3% ofpigs were deficient in copper, 78.6% deficient inmanganese and 55.7% were deficient in iron. Theextent of mineral deficiency was also huge and analarming level of 87.9% deficiency was observedin case of zinc. From this study, it was inferredthat there are good numbers of potential non-conventional source of mineral that might be usedmore economically to improve the mineralavailability to pigs.

Incidence of testicular abnormalities andtesticular biometry in pigs

A total number of 206 piglets were examinedfor testicular abnormalities and morphometry. Ofthe piglets examined, two nondescript local pigletshad unilateral cryptorchidism. Similarly, cases oftesticular hypoplasia and epididymal cyst were alsorecorded in Large White Yorkshire piglets. Theoverall incidence of cryptorchidism, testicularhypoplasia and epididymal cyst was 0.9, 0.9 and0.5 per cent, respectively. The epididymal cyst waslocated at the caput region and its size was 0.6 X0.6 cm and 0.7 X 0.6 cm in left and right testis,respectively. The weight of testes was 16.44±1.64,16.80±3.01 and 24.26±2.16 g in Large WhiteYorkshire, Hampshire and nondescript local pigs,respectively at 2 months of age, while thecorresponding weights at six months age were59.96±2.48, 69.70±3.28 and 77.12±2.16 g,respectively. The weight and circumference of thetestes and were higher (p<0.05) in nondescript localpigs compared to Hampshire and Large WhiteYorkshire pigs, but the testicular length did notdiffer significantly. There was no significantdifference in the weight of epididymis betweenHampshire, Large White Yorkshire and nondescriptlocal pigs. The epididymis was divided into caput,corpus and cauda and the length of each segmentwas measured. As like epididymis weight, thelength of different segments also did not differsignificantly between Hampshire, Large WhiteYorkshire and nondescript local pigs.Fig 2. Blood serum biochemical profile of

indigenous and exotic pigs reared undersmallholder low input production system


HEALTH

Surveillance, monitoring and investigation ofdiseases outbreaks in the region

BrucellosisThe Brucella organism was also isolated from

aborted foetal content from an abortion case of sowat an organized pig farm. The Brucella isolates wereconfirmed by PCR based on gene for 31kDa OMP(Fig.1) and the repetitive genetic element IS711.Out of 68 swine serum samples screened forbrucellosis, 5 (7.4%) samples were seropositive forbrucellosis. Out of 36 goat serum samples, 2 (5.6%)showed positive reaction for antibodies againstbrucellosis. The findings indicated the presence ofthis dreaded disease in the region.

Fig. 1. PCR detection of 31kDa OMP of Brucella.Lane 1- Marker, Lane 2 to 5- Brucella organisms

Swine feverThe outbreaks of swine fever were recorded at

two organized farms in Meghalaya with an averagemortality rate of 13.4%. Even nine month old gilt

vaccinated six and half months back died withrashes on the ventral side of the body. Thepostmortem examination revealed button shapedulcers in the large intestine, patchy heamorrhagesin the internal surfaces of urinary bladdersuggesting death due to swine fever virus disease.The disease was also confirmed by Agar gelprecipitation Test (AGPT). The cause of occurrenceof the disease in some of the vaccinated animalscould not be known. The feed samples were also

500 bp

200 bp

100 bp

223 bp

Table 1. Biometry of epididymis of LWY, Hampshire and ND pigs (n=206)

Epididy LWY Hampshire NDmis part

2m 4m 6m 2m 4m 6m 2m 4m 6m

Caput 2.10±0.2 3.01±0.1 5.92±0.2 2.28±0.1 3.45±0.2 5.45±0.2 3.00±0.2 3.63±0.3 5.57±0.3length (cm)Corpus 3.12±0.1 4.00±0.2 6.10±0.3 3.28±0.1 3.95±0.4 5.95±0.1 3.53±0.3 4.48±0.2 5.52±0.3length (cm)Cauda 3.09±0.1 3.81±0.1 5.50±0.2 3.26±0.2 3.62±0.2 5.45±0.2 3.36±0.2 4.19±0.2 5.57±0.3length (cm)

Fig. 2. Piglet suffering from swine fever showingcrawling movement (nervine manifestation)

Fig. 3. Button ulcer in the intestine of pigs in caseof swine fever


tested for presence of mycotoxins affecting theimmunity of the animals, however, none of the feedsamples showed the presence of mycotoxins.

Fig. 4. Haemorrhages in stomach mucosa in case ofswine fever

NUTRITION

Growth rate and nutrient digestibility incrossbred piglets fed on rice bran based ration

A feeding experiment for the period of 115 dayswas conducted on crossbred (CB) castrated malepiglets to study the growth performance andnutrient digestibility on locally available rice branbased feeding regime. The survey of rice branavailable in the local markets has shown a widevariation in nutrient composition with crude proteincontent varying from 6.15 to 13.00% and crudefibre content ranging between 14.96 and 25.27%.In the experiment, twelve CB male piglets(10.83+0.07kg BW) were distributed into fourgroups. Four isonitrogenous (CP 18%) andisocaloric (DE 3020 Kcal/kg) mash rations wereprepared by incorporating rice bran at 0 (T1), 25(T2), 50 (T3) and 73 (T4) percentage levels. Theserations were offered in ad-libitum to the piglets inrespective groups. At the end of feedingexperiment, a digestion trial for the period of 5 dayswas conducted and the resultant data are presentedin Table 4. The results revealed that the digestibilityof DM and CP decreased and the ADG reducedeven at 25 % level of inclusion of rice bran withpoor feed conversion efficiency. Therefore, it wasconcluded that locally available rice bran was ofpoor quality and farmers can mix it in pig rationsup to a maximum of 25% level for some what

acceptable growth performance. However, furtherresearch is required to effectively utilize higherlevels of inclusion of rice bran in swine rations.

Table 4. Growth performance and nutrientdigestibility in crossbred piglets

Particulars T1 T2 T3 T4(RB 0) (RB 25) (RB 50) (RB 73)

ADG (g/d) 416 324 226 164FCR 3.34 4.29 5.49 7.56DM Digt. (%) 64.91 61.28 47.94 46.65CP Digt. (%) 63.73 60.81 50.72 47.87

Growth rate of female and castrated male CBpiglets

A feeding experiment for the period of 115 dayswas conducted on 3 female & 3 castrated male CBpiglets (10.93+0.06kg BW) to study theirperformance on standard feeding regime.Concentrate mash ration (CP 18% and DE 3000Kcal/kg) was offered in ad-libitum, one half in themorning and other half in the evening after mixingin water in the ratio of 1:1 (w/v). Results (Fig. 4)inferred that growth performance of female andcastrated male CB piglet was similar in terms ofADG (441 and 438g/d) and FCR (3.15 and 3.17)values.

Fig. 4. ADG and FCR value in female andcastrated male CB pig

Evaluation of fresh and preserved boarspermatozoa using zona-binding assay

Fresh ovaries were obtained fromslaughterhouse and washed 2 to 3 times with PBS.The follicular fluid was aspirated from antralfollicle with a diameter of 4 to 8mm by aspirationmethod. Oocyte with cumulus were recovered frompooled follicular fluid under zoom stereo


microscope. The cumulus free oocytes werewashed with PBS and kept at 4°Cuntil they wereincubated with spermatozoa. A total 12 semenejaculate was collected four healthy Hampshireboars and physical and morphological characterswere evaluated. The good quality semen wasdiluted in BTS and preserved at 18°C for 3 days.The fresh and preserved spermatozoa at 0, 24, 48and 72h were evaluated for motility, membrane andacrosome integrity and zona binding ability. Forzona binding assay, fresh and preservedspermatozoa were washed in PBS and 10 µl ofsperm droplets of 1 million spermatozoa per mlwere placed in 35 mm multiwell Petri dish. Thenthe oocyte was added to each droplet and coveredwith mineral oil and incubated at 30°C in 5% CO2in air and under 98% humidity for 4 hrs. Thenumber of bound spermatozoa varied from 82 to112 per oocyte in fresh semen. While the averagenumber of bound spermatozoa was75.45±7.82,.63.76±6..23, 56.64± 6.01 and 44.67± 5.47 respectively, at 0, 24, 48 and 72h ofpreservation. The sperm binding ability differedsignificantly between the boars. In preservedsemen, the sperm binding ability was significantlyreduced from 0h to 24h and a trend of decrease inzona binding ability was observed up to 72h. Therewas significant positive correlation between spermmotility and acrosome integrity in fresh andpreserved semen.

Mortality pattern of different genetic groups ofpig

Mortality records of indigenous and upgradedpigs were collected for the period of 11 years (1993-2003), analyzed and the mortality pattern wascorrelated with genetic group, age of pigs, climaticfactors and causes of death. Results revealed thatthere was significant (p<0.05) difference inmortality between the indigenous (6.05%) andupgraded (5.64%) pigs. The mortality percentagewas significantly (p<0.05) higher in bothindigenous and upgraded pigs of age group 0-4months compared to pigs of age group 7 monthsand above. Among different seasons, significantly(p<0.05) higher mortality was observed duringpost-monsoon and winter seasons compared toothers (Fig. 5). Season-wise overall mortalitypercentage was 4.74, 5.25, 7.51 and 6.56 during

pre-monsoon, monsoon, post-monsoon and winterseasons, respectively. Indigenous pigs recordedsignificantly (p<0.05) higher pre-weaning mortality(14.26%) than the upgraded (9.58%) pigs. Amongdifferent causes, digestive disorders accounted tosignificantly (p<0.05) higher mortality followed bymiscellaneous and respiratory disorders.

On farm trial on improved pig productionProductive and reproductive performance of

upgraded pigs was studied under traditionalproduction system. A total number of thirty farmerswere selected in four villages and upgraded pigs(Khasi local with Hampshire) were distributed forrearing under traditional production system. Underthis system, pigs were mainly fed with vegetableresidue, kitchen waste, rice brain, local grass andweeds. Frequent visits were carried out to assessthe litter characteristics. The reproductiveperformance of the upgraded pigs is given inTable5.

Table 5. Performance of upgraded pigs undertraditional production system

Parameter Values

Age at puberty (days) 285.45±28.23Age at first conception (days) 330.24±37.43Age at first farrowing (days) 456.65±38.48Inter farrowing interval (days) 212.76± 23.34Litter size at birth 8.85± 0.39Litter size at weaning 6.47±0.23

Fig. 5. Mortality pattern of indigenous andupgraded pigs during different seasons of the year


GOAT

PRODUCTION

Physical characteristics, production andreproduction performance

The physical characteristics of Assam hill goatswere studied under stall-feeding system with treeleaves, grasses and concentrate. The mostpredominant colours of Assam hill goats are black,black and white, and brown with patches ofdifferent colours in the body. All three types of earsare observed in which the percentage of horizontalmedium-sized ear is dominant over the erect andpendulous. The thick and small sized (7.7 cm) blackcolour horns in female shows upward and backwardorientation. But in male the orientation is straightupward. The adult body measurements were takento correlate them with the final body weight of theanimals (Table 3) and observed that the bodyweight has significantly higher correlation with theheart girth of the animals followed by the paunchgirth.

Table 3. Body measurement of Assam hill goat

Physical parameters (in cm) Mean ± S.E

Live Body weight (adult) 20.14 ± 1.00Head

i. Length 16.2 ± 0.2ii. Breadth of forehead 3.85 ± 0.13iii. Eye to eye 9.385 ± 0.25

Horni. Horn Length 7.705 ± 0.69ii. Distance between horn 6.357 ± 0.22iii. Circumference 5.8525 ± 0.16

Ear length 13.25 ± 0.33Neck

i. Length 35.475 ± 0.98ii. Circumference 27.35 ± 0.83

Barreli. Body length 82.3 ± 1.15ii. Oblique body length 48.425 ± 2.03iii. Height at wither 54.55 ± 0.58

Girthi. Heart girth 62.875 ± 0.95ii. Abdominal girth 78.85 ± 1.97iii. Paunch girth 72.35 ± 1.39

Tail length 11.175 ± 0.32

The body weight at different ages was recordedat 30 days interval upto 240 days of age in 38

genetically selected newly born kids (23 male and15 female). The average body weight at birth wasfound to be 1.6±0.07 kg in male and 1.5±0.10 kgin female (Table 4). The lactation length, daily yieldand total lactation yield were documented basedon the lactation records. The twinning, triplet andsingle birth percentage were estimated (n=39) andwere documented in table 5.

Table 4. Body weight of Assam hill goat atdifferent ages (Mean ± SE)

SexAge(days) Male (Kg) Female (Kg)

At birth 1.6±0.07 1.5±0.1030 d 3.8±0.28 3.3±0.3860 d 4.4±0.44 3.9±0.4490 d 4.50.69 4.7±0.73120 d 7.4±1.13 5.6±0.84150 d 8.6±1.93 7.5±0.28180 d 9.6±2.49 8.1±0.67210 d 10.1±2.67 8.4±0.72240 d 13.2±1.25 9.9±0.1

Table 5. Reproductive parameter of Assam hillgoat

Traits Mean ± SE

Lactation length 90.4±3.05 daysDaily lactation yield 105.99 mlTotal lactation yield 9581.3 mlTwinning percentage (n=39) 38.46%Triplet percentage (n=39) 2.56%Singe birth percentage (n=39) 58.97%

The common diseases observed in Assam hillgoats during the study period were pneumonia, miteinfestation, contagious ecthyma and parasiticinfestation (Moneizia and Stronglyle infestation).

Blood bio-chemical profile of Assam hill goatThe plasma glucose level was estimated through

o-toluidine method and, total protein, total albumin,globulin and A/G ratio were estimated by Biuretand BCG dye binding method. A total of 34 nos. ofAssam hill goats managed under similar feedingregime were subjected for the study. The meanglucose level was found to be 53.02±1.48 mg%.The total protein, total albumin, globulin level andthe A/G ratio were 5.1±0.07 g%, 3.1±0.11 g%,2.1±0.19 g% and 1.6 respectively.


NUTRITION

Supplementation of broom grass with Soybeanor rice bean in goats

A study was conducted in adult male Assamlocal goats to assess the nutrient digestibility ofthe rations after supplementation of green legumeforages i.e soybean or rice bean along with broomgrass in equal proportions (on DM basis). Soybeanand rice bean contained 19.31 and 13.08 % crudeprotein on DM basis respectively. The intake anddigestibility forages are given in Table 2.The results indicated that the supplementation ofsoybean or rice bean along with broom grassimproves the availability of nutrients in goats withsoybean having little more digestibility than ricebean. The blood parameters on similar treatmentswere however, remained in normal range (Table3).

Plate 1: Colour variation of male Assam hill goat

Table 2. Intake and digestibility of nutrients onsoybean and rice bean supplementationin adult goats

Particulars Soybean + Rice bean +broom grass broom grass

DM Intake/day (g) 543 650DM digestibility (%) 56.5 59.0CP digestibility (%) 61.7 55.1

Growth of Assam local goats during lean season Six male and six female Assam local goats

(9.62+0.13 kg BW) were selected and distributedinto two groups to study the growth during leanseason for the period of 60 days. The animals werefed on broom and parari fodder. Apart from broomfodder (T1) or parari tree leaves (T2) ad-libitum,the individual goat received 100g concentratemixture (16% CP and 65%TDN) in mash form


daily. The goats attained an ADG of 40.17+2.77and 45.83+1.14g in T1 and T2 respectively. Theresults inferred that broom and Parari fodder, whichgrow well in mid altitude, are excellent source offodder leaves for goats rearing during lean season.

Growth of Assam local goat kids fed on nativegrasses during rainy season under stall feedingsystem

Seven male and seven female Assam local goats(7.23+0.49kg BW) were selected and distributedinto two groups as per their sex to study theirgrowth rate during rainy season for the period of100 days fed on native pasture grasses in ad-libitumunder cut and carry system (Fig.3). The goats wereoffered a concentrate mash ration of 16% CP and65%TDN @ 70g/d/head. The male and female goatkids attained an ADG of 29.28+2.58 and36.60+3.09g respectively. The results inferred thateither male or female goat kids were attained poordaily gain on native pasture and it might be duelow nutritive value of grasses.

Table 3. Blood parameters of goats on soybeanand rice bean fodder supplementation onbroom grass based diet

Particulars Soybean + Rice bean +broom grass broom grass

Glucose (mg/dl plasma) 48.7 46.7Hb(g/dl whole blood) 13.3 13.0Total Protein (g/l plasma) 63.3 62.7Albumen (g/l plasma) 30.6 31.0Urea N (mg/dl plasma) 1.65 1.64Ca (mg/dl plasma) 11.2 11.6

POULTRY

Evaluation, characterization and conservationof poultry breeds of northeastern region

Mizo-local and Miri chickens were obtainedfrom Kolasib and North Lakhimpur districts,respectively and reared on deep litter underintensive system. The production performance ofF-1 generation Mizo-local chicken, generated byinter-se mating of birds collected from the field,was assessed in comparison with Miri chicken. The

Mizo-local chicken had significantly (p< 0.01)better growth rate in terms of body weightmeasured at various intervals i.e. fourth, sixth,eighth, tenth, twelfth, fourteenth, eighteenth week,sexual maturity and forty weeks of age (Figure 1).Although there were no significant differencesbetween Mizo-local and Miri chicken for keellength at sexual maturity and 40 weeks of age butMizo-local variety had significantly longer shanklength at sexual maturity (94.33 ± 2.11) and at 40weeks of age (94.81±2.07). There were significant(p<0.01) correlations between body weight andshank length; body weight and keel length andbetween shank length and keel length measured atdifferent age in Mizo-local chicken variety. Thisinformation could be useful in selecting birdsindirectly for increased shank length, as longershanks are desirable in chickens used for backyard/free-range poultry production. Mizo-local birdswere also significantly heavier than the Miri birdsat sexual maturity (1715.74 ± 60.90) as well as atforty weeks of age (1966.41±79.68). The averagefeed intake on daily and weekly basis was higherin Mizo-local birds compared to Miri variety.However, feed conversion ratio (FCR) of Mizo-local (2.02) variety was lower than Miri (2.91) from0 to 8th weeks of age. Age at first egg was more inMizo-local variety (163.56 ± 1.34 days) ascompared to Miri birds (147.90 ± 1.10 days). Henday egg production up to 40 weeks of age in Mizo-local variety (31.96) was comparable to Mirichicken variety (33.59).

It was observed in the study that the rearing ofMizo-local birds up to 12 weeks of age underintensive system of rearing was economical formeat production purpose as they attain an average

Figure 1 Growth performances of Mizo-local andMiri chicken varieties up to 18 weeks


body weight of 848.62 ± 23.06 g on combined sexbasis with the feed conversion ratio of 3.22.Considering the cost of feed @ Rs. 13.35 per kg(Calculated as per the Institute rate) translating toRs. 43.00 per bird on total feed cost up to 12 weeksof age, Rs. 10.00 on saw dust and health care andRs. 10.00 on labor and electricity and market salerate of Rs. 100-120 per kg live weight (Average ofRs. 110.0/kg) for indigenous chicken, the netincome earned per bird in 12 weeks would be Rs.30.35/- per bird.

Incidence of diseases in indigenous chickenA total of 101 number fecal samples collected

from the farm were screened for the presence ofenteric pathogens such as E. coli, Salmonella,Clostrdium perfringens, Campylobacter etc. Outof 101 samples, 45 were positive for E. coli, fourwere positive for C. perfringens, two were positivefor campylobacter. The isolates were subjected fordetection of virulence gene by employingPolymerase Chain Reaction (PCR) using specificprimers. Antibiograms studies were conducted byusing different antibiotic discs (Table 1). Besidesthese, the study revealed that the most commonlyprevailing viral disease among the local birds wasthe Ranikhet Disease.

A few birds showed positive for roundworminfestation. One more important observation madein indigenous birds reared under intensive systemwas that the incidence of infestation of birds withRed mite (Dermanyssus gallinae; Fig. 2) was morein broody hens.

Molecular phylogenetic study of poultry andlivestock populations of N. E. H. Region

The phylogenetic relationship of indigenouspoultry and livestock breeds/varieties native tonorth-eastern region of India with their exoticcounterparts was studied using partial nucleotidesequence of mitochondrial cytochrome b gene. 357bp of cytochrome b gene of indigenous chickensuch as Miri, Mizo-local chicken and exotic Whiteleghorn chicken, Large White turkey, Khasi-localand exotic Hampshire breeds of pig, Assam Hillgoat, New Zealand white and Soviet Chinchillabreeds of rabbits was amplified by PCR (Fig. 3)and sequenced. The consensus phylogenetic treewas constructed using sequence data ofcytochorome b gene with Neighbor Joininganalysis (Fig. 4). Sequence analysis of cytochromebgene revealed four nucleotide variation sitesbetween Khasi Local and Hampshire breeds of pig

Table 1. Bacterial isolates recovered from fecal samples

Organisms No. of samples No. of isolates Detection of Antibiogram studyexamined recovered/ virulence genes

samples positive by PCR Sensitive Resistant

E. coli 53 45 Negative for Chloramphenicol, Tetracycline‘stx1’, ‘stx2’, ‘elt’ Ciprofloxacin, Ampicillin and ‘est’ genes Gentamicin

Clostridium 19 4 Positive for α Ciprofloxacin Co-trimoxazoleperfringens and α2 toxin gene. Tetracycline

Campylobacter 29 2 Positive for 16S r Ciprofloxacin and Cefotaxime jejuni RNA and hip Gentamicin Cephaloxin &

O gene Ampicillin

Figure 2. Microscopic dorsal and ventral view ofred mite (Dermanyssus gallinae) of poultry


with 1.4 % sequence divergence. Indigenouschicken and White Leghorn chicken sharedidentical sequences. Between domestic chickenbreeds and Red Jungle fowl four variation siteswere observed with 1.1 % sequence divergence.Assam Hill and Black Bengal breeds of goat hadthree sequence variation sites with 0.8 % sequencedivergence. Interestingly, New Zealand white andSoviet Chinchilla breeds had 50 nucleotidevariation sites with as many as 9 indels withsequence divergence of 7.9% between them.

Fig. 3. Representative figure of PCR amplificationof partial sequence of cytochrome b gene with

Cyto F and R Primers. Lane M is molecular size(MS) marker Lane 1 is Khasi local, lane 2 isHampshire pig, lane 3 is New Zealand White

rabbit, lane 4 is Soviet Chinchilla rabbit, lane 5 isAssam Hill Goat, lane 6 is Blank, lane 7 is Mizo-

local and lane 8 is White leghorn chicken.

Immunological, reproductive, meat and eggquality studies in indigenous chickenimmunological traits

Evaluation of indigenous and improved chickenvarieties for immunological traits revealed non-significant difference between genetic groups forhumoral response (log2 HI titer), totalimmunoglobulin (Ig) level and circulatory immunecomplex level (C.I.C.) Vanaraja birds werenumerically superior for both humoral response(5.67 ± 0.33 - Log2 HI Titer) and circulatoryimmune complexes (3.09 ± 0.057 g/dl) levelfollowed by Miri, Mizo-local and Gramapriyavariety for humoral response and Gramapriya, Miriand Mizo-local variety for circulatory immunecomplex level. Miri birds had numerically highertotal immunoglobulin (3.231 ± 0.031 g/dl) levelfollowed by Mizo-local (3.01 ± 0.057 g/dl),Vanaraja (2.96 ± 0.028 g/dl) and Gramapriya (2.95± 0.034 g/dl) variety. Thus it is evident that theimproved varieties of chicken have similar immunecompetence level as that of indigenous chickenvarieties.

Sensory evaluation of meat quality traitsSensory evaluation of cooked meat samples of

indigenous and improved chicken varieties using9 point hedonic scale revealed non-significantdifference between genetic groups for meat qualitycharacteristics like appearance, flavor, juiciness,texture, tenderness and overall acceptability ofmeat samples. However, overall acceptability of

Fig. 4. Phylogenetic tree constructed by use of cytochrome b gene nucleotide sequence data. Numbers arepercentage bootstrap support.

M 1 2 3 4 5 6 7 8

357 bp


meat of Gramapriya birds was numerically superiorfollowed by Vanaraja, Miri and Mizo local chickenvarieties.

Sensory evaluation of egg quality traitsSignificant differences (p<0.01) were observed

between genetic groups for sensory attributes ofegg quality like aroma, flavor, overall acceptabilityand order of preference. It was observed thatconsumer liking of Aroma, Flavor and Overallacceptability of eggs of Miri, Mizo-local andVanaraja birds were significantly higher than thatof Gramapriya birds. However there were nosignificant differences between genetic groups forappearance or color of eggs. Overall the preferencefor eggs of Miri birds were superior followed byMizo-local, Vanaraja and lastly Gramapriya birds.

Production performance of Turkeys under agro-climatic conditions of Meghalaya

Turkey were introduced and studied for theirperformance under agro-climatic conditions ofMeghalaya. Fertile eggs of turkeys, procured fromCentral Avian Research Institute, Izatnagar werehatched at state government hatchery and poultswere reared on deep litter system of rearing. Thebody weight of turkeys recorded at 18 weeks ofage and at sexual maturity were 2428.33 ± 144.39g and 3748.33 ± 232.38 g respectively on combinedsex basis (Fig. 5). The Daily feed intake of turkeysincreased from 8.12 g during first week, to 66.96 gat 10th week and went up to 164.76 g at 18 weeksof age on ad libitum feeding regimen. Feedconversion ratio of turkeys ranged from 2.96 during4th week to 3.99 during eighteenth week of age.

There were no incidence of infectious diseases inturkeys except for mild out break of Coccidiosisand infected birds responded promptly to anti-coccidiosis medication. Figure 12 depicts thephotographs of black and white varieties ofTurkeys.

Fig. 12. Black and white varieties of turkeysintroduced in the region.

HEALTH

Salmonellosis in poultryOut of 53 poultry intestinal samples collected

during the postmortem of poultry from variouspoultry farms in Meghalaya and screened for thepresence of Salmonella species, 13 (24.53%) werefound positive for Salmonella spp. (Fig. 5 - 9). Allthe isolates were positive for stn (Fig. 10) and invAgenes. On analysis of water samples from these

Fig. 5. Average Body weight of Turkeys at differentage under agroclimatic conditions of Meghalaya


farms, 3 out of 8 samples were found positive forSalmonella spp. that explains the comparativelyhigher prevalence of Salmonellosis in poultry ofthese farms and needs immediate attention of theprofessionals. S. Enteritidis with 9,12:g,m:-antigenic structure was the widely encounteredserotype that was followed by S. Kentucky serotypewith 8,20:i:z6 antigenic structure. One isolate wasserotyped as S. Typhimurium with 4,12:i:1,2antigenic structure. The antibiogram of theseisolates showed a variable pattern of antibioticresistance/ sensitivity; however, all the isolateswere sensitive to Ofloxacin.

Fig. 7. Hepatomegaly in chicken suffering fromSalmonellosis

Fig. 9. Spleenomegaly and presence of necrotic fociin spleen of chicken affected with Salmonellosis

MycotoxicosisThe cases were investigated for unusual deaths

at an organized poultry farm of Meghalaya duringthe month of September 2007. The postmorteminvestigation revealed cachectic condition of birds,dark discoloration of liver, presence of tumors inliver and Hydropericardium. The representativefeed samples were collected for detection ofmycotoxins. Aflatoxin B1 and Citrinin weredetected at a concentration of 24 to 36 ppb and 40to 120 ppb, respectively in different feed samples.The findings cautioned the poultry farmers forproper processing and storage of feed in the regionwhere high humidity prevails for most of the time.

Clostridium perfringens infection in poultryClostridium perfringens was isolated from 14

out of 16 samples collected during the postmortemof the poultry birds and subjected forbacteriological examination. The birds died aftershowing the symptoms of enteritis. The isolateswere confirmed by PCR on the basis of detectionof cpa gene. The isolates were found to becomparatively resistant to wide number ofantibiotics. Only 8 (57.1%) isolates were sensitiveto Metranidazole and 7 (50%) to Sparfloxacin.

Collibacilosis in poultry and goatOut of 57 samples of intestinal contents from

the dead birds, 21 were found positive forEscherichia coli with varying degree of sensitivityfor antimicrobials like Ofloxacin, Ciprofloxacin,Ampicillin, Cephalothin and Sulphfurazole. TheE. coli was also isolated from a goat that died after

Fig 5. Liver of chickenshowing necrotic foci

infected with Salmonella

Fig. 6. Fragile andenlarged spleen of

chicken affected withSalmonellosis

Mucosal layer of caeca revealswhitish ulcerated areas in

Salmonellosis

Deformed ova of chickenaffected with Salmonellosis

EnlargedLiver

NormalLiver

600 bp

675bp

1 2 3 4 5 6 7 8

Fig. 10. Detection of stn gene of Salmonella, Lane1- marker, lane2- standard culture, lane 3-8-

isolates


severe gastroeintestinal disturbances and showedexcessive haemorrhages in the intestinal mucosaduring postmortem (Fig. 11). The serotypesencountered were O5, O63, O9, O20, O128, O33,O154, O15, O146, O12 and O160.

Fig 11: Small intestine of goat showinghaemorrhage died due to E. coli infection

Thermophilic CampylobacterCampylobacter has been shown to be almost

exclusively transmitted through foods of animalsand poultry origin. The food chain getscontaminated from intestinal contents mainlyduring slaughter or post slaughter processing. Atotal of 122 faecal samples of animal and poultryorigin comprising goat (36), cattle (24), poultry (48)and duck (14) were processed for isolation ofthermophilic Campylobacter spp. A total of 16isolates of C. jejuni were recovered from poultrysamples. Other samples turned to be negative forCampylobacter. The isolates were confirmed byemploying PCR protocol based on 16S rRNA gene.Further characterization of the isolates at

subspecies level revealed that only 2 C. jejunihydrolyzed DNA and thus categorized underbiotype II, rest were found to belong to biotype I.The PCR based protocol was employed using thepublished primer sequences of hipO (HippuricaseO) gene which is specific for C. jejuni (Fig.12) todifferentiate C. jejuni from C. coli.

Occurrence of zoonotic organisms in productsfrom livestock and poultry

The analysis of 436 meat samples (88 beef, 142pork, 170 chicken meat and 36 goat meat) revealedthat 14 (3.2%) samples were positive for L.monocytogenes, 38 (8.7%) for mesophilicAeromonas spp., 24 (5.5%) for Salmonella spp.,72 (16.5%) for E. coli and 14 (3.21%) forthermophilic Campylobacter spp. Thebacteriological analysis of 99 samples of milk andmilk products revealed that 4 (4.04%) samples werecontaminated with Salmonella spp., 38 (38.38%)with Staphylococcus aureus, 18 (18.18%) withStreptococcus and 14 (14.14%) with E. coli. Theisolates showed a varying degree of sensitivity forvarious antibiotics with highest sensitivity toenrofloxacin followed by chloramphenicol andtetracycline. The isolates were examined for thepresence of various virulence genes to know theirpathogenic potential. The PCR based detectionmethods were used for screening the virulenceassociated genes viz: hlyA, iap, plcA and plcBgenes in L. monocytogenes; stn, invA, fimA, sefC,pefA, sopE and sopB in Salmonella; stx1, stx2,hlyA, est and elt genes in E. coli; ahh1, AH-aerAand asa1 in mesophilic Aeromonas and flaA, iam,cadF, racR, pldA, cdtA, cdtB, cdtC genes inCampylobacter.

Fig.12. Detection of hipO gene (735bp) of Campylobacter jejuni. Lane 1- Marker, Lane 2-10- Testorganisms

750bp500bp250bp

735bp

1 2 3 4 5 6 7 8 9 10


VETERINARY PARASITOLOGY

Revalidation of Diagnostic kit in field level aswell as in organized farm of different Institutes

The diagnostic kit had already been revalidatedin organized farms of different Institutes locatedin Eastern and North East Region of the Countryviz. NRC on Mithun, NRC on Yak, EasternRegional Centre of IVRI, Animal HusbandryDepartment of Meghalaya, Nagaland Universityetc. Analysis of revalidated result given by differentInstitutes showed that out of 904 screened serasample, 240 (25.5%) sera sample showed positiveantibody response for both Oesophagostomum andBunostomum sp while 217 (24%) sera sampleshowed negative antibody response. While 207(22.8%) sera sample showed the positive antibodyresponse for Oesophagostomum sp. only and 170(18.8%) sera sample showed the positive antibodyresponse for Bunostomum sp. only.

For revalidation of the kit in different agroclimatic condition of the country, it was sent todifferent Coordinating unit of AINGIP viz. SikkimCentre of ICAR Research Complex, CSWRI,Avikanagar, Pantnagar University, West BengalUniversity of Animal Science and Fisheries anddifferent KVKs of ICAR Research Complex forNEH Region located in different States of NorthEast.

PCR based diagnosis for parasitic infection inAnimals

PCR based technique has been standardized foridentification of species specific gastrointestinalparasites from faecal samples of cattle and goat.

The eggs present in the faecal material wereconcentrated using sugar floatation techniques. Theconcentrated eggs were put into FTA CARD(Whatman®) and dried in room temperature and asmall punch of this card was put directly to PCRtube

Genomic DNA from O.columbianum, O.venulosum, H. placei, B. trigonocephalum wereamplified by multiplex PCR in differentcombination using different sets of primers. Theamplified products were analysed by Agarose gelelectrophoresis( Fig 1), The result of the experimentshowed that all the parasite DNA fragments wereamplified according to the primer used in themultiplex format.

The false positive amplification signal was onlynoted in lane No 4 (73 bp) using universal primeragainst B . trigonocephalum adult parasite DNA.This signal intensity of specific bands were notuniform in all the species .In lane No 1 O.venulosum genomic DNA showed only one band(182 bp) but in lane No 6 O. columbianum showedtwo bands (180 bp and 106 bp) (Fig.1) .In lane No7 Haemonchus sp. showed a single band (176 bp)and in lane 8 Bunostomum trigonocephalumshowed a single band(153 bp). The experimentdegined in such a fashion that in first experiment(Fig 1) known template DNA isolated fromOesophagostoum columbianum, O. venulosum andHaemonchus sp was used to know amplificationagainst the corresponding primer. In the secondexperiment (Fig 2) DNA isolated from faecalsample was used as template DNA along withdifferent combination of primer to identify thespecies specific parasitic egg.

Table 1. Result of revalidation of diagnostic kit supplied to different Institutes

CATTLE GOAT

ICARNEH Pantnagar Manipur Arunachal Total Pantnagar Arunachal Manipur Nagaland TotalSikkim University (KVK) (KVK) University KVK KVK KVK

(Mithun)

Total No. 19 12 4 10 45 6 6 10 10 32ScreenedBoth Positive 4 6 - - 10 4 - 2 1 7Both Negative 6 - 4 10 20 1 5 6 8 20+ Oeso- Buno - - - - 0 1 1 2 - 4- Oeso+ Buno 9 - - 6 15 1 - - 1 2


To diagnose the presence of any GI parasiticnematode in the fecal sample, we have used onecontrol primer set(5’GCTGAAACTTAAAGGAATTGAC) and (5’

TCAGTGTAGCGCGCGTGC) ( Zarlenga et al.,2001) which generate a 325 bp fragments for allparasite DNAs of GI Parasitic nematode. Usingthis primer as control, it was possible to diagnosethe presence of parasitic nematode whether or notusing the specific primer for a particular parasite

1 2 3 4 5 6 7 8

353182 180 176 153

73 106

Fig 1. Multiplex PCR of gastrointestinal nematodegenomic DNA derived from eggs and adult

parasites. In Lane 1 showing amplification ofOesophagostomum venulosum DNA (182 bp)

derived from egg of the parasite. Lane 2,3 and 4showing amplification of homologous DNA ofHaemonchus sp and Bunostomum sp. Usinguniversal primer (353 bp), lane 6 showing

amplification of Oesophagostomum coulmbianumDNA ( 180 and 106 bp) derived from egg of theparasite, Lane 7 and 8 showing amplification of

Haemonchus sp. DNA (176 bp) and Bunostomumtrigonocephalum DNA (153 bp), respectively

353

176182 106

Oesophagostomum columbianum - + - -Oesophagostomum venulosum + - - -Haemonchus sp. - - + -Bunostomum trigonocephalum - - - -Universal primer + +

Fig 2. Multiplex PCR using genomic DNA fromeggs of gastrointestinal nematode derived from

faecal samples. Lane 1 showing positiveamplification of Oesophagostomum venulosumDNA (182 bp), lane 2 showing amplification of

Oesophagostomum columbianum DNA (106 bp),lane 4 showing amplification of Haemonchus DNA

(176 bp) for specific primer as well asamplification of universal primer (353 bp) andlane 5 showing amplification of only universal

primer (353 bp)


FISHERIES

Standardization of suitable concentration ofactivating solution (NaCl) for activation ofsperm motility in Chocolate Mahseer(Neolosochilous hehagonolepis)

A study was undertaken to evaluate differentconcentrations of NaCl on activation of spermmotility in Chocolate Mahseer. The concentrationof NaCl studied was 10, 25, 50, 75, 100 and 200mM. Fresh milt was collected from matureChocolate Mahseer (n=10) as per the standard handstripping method, during October to Novembermonths. Fresh milt was divided into two parts; partone was used for sperm activation studies whilepart two was centrifuged and sperm and seminalplasma were separated for protein profile studies.Part one of each milt was split into six sub partsand extended in 10, 25, 50, 75, 100 and 200 mM

NaCl solution. The parameters studied were spermmotility and latency period. Results revealed thatmaximum sperm were non motile in fresh milt.Upon mixing different molalities of activatingsolution the sperm motility was activated. Amongthe different concentration of activating solution,50mM NaCl was found to be the best concentrationfor activation of sperm motility. The latency periodin this group was 1 to 2 seconds and the percentageof sperm motility was mote than 80%. In 75mMNaCl solution added group oscillatory and circularmotion of sperm was very much evident. Therewere no motile sperm in the concentration ofactivating solutions containing more than 100mMNaCl. Sperm membrane and seminal plasmaprotein profile studies are in progress. It may beinferred from the result of the present study, that50 mM NaCl can be used for activation of spermmotility in Chocolate Mahseer.


Water Management

Research articles1. Saha, R., Ghosh, P.K., Mishra V.K. and

Bujarbaruah. K.M. 2007. Low-cost microrainwater harvesting technology (Jalkund)for new livelihood of rural hill farmers.Current Science. 92 (9): 1258-1265.

2. Saha, R., Tomar, J.M.S. and Ghosh, P.K.2007. Evaluation and selection ofmultipurpose tree for improving soil hydro-physical behaviour under hilly eco-systemof northeast India. Agroforestry Systems. 69:239-247.

3. Saha, R. and Mishra, V.K. 2007. Long-termeffect of various land use systems onphysical properties of silty clay loam soil inN-E hills. Journal of the Indian Society ofSoil Science. 55(2): 112-118.

4. Saha, R. and Mishra, V.K. 2007. Effect ofsoil moisture regimes and N levels on soilhydraulic properties and yield of rainfedmaize under mid hill altitudes of NortheastIndia. Environment and Ecology. 25S (1):21-24.

5. Saha, R., Mishra, V.K. and Majumdar, B.2007. Movement and distribution of nitrogenas influenced by application methods of Ureaunder simulated water managementpractices in acid soils of Meghalaya. Journalof Hill Research. 20(1): 28-31.

6. Saha, R. and Mishra, V.K. 2008. Long-termeffect of organic residue management on soilhydro-physical behaviour and rice yield ineastern Himalayan region. Journal ofSustainable Agriculture. (In Press)

Popular articles1. Saha, R., Ghosh, P.K. and Roy Burman, R.

2007. Raised-Sunken bed system: means ofhigher productivity and income in Ricebased cropping system under high rainfallNEH Region. Agriculture Today. Sept. issue,pp. 49-51.

Technical bulletins/ leaflets1. Ghosh, P.K., Saha, R., Lama, T.D., Samuel,

Manoj. P., Tripathi, A.K. and Ngachan, S.V.2008. Soil Moisture conservation throughresidue management and land configurationin hilly ecosystem. Leaflet. ICAR ResearchComplex for NEH Region, Umiam,Meghalaya.

Book chapters1. Ghosh, P.K., Saha, R., Das, Anup and

Munda, G.C. 2007. Organic Farming inIndia: Potential and Prospects. In: Advancesin Organic Farming Technology in India.Eds. G.C. Munda, P.K. Ghosh, Anup Das,S.V. Ngachan and K.M. Bujarbaruah. ICARResearch Complex for NEH Region,Umiam, Meghalaya, pp. 1-17.

2. Saha, R. and Ghosh, P.K. 2007. Optimizationof Farm Input Allocation in OrganicFarming: Concepts & Evaluation. In:Advances in Organic Farming Technologyin India. Eds. G.C. Munda, P.K. Ghosh, AnupDas, S.V. Ngachan and K.M. Bujarbaruah.ICAR Research Complex for NEH Region,Umiam, Meghalaya, pp. 539-549.

3. Ghosh, P.K. and Saha, R. 2007. Watermanagement for hill agriculture. InIntegrated Farming System for HillAgriculture. Eds. N. Prakash, Rajesh Kumar,Brajendra and Rajiv Kumar. ICAR ResearchComplex for NEH Region, Umiam,Meghalaya, pp. 35-38.

Presentations in conferences/ Symposia/Seminars/ other fora1. Ghosh, P.K., Saha, R. and Brajendra.

Influence of land treatment – inducedmoisture available on pod yield of groundnutand P availability in acid soil of Meghalaya.2007. “Changing Global Vegetable OilsScenario: Issues and Challenges beforeIndia” held at Hyderabad from January 29-31, 2007.

PUBLICATIONS


2. Saha, R. and Ghosh, P.K. 2007. ClimaticWater Balance Approach for Identificationof Water Surplus and Deficit Periods in HillyTopography of Meghalaya. In: XXVINational Seminar on Hydrology at NEHU,Shillong from 26th – 28th Oct., 2007.

3. Ghosh, P.K. and Saha, R. 2007. Soil moistureconservation through in-situ residuemanagement and possibility of doublecropping in terrace situation of Meghalaya.In: XXVI National Seminar on Hydrologyat NEHU, Shillong from 26th – 28th Oct.,2007.

4. Saha, R., Mishra, V.K. and Khan, S.K. 2007.Characterization of Soil Erodibility Indicesunder Modified Land Use Systems as againstShifting Cultivation in Hilly Ecosystems ofMeghalaya. In: National Seminar on“Developments in Soil Science- 2007” atBAU, Rachi during 2nd-5th Nov., 2007.

5. Saha, R. and Ghosh, P.K. 2007. Crop WaterRequirement for High Value vegetable Cropsbased on Soil Moisture Status in HillyTopography of Meghalaya. In 2nd IndianHorticulture Congress: Opportunities andlinkages for Horticulture Research anddevelopment (Focus: North-eastern Region)held at ICAR Complex for NEH Region,Umiam, Meghalaya from 18-21st April,2007.pp. 80.

6. Ghosh, P.K., Saha, R., Das, Anup andNgachan. S.V. 2008. Soil HealthManagement under Hill Agro-ecosystem. In:95th Indian Science Congress (Theme:Knowledge based Society usingenvironmentally sustainable science andtechnology) at Andhra University,Visakhapatnam during 3rd to 7th January’2008.

Plant Pathology

Research articles1. Chandra, S., Baiswar, P and Kumar, R. 2007.

The first report of powdery mildew of sedumin India. Journal of OrnamentalHorticulture. 10(4): 276.

2. Baiswar, P and Chandra, S. 2007.Compatibility between fungal biocontrolagents against corm rot of gladiolus. JournalMycology and Plant Pathology. 37 (3): 536-537.

3. Baiswar, P., Chandra, S and Kumar, R. 2007.Phytotoxic effects of carbendazim onanthurium cultivars. Journal of OrnamentalHorticulture. 10(4): 277.

4. Baiswar, P., Chandra, S and Kumar, R. 2008.First report of rust caused by Coleosporiumplumerie on Plumeria alba in India. PlantPathology. (online)

5. Baiswar, P., Singh, A. K and Chandra, S.2007. Influence of weather factors ondevelopment of northern leaf blight of maizein Meghalaya. Environment and Ecology.25(3): 506-508.

6. Baiswar, P., Singh, A. K and Chandra, S.2007. Analytical models for influence of leafwetness duration on incubation and latentperiod of Exserohilum turcicum.Environment and Ecology. 25 (3): 581-583.

7. Baiswar, P., Singh A. K and Chandra S. 2007.The First Report of White Rust ofMomordica cochinchinensis caused byAlbugo ipomoeae-panduratae in India.Journal Mycology and Plant Pathology. 37(1): 138.

Book chapters1. Chandra, S and Baiswar, P. 2007. Disease

management in Organic agriculture. pp 429-438. In: Advances in organic farmingtechnology in India. (Eds. G.C.Munda,P.K.Gosh, Anup Das, S.V. Ngachan andK.M.Bujarbaruah) ICAR Research Complexfor NEH Region,Umiam, Meghalaya.

2. Chandra, S., Baiswar, P and Dutta, R. 2007.Disease management. pp 386-404. In:Sustainable crop production for foodsufficiency in NE India. (Eds. A.S. Panwar,S.V. Ngachan, G.C.Munda and Anup Das)ICAR Research Complex for NEHRegion,Umiam, Meghalaya.

3. Dutta, R, Chandra, S and Baiswar, P. 2007.ITK in Disease management. pp 404-415.In: Sustainable crop production for food


sufficiency in NE India. (Eds. A.S. Panwar,S.V. Ngachan, G.C.Munda and Anup Das)ICAR Research Complex for NEHRegion,Umiam, Meghalaya.

4. Chandra, S., Baiswar, P and Dutta, R. 2008.Management of Plant Diseases.pp386-405.In: Sustainable Crop Production for foodsufficiency in NE India (eds) A.S. Panwar,S.V. Ngachan, G.C. Munda and Anup Das.,ICAR Research Complex for NEH Region,Umiam.

5. Dutta, R. 2007. Citrus Diseases and TheirManagement in NEH Region. In: TrainingBulletin on “Rejuvenation of CitrusOrchards” (eds, Pant et al.) underTechnology Mission (MM-1), during 15-17November 2007, Horticulture and Cash CropDevelopment Department, Government ofSikkim, Tadong, Gangtok, Sikkim

6. Dutta, R. 2007. Virus and Virus like Diseasesof Citrus and Their Management. In:Training Bulletin on “Rejuvenation of CitrusOrchards” (eds, Pant et al.) underTechnology Mission (MM-1), during 15-17November 2007, Horticulture and Cash CropDevelopment Department, Government ofSikkim, Tadong, Gangtok Sikkim

7. Dutta, R. 2007. Mushroom cultivation as acomponent in Integrated Farming Systempp.87-97. In: Integrated Farming System forHill Agriculture (eds) N. Prakash, RajeshKumar, Brajendra and Rajiv Kumar. ICARResearch Complex for NEH Region,Umiam.

Abstracts1. Rangad C.O. and Chandra, Satish. 2007.

“Mushroom Cultivation in NE Region” p38in Sovinier & Abstracts 2nd IndianHorticulture Congress-2007 held during18-21 April at ICAR Research Complex forNEH Region, Umiam , Meghalaya.

2. Baiswar, Pankaj, Chandra, Satish andKumar, Rajiv. 2007. Effect ofmycoparasitism and volatile compounds ofTrichoderma and Aspergillus spp onPenicillium and Aspergillus causing storagerot of gladiolus. p304 in Souvenir &Abstracts 2nd Indian Horticulture Congress-

2007 held during18-21 April at ICARResearch Complex for NEH Region,Umiam, Meghalaya.

Popular articles1. Baiswar, Pankaj, Singh, A.K. and Chandra,

Satish.2007. Anticrop Bioterrorism. CurrentScience, 93(7), October 2007.

2. Baiswar, Pankaj, Chandra, Satish andKumar, Rajiv.2007. Disease scenario ofbulbous crops in northeastern region andtheir management. Floriculture Today. June2007, 36-38.

3. Baiswar, Pankaj, Chandra, Satish andKumar, Rajiv. 2007. Status of gladiolusdiseases and their management in India- Areview. Journal of Ornamental Horticulture.10(4): 209-214.

Agricultural Extension

Technical Bulletins/Books1. Patiram, Brajendra, T.Ramesh, Rajesh

Kumar and L.J.Bordoloi. 2007.Soil testingmanual.pp23.

2. Prakash N., Kumar R., Bujarbaruah K.M.,Ngachan S.V., Sarma B.K., Kumar R. 2007.Making partnership a success towardssustainable hill agriculture. ICAR Complexfor NEH Region, Umiam, Meghalaya pp437.

3. Prakash N., Ngachan S.V., BujarbaruahK.M., Kumar R. and Sarma B.K.(eds).2007.Shaping Agrarian ProsperityThrough Integrated Intensive Farming.ICAR Complex for NEH Region, Umiam,Meghalaya.289pp.

Book chapters1. Prakash N. , Pal P.P. , Kumar Rajesh and

Sarama Meghna .2007. Extension Approachfor Organic Farming in North–East. pp65-69 In : Organic Food Production In NorthEast India(Volume-II): Prospects andAspects: (eds)K.M.Bujarbaruah, B.K.Sarma, Narendra Prakash and RajeshKumar.ICAR Complex for NEH Region,Umiam, Meghalaya.


2. Kumar Rajesh , Prakash N. and Pal P.P.2007. Organic Farming in Meghalaya – AnExtension Perspective. pp70-75.In : OrganicFood Production In North EastIndia(Volume-II) : Prospects and Aspects:(eds) K.M.Bujarbaruah, B.K. Sarma,Narendra Prakash and Rajesh Kumar. ICARComplex for NEH Region, Umiam,Meghalaya.

3. Pal P.P. , Prakash N. , Kumar Rajesh andSarma Meghna. 2007. Success stories inorganic farming Organic. pp76-81. In: FoodProduction In North East India (Volume-II):Prospects and Aspects: (eds)K.M.Bujarbaruah, B.K. Sarma, NarendraPrakash and Rajesh Kumar.ICAR Complexfor NEH Region, Umiam, Meghalaya.

4. Brajendra, Bujarbaruah K.M., PrakashNarendra and Kumar Rajesh . 2007. Webbased Organic Farming informationsystem(OFIS WEB). In: Food Production InNorth East India(Volume-II): Prospects andAspects: (eds.) by K.M.Bujarbaruah, B.K.Sarma, Narendra Prakash and Rajesh Kumar.pp 82-89.ICAR Complex for NEH Region,Umiam, Meghalaya.

5. Kumar Rajesh and Prakash N. 2007. Genderperspective and women empowerment forhorizontal spread of integrated farmingsystem. pp 194-206. In: Integrated farmingsystem for hill agriculture (eds) N. Prakash,Rajesh Kumar, Brajendra and RajivKumar.ICAR Complex for NEH Region,Umiam, Meghalaya.

Entomology

Research articles1. Azad Thakur, N.S., Saikia, Kanchan,

Shylesha, A.N. and Sarmah, M.C. 2006. Newrecord of earthworm species of agriculturalimportance from north eastern hill region ofIndia. Indian J. of Hill Farming 19 (1&2):133-134.

Papers in seminar/ conference / workshop1. Azad Thakur, N.S. and Saikia, Kanchan.

2007. Rice pests and disease management,pp 29, In workshop on “Rice and Foodsecurity” held from 12-13 December, 2007at Dimapur, Nagaland.

2. Azad Thakur, N.S. and Saikia, Kanchan.2008. IPM-an important component of cropproduction in Integrated Farming System(IFS), pp. 16-26. In Compendium of NationalSeminar on “Integrated Farming SystemsRelevant to N.E. Region (February 07-08,2008)”.

Book chapters1. Azad Thakur, N.S. 2007. IPM-an important

component of crop cultivation in IFS, pp.70-81 In Integrated Farming System for HillAgriculture (eds. N. Prakash, Rajesh Kumar,Brajendra and Rajiv Kumar). Published byDirector ICAR Research Complex for NEHRegion, Umiam, Meghalaya.

2. Azad Thakur, N.S. 2007.Vermicompostingfor recycling of IFS bio-mass for sustainablecrop production, pp.98-106. In IntegratedFarming System for Hill Agriculture (Eds.N. Prakash, Rajesh Kumar, Brajendra andRajiv Kumar). Published by Director ICARResearch Complex for NEH Region,Umiam, Meghalaya.

3. Azad Thakur, N.S., Shylesha, A.N. andSaikia, Kanchan. 2007. Biopesticides inOrganic Farming- Potential and Prospects,pp 403-414, In Advances in OrganicFarming Technology in India (Eds.G.C.Munda, PK Ghosh, Anup Das, SV Ngachanand KM Bujarbaruah). Published by ICARResearch Complex for NEH Region,Umiam, Meghalaya..

4. Kodamdaram, M.H. and Azad Thakur, N.S.2007. Post harvest insect pests and theirmanagement, pp 415-428, In Advances inOrganic Farming Technology in India(Eds.G.C. Munda, PK Ghosh, Anup Das, SVNgachan and KM Bujarbaruah). Publishedby ICAR Research Complex for NEHRegion, Umiam, Meghalaya.


Agroforestry

Book chapters1. K.A. Pathak, Kundan Kishore, A. Kumaresan,

A.K. Vishwakarma and Brajendra. 2007.Integrated Intensive Farming System inMizoram Shaping Agrarian ProsperityThrough Integrated Intensive Farming,ICAR Research Complex for NEH Region,Umiam, Meghalaya, 2007.

Research articles1. Vishwakarma A.K., Pathak K.A. and

Brajendra. 2008. Influence of Sowing Dateson Growth Yield of Groundnut under Agro-Climatic Conditions of Mizoram.Environment and Ecology 26(1A).

2. Vishwakarma A.K. , Ayachi A.K. andTiwari J.P.2007. Effect of different nitrogenlevels on growth and yield of differentcultivars of Japanese Mint (Mentha arvensisL.) International Journal of TropicalAgriculture 25(3) .

3. Vishwakarma A.K., Pathak K.A. andBrajendra. 2007. Studies on Influence ofSowing Dates on Growth and YieldAttributes of Upland Rice in MizoramInternational Journal of TropicalAgriculture 25(4).

4. Sarangi S.K. , Singh K.A. and Singh R.2007. Performance of turmeric (Curcumalonga) under shade of tree species RangeManagement and Agroforestry 28(1).

Abstracts1. Pathak K.A., Vishwakarma A.K. and

Boopathi T. 2007. Upland Rice Cultivationand Cropping Systems in Mizoram. In Riceand Food Security Workshop, DimapurNagaland.

2. Vishwakarma A.K. , Pathak K.A. , Brajendraand Pattanayak A. 2007. ProductivityEnhancement of Rice Through VarietalScreening Under Lowland Ecosystem inMizoram Rice and Food SecurityWorkshop, Dimapur Nagaland.

3. Brajendra, Vishwakarma A.K. and PathakK.A.. 2007. Physico-Chemical Properties ofsoils Under Paddy Agro-Ecosystems of

Mizoram Rice and Food Security Workshop,Dimapur Nagaland.

4. Vishwakarma A.K., Brajendra and PathakK.A.. 2007. Effect of Integrated NutrientManagement on Lowland Rice BasedCropping System in Mizoram . Rice andFood Security Workshop, DimapurNagaland.

5. Singh Ramesh, Singh A.K. and Kumar Deep. Varietal evaluation of Passion fruits undernatural condition in Sikkim Himalayas.National Symposium on Improving InputUse Efficiency in Horticulture, IIHR,Hessaraghatta, Bangalore

Book Chapters1. Kishore Kundan, Brajendra, Vishwakarma

A.K. and Pathak K.A. 2007. BiodynamicFarming: Theory and Practices pp. 139-154.In: Advances in Organic FarmingTechnology in India : Prospects and AspectsVol-II (eds) G.C. Munda, P.K. Ghosh, AnupDas, S.V. Ngachan and K.M.Bujarbaruah.ICAR Research Complex for NEH RegionUmiam, Meghalaya

2. Vishwakarma A.K., Brajendra, KishoreKundan and Pathak K.A. 2007. Evaluationof Organic Farming Components inMizoram Through Integrated FarmingSystem Approach. pp.337-346. In: Advancesin Organic Farming Technology in India:Prospects and Aspects Vol-II (eds) G.C.Munda, P.K. Ghosh, Anup Das, S.V.Ngachan and K.M.Bujarbaruah. ICARResearch Complex for NEH Region Umiam,Meghalaya

3. Vishwakarma A.K. , Bhatt B. P. and SinghRamesh. 2007. Role of integrated farmingsystem for food security in hills. pp. 1-9. In:Integrated farming system for hill agriculture(eds) N.Prakash, Rajesh Kumar, Brajendraand Rajeev Kumar. ICAR ResearchComplex for NEH Region Umiam,Meghalaya

4. Vishwakarma A.K. and Mishra Anupam2007. Communication in hill agriculture pp207-211. In: Integrated farming system forhill agriculture (eds) N.Prakash, RajeshKumar, Brajendra and Rajeev Kumar. ICAR


Research Complex for NEH Region Umiam,Meghalaya

Agronomy

Research articles1. Das, Anup., Tomar, J. M. S., Patel, D. P.,

and Munda, G. C. 2007. Effect of OrganicManures on the Productivity of Black Gram(Phaseolus mungo) with and withoutFertilizer. Environment & Ecology, 25 (1):15-18.

2. Das, Anup, Patel, D. P., Munda, G. C. andHazarika, U.K. 2007. Productivity of UplandRice (Oryza sativa L.) as Influenced byCultural Management Practices Under MidHills of Meghalaya. Environment & Ecology,25 (2): 244-246.

3. Munda G. C., Islam M. and Patel D. P. 2007.Effect of IPNS on productivity, profitabilityand economic feasibility of maize basedcropping system on farmers’ field. Indian J.Agric. Res. 41 (3): 200-204.

4. Panwar, A.S. Effect of integrated nutrientmanagement in maize (Zea mays) – mustard(Brassica compestris var. toria) croppingsystem in mid hills altitude. Indian Journalof Agricultural Sciences, 76 (1): 27 – 31.

5. Panwar, A.S. and Munda, G.C. Response ofgroundnut (Arachis hypogaea L.) to organicand inorganic sources of nutrient supplyunder mid hill altitude conditions. IndianJournal of Agricultural Sciences, 77 (12):814 – 818.

Technical bulletin1. Tripathi, A. K., Das Anup, Patel, D. P.,

Hazarika, U. K. and Munda, G. C. 2007.Organic Rice Production- Package ofPractices for North East India. TechnicalBulletin No. 2. Krishi Vigyan Kendra, ICARResearch Complex for NEH Region,Umiam, Meghalaya.

Book chapter1. Munda, G. C., Das, Anup, Patel, D.P.,

Hazarika, U. K., Kumar, Rajesh and Panwar,A. S. 2007. Organic Production of Crops inNorth Eastern Region of India, pages 25-38,In Advances in Organic Farming Technologyin India, (eds.) Munda, G. C., Ghosh, P. K.,Das, Anup, Ngachan, S.V. and Bujarbaruah,K. M., ICAR Research Complex for NEHRegion, Umiam, Meghalaya, India.

2. Das, Anup, Patel, D.P., Munda, G. C., Ghosh,P. K., Hazarika, U. K., Kumar, Rajesh andPanwar, A. S. 2007. On and Off –FarmResources for Nutrient Management inOrganic Farming pages 113-138. InAdvances in Organic Farming Technologyin India, (eds.) Munda, G. C., Ghosh, P. K.,Das, Anup, Ngachan, S.V. and Bujarbaruah,K. M., ICAR Research Complex for NEHRegion, Umiam, Meghalaya, India.

3. Patel, D.P., Das, Anup, Munda, G. C., andHazarika, U. K. 2007. Organic Productionof French bean in NEH Region of Indiapages 281-290.In: Advances in OrganicFarming Technology in India, (eds.) Munda,G. C., Ghosh, P. K., Das, Anup, Ngachan,S.V. and Bujarbaruah, K. M. , ICARResearch Complex for NEH Region,Umiam, Meghalaya, India.

4. Das, Anup, Patel, D.P., Munda, G. C.,Hazarika, U. K., Panwar, A. S., Kumar,Rajesh and Chandra, Avinash 2007. OrganicRice Cultivation - Practices and QualityAssessment pages 495-507. In: Advancesin Organic Farming Technology in India(eds) Munda, G. C., Ghosh, P. K., Das, Anup,Ngachan, S.V. and Bujarbaruah, K. M.,ICAR Research Complex for NEH Region,Umiam, Meghalaya, India.

5. Munda, G. C., Das, Anup and Patel, D.P.2007. Role of Livestock in Organic CropProduction pages 32-43. In: ComplementaryRole of Livestock and Fisheries TowardsSustainable Farming in North East India(eds.)Das Anubrata, Kumaresan, A.,Bardoloi, R. K., Bujarbaruah, K. M. andNaskar, S. , ICAR Research Complex forNEH Region, Umiam, Meghalaya, India.


6. Panwar, A.S., Anup Das, Ngachan, S.V.,Jogendra Singh and Panwar, B.S.2007.Multiple Cropping for sustainable cropproduction, pp 94 – 115. In: SustainableCrop Production – for food sufficiency inNE India. (eds.) A.S. Panwar, G.C. Munda,S.V. Ngachan and Anup Das. ICARResearch Complex for NEH Region,Barapani, Meghalaya.

7. Panwar, A.S., Munda, G.C., Anup Das,Bhadana, V.P. and M.R. Verma. 2007.Integrated nutrient management, pp139 –163. In: Sustainable Crop Production – forfood sufficiency in NE India (eds.) A.S.Panwar, G.C. Munda, S.V. Ngachan andAnup Das. ICAR Research Complex forNEH Region, Barapani, Meghalaya.

8. Panwar, A.S., Raverkar, K.P., Vinod Kumar,Ngachan, S.V. and Bhadana, V.P.,Nitrogenous biofertilizers, pp 188 – 204. In:Sustainable Crop Production – for foodsufficiency in NE India. (eds.) A.S. Panwar,G.C. Munda, S.V. Ngachan and Anup Das.ICAR Research Complex for NEH Region,Barapani, Meghalaya.

9. Panwar, A.S., Raverkar, K.P., Vinod Kumarand Rajeev Kumar.2007. Phosphaticbiofertilizers, pp 205 – 224. In: SustainableCrop Production – for food sufficiency inNE India, (eds.) A.S. Panwar, G.C. Munda,S.V. Ngachan and Anup Das). ICARResearch Complex for NEH Region,Barapani, Meghalaya.

10.Munda, G.C., Das, Anup, Patel, D.P.,Hazarika, U.K., Kumar, Rajesh, and Panwar,A.S. 2007. Organic production of crops inNorth Eastern Region of India, pp 25-38. In:Advances in Organic Farming Technologyin India, (eds)G.C. Munda, P.K. Ghosh, AnupDas, S.V. Ngachan, and K.M. Bujarburah .ICAR Research Complex for NEH Region,Barapani, Meghalaya.

11.Das, Anup, Patel, D.P., Munda, G.C., Ghosh,P.K., Hazarika, U.K., Kumar, Rajesh, andPanwar, A. S. 2007. On and off farmresources for nutrient management inorganic farming, pp 113-138. In: Advancesin Organic Farming Technology in India.(eds)G.C. Munda, P.K. Ghosh, Anup Das,

S.V. Ngachan, and K.M. Bujarburah. ICARResearch Complex for NEH Region,Barapani, Meghalaya.

12.Das, Anup, Patel, D.P., Munda, G.C.,Hazarika, U.K., Panwar, A. S., Kumar,Rajesh, and Chandra, Avinash. 2007.Organic rice cultivation – Practices andquality assessment, pp 495-507. In:Advances in Organic Farming Technologyin India. (eds)G.C. Munda, P.K. Ghosh, AnupDas, S.V. Ngachan, and K.M. Bujarburah.ICAR Research Complex for NEH Region,Barapani, Meghalaya.

13.Munda, G.C., Das, Anup, Panwar, A. S.,Patel, D.P., Ngachan, S.V., 2007, Status andtechnology of crop production, pp 32 – 58.In: Sustainable Crop Production – for foodsufficiency in NE India. (eds.) A.S. Panwar,G.C. Munda, S.V. Ngachan and Anup Das.ICAR Research Complex for NEH Region,Barapani, Meghalaya.

14.Das, Anup, Patel, D.P., Munda, Panwar, A.S.,and Munda, G.C. 2007. Vermicomposting,In: Sustainable Crop Production – for foodsufficiency in NE India, pp164 - 187. (eds.)A.S. Panwar, G.C. Munda, S.V. Ngachan andAnup Das. ICAR Research Complex forNEH Region, Barapani, Meghalaya.

15.Das, Anup, Patel, D.P., Hazarika, U.K.,Munda, G.C. and Panwar, A. S., 2007.Nutrient supplementation in cropproduction, , pp 237 -258. In: SustainableCrop Production.– for food sufficiency in NEIndia. (eds.) A.S. Panwar, G.C. Munda, S.V.Ngachan and Anup Das). ICAR ResearchComplex for NEH Region, Barapani,Meghalaya.

16.Rajkhoa, D.J. and Panwar, A.S. 2007. WeedManagement, pp 335 – 361. In: SustainableCrop Production – for food sufficiency inNE India. (eds) A.S. Panwar, G.C. Munda,S.V. Ngachan and Anup Das). ICARResearch Complex for NEH Region,Barapani, Meghalaya.

17.Kanwat Manish , Bhagawat, R., Singh, M.Singh, Panwar, A.S. Singh, A.K. Kumar andKumar, P.S. 2007. Traditional Wisdom ofApatanis: Wet Rice cultivation, pp 471 – 478in Sustainable Crop Production – for food


sufficiency in NE India,. (eds.) A.S. Panwar,G.C. Munda, S.V. Ngachan and Anup Das.ICAR Research Complex for NEH Region,Barapani, Meghalaya.

Abstracts1. Das, Anup, Munda, G. C., Patel, D. P.,

Hazarika, U. K., Ghosh, P. K., Bordoloi, J.and Gogoi, G. 2007. Productivity of Rice-Vegetable based cropping systems underorganic management practices in raised andsunken beds P-258 in 2nd Indian HorticultureCongress-2007 organized by theHorticulture Society of India at the ICARResearch Complex for NEH Region,Umiam, Meghalaya from 18-21 April,Abstract,.

2. Munda, G. C., Das, Anup and Patel, D. P.2007. Performance of Lowland rice (Oryzasativa L.) as influenced by standestablishment and nutrient managementpractices at mid altitude of Meghalaya P-92-93 in 2nd National Symposium on Systemof Rice Intensification (SRI) in India-Progress and Prospects. Department ofAgriculture, Govt. of Tripura, DRR,Hyderabad, CRRI, Cuttack, DRD, Patna andANGRAU, Hyderabad at Agartala, Tripura3-5 October, Papers and ExtendedSummaries of the second National SRISymposium.

3. Patel, D. P., Das, Anup and Munda, G. C.2007. Evaluation of aerobic rice (Oryzasativa L.) culture in the mid-hill ecosystemof Meghalaya P-81 in National Seminar onPlant Physiology (Physiological andMolecular approaches for Increasing Yieldand Quality of Agricultural, Horticulturaland Medicinal Plants Under ChangingEnvironment) 29-30 Nov. & 1st Dec,(Abstract) Dr. B. S. Konkan KrishiVidyapeeth, Dapoli (M.S.) & Indian Societyfor Plant Physiology, IARI, New Delhi atDapoli.

Extension leaflets1. Patel, D. P., Das, Anup, Hazarika, U. K.,

Munda, G. C. and Bordoloi, J. 2007. Package

of practices for organic production of Frenchbean in NEH Region.

2. Das, Anup, Patel, D. P., Hazarika, U. K. andMunda, G. C. 2007. KA RUKOM REPPHRISBIN [Package of practices for organicproduction of French bean in NEHRegion](in Khasi Language).

3. Das, Anup, Patel, D. P., Hazarika, U. K.,Munda, G. C. and Chandra, A. 2007.Technology for Organic Farming.

4. Das, Anup, Patel, D. P., Hazarika, U. K.,Munda, G. C. and Chandra, A. of 2007. KARUKOM REP DAKA ORGANICFARMING [Technology for OrganicFarming] (in Khasi Language).

Soil Science

Research articles1. Patiram 2007.. Management and future

reserach strategies for enhancingproductivity of crops on the acid soils. J.Indian Soc. Soil Sci. 55: 411:420.

Papers in proceedings1. Patiram, Kumar Rajesh, Singh Ramesh and

Mishra A. 2007. Shifting cultivation in northeastern hills and its implications for farmersperspective. In: Proc. Workshop on“Characterization of land resources andagro-eco-zones of India” (eds.) Singh, A.K.and Patra, S.C), pp. 114-125. North EasternRegional Institute of Water and LandManagement, Tezpur, Assam, from 24-25th

September 2007.2. Patiram.2007. Optimization of crop

productivity on aluminium toxic acid soilsof north eastern hills region. In: Proc.Workshop on “Characterization of landresources and agro-eco-zones of India” (eds.)Singh, A.K. and Patra, S.C), pp. 137-145.North Eastern Regional Institute of Waterand Land Management, Tezpur, Assam, from24-25th September 2007.


Books1. Patiram, Brajendra, Azad Thakur N.S. and

Ramesh T. 2007. Soil Testing and Analysis:Plant, Water and Pesticide Residues. NewIndia Publishing Agency, Pitam Pura, NewDelhi.

2. RameshT.,Brajendra,Patiram, ViswakarmaA.K. and Ngachan S.V. 2007. Objective SoilScience. New Vishal Publication, NewDelhi.

Book chapters1. Brajendra.2007. Application of information

technology in organic farming. In: Advancesin Organic Farming Technology in India(eds.) G.C. Munda, P.K. Ghosh, Anup Das,S.V. Ngachan and K.M.Bujarbaruah, pp.551-557. ICAR Research Complex for NEHRegion, Umroi Road, Umiam-793103,Meghalaya.

2. Patiram. 2007. Scope of organic agriculturein acid soil of north eastern region of Indiapp.223-229. In: Advances in OrganicFarming Technology in India (eds.) G.C.Munda, P.K. Ghosh, Anup Das, S.V.Ngachan and K.M.Bujarbaruah. ICARResearch Complex for NEH Region, UmroiRoad, Umiam-793103, Meghalaya.

3. Patiram. 2007. Land degradation, hillagriculture and integrated soil fertilitymanagement pp. 19-34. In: IntegratedFarming System for Hill Agriculture (eds.)N.Prakash, Rajesh Kumar, Brajendra andRajeev Kumar. ICAR Research Complex forNEH Region, Umroi Road, Umiam-793103,Meghalaya.

4. Brajendra.2007. Role of informationtechnology for hill agriculture in Integratedfarming system for hill agriculture pp. 221-231. In: Integrated Farming System for HillAgriculture (eds.) N.Prakash, Rajesh Kumar,Brajendra and Rajeev Kumar.ICARResearch Complex for NEH Region, UmroiRoad, Umiam-793103.

5. Patiram. 2007.Management of acid soil pp.259-277. In: Sustainable Crop Production(eds.) A.S. Panwar, S.V. Ngachan, G.C.Munda and Anup Das. ICAR Research

Complex for NEH Region, Umroi Road,Umiam-793103, Meghalaya.

6. Ramesh, T., Patiram and Brajendra. 2007.Management of soil health pp. 278-303. In:Sustainable Crop Production (eds.) A.S.Panwar, S.V. Ngachan, G.C. Munda andAnup Das. ICAR Research Complex forNEH Region, Umroi Road, Umiam-793103,Meghalaya.

Agricultural Economics and Statistics

Research articles1. Tripathi A.K., Verma M. R., Mandal S. &

Hussain Safiqul 2007. Economics of GingerProduction in Ri-Bhoi District ofMeghalaya. International Journal ofTropical Agriculture. 25(3): 637-644.

2. Tripathi A.K., Verma M. R., Mandal S.,Hussain Safiqul & Tarat R.K. 2007.Production and Marketing of Tomato andCapsicum in Ri-Bhoi District of Meghalaya.International Journal of TropicalAgriculture. 25(4): 855-865.

3. Mandal Subhasis, Datta K.K., Hore D.K. andMohanty Suchitra 2008. Biodiversity andOrganic Agriculture: Opportunities andChallenges for North East Region of India,Outlook on Agriculture, Vol. 37 (2): 287-294

4. Mandal Subhasis, Mahapatra B. K., TripathiA. K., Verma M. R., Datta K. K, andNgachan S. V. 2007. AgribusinessOpportunities of Ornamental Fisheries in theNorth East Region of India. AgriculturalEconomics Research Review, Vol 20 (Conf.No), pp. 471-488.

5. Mandal Subhasis, Datta K. K., Verma M.R.and Tripathi A. K. 2007. AgriculturalDevelopment Status in North Eastern States:Assessment and Priorities. InternationalJournal of Tropical Agriculture, 25 (3): 645-663.

6. Verma M.R., Datta K.K., Mandal Subhasisand Tripathi A.K. 2007. Diversification ofFood Production and consumption patternin India. Journal of Agricultural and FoodInformation. 8 (3): 87-100.


7. Verma M.R., Datta K.K., Mandal Subhasisand Tripathi A.K. 2007. Food Productionand Consumption Pattern in North EasternRegion of India. Agricultural Situation inIndia, 64(3): 89-95.

9. Verma M.R., Datta K.K., Mandal Subhasisand Tripathi A.K. 2007 Dynamic Change inPoultry Population and Production inMeghalaya. International Journal ofTropical Agriculture, 25 (3): 559-568.

10.Verma M.R., Joorel J.P. Singh and AgnihotriR.K. 2007. Optimum stratification for twosensitive quantitative variables using equalallocation. Rev. Mat. Estat, 25 (2), 73-85.

11.Verma M.R. and Rizvi S.E.H. 2007.Optimum Stratification for PPS Samplingusing Auxiliary Information. Journal ofIndian Society of Agricultural Statistics,61(1): 66-76.

12.Datta K.K., Mandal S., Tripathi A.K., SinghS.B., Verma M.R., Mahapatra S. Mohanti2007. Retrospect and prospect of foodsecurity in North Eastern Hilly Region ofIndia. Agricultural Situation in India, 64(5):37-49.

13.Kozak M., Singh P.K., Verma M.R. and HoreD.K. 2007. Causal mechanism for

determination of grain yield and millingquality of lowland rice. Field CropsResearch, 102: 178-184.

14.Kozak M., Verma M. R., Zieliñski Andrzej2007. Modern approach to optimumStratification: Review and Perspectives.Statistics in Transition, 8(2): 223-250.

16.Singh P. K., Verma M. R., Borthakur M. andDas Alpana 2007. Genotype × Environmentinteractions and stability analysis of yieldand its components in buckwheat(Fagopyrum sp.) in North EasternHimalayan Region of India. Fagopyrum, 24:111–116.

Bulletins1. Tripathi A. K., Das A, Patel D.P., Hazarika

U.K., and Munda G.C. 2007. Organic RiceProduction Package of Practices for NorthEast India. Published by Krishi VigyanKendra, Ri Bhoi, ICAR (RC) Barapani.

2. Tripathi A. K., Mandal Subhasis, VermaM.R, Datta K. K., and Ngachan S. V. 2007.Production and Marketing of Selected HighValue Crops in Meghalaya. Published byDirector, ICAR Research Complex for NEHRegion, Umiam, Meghalaya.


VISITORS

1. Dr. K.M. Bujarbaruah, Deputy Director General(Animal Science), Krishi Bhavan, New Delhi

2. Mr. Anu Ferguson from London, U.K. visitedthis complex on 14th August 2007

3. Dr. Jairam Ramesh, Minister of State(Commerce), Govt. of India visited this complexon 23rd September 2007

4. Mr. Arjun Sharma, Secretary, KundarbilFarmers’ Club, Udalguri, Assam visited thiscomplex on 27th September 2007

5. Sri Okram Idobi Singh, Hon’ble Chief Minister,Manipur visited this complex on 15th December2007


ARUNACHALPRADESHCENTRE


Maximum rainfall was received in the monthof June (412.5mm) followed by July (380 mm).Relative humidity was more in the morning hours

WEATHER

Air temperature (0C) Relative Humidity (%) Rainfall (mm) Rainy days

max min 8 hrs 14 hrs

19.41-34.7 6-25.7 69.5-82.7 43.5-64.8 2621.7 120(25.68) (15.64) (75.28) (52.18)

than in the afternoon and it varied from 69.5%(May) to 82.7% (Feb) in the morning hours and43.5% (Jan) to 64.8% (Dec) in the afternoon period.



CROP SCIENCE

RICE

Effect of cultural management practices underlow input production system for wet land rice

Four rice varieties viz. Lachit, Puja, VL-61 andVL-225 and three cultural management practiceswere tested.The treatments were; (i) One spadingat the time of transplanting (ii) Two spading (1st

before 20days of planting and other at the time oftransplanting). (iii) Puddling with power tiller.Transplanting was done at spacing of 25cmX10cm.Plot size was 4mX4m. The FYM was applied @5t/ha at the time of field preparation and 20 kgnitrogen/ha was given at the time of panicleinitiation stage. The observations were taken forgrowth, yield attributes, yield and weed biomass.The maximum yield was recorded by VL-61+puddling (4.24 t/ha), Lachit+puddling (4.2 t/ha), Puja+puddling (3.9 t/ha), and VL-225+puddling (1.5 t/ha) followed by VL-61+2spading (4.08 t/ha), Lachit+2 spading (3.8 t/ha),Puja+2 spading (3.7 t/ha) and VL-225+ 2 spading(1.14 t/ha).The highest weed biomass was recordedby VL-225+ one spading (21.33 kg/plot) followedby Lachit+one spading (19.00 kg/plot) and VL-61+one spading (17.66 kg/plot). Lachit was highlysusceptible to leaf and neck blast. Highestinfestation was observed by rice gundhi bug.

Evaluation of organic sources of nutrientssupplied for rice-pea cropping system inwetland condition

A field experiment was laid out in 30 plots andsize 4mx3m with the use of organic sources andrice-pea cropping system under wetland ricecultivation at ICAR, Basar. Two varieties of riceviz. Luit and Vandana and two varieties of pea viz.TRCP 9 and Azad P1 were evaluated with FYM,green manures of Tephrosia candida, Crotolariatetragona, and weeds. All the organic manures

were applied @ 80 kg N/ha on the basis ofrespective nitrogen percent content( T . c a n d i d a = 3 . 5 7 % , C . t e t r a g o n a=3.23%,weeds=1.87% and FYM=0.52% N). Allgreen manure crops were chopped into pieces andapplied before 15 days of transplanting. FYM wasalso applied at the same time.

The maximum grain yield was recorded byLuit+ Tephrosia (4.8 t/ha)-green pods TRCP 9+Tephrosia (4.7 t/ha) followed by Luit+ Crotolaria4.1 t/ha)-TRCP 9+ Crotolaria (4.5 t/ha) andLuit+weeds (4.0 t/ha)-TRCP 9+weeds (3.8 t/ha).The lowest grain yield was recorded byVandana+FYM (3.0 t/ha)-greenpods Azad P1(2.5t/ha). However Luit+control yielded (2.2 t/ha)-TRCP 9 (2.5 t/ha) followed by Vandana+control(1.9 t/ha)-Azad P1+control (1.8 t/ha).

RICE PATHOLOGY

Screening nurseries for host plant resistanceagainst leaf blast

The National Screening Nursery 1 (NSN 1)comprised of 140 test entries drawn from 13advanced varietal trials of 2007 was included withnational, regional and local test check forcomparison. These entries were evaluated againstleaf blast under uniform blast nursery (UBN)pattern and disease pressure was moderate at Basarcondition with location severity index (LSI 4.5).In 0-9 scale, 29 entries scored 9 scale and 15 entries


recorded 1 scale, 42 entries in 2 scale, 23 entriesin 3 scale and 57 entries in between 4-8 scale.

The National Screening Nursery Hills (NSN-H) included 54 entries drawn from AVT and IVT-Hill trial during 2007.The entries were evaluatedin UBN pattern against leaf blast under Basarcondition and showed moderate disease pressurewith location severity index of 4.46 with 26 entriesscored between 5-9 scale and 28 entries between2-4 and none in 0-1 scale.

Screening of collected rice germplasm/varietiesfor blast resistance

One hundred twenty one rice varieties/ localgermplasm from different agricultural institutes andlocal growers of N.E. States were collected andscreened for blast resistance in UBN pattern. Thedisease pressure was moderate at Basar conditionwith LSI 4.43. Three varieties showed resistantreaction, 51entries recorded as tolerant, 47 entriesobserved were susceptible and 20 entries werehighly susceptible.

Production Oriented Survey (POS) inArunachal Pradesh during 2007

The survey was conducted in different altitudecovering forty-eight farmers in eleven villages ofLikabali and Basar block of West Siang district inkharif 2007. In the district, total rice area is 24,343ha and of which irrigated area is 5,900ha. The cropsuffered very adversely as the weather was veryharsh with 22 rainy days only in the month ofJuly’07 with a total 704.70 mm rainfall. Duringthe survey, it was observed that most of the farmersare growing local traditional rice varieties like

Mipun, Mugme, Jangia, Alpana etc. because ofnonavailability of HYV seeds in time suitable totheir farming situations in time. The socio-economic conditions of the farmers are also notsound to adopt input intensive improvedtechnologies for higher production and productivityand there were hardly any retail outlets in thesetwo blocks for agricultural inputs. The farmers arealso rigid in their belief and difficult to convincefor adoption of new production technologies. Thefarmers grow only one rice crop and after harvestof rice keep the land fallow because of the problemof stray cattle. Mithuns are kept free for grazing. The average rice yield in this region ranged from900-1600 kg/ ha. In WRC fields, the optimumsowing time of seeds in nursery is April/ May andtransplanting time is last week of May and Juneonwards. Most of the farmers used a seed rate of60-80 kg/ha but some farmers used still higher seedrate of 90-100 kg/ha and 30-40 days old seedlingfor transplanting. Many farmers apply FYM/cowdung / pig dung @ 1-3 t/ha in the fields. None ofthe farmers applied any chemical fertilizers,fungicides or pesticides in the nursery or in themain fields. Transplanting was done mainly atrandom and there was a wide variation in the plantpopulation per unit area which ranged from 30-90/m2.

Among the diseases, blast was widespread inmoderate to severe intensities (4-7 score in 0-9scale) in most of the places. Other diseases likebrown spot and grain discoloration were in low tomoderate intensities. There was no record of anydeficiency or toxicity of nutrients. Among thedifferent insect pests, leaf folder was moderate with35% intensity recorded in some of the places. Stemborer and Gundhi bug attack were also moderatewith an intensity up to 25% in some places andother insect pests like GLH, horned caterpillar,mealy bug, leaf hopper and rat damage were lowto moderate intensities. None of the farmersadopted any plant protection measures. Harvest andpost harvest loss ranged from 9-27% duringharvesting to threshing, cleaning, drying, baggingand storing.

Front line demonstration on riceThe FLD on rice was conducted with five

varieties viz. Luit, Aghoni Bora, Chandrama, Anjali


and Vandana each with 20 numbers and on riceblast disease management 20 nos during kharif2007. Luit recorded about 52 % yield advantageover the local varieties while the yield advantageof other varieties ranged between 10 and 16%. Inrice blast disease management FLD, diseaseincidence was less in tolerant variety Luitcombined with spray of Bavistin @2g/litre orHinosan @2ml/litre water as compared with locallygrown varieties. The blast disease managementdemonstration recorded a yield of 1.76 t/ha that isabout 62% more than the farmers practice. Thiscentre has undertaken these FLDs for the first timeand executed in collaboration with the officials ofstate agricultural department.

Table 1. Front line demonstration on rice varieties

Technologies Local Check Area FLD Yield Check Yield % YieldDemonstrated (t/ha) (t/ha) Advantage

Luit Local Varities 25.00 1.52 1.00 52.00Aghoni Bora Local Varities 25.00 1.16 1.00 16.00Chandrama Local Varities 20.00 1.16 1.00 16.00Anjali Local Varities 15.00 1.13 1.00 13.00Vandana Local Varities 15.00 1.10 1.00 10.00Blast Disease Farmers’ practice 20.00 1.76 1.08 62.96Management(IPM) (no care)

PULSES


Mungbean

Performance of mungbeanFour mungbean varieties viz. PU-99-125,

HUM-12, Pusa-9531 and Pant M-2 with threetreatments i.e., control, FYM 10t/ha+60 kg P2O5/ha and vermi-compost 3t/ha+60 kg P2O5/ha weretested. The plot size was 4mx3m. The plantingdistance was 30cmx10cm.

The maximum grain yield 0.60 t/ha wasrecorded by PU-99-125+VC+60 kg P2O5/hafollowed by PU-99-125+FYM+60 kg P2O5/ha (0.53t/ha) and Pant Mung 2+VC+60 kg P2O5/ha (0.53 t/ha).The lowest grain yield was found in Pusa

9531+control (0.35 t/ha).However, Pusa9531+VC+60kg P2O5 yielded 0.48 t/ha and HUM-12+VC+60 kg P2O5/ha gave 0.48 t/ha.

Varietals evaluationTwo varieties were sown on 07/04/07 at spacingof 30cm X10cm in 4mx3m plot size. Variety AAU-34 recorded maximum yield 0.66 t/ha followed byPratap (0.49 t/ha). AAU-34 and Pratap matured in83 days and 81 days respectively. The highest testweight was recorded in Pratap (41.5 g) followedby AAU-34 (34.6 g).

DISEASES

LentilScreening of lentil varieties against locationspecific diseases

Six entries received from VPKAS, Almora wereevaluated at Basar during Rabi 2007-08 season.Sowing was done on 5th October’07 in 3x2 m2 plotswith30x10cm spacing. Three replications weremaintained. All the test entries were found freefrom pests and diseases.

Though 50% flowering was observed in all thetest entries during 28-30th January’08, in the entryVL 507 no seed setting was observed whereashighest yield was recorded in VL-126 (.2 t/ha)followed by VL –103 (.14 t/ha), VL-4 (.13t/ha),VL-125 (.1 t/ha) and lowest in VL-1 (.07 t/ha)

Field peaEvaluation of field pea varieties against locationspecific diseases

Two entries namely VL-40 and VL-42 receivedfrom VPKAS, Almora were sown on 6th October’07


in plots of 3x2 m2 with 45 cmx15cm spacing. Theexperiment was totally free from attack of any pestand diseases. 50% flowering was observed in VL-40 on 20th November’07 and VL-42 on 22nd

November’07 and average plant height in VL-40was recorded 137.73 cm and in VL-42 was 143.5cm. Yield of VL-40 was .34 t/ha and VL-42recorded .33 t/ha

TUBER CROPS

DISEASESEvaluation of potato tuber varieties againstlocation specific diseases

Seven potato tuber varieties namely, Himalini,Kufri Jyoti, Kufri Giriraj, Kufri Megha, KufriSherpa, Kufri Chipsona and SSC-562 werecollected from the Agronomist, Potato Seed Farm,Tawang, AP and planted in a plot size of 2.5 x 3.5m2 in three replications on 31st October’07.

Appearance of late blight was first noticed inHimalini and disease severity was recorded in 0-9scale in one month interval and final diseaseobservation before harvest showed Himalini, KufriGiriraj, Kufri Megha and Kufri Sherpa were withhighest late blight incidence scoring 9 with allleaves, stems and tubers got infected while KufriJyoti showed disease score 6 and Kufri Chipsonaand SSC-562 showed tolerant reaction with diseasescore 3. However it was observed that the diseaseseverity had not much effect on yield and highestyield was recorded on Kufri Giriraj (10.21 t/ha)followed by Kufri Chipsona (7.43 t/ha), KufriMegha (7.23 t/ha), Himalini (6.91 t/ha), KufriSherpa 6.86t/ha), Kufri Jyoti (4.94 t/ha) and lowestin SSC –562 (1.77 t/ha)

WHEAT

AICRP on wheatEvaluation of wheat varieties under wheatimprovement programme

Eight varieties of wheat were planted on 07/1/07(Timely sown) with row spacing of 23cm.Variety VL-738 recorded maximum grain yield(2.28 t/ha) followed by HS-240 (1.83 t/ha) and VL-

804 (1.48 t/ha).Maximum test weight was recordedwith VL-907 (45.71 g) followed by VL-900 (45.17g).

FLORICULTURE

Performance of gladiolusEight varieties viz., Promise, Red Majesty,

Candy Man, Rosared, Pusa Chandhini, Pusa Josna,Snow Princess and Novalux were evaluated fortheir performance under mid hill condition. It wasobserved that cv. Promise performed betterfollowed by Pusa Josna, Red Majesty and PusaChandhini. Desirable plant height (117 cm), spikelength (73 cm) and rachis length (45 cm) andnumber of florets per spike (13) were recorded withPromise. Post harvest life of the spike was alsosuperior with cv. Promise.

General field view

FRUITS

CITRUS

Studies on budding in citrus with differentrootstock and scion combination

The experiment was laid out with four types ofmandarin oranges (Khasi Mandarin, NagpurSantra, Hill Mandarin and Sikkim Orange) and sixspecies of rootstock (Tanyum, C. volckamariana,C. latipes, Trifoliate Orange, Rough lemon and


Karna Khatta) during May, 2001. Among differentcombinations of rootstocks and scions, Citruslatipes + Hill Mandarin attained the maximumplant height (2.75 m), root stock diameter (6.9cm)and no. of branches (16). Out of different rootstock- scion combinations, Tanyum + Khasi mandarinproduced highest number of fruits (82) after 6th yearof planting followed by Tanyum + Hill mandarin.Further, it is observed that C. latipes + Hillmandarin recorded the highest fruit weight, fruitdiameter and juice content. T.S.S. (10.4 0B) wasfound to be highest in Tanyum + Sikkim orange.Acidity was higher in Trifoliate + Khasi mandarin(0.75 %) while the lowest was observed in Tanyum+ Sikkim orange (0.51%).

Effect of organic manures and inorganicfertilizers on Khasi mandarin

An experiment was laid out with 12 differentdoses of organic manures comprising FYM, pigmanure, poultry manure and four different dosesof inorganic fertilizers (NPK). Results indicatedthat highest number of fruits per plant (663) wasrecorded with 600, 400, 400 g NPK applicationfollowed by 80 kg application each of pig manureand FYM. Plant height (6.96 m) and crop canopy(5.7x5.6 m) were highest with full dose of NPK.However, stem diameter (86.8 cm) was highest withthe application of 80 kg pig manure. Though thenumber of fruits and fruit yield were low withapplication of organic fertilizers than the full doseof NPK, the numbers of fruits in extra special andspecial grades were high with organic nutrientsources. The physico-chemical characteristics offruits showed that peel weight (32.14 g) andthickness (4.2 mm) were more with full doseapplication of NPK while segment weight (87.52g) and fruit weight (120.4 g) were highest with 80kg FYM followed by 80 kg pig manure.Development of seeds/fruit (6.63) was lowest withthe application of 60 kg poultry manure. Juicecontent (54.45 ml) and TSS (11.2) was also highestwith FYM and Pig manure application.

Performance of Khasi mandarin under highdensity planting

Data were recorded on fruit quality of Khasimandarin in its 7th year, planted in HDP with threedifferent spacing of 2 m x 2 m, 2.5 m x 2.5 m and3 m x 3 m. It was observed that 3m x 3 m spacing

had fruits with highest weight (117.26 g), size (4.9x 6.1cm2), segment weight (76.28 g) and also juicecontent (54.6 ml). On the other hand, highestacidity (0.53 %) was recorded in 2m x 2m spacing.

Rejuvenation of Khasi mandarinA trial was laid out to standardize the top

working height in the old Khasi mandarin orchardwith the following heights viz., 0.5m, 1.0m, 1.5m,primary branch pruned and control (withoutpruning). It is noticed that after 7th year ofdehorning control (without pruning) producedplants with maximum height (8.3 m), no. ofbranches (21), canopy spread (4.91 x 4.88 m2) andshoot length (6.0 m). But the highest no. of fruits(418) was obtained in primary branch pruned plantswhile least no. of fruits (223) was recorded in 0.5mrejuvenated plants. Maximum fruit weight (146.7g), fruit size (6.5 x 5.2 cm2), segment weight (105.5g), juice content (76.8 ml) were achieved in plantswith primary branch pruned. The highest TSS(10.4°B) and acidity (0.83%) were observed in1.5m pruned plants.

Performance of micro propagated plants ofKhasi mandarin

Micro propagated plants of 10 years old wereevaluated for their growth and yield characteristics.It was observed that the plants are uniform in heightand are having similar shape fruits with goodkeeping quality. Data were recorded in averageplant height (3.32 m), stem growth (6.1 cm),number of primary branches (16) besides onnumber of fruits per tree (537), fruit droppercentage (7%), fruit weight (108.4 g), TSS(11.230 B) and acidity (0.52%).

Maintenance of germplasmGermplasm block was established and

maintained with 14 different varieties of sweetoranges, eight mandarin oranges and 10 differentimportant rootstocks. Root stocks likeC.volkumeraina, C.trifoliata and C.jigardio weremass multiplied and maintained.

Performance of Kinnow at low hills ofArunachal Pradesh

Kinnow, a hybrid between King orange andWillow leaf mandarin was evaluated for theirperformance under mid hills of Arunachal Pradesh.


It was observed that fruits are bright orange incolour, oval, glossy and slightly tight skinned. Thefruits recorded an average weight of 135.05 g, fruitsize 5.11 cm x 6.85 cm, juice content of 56.80 ml,TSS of 8.84 °B and 1.96% acidity.

GUAVAPerformance of guava varieties under differentspacing

Field trial was conducted with two differentvarieties Allhabad safeda and L-49 under differentspacings viz., 3x4 m, 3x3m and 4x4m. It wasobserved that Allahabad safeda performed betterin all the three different spacings. L-49 recordedmore number of fruits (571/tree), yield (75 kg/tree))and fruit weight (174.38 g) under 4x4 m spacing.

AONLAPerformance of aonla varieties

Six different cultivars viz., Assam local, NA-6,NA-7, Kanchan, Chakkaiya and NA-10 wereplanted in 2000 to evaluated their performance. Itwas observed that assam local performed betterthan other improved varieties under mid hillcondition. Assam local recorded early fruiting andhigher fruit yield (4 kg/tree). Cultivars likechakkaiya and kanchan didn’t give flowering evenafter eight years of planting.

BANANAThirty germplasm of banana have been

maintained at the Research Farm. Karpurachakrakeli attained maximum vegetative growth.While highest bunch weight (6.2 kg), number ofhands (14), finger per hand (18) were recorded inChinni champa followed by Malbhog andHatidath.

High density planting in bananaTrial was conducted to identify the best planting

density for banana varieties. Planting densities viz.,3x2m, 1.8x1.8 m, 1.5x2 m and 1.5 x1.5 m weretried with four varieties viz., Chini champa,Malbhog, Hatidath and Dwarf Cavindish. It wasobserved that Dwarf Cavindish performed betterunder 1.5x1.5 m spacing followed by Malbhog.However, Chinni champa came to flowering wellearlier than other varieties with wider spacing

(1.8x1.8m). The bunch weight (7.4 kg) was higherwith Dwarf Cavindish without any blemishes.

PEACHThree low chilling varieties of peach namely

Sharbati, TA-170 and Flordasun were evaluated fortheir yield attributing parameters under mid altitudecondition. It was noticed that Sharbati recorded thehighest yield of 933 fruits/plant followed by TA-170 (723).

PERFORMANCE OF INDIGENOUS FRUITSDifferent indigenous fruits of Arunachal

Pradesh were evaluated to study their growthperformance. Taktir and Buri fruits are eaten rawby the local people and can also be used forpreparation of squash and pickle. It was observedthat the species like Tagu guti, Taktir, Saam kothal,Naspati and Takuk performed well under Basarcondition. Among different species, Taktir (205fruits /tree), Hilum (108 fruits /tree) and Buri (74fruits/tree) performed better and came to fruitingwithin seven years. Since Taktir has good naturalcolour, it can be used for preparation of processedproducts like squashes.

VEGETABLES

Package of practices were developed forsprouting broccoli, spinach, local cabbage, okra fortheir better performance under mid hill conditionof Arunachal Pradesh. Sprouting broccoli wasintroduced to grow in off-season. It recorded good


TSS (4.0 Bx), pH (6.8), acidity (0.32%), reducingsugars (3.33%) and ascorbic acid (16.2mg/100g).curd initiation and maturation occurred 54 days and72 days respectively after maturation.

Performance of Pea var. Azad was evaluated forits growth and yield parameters. It was observedthat 50% flowering was recorded after 60 days ofsowing while it took another two weeks for podmaturation. The total duration of variety was 120days with the pod yield of 185g/plant of which seedweight was 92.61 g. chemical attributes recordedwere total sugar (3.86%), TSS (4.80Bx), pH (6.1)and acidity (0.26%).

CAULIFLOWER

Effect of boron and molybdenum on cauliflowerField trial was conducted to identify the effect

of micronutrients and their mode of application ongrowth and yield attributes of cauliflower var. Snowcrown. It was noticed that combined foliar sprayapplication of borax (0.3%) + ammoniummolybdate (0.3%) performed better than soilapplication. Highest curd diameter (17.43 cm), curdlength (14.81 cm), gross weight (225.38 g) and netweight (187.39 g) were recorded with combinedfoliar application.

TOMATOPerformance of tomato hybrids underpolyhouse

Five different varieties of tomato viz., Rocky,Avinash, Cheeranjeevi, Arjuna and PS 225 weregrown under polyhouse to evaluate the best varietyfor off season (Apr-July) production of vegetables.Among different varieties Arjuna performed well

followed by Avinash and PS 225. Early flowering(55 days), highest fruit set and more yield (3.2 kg/plant) was recorded with Arjuna. However, var.Avinash was tolerant to late blight of tomatofollowed by Arjuna.

AGROFORESTRY

Evaluation of multipurpose treesDuring 1997-2001, 53 MPT species have been

planted, out of which 49 species are established.Among 16 tree species established in 1997, Pinuskesia attained maximum basal girth (109.4) andcanopy spread (7.86m x 7.92m) after eleven yearsof planting. Highest plant height was recorded inMichelia obtusifolia (15.91m) followed byCastonopsis indica(15.19m) and Anthocephaluscadamba (15.08m). Chlorophyll content was foundmaximum in Ixonanthus khasiana (47.5 SPAD)followed by Mesua ferrea (46.6 SPAD) andLivistonia jenkinsiana (46.4 SPAD). Highest lightintensity in inter-rows was recorded highest inTerminalia myriocarpa (677.3 lux) followed byGmelina arborea (556.3 lux) and Anthocephaluscadamba (386.3 lux) and lowest in Mesuaferrea(6.3 lux).

Among the 20 tree species planted in 1998,Acacia mangium attained maximum height (22.33m) followed by Pinus wallichiana (15.69m) andPenlow (14.88m) and lowest in Morus alba (1.95m).The canopy spread was found highest in Acaciamangium (9.68m x 8.64m) followed by Pinuswallichiana (7.84m x 7.86m) and Duabangagrandiflora (4.96m x 4.60m) and lowest in Morusalba (1.21m x 1.5m). Chlorophyll content wasrecorded highest in Symmingtonia populnea (66.5SPAD) followed by Cunninghamia lanceolata(61.3 SPAD) and Caryota urens (59.1 SPAD) andlowest in Pinus wallichiana (1.5 SPAD). Highestinterspacing light intensity was recorded inGravelia robusta (868 lux) followed by Alnusnepalensis (612 lux) and Lagerstoemia speciosa(551 lux) and lowest in Cunninghamia lanceolata(9.3 lux) followed by Symmingtonia populnea (21lux) and Cephalo taxus (26 lux).

Among six species established in 1999,Manglietia insignis attained highest plant height


(12.72 m) followed by Parkia roxburghii (12.16m) and Aleurites montana (11.27m) and lowest inBauhinia purpurea (4.75 m). The basal girth wasfound highest in Aleurites montana (70 cm)followed by Manglietia insignis (59.2 cm) andEngelhardtia spicata (59 cm) and lowest inBauhinia purpurea (23.8). Aleurites montanarecorded the highest canopy spread (6.10m x5.56m) followed by Manglietia insignis (4.78m x4.92m) and Engelhardtia spicata (4.70m x 4.54m)and lowest in Bauhinia purpurea (2.76m x 2.72m).The chlorophyll content was recorded highest inManglietia insignis (44.0 SPAD) followed byEngelhardtia spicata (41.2 SPAD) and Emblicaofficinalis (27.7 SPAD) and lowest in Aleuritesmontana (23.55 SPAD). Aleurites montana showedthe highest inter spacing light intensity (879 lux)followed by Emblica officinalis (305 lux) andBauhinia purpurea (264 lux).

Among five species planted in 2000, maximumplant height was recorded in Eleocarpus sphaericus(18.24m) followed by Kobolakso (8.14m) andSapindus mukorossi (6.7m) and lowest inAquillaria agallocha (4.97m). The basal girth wasfound highest in Eleocarpus sphaericus (91.6 cm)followed by Kobolakso (42.8 cm) and Aquillariaagallocha (27.8 cm). Eleocarpus sphaericus alsorecorded the highest canopy spread (7.51m x 8.2m)followed by Kobolakso (3.94m x 3.88m) andChukrasia tabularis (1.26m x 1.39m). Thechlorophyll content was found highest inEleocarpus sphaericus (41.7 SPAD) followed byChukrasia tabularis (36.4 SPAD) and Sapindusmukorossi (34.05 SPAD).

Out of four species planted in 2001, Hikorecorded the highest plant height (7.58m) followedby Litsea lacta (7.10m) The basal girth was foundhighest in Litsea lacta (41.25cm) followed by Hiko(34.2cm). The canopy spread was recorded highest(3.66m x 3.86m) in Hiko followed by Litsea lacta(3.38m x 3.35m). The chlorophyll content wasfound highest in Hiko (43.5 SPAD) followed byLithocarpus sperma (41.5 SPAD). The inter-spacing light intensity was recorded highest inLitsea lacta (131.3 lux) followed by Hiko (67.0lux).

The soil pH of 50 multipurpose tree speciesplantations was ranged from 4.3 in Sapindusmukorossi to 3.1 in Kobolakso.

Among 31 combinations of 51 species of MPTand 5 species of cane, Anthocephalus cadamba +Ada was reported best in terms of basal girth (30.5)followed by Alnus nepalensis + Takek (27.33) andPinus khasiana + Takek (25.33). However, thechlorophyll content was found highest in Alnusnepalensis+Takek (65.03 SPAD) followed byPinus khasiana+Takek (55.93 SPAD) and Acaciamangium+Taher (53.93 SPAD). The plant heightof canes was found highest in Duabangagrandiflora (260.6 cm) followed by Terminaliamyriocarpa (225.0 cm) and Castanopsis indica(178.6 cm).

Alnus nepalensis + Takek

Out of different combinations of turmeric and25 MPT species, highest yield of turmeric wasobtained from the combination Duabangagrandiflora + turmeric (9.50 kg / row ) followedby Pinus kesia + turmeric ( 7.60 kg / row ) andTerminalia myriocarpa + turmeric (7.50 kg / row).

Among 12 combinations of MPT species andginger, the combination Castonopsis indica +ginger recorded the highest ginger yield (4.50 kg /row) followed by Pinus kesia + ginger (3.50 kg /row) and Pinus wallichiana + ginger (2.80 kg/row).

Among 29 combinations of MPT species andGuinea grass, the combination Castanopsis indica+ Guinea recorded the highest guinea grass yield(34.66 kg / row) followed by Chukrasia tabularis+ Guinea (30.66 kg / row) and Sapindus mukorossi+ Guinea (25.00 kg / row). In all combinations ofMPTs and other crops, the length of row was 30meters.


Morus alba + Guinea grass

Effect of tree densities on the growthperformance of Ghamari (Gmelina arborea)

The spacing trial of Ghamari was establishedin 1999. In 9th year of establishment, Ghamariobtained highest plant height (9.4 m) in the spacing4m x 4m followed by the height (9.2m) in spacing6m x 4m. The basal girth was recorded highest(91.2 cm) in the spacing 4m x 4m followed by thegirth 90.2 cm in 6m x 4m. The girth at breast heightwas found highest (67.2 cm) in the spacing 4m x4m followed by 64.6cm in 6m x 4m spacing.

Spacing trial of Bola (Morus laevigata)The spacing trial of Bola was established in

1998. After 10 years, maximum plant height (7.95m) was attained in the spacing 3m x3m followedby 7.20 m in 4m x 3m spacing. The spacing 3m x3m recorded the highest basal girth (45 cm)followed by 38.4 cm in the spacing 4m x 3m. Thegirth at breast height was also found highest (33.0cm) in the spacing (3m x 3m) followed by 28.2 cmin the spacing 2m x 3m.

Spacing trial of bamboo speciesOut of 13 species of bamboo grown under three

spacing, maximum clump circumference wasrecorded in Bambusa cacharensis (12.6 m) at 5mx 5m spacing followed by the same species (10.2m) planted at spacing 6m x 6m. But in spacing 7mx7m, Bambusa nutans recorded the highest clumpcircumference (8.2 m). Highest number of culmsper clump was recorded in Bambusa pallida (47)at 7m x 7m spacing followed by Dendrocalamussahnii (42) at 6m x 6m spacing and Dendrocalamushamiltonii (39) at 5m x 5m spacing.

FARMING SYSTEM RESEARCHPROJECT

Performance of field cropsExperiment have been conducted on cropping

system research consisted for evaluation ofadvantageous crop rotation of various crop varietiesin ten cropping sequences under terrace (4nos.)cultivation. The cropping sequences evaluated onthe yield performance of maize-potato, maize-broccoli, maize-cabbage, sesamum-raddish,sesamum-cabbage, sesamum-pea, french bean-spinach, french bean-coriander, mungbean-fenugreek and soybean-french bean. Theperformance of crops was evaluated on the basisof yield and rate of economic produce. The mostadvantageous crop sequence are sesamum-pea wasfound superior amounting Rs.82,378 followed bymaize-potato (Rs.76,676) which was at par withmaize-broccoli (Rs.76,512) and the lowest returnwas found by french bean-spinach (Rs.44,672)among the all cropping sequences.

Performance of riceA field experiment was conducted to study the

effect of boon (Bio-organic) on the performanceof three rice varieties. All varieties were grownunder wetland condition without no external inputs(fertilizers/manures).The forest litter washed wasutilized by the crop under natural condition. Theboon was sprayed @ 4ml/lit. of water at 30,45,60days after planting to all rice varieties Mipun (local)attained maximum height i. e. 82.06 cm followedby P3 (81.33 cm) and RCRT-C/400/6 IET 18591(76.93 cm) at 60 days after planting (60DAP).However, the maximum yield was recordedby RCRT-C/400/6 IET 18591 i.e.1.62 t/ha followedby Mipun (1.59 t/ha) and P3 (1.54 t/ha). The highestpercentage of increase in yield over to control(19.31%) by Mipun (local) followed by RCRT-C/400/6 IET 18591 (16.39%) and P3 (13.75%).

Performance of horticultural fruit cropsData recorded on the performance of

horticultural fruit crops planted in 2003 underFSRP. Peach recorded maximum plant height (2.75m), canopy spread (2.90m X 2.98m) followed by


guava in plant height (2.17m) and canopy spread(2.83m X 2.61m),whereas basal girth was highestin guava (20.7 cm) followed by peach (18.0 cm).Orange showed lowest growth performance. Thechlorophyll content was highest in orange (66.30SPAD) followed by peach (38.96 SPAD) and guava(32.46 SPAD). The average number of fruits/treewas produced 210 and 65 by peach and guavarespectively; however orange has not yet startedfruiting.

Peach under FSRP

Performance of MPTsData on growth parameters of 10 MPTs under

FSRP were recorded, the Eleocarpus sphaericus(Rudraksh) attained maximum height 18.44 m,basal girth 145.25 cm, breast girth 106.00 cm andcanopy spread 10.62 m X 13.37 m followed byMorus laeviegata (Bola) has plant height (7.4 m),basal girth (87 cm), breast girth (63.20 cm) andcanopy spread (9.76 m X 10.06 m).The lowest plantheight (4.3 m),basal girth 22.25 cm, breast girth15.00 cm and canopy spread (3.00 m X 2.43 m)was observed in Castanopsis indica(Kora).Whereas, the chlorophyll content was foundhighest in Ixonanthus khasiana (47.5 SPAD)followed by Mangeleitia insignis (44.0 SPAD) andEleocarpus sphaericus (41.7 SPAD).

Maintenance of bamboo germplasmBamboo germplasm of 30 species is being

maintained and morphological observations weretaken on the performance of all species of bambooplanted under FSRP. Bambusa cacherensisrecorded the maximum clump circumference(25.7m) followed by Dendrocalamus hamiltonii(18.2m), hamiltonii –Akashe ganga local-1(15.3m)and Bambusa balcoa (14.2m).The number ofculms/clump was observed highest (3000 nos.) inChimonobambusa armata[Ebum (runnertype)]followed by B.multiplex (2100 nos.) andB.variegata (1040 nos.). Individual culmcircumference was recorded highest 35.60 cm inD.hamiltonii followed by hamiltonii – Akasheganga local-1(33.00cm) and B.arundinaceae (32.33cm). The length of internodes was measured highest(55 cm) in Chimonobambusa griffithiana andlowest (12cm) in B.khasiana.Chlorophyll contentwas measured highest (46.53 SPAD) in hamiltoniifollowed by B.pallida (43.53 SPAD) and B.khasiana (42.46 SPAD), whereas the bans lochan(white powder) was more used for treatment ofasthma disease highly in asper and partially presentin Cephalostachyum pergracile, .B. variegate,B.nana, B.nutans and hamiltonii.

B.variegata under FSRP


1. Dr.R.T. Patil, Director, Central Institute ofPost Harvest Engineering & Technology,Ludhiana, Punjab

2. Dr. R.P.Tiwari, Director, National ResearchCentre for Mushroom, ICAR, Chambaghat,Solan, Himachal Pradesh

VISITORS

3. Bidyut Kr.Baruah, Regional Manager,APEDA, Guwahati, Assam.

4. Bijan Saha, Asst. Manager, NEDFi,Guwahati, Assam.


MANIPUR CENTRE


RICE

Breeding for high yielding, disease resistantquality rice for main kharif season

Twenty eight advanced lines of rice along with4 popular local checks were evaluated in areplicated advanced yield trial (AYT) for theircomparative performance under lowlandtransplanted conditions of Manipur valley. Theseentries were found to be resistant to biotic stressesand out yielded all the four checks. The entries,namely, MC-17-8-2-16-2, MC-17-8-2-16, MC-17-19-1, BR-1/Leimaphou and MC-17-30-6-12performed exceptionally well and recorded with8410, 8060, 7920, 7865 and 7625 kg/ha yield,respectively. These entries will be evaluated forquality parameters and promising ones will bepromoted for all India testing under AICRIP. Twoentries, RCM-21 and RCM-22 on the basis ofconsistency in their performance in AYT over theyears and RCRT-lowland for two consecutive years(2005 & 2006) across the locations were nominatedfor Initial Variety Trial –Medium - Hills of All IndiaCoordinated Rice Improvement Programme(AICRIP) during Kharif 2007. RCM-21 (IET20193), a derivative of Prasad/IR 24 with longslender grain and 125-130 days maturity durationranked second (5316 kg/ha) in Initial Variety Trial– Medium-Hills of AICRIP. It was found to beresistant to neck blast. Similarly, RCM-22 (IET20194) a sister line of RCM-21 with long slendergrains and medium duration out yielded Nationalcheck, Regional check and Local check withsignificant margin and ranked 4th in IVT-M(H). Itwas also found to be moderately resistant to leafblast and neck blast. On the basis of superiorperformance across different locations both theentries have been promoted to AVT1- Medium-Hill. New cultures namely, RCM-16, RCM-17 and

RCM-23 developed at ICAR Manipur Centre havealso been nominated for IVT-M (H) of AICRIP fortheir all India testing for yield and its consistencyand reaction to diseases and insect pests.

Breeding for cold tolerant and short durationrice genotypes suitable for pre-kharif season

Three hundred outstanding families of F7generation with different maturity durationsranging from 90 to 150 days having high yieldingattributes and desirable grain types have been raisedand evaluation was done for yield and reaction todiseases and insect pests. Selection was done inconsultation with farmers representing differentareas and ecologies of Manipur and more than 100lines were selected. Out of these 7 lines were earlyduration (90-105days), 11 lines were of mediumearly duration (130 days), 35 lines were of mediumduration (140 days) and 48 lines were tall (>120cm) and non-lodging type. Tall entries will be usedfor development of suitable varieties for paddy cumfish culture. All these lines will be tested inreplicated station trials during 2008. Four F2populations developed by crossing RC Maniphou-7 x Manuikharamui, Lungnilaphou x Akhanphou,Akhsnphou x Lungnilaphou and Taothabi xLungnilaphou have been raised and selection waspracticed for desirable combinations of charactersand altogether 246 plants were selected.

New crosses attemptedFollowing crosses were attempted in order to

create variability and transfer of desirable traits:IR-64 x SARS-1, IR-64 x SARS-9, IR-64 xAkhanphou, IR-64 x Wong Sim, IR-64 xLeimaphou, IR-64 x Ramyang Makrei, IR-64 xPhougak (clustered spikelets), IR-64 x PhungphaMah, Leimaphou x Wongshim Makel, Akhanphoux MC-17-34-2-1-1, Leimaphou x Chakhao amubi,Akhanphou x IR-64, Leimaphou x Yungra Makrei,Phougak (clustered spikelets) x Leimaphou,Leimaphou x Phougak (clustered spikelets) andLeimaphou x Wong Shim. F1 plants of these crosseswill be raised next season.


CROP SCIENCE


Unique rice mutant with clustered spikeletsRice plant with unique pattern of spikelets

arrangements having 3 spikelets in each cluster wasobserved during 2006 in germplasm locally knownas Phougak collected during 2005 from Yaral loukolof Top Dushera village of Imphal East District. Allthe spikelets were fertile and well filled with matureand fully developed grain. Plants were tall in stature(168 cm), early medium in maturity duration (126days) medium in tillering having long panicle (27cm) (Plate 1.). Grain of this germplasm are shortbold type with L/B ratio of <2.0. It was crossed byusing male and female with popular varietyLeimaphou and with IR-64 with the objectives tostudy the inheritance of the character and transferof the same to elite background. This trait canprovide boost to the yield by increasing thespikelets/ panicle.

Plate 1. Panicles having spikelets in clusters

Development of blast resistant linesIn a blast screening trial two advanced linesdeveloped by Manipur centre namely MC-34-7-21-15-58-49 and MC-34-7-5-2-75-33-19 came out tobe resistant to neck blast, absolutely unaffected,where susceptible lines suffered 100% with neckblast (Plate. 2). Both the resistant lines are sisterlines with differences in maturity duration, effectivetillers and yield/plant. These lines will be utilizedfor developing blast resistant varieties.

Collection and evaluation of rice germplasmOne hundred seventy rice germplasm lines

mostly indigenous collected from different partsof Manipur were evaluated and maintained at ICAR

Manipur Centre. Wide range of variation has beenobserved in respect of agronomic traits. Days tomaturity ranged from 115 days in China-1 to 160days in Taothabi and Ching Chakhao. Plant heightranged from 104cm Phou-oibi to 200cm inLangphou-phoujao. In collaboration with PlantPathologist of the centre major emphasis was givenfor screening against prevailing diseases such asblast, sheath blight and brown spot. None of thegermplasm lines was found free from brown spotand severity varied from 1 in Manukharamui to 7in a land race from Maring area of Chandel district.Neck blast incidence varied from 4.34 in Phourelto 77.55% in Leimaphou. Sheath blight incidencealso varied a lot and Phou-oibi and Drumphourecorded with score of 9. A good number of ricegermplasm which include popular Naga Wonderrice, Teke, Gum Rice etc. have been collected fromdifferent areas and details are as follow:

Name of the place No. ofgermplasms

Nagaland 143Arunachal Pradesh 11Chandel district of Manipur 7Churachandpur district of Manipur 2

Research Complex Regional Trials (RCRT)RCRT on Lowland rice

Thirteen entries including six from Manipur(RCM-11, RCM-18, RCM-19 RCM-20, RCM-21

Plate 2. Blast resistant lines (on both sides) andblast susceptible line (in the middle)


and RCM-22) along with 2 local checks i.e. RCManiphou-7 and Lungnilaphou were evaluatedunder at Lamphelpat farm to study theircomparative performance under Manipurconditions. Among these entries the genotypesnamely, RCM-21 (7856 kg/ha) and RCM-22 (7746kg/ha) could give more yield than best local checki.e. Lungnilaphou (7280 kg/ha).

RCRT Aromatic riceIn this trail 11 entries which also include 5

entries developed from Manipur centre wereevaluated for their comparative performance undertransplanted conditions at Lamphelpat farm ofICAR Manipur Centre. Five entries namely, RCM-17, AR-4, AR-3, AR-5 and RCM-16, performedwell under Manipur valley conditions and gave8510, 7066, 6926, 6533 and 6456 kg/ha yieldrespectively. On the basis of consistency in yieldover the locations and time RCM-16 and RCM-17have been promoted for All India testing.

RCRT Fine grain riceIn this experiment 7 entries of fine grain type

along local check i.e. Lungnilaphou were evaluatedunder transplanted conditions for their comparativeperformance in Manipur valley. Four entriesnamely, AR-12, IET17278, IET16313 andIET17281 performed exceptionally well andrecorded 7900, 7646, 6980 and 6810 kg/ha yield,respectively.

All India Coordinated TrialsTwenty five entries including checks in two

trials of All India Coordinated Rice ImprovementProgramme namely, IVT-M(H) (16 entries) andAVT 2-Irrigated Mid Early (9 entries) wereevaluated for their comparative performance underManipur valley during Kharif 2007. Entries viz,IET-20194 (6666 kg/ha), IET-20193 (6516 kg/ha),IET-20192 (5923 kg/ha) and IET-20190 (5860 kg/ha) of IVT-M(H) performed well and recordedsignificantly higher yield than local check. Whereasin AVT2-IME only one hybrid entry i.e. IET-18160(9773 kg/ha) recorded higher yield than hybridcheck.

Front Line Demonstrations (FLD)In order to popularize Lungnilaphou a high

yielding variety released by Manipur centre 60 FLD

were taken up in 8 districts (four valley and fourhill districts) during Kharif 2007. Seventy oneprogressive farmers belonging to 31 general, 36ST and 4 SC categories were selected inconsultation with the State Agriculture Department.Maximum average yield gain over check wasrecorded in Churachandpur (69.5%) followed byChandel (41.11%), Bishnupur (27.14%) andThoubal (20.76%).

District-wise average yield performance ofLungnilaphou and advantage over checks

Name of Districts Area FLD %variety (ha.) Yield Advant-

(t/ha) ageoverchecks

Lungnilaphou Imphal West 9.00 5.97 17.05Imphal East 10.00 5.80 18.36Churachandpur 11.00 6.78 69.50Bishnupur 9.00 6.23 27.14Ukhrul 6.00 4.94 9.77Senapati 1.00 4.55 3.41Chandel 7.00 5.08 41.11Thoubal 7.00 6.28 20.76

Total 60.00 - -


Effect of Zinc and different P sources on lowlandpaddy

The experiment was continued to optimise thezinc and P sources for an optimum yield of rainfedpaddy in the lowland with the variety RCManiphou-7. The grain and straw yield increasedsignificantly with 5 kg Zn/ha level over control andremained at par with the higher dose. Among the Psources application of DAP along with PSM(Bacillus polymixa) inoculation increased the yieldsignificantly and remained at par with ½ DAP + ½RP + PSM. The interaction was found significantfor grain yield. Under low zinc level and controlled(no Zn level) condition inoculation with PSMincreased the grain yield significantly whereasinoculation with PSM could not raise the yieldsignificantly under high Zn levels. Effect ofdifferent sources of P at each level of Zn on thefree living N fixers, total bacteria, MPN of


Azospirillum(presumptive) and ammonifiers wereenumerated, sampled at harvest. The respirometricstudies conducted in the field condition over thewhole period of crop growth showed variation inCO2 evolution under different treatment. Thecarbon dioxide evolution pattern showed increasedrespiration with increase in doses of Zn in DAPtreated soils.

Integrated nutrient management for optimumcrop productivity and soil health

The experiment was conducted with treatmentsviz., 1) Control, 2) Crop residue, 3) FYM @ 5 t/ha, 4) Biofertilizer (PSM + Azospirillum/Azotobacter) and 5) Crop residue + FYM @ 5 t/ha+ Biofertilizer and three subtreatments viz., i) 0NPK, ii) ½ NPK and iii) ¾ NPK alongwith one100 per cent NPK kept as absolute control. Thegrain and straw yield increased significantly withcrop residue and remained at par with FYM @ 5 t/ha and Crop residue + FYM @ 5 t/ha + biofertilizer( Azospirillum + Bacillus polymixa ) over controland recommended NPK. The interaction was foundsignificant for grain and straw yields.

DISEASES

Evaluation of rice germplasm against fungaldiseases

One hundred and thirteen lines / varieties wereevaluated under field conditions under the project“Rice improvement through participatory plantbreeding” for their reaction against blast, sheathblight and brown spot diseases. Nursery was sownon 11th June 2007 and 28 days old seedlings weretransplanted at 15 cm plant to plant spacing with 1seedling per hill. Terminal severity of these diseaseswas recorded as per standard scales. Neck blastincidence varied from 4.34 in Phourel to 77.55%in Leimaphou (KD 263). All the lines were freefrom leaf blast.

All the lines had brown spot infection. Thehighest disease score of 7 was recorded in a landrace from Maring followed by a disease score of 6in Kapongramah, Chingjuimakrei, Chingchakhao,SARS-1, Mhshimah, Kahaoramah, Nafamah,Phungchammah, Marakateowa, KD phoubi,

Thaothabi. Manukharmu, Sanaphou, Chakhaowhite, Dramphu, RCM-13, Chingphourel aut,Champhraphoutlou, Changphoukhongnhou,Langpkou upokpi, Paorpimadiang had lowestdisease score of 1.

In the case of sheath blight, the highest score of9 was recorded in Makharomasuto,Champhaikhougnbi, Dramphou, Prakash, and K Dphoubi. The remaining lines were free from sheathblight infection.

MAIZE


Integrated nutrient management for optimumcrop productivity and soil health

The experiment was conducted in upland maize-pea cropping system under rainfed terraceconditions at Langol Farm, with single orcombined application of crop residue, FYM, PSM,Azotobacter and Rhizobium (for maize/pea) alongwith 1/2 or 3/4th dose of inorganic fertilizers as sub-treatment. The maize and pea variety used wasMahi Kanchan and Arkel respectively.

The grain and stover yield increasedsignificantly with FYM @ 5 t/ha and was at parwith Crop residue + FYM @ 5 t/ha + biofertilizer( Azospirillum + Bacillus polymixa ) over controland recommended NPK. Maximum pod yield inpea was obtained with the combined residual effectof FYM @ 5 t/ha + biofertilizer + crop residue +¾ NPK.

PULSES

Wide hybridization for transferring insectresistance in pigeon pea

Twenty one entries of pigeon pea were collectedfrom different locations namely, ICRISAT,Hyderabad, G.B. Pant University of Agriculture andTechnology, Pantnagar and ICAR ResearchComplex for NEH Region, Umiam (Meghalaya).These entries were evaluated in replicated trials


for yield and yield contributing traits at foot hillsof Langol farm, Imphal during Kharif 2007-08. Outof 21 entries, 4 entries confirmed their superiorityby yielding 2.6–3.1 t/ha. Maximum seed yield wasrecorded in UPAS 120 (3.1 t/ha) followed by PA134 (2.87 t/ha), 124 (2.6 t/ha) and ICPL 88034 (2.85t/ha).

On the basis of agronomical traits and overallperformance under Manipur conditions 4 cultivarsof pigeon pea were selected for transferring insectresistance from wild species. Crosses amongselected cultivars and wild species were attempted.Interspecific hybrids will be grown during kharif2008 and backcrossing will done. Crosses amongincompatible combinations will also be tried withthe help of application of plant growth regulatorsduring coming season.

Collection and characterization of rice beangermplasm using morphological, SDS-PAGEand isozymic analysis

Seed storage protein profiling of 94 accessionswas done through SDS-PAGE technique.Considerable variation in relation to number ofbands of seed storage proteins was observed amongthe accessions. Isozymic analysis is also beingcarried out.

Collection and maintenance of germplasm otherthan rice

Fifty six accessions of maize collected fromUkhrul during last year have been maintained.Thirty pigeonpea lines/varieties collected fromdifferent locations have been evaluated andmaintained. Three wild species of pigeonpeanamely Cajanus scaraboides, C. platycarpus andC.ajanifolius were also collected for their use inbreeding programme.

OILSEEDS


Different methods of lime application ingroundnut and soybean

The groundnut variety ICGS 76 was tested withtwo main treatments, 1) Control and 2) Rhizobiumwith three sub-treatments in the sub-plots viz i) No

lime(L0), ii) Lime in furrows @ 250 kg/ha, (LF),iii) Lime pelleting (LP) with 400g per 10 kg seeds,at Longol Farm, ICAR. The maximum yield wasrecorded with furrow application of lime whentreated with Rhizobium (NC 92) and was at parwith Rhizobium treated pelleted seeds. The limepelleting of seeds (@400 g/10 kg seeds) could bean effective means of low doses of lime applicationto harvest yield at par with recommended 250 kgfurrow lime application, through effectiveexploitation of BNF and thus cheaper. In soybean,the maximum yield (14 q/ha) was recorded withfurrow application of lime when treated withRhizobium, while furrow liming and pelletingwithout rhizobium yielded 1.13 and 1.2 t/harespectively (control 0.83 t/ha).

Identification of suitable groundnut varieties forvarious intercropping systems

The field experiment was carried out in a splitplot design with three intercropping systems (rice+ groundnut, maize + groundnut and green gram +groundnut) in main plots and four varieties ofgroundnut (ICGS 76, TKG 19A, JL 24 and ICGV86590) in subplots replicated thrice. The highestsignificant Groundnut Equivalent Yield (GEY) of2.05 t/ha was obtained in maize + groundnutintercropping system over other two intercroppingsystem. ICGV 86590 and ICGS 76 producedsignificantly higher GEY over other varieties inrice + groundnut and greengram + groundnutintercropping system.

Organic farming in groundnutA field experiment was carried out with 8

treatments consisting of different organic sourcesof nutrients. All the treatments recordedsignificantly higher pod yield over control. Amongthe organic treatments vermicompost @2t/haproduced the highest pod yield (1.8 t/ha) and haulmyield followed by FYM @ 5t/ha. The highestharvest index was recorded with application ofrecommended dose of NPK, which wassignificantly higher over all other treatments.

Identification of confectionary / large seededtable purpose groundnut varieties

A field experiment was conducted at Langolfarm of the institute in a randomized block design


with five confectionary groundnut varieties andfour replications. Among the varieties highestnumber of pods per plant (9.06) and pod yield (2.1t/ha) was recorded in the variety ICGS 76 followedby TKG 19A and CSMG 84-1. The highest 100kernel weight (49.57 g) was recorded by the varietyTKG 19A followed by GG 20 (48.63g).

FRUITS

DISEASES

Survey and management of important diseaseof passion fruit in Senapati District, Manipur

Village Disease

Purul Sporadic occurrence of leafspot disease

Kodei -do-Puni Pfosemai -do-Pudunamei Collar rotPunanamei -do-

VEGETABLES

TOMATO

Evaluation of advanced lines of tomatoTwenty five advance breeding lines were

evaluated under valley conditions of Manipur afterkharif paddy to develop varieties for paddy fallowshaving stress tolerance. Among F10 populations theline TMC-2 recorded highest yield (34.7t/ha)followed by TMC-1 (31.9 t/ha) and TMC-10 (31.4/ha). Whereas in F11, line MCTR 7B recordedhighest yield (41.7t/ha) followed by MCTR-5(36.9t/ha). Highest number of fruits were recordedin MCTR-5 (38.4 fruits) followed by MCTR-10(29.60 fruits) indicating that some of these linesare very much potential like hybrids.

Evaluation of selectionsAmong the eight selections tested, maximum

number of fruits per plant (24.89 fruits) were

recorded in Sel.-11 followed by Sel.-7 (18.13 fruits/plant). Highest yield was recorded in Sel. 9A (42.5t/ha), closely followed by Sel. 7 (42.5t/ha). TheSelection 9A (RCMT-1) also proved its superiorityover the other lines in AICRP (V) trials and bothare also being evaluated under farmers’ conditionsat district level in Manipur.

BRINJAL

Evaluation of advanced lines for yield andbacterial wilt resistance

Thirteen lines of brinjal developed at Manipurcentre were evaluated for their comparativeperformance under Manipur conditions. Thehighest yield per hectare was recorded in Sel. 3x8A(27t/ha), followed by Sel.4x7B (23.9t/ha) ascompared to the standard check Arka Keshav(20.3t/ha).

BEANS

Collection, evaluation and maintenance of beansgermplasm

Protein extraction from mature seed andelectrophoretic parameters for seed protein profilesusing SDS-PAGE, have been perfected for both theFrench bean and cowpea. Data on presence orabsence of protein bands were recorded on gel forall the available germplasm and subjected to theanalysis in order to get similarity index. Goodamount of variation was recorded in both the beans.

Fruits of tomato Selection 9A


Further studies on correlation will be helpful toestablish the relationship between presence ofparticular protein and its effect on quality.

TUBER CROPS

Evaluation of short duration cassava varietiesSeven varieties of CTCRI along with a local

check with three replications were tested during2007 at Langol Farm. Highest tuber yield/ha wasrecorded in var.Sree Prakash (38.37t) followed byH-226 (35.56t) and H-165 (34.81t). Though, thehighest number of tubers per plant (11) and girthof the tuber (15.03cm) was recorded in H-165, thetuber yield/plant was comparatively low (2.35kg).Local collection recorded the highest vegetativegrowth but low yield (20.15t/ha).

Evaluation of orange coloured flesh sweet potatovarieties

Varietal evaluationUnder the foot hills conditions of Manipur out

of ten orange coloured flesh sweet potato varietiestested along with a local check, the highest numberof tubers per vine (4), highest weight of marketabletubers/vine (539g) and tuber yield/ha (29.99t) wererecorded in the var. Gauri.

Sensory evaluation of tubersIn the sensory evaluation of tubers of different

genotypes, the taste and overall acceptability washighest in Acc. No. 420027 with 4.7 and 3.9 pointsfollowed by Acc. No. ST-14 with 3.5 and 3.7 points,respectively. Similarly, the consistency was alsohighest in Acc. No. 420027 with 3.9 points.

Evaluation of clonal selection of colocasiagenotypes suitable for Manipur conditions

Four clonal selections from local genotypes ofColocasia along with the var. Muktakesi wereevaluated. The highest yield of marketable tubers(28.49t/ha) were recorded in the RCMC – 3(selected from Chingpal) followed by 24.36t/ha inRCMC – 2 (selected from Palgong). Low infectionof leaf spot was observed in both selections.

Performance of Colocasia genotypes underManipur conditions

Genotypes Plant No. of No. of Yieldheight leaves/ rhizomes/ (kg/ha)(cm) plant plant

RCMC – 1 77.46 19.24 5.48 1822RCMC – 2 52.57 12.15 2.45 2436RCMC – 3 62.20 11.94 2.33 2849RCMC – 4 66.93 16.83 5.36 1656Muktakesi 69.00 17.00 5.00 1515

Studies on the effect of spacing and fertilizermanagement in yam (Dioscorea alata) intercropped in agro-forestry

Intercropped under tree bean (Parkiaroxburghii)

Highest tuber weight/vine (1500g) was recordedin 90x90cm spacing followed by 75x75cm (1385g)and 60x60cm (940g) indicating that tuber size hasincreased as the spacing was increased. However,highest tuber yield/ha was recorded in 60x60cmspacing (25.1t) followed by 75x75cm and 90x90cmindicates that the increase of tuber size due to widerspacing could not be reflected in tuber yield/ha dueto higher number of plants.

Intercropped under agro-forestryThe results revealed that the tuber weight and

tuber yield/ha were increased as the increase in thefertilizer dose indicated that yam has respondedwell to the fertilizer dose. Similarly, highest tuberyield/ha (19.1t) was recorded at 60x60cm spacingfollowed by 90x90cm (15.4t) and 75x75cm (14.1t).

MM-1

Technology Mission for integrated developmentof horticulture for north eastern states, Sikkim,Jammu & Kashmir, Himachal Pradesh andUttaranchal

Standardization of production and protectiontechnologiesVarietal evaluation of passion fruit

Six accessions of passion fruit viz., Purple(Manipur local), Sikkim local, Giant granadilla,


Meghalaya local, Kaveri (Hybrid), Exotic andPhilippines were collected and planted at LangolFarm during August, 2004 for evaluation under hillslopes as rainfed crop. Highest yield (13.42t/ha)was recorded in var. Kaveri (Hybrid) closelyfollowed by ‘Yellow’ a derivative population ofvar. Kaveri (12.62t/ha).

Bamboo drip in passion fruitExperimental results revealed that 3 lit. water

per bamboo once in three days can safely keep theplants alive under the foot hill conditions ofManipur without much affect due to coldtemperatures. Fruit yield of 13.45t/ha was recordedin bamboo dripped plants of Kaveri as comparedto 11.12 t/ha in untreated control.

Spacing trial in passion fruitIn conformity with the previous years results

spacing of 3x2m was found optimum for Passifloraedulis on the slopes with a yield of 7.2 t/ha in LocalPurple and 3x3m for Kaveri with a yield of 11.4 t/ha. In terraced slopes, 2x4m spacing intercroppedwith turmeric and ginger recorded highest yield(12.7 t/ha) with var. Kaveri as compared to 7.5 t/ha in Local Purple. Kniffin system of trainingwithout intercrop and telephone system of trainingwith intercrop were found best suitable on hillslopes.

Effect of mulching and INM on the yield andquality of pineapple

In an experiment with polymulch, drygrassmulch and control (without mulch) as main plot

factors and FYM, vermicompost and biofertilizersas sub plot factors during July 2004 in order tostudy the effect of mulching and integrated nutrientmanagement on pineapple. Evaluation of the ratooncrops indicated that the days taken for the harvestof third ratoon crop was the shortest (258days) inuntreated plots than those mulched with grass(285days) and polythene mulching (292 days).With respect of types of manures tried, the earliestflowering was observed in Azospirillum (260days)and the longest duration for flowering invermicompost (274days) treated plots. The highestyield was recorded in polymulch (49t/ha) whichwas followed by grassmulch (44t/ha) and non-mulched plot (42t/ha). Similarly, higher yield wasrecorded in Azospirillum treated plots (44 t/ha)followed by FYM (43.5 t/ha) and Azotobactor (43t/ha).

Kiwi introduction, evaluation andstandardization of production technology

Five kiwi varieties viz. Allison, Bruno, Monty,Abbott and Hayward were evaluated at fourlocations. No flowering was observed under thefoot hill conditions of Imphal (800m above msl).This may be due to non compliance of theminimum requirement of chilling of kiwi forflowering.

Hardwood cuttings treated with a mixture ofIBA (2500ppm) and NAA (2500ppm) solution for30 seconds under intermittent mist for 2-3 minutesevery 20 minutes interval in a day with sand, farmyard manure and soil as rooting media gave 70 percent success.

Production of quality seed/planting material

Crop Target Target

Citrus seedlings (Khasi mandarin and Kachai lemon) 15000 14,355Passion fruit rooted plants var. Kaveri 2000 2,997Tomato seed 1000g 1,265gFrench bean 100 kg 75kgStrawberry 2000 plantlets 390 plantletsMushroom spawn packets 10000 packets 5,350 packetsBanana suckers plants 20000 plantlets 1,600 plantlets*Turmeric var.Megha Turmeric-1 15000 kg 1,600kg

*The work will be initiated as the power supply position has improved recently


Assessment of post harvest analysis

Physico-chemical analysis of passion Fruit

Particulars Kaveri Purple(Hybrid)

1. Weight of fruit (g) 66.95 26.622. No.of fruits/vine 116 1723. Yield/ha (t) 12.89 7.604. Acidity (%) 5.45-6.12 4.33-5.025. Ascorbic acid (mg/100g) 20.12-22-35 22.56-35.626. Reducing sugar (%) 4.71-5.05 4.29-6.047. Total sugar (%) 5.33-6.40 5.28-6.688. Non-reducing sugar (%) 0.97-1.35 0.55-1.089. TSS 0 Brix 13.40-15.50 13.50-14.7010. Juice content (ml/fruit) 36.50-68.50 10.00-15.00

Turmeric: Analysis of curcuminSamples from different districts of Manipur

were collected for the analysis of curcumin contentand the work is under progress.

Citrus: Fruit quality evaluation

Parameter Kachaim Khasilemon mandarin

1. Polar diameter (cm) 5.32 5.652. Equatorial diameter(cm) 5.01 6.463. Fruit weight (g) 79.93 114.854. Juice content (ml) 27.29 44.45. Juice (%) by weight 31.15 38.76. T.S.S. (%) 8.44 12.067. Acidity (%) 6.11 0.888. Ascorbic acid (mg/100g) 47.50 14.549. pH 2.89 3.9510. Rind thickness (mm) 3.49 3.0911. No. of seeds/fruit 11.3 16.6

Training and demonstration

Citrus rejuvenation programmeThree programmes were taken up (2-4 April, 07,10-12 April, 07 and 21-23 January, 08) under theTechnology Mission (Horticulture) project in twodistricts of Manipur viz., Tamenglong and Ukhrulwhich are the major citrus growing areas.Altogether 100 ha were covered under theprogramme in ten different villages. From eachvillage 16 farmers were selected with the help ofvillage development authority and they were

trained in various aspects of citrus rejuvenation andmaintenance of orchards. Demonstrations wereconducted and critical inputs were given to all theselected growers. The impact of this programme isvery impressive, thereby many village authoritieswhere Khasi mandarin is growing and decline is aproblem are approaching for similar programmesin their villages.

Training on citrus rejuvenation

AGROFORESTRY

National Network on Integrated DevelopmentJatropha (Sponsored by NOVOD Board)

Survey and collection of superior plantingmaterials (Seeds and cuttings)

Local survey was conducted and eight newaccessions were collected in addition to the existingsix accessions of previous year and the details ofcollection are given below. The seed oil content ofJatropha accessions MNJ-01 to MNJ-14 analysedat TERI, New Delhi and MNJ-01 to MNJ-06 atNBPGR, New Delhi. The survey in differentdistricts indicated large variation in the germplasm.Out of 14 accessions analysed so far, twoaccessions (MNJ 001 and MNJ 006) showed morethan 40% seed oil content. This indicates that thereis a good scope for exploitation of superioraccessions of Manipur for further improvement.

Seed characters of different accessionsSeed characters of different accessions were

studied . Among various accessions, the seed length


varied from 15.08mm in MNJ-013 to 18.38 mm inMNJ-015. The average breadth of seed ranged from9.80mm in MNJ-013 to 11.19mm in JIP-02. Theseed thickness was the maximum in MNJ-014(9.23mm) and the minimum in MNJ-013(7.37mm). With respect to the weight of seeds,MNJ-003 recorded the maximum value of 80.06gand the minimum by MNJ-011(47.5g).

Progeny trialAltogether 13 progenies were raised under this

trial during July, 2006 which includes two localaccessions (MNJ-002 and MNJ-005), four eachfrom Jabalpur and Jammu, two from Pantnagar andone accession from DOR, Hyderabad. The data ongrowth parameters reveals that Jatropha accessionNo. DOR recorded the highest collar diameter(40.63mm) followed by TFRI-04 (38.93mm) andPJ-02 (38.73mm) while maximum number ofbranches per plant were recorded with PJ-01 (3.4)followed by PJ-02 (3.2).

Multilocational trial

National network trialAltogether four accessions from Jabalpur and

two accessions from Pantnagar were obtainedunder the national network trial and planted at aspacing of 3x3 m in three replications during Aug.,2006. At eighteen months after planting themaximum collar diameter was observed in PJ-01(30.60mm) followed by PJ-02 (29.34mm).Similarly highest number of branches was recordedin PJ-01 (4.30) followed by PJ-02 (3.5).

Zonal trial (Zone - I)The trial with six accessions was taken up

during Aug., 2006. After 18 months of planting theresults on growth parameters shows that highestCollar Diameter (47.04mm) and number ofbranches per plant (4.3) were recorded inAcc.No.PJ-01 followed by PJ-02 (42.34mm and3.5, respectively).

Multilocational trialThe trial was taken up during July, 2007 at

Langol farm on hill slopes at an elevation of 800mabove mean sea level with ten superior accessionsobtained from different centres in India. The growth

parameters on these accessions were recorded.Collar diameter ranged from 18.15cm (var.JawaharJatropha) to 23.90cm (JPL-103). Similarly the plantheight ranged from 19.00cm (MPJ-55) to 28.3 cm(JA-9).

Propagation techniques

Propagation through stem cuttingsTreatment with different rooting hormones was

tried in stem cuttings of accessions namely MNJ-002, MNJ-004 and MNJ 005 for 24 hour duration.The experiment showed that treatment with 50 BAwas effective in obtaining cent percent sproutingin apical as well as basal cuttings.

Propagation through seeds: Standardization ofpotting mixture composition

Eleven different combinations of pottingmixture were tried. The results indicated that after60 days of sowing, the maximum seed germinationof 54.29 per cent was obtained with soil + FYM at1:1 ratio and the lowest (25.71%) in soil + sand +FYM at 1:1:1 ratio and sand + FYM at 1:1 ratio.

Effect of pre-treatments on seed germinationand growth of Jatropha

The results showed that, among the various pre-treatments, untreated seeds resulted in themaximum germination percentage over all theperiods of observation which was followed byseeds treated with 20ppm GA3. This could beattributed to the release of phenolic compoundswhile soaking the seeds with water or othersubstances which in turn could have interfered withthe germination.

Studies on germination of seedThe percent germination of seed was maximum

(76.62) on 30 days after sowing irrespective of thepre-treatments given. Thus, it can be inferred thatthe time required for maximum germination ofjatropha seeds is 30 days.

Package of practicesStandardization of spacing for rainfed conditionon hill slopes

In order to standardize the spacing requirementof jatropha, an experiment with three spacing (2m


x 3m, 3 m x 3 m and 3m x 4m) was taken up on 2local accessions MNJ 002 and MNJ 005. Theexperimental results revealed that MNJ 005 spacedat 3m x 4m gave highest fruit yield of 68.76 kg/ha.The maximum seed yield (31.47 kg/plant) wasfound again with MNJ 005 spaced at 2m x 3m, atpar with MNJ 005 at 3m x 4m spacing.

INSECTS AND PESTS

Studies on insect pests and diseases of Jatrophacurcas

Incidence of mosaic disease in jatropha

District Place Incidence(%)

Imphal West Langol 74.55Imphal East Keirao wangkhem 10

Maibing Kom 5.2Senapati Oklong Khunou 7.8

Karong 5.7

In the jatropha plantation at the farm, theAgeratum conyzoides weed was infected with veinyellowing virus. The virus present in Jatropha andAgeratum was identified as a Begomovirus.

DISEASES

Incidence of powdery mildew and virusinfection in jatropha at Langol farm, ICAR

Acc. no. Total No. of No. of plantsno. of plants infectedplants infected

with powdery virus &virus mildew powderyonly mildew

MNJ002 79 6 15 49(7.59%) (18.98%) (62.02%)

MNJ005 78 10 2 53(12.82%) (2.56%) (67.94%)

AGRICULTURAL ECONOMICS

An economic evaluation of aquaculture basedfarming systems in Manipur

Studies on yield gap analysis among thedifferent aquaculture based farming systemsindicated that under fingerling production theoverall yield gap of the sample farmers was 3.35lakhs per hectare. The yield gap between potentialyield and average yield under seed production washighest for the credit and trained farmers. The sametrend was found for composite fish culture. Itindicates that training alone could not increase theproductivity of fish seeds and composite fishculture in the absence of sound institutional credit.

Under paddy cum fish culture, the overall yieldgap of the sample farms was found to be 625 kgper hectare which was about 24.43 per cent of thepotential yield. Thus to integrate fisheries andagriculture, multi-sectorial integration betweenvarious government agencies involved in fisheriesand agriculture is essential. The various sub-sectorsin agriculture need to recognize paddy cum fishfarming as a distinct and viable farming systemthat farmers can choose to adopt wherever thephysical conditions are appropriate. Properguidelines should also be in place to safeguard thatthe fish culture component not be overdone to thedetriment of rice production.

Problems and constraints of aquaculture inManipur

Problems and constraints Respondent

Loss due to flood 70%Poor quality of water 65%High cost of construction and 93%maintenance of ring bunds/pondsLack of institutional credit 95%Lack of scientific fish culture 87%Non-availability of fingerlings 30%of desired sizeLoss due to drought 12%Loss due to low temperature 8%Loss due to diseases 5%Lack of marketing facilitates nil

Marketing of fish is at all not a problem inManipur. Thus, for increasing fish production in


the state the following policy implications arenecessary. Necessary training on scientific fishproduction will help in improving productivity andreduce yield gaps. Widespread introduction of rice-fish concepts to communities, coupled withdemonstrations in farmer’s own fields, and linkingof the rice-fish approach with the Krishi VigyanKendras is likely to result in sustained adoption.The fisheries agencies will need to put furtherefforts in the establishment of viable state fish seedproduction and distribution system operated byprivate sector so that fingerling of the desiredspecies and size are readily available to the farmers.Thus, each district should have hatchery andnursery for fingerlings production. Institutionalcredit facilities can be extended for pondconstruction, maintenance and fingerlingsprocurement. Flood management and engineeringefforts should be made to avoid losses due torecurrent flood and water seepage in the area.

Socio-economic analysis of agricultural systemsin the hillside areas of Churchandpur,Tamenglong and Chandel districts, Manipur

The land use system indicated that 16.94 percent, 8.3 per cent, 52.38 per cent , 13.23 per centand 2.13 per cent of the operational area were underwetland paddy, terrace, jhum, fruits and forestplantations respectively. The overall croppingintensity came out to be 98 per cent. Theproductivity of Jhum rice and wetland rice were1.2 tons and 2.4 tons respectively. King chilly wasfound to be an important cash crop in the studyarea which could realize average gross returns ofRs.50, 000 to 70,000 per hectare. Pigs and poultryare the important animals of the district whichconstituted about 80 per cent of the total livestockpopulation. Indigenous breeds of both poultry andpigs are mostly rear in the village which needsattention for improvement.

The income distribution analysis indicated thatmajority of the households fall under the poor andvery poor category (65.03%) followed by mediumcategory (30.06%) while rich category householdformed only 4.91% of the total households.

Livelihood analysis indicates that agricultureis the major source of income for the farmer of thevillage except the rich category households asevident from its share of total income i.e. medium

(82.17), poor (55.36%) and very poor (55.54%).For rich category households income from off farmincome including service and business contributeda lion’s share of 77.48% and thus, income fromagriculture being 22%. The medium, poor and verypoor category households depends mostly oncasual labour and selling forest products tosupplement their meager agriculture income forlivelihood. None of the household in the villagepractice small scale industry as source oflivelihood. The average annual income ranged fromRs.19555.00 in very poor category households toRs.133050.00 under rich category households.Expenditure on food items constituted a majorshare in the total expenditure followed by children’seducation and clothing. It reveals that children’seducation is considered as priority irrespective oftheir wealth status which is a positive sign. Theover all livelihood analysis indicated that about95% of the household are under poverty linebecause of the practice of subsistence farming.

SEED TECHNOLOGY

Feasibility study on scientific production andstorage of farmers’ saved seed in major crops

The quality of farmers’ rice seed undertreatment (supervision) in the valley districts werefound superior over their neighbours’ saved seeds(check) (Table 1). The off types present were aslow as 0.6% as compared to 26..5% in the check(neighbours’ field). The obnoxious weeds werevery high (16.75%) in the checks while it wasweeded out (not found) in plots under treatment.240 rice seed samples collected during the year1996-97 from all the districts were found to contain15.6-28.7% off- types, 12.6-26.4% weed seeds and14.7-27.5% diseased seeds.

Rabi maize for seed production as time isolationat farmer’s field

In maize (var.Pusa Composite-3) the seedsunder time isolation in farmers’ (rabi sown) fieldswere able to maintain purity of 86.33% after 2sowing seasons as compared to that of 64.23% inthe neighbours’ plots under summer/kharifplanting. 28 kg of basic seeds of rapeseed M-27


was purified in the ICAR farm of Manipur centreto be given for time isolation for checking crosspollination by insect (bees) started under farmers’conditions.

Table 1. Quality of farmers’ own produced riceseeds under supervision andneighbours’ seeds in two valley districtsof Manipur

Standard (Indian Seed under Neighbours’minimum treatment seedstandard) (supervision)

Pure seed (98%) 99.80% 94.12%Inert matter (2.5%) 0.54% 17.04%Weed seed (10/kg) 1.8 25.22Germination (80%) 86.54% 82.12%Moisture content (%) 12.54% 13.43%

Seed storage in charcoal desiccated beans atfarmer’s condition

In farmers’ conditions, seeds stored under thecharcoal desiccated bins were found superior tothose stored under ambient conditions. Seedmoisture remained low at 9.1% moisture (w/w) inmaize (as against 13.6% under ambient conditions)and 9.02% in rice (vs.12.6%). Seed germinationwas retained at 80.5% after 20 months in rice(02.12% in ambient) and 76.22% (vs.00.0%) inmaize. In rapeseed M27, moisture content was6.4% and germination was 86.48% (vs.65.33%).

Maintenance breeding of locally released/recommended varieties of important crops

Rice varieties being released from this centreare being maintained through panicle row selection

and basic seeds are being produced every year.Seeds were supplied to the certified seed growersthrough the Agriculture Department, Manipur. Pre-kharif rice varieties, viz., RC Maniphou-4 and RCManiphou-5, panicle rows were raised from the lastyears’ selected row. For kharif varieties viz., RCManiphou-6, RC Maniphou-7 and Lungnilaphou,seed crops were raised and true to type panicleswere selected.

During the year 2475kg basic seeds ofLungnilaphou, 2585kg of RC Maniphou-7, 848kgof RC Maniphou-6, 715kg of RC Maniphou-5 and825kg of RC Maniphou-4 were produced underdifferent classes of seeds. In maize, Pusa MaizeComposite 3, sixth generation maintenance wascarried out by raising in the winter (December) astime isolation. The purity was maintained andselections were made for true to type plants.

Seed Storage: Use of botanicals in seed storageLocally harvested seeds of rice, maize, soybean

and rapeseed treated with the plant powders at 4g/kg seed were stored under both ambient andcharcoal desiccated conditions. Seed stored underdesiccated conditions showed superior both withand without treatments up to eight months ofstorage. Charcoal desiccation could reduce seedmoisture content to 1.5 to 2% thereby maintaininggermination.

Seeds under the desiccated conditions were freefrom insect and seed fungi. At 20th month ofstorage, the viability remained at 84.23% in rice,78.65% in maize, 86.0% in rapeseed and 78.5% insoybean. After 14 months of storage under ambientconditions, the seeds lost viability below thecertification standards.

Table 2. Mean germination per cent and seedmoisture content after 20 months ofstorage under charcoal desiccated andambient conditions

Crop/ Variety Charcoal Ambientdesiccated

Rice: Maniphou 7 84.23%(10.9)* 32.85 %( 12.65%)Maize: PMC 3 78.65%(11.23%) 2.50% (12.80%)Soyabean: JS335 78.50% (9.25%) 0.25 %( 10.2%)Rapeseed: M-27 86.52% (8.7%) 98.00 %( 7.25%)

* Per cent moisture content (w/w)


Development of seed production packages ofmajor crops in north east

In a study to develop suitable Seed Productiontechnologies in major crops of the region, seedcrops of six different crops viz., rice, maize,rapeseed, pea, soybean and groundnut were raisedwith recommended varieties. In rice, four varieties,viz., RC-Maniphou-7, RC-Maniphou-6 andLungnilaphou were taken for Kharif and RC-Maniphou-4 and RC-Maniphou-5 were taken forpre kharif season. In Maize, composite varieties,Pusa Composite 3 and Navjot were taken. In pea,varieties Rachana and Arkel, in soybean, JS-355,in rapeseed, M-27 and in groundnut, ICGS-76 weretaken. Treatments were initially taken up for sowingtime, isolation time, rouging frequencies, selectionin maize and rapeseed, maturity and harvest stages.

FISHERIES

Studies on the effect of various inducing agentsin breeding performance of Asian catfish(Clarias batrachus (Linn.) in Manipur valley

An experiment was conducted to induceovulation in Asian catfish, Clarias batrachus by asingle injection of Wova FH. The highest numberof eggs was stripped after 26h of post injection of1.0 ml Wova FH kg -1 body weight of female. Thefertilisation and hatching percent of eggs hadsignificantly increased with increase in latencyperiod to 25h at a dose of 1.0 ml Wova FH kg -1

body weight. The latency period of 25h and doseof 1.0 ml Wova FH kg -1 body weight of femalewas found to be suitable to obtain best spawningperformance and good quality eggs and larvalproduction in Clarias batrachus. The fertilizationof egg was 58 % and hatching of 45% with thisdose. Incubation period was more than 35 hours.

Studies on the comparative efficacy of Ovaprimand Ovatide in induced breeding of Labeo bata(Hamilton) in Manipur

Induced breeding of the Indian minor carp,Labeo bata (Ham.) was conducted using synthetic

hormones Ovaprim and Ovatide in three intensitylevels. It was found that, all the intensity levels ofhormones Ovaprim and Ovatide could enhance thefishes to breed and lay eggs whereas no breedingwas observed in control set. The latency period wasfound to be 7-8 hours. The egg output / female washighest with Ovaprim at a dose of 0.5 ml/kg offemale and 0.2 ml/kg of male body weight and withOvatide at a dose of 0.4 ml/kg of female and 0.2ml/kg of male body weight. The number of eggsreleased by the female (40-45g body weight) wasranged from 3500 to 4000. The oocyte diameterwas found to be 3.5 ± 0.5 mm in size. Fertilizationrate and hatching rate was found to be 55.7 ± 1.50% and 53.42 ± 2.31% respectively with Ovaprimdose of 0.5 ml/ kg of female and 0.2ml/kg of malebody weight and 52.3 ± 1.50% and 51.48 ± 2.11 %respectively with Ovatide dose of 0.4ml/ kg offemale and 0.2ml/kg of male body weight. Incomparison, Ovaprim showed better efficacy thanOvatide in producing more numbers of hatchlings.

Labeo bata embryo development at 27 0C: (A) 2hpost fertilization (pf), (B) 13h pf embryo prior to

hatching, (C) Just hatched out larva (3.8 ± 0.2mm)

Studies on the genetic diversity and species-specific DNA markers of five species of Puntiusin Manipur

The genus Puntius Hamilton comprises a groupof species of the Cyprinid family, which are

ANIMAL SCIENCE


commonly known as barbs. About 14 species ofPuntius are reported from Manipur. The geneticvariation and phylogenetic relationship betweenfive Puntius sp. namely P. bizonatus, P.manipurensis, P. sophore, P. chola and P. jayaramifound in Manipur are under study using RAPD-PCR with primer OPC-05 (lane 1-10) M- 100 bpDNA ladder.

RAPD profile of 10 individuals of P. sophore

M 1 2 3 4 5 6 7 8 9 10

Training on induced breeding of Magur(Clarias batrachus)

TRANSFER OF TECHNOLOGY

The sweet potato variety Gauri has beenidentified as superior genotype for tuber yield underthe foot hill conditions of Manipur. The vinecuttings of these genotypes were supplied to thefarmers of three villages in Chandel district ofManipur on a seed village concept and the resultsare very encouraging

Front Line Demonstrations

Sl. Crop Farmers Area(No.) (ha)

1. Groundnut 35 5.52. Soybean 13 2.53. Black gram 13 2.54. Rice (Kharif) 21 150.05. Rice (Pre-kharif) 25 11.36. Hybrid cabbage 20 4.07. Garden pea 4 1.08. Onion 15 3.09. Tomato 8 1.010. French bean 5 0.511. Bhindi 5 1.012. Fishery 21 9.013. Home science 11 1.0

(Weaning diet)14. Animal Science 7 -

Total 203 192.39Imphal West

Discipline PF RY EF Total Participants Venue

M F Total On Off

1. Agronomy/Extension 8 2 1 11 158 40 196 4 72. Horticulture 4 1 1 6 62 101 163 2 43. Fishery 5 6 1 12 371 102 473 9 34. Home Science 6 3 2 11 4 143 147 9 25. Animal Science 3 1 0 4 60 32 92 4 0Total 26 11 5 43 655 418 1071 28 16




1. Groundnut 12 3.02. Soybean 7 2.03 .Black gram 8 5.04. Rice (Kharif) 7 9.05. Hybrid cabbage 10 1.06. Garden pea 8 5.07. Tomato 4 0.18. French bean 10 1.09. Bhindi 10 0.510. Mustard 5 5.011. Broadbean 2 0.512. Brinjal 5 0.113. Home science 10 -14. Animal Science 10 -

Total 108 32.20

Chandel



1 Rapeseed 10 5.02 Field pea 20 2.03 Rice 15 5.04 Cabbage 15 6.05 Garden pea 6 2.0

Total 66 20

Churachandpur


M F Total On Off

1. Soil science 7 1 8 11 98 81 179 1 72. Horticulture 10 - 11 16 126 80 206 8 33. Fishery 4 1 6 10 94 46 140 4 24. Animal science 9 1 10 14 114 96 120 8 25. Home science 9 1 10 18 6 183 189 6 46. Plant pathology 6 1 8 11 134 76 210 5 37. Extension 6 - 8 10 39 116 155 8 -Total 51 5 61 90 611 668 1279 40 21


M F Total On Off

1. Plant Breeding 180 15 15 14 97 113 210 2 122. Horticulture 260 50 10 17 140 180 320 3 143. Animal Science 240 20 20 14 113 167 280 1 134. Home Science 200 70 40 16 15 295 310 6 105. Agril. Engineering 200 20 - 12 210 10 220 1 116. Agril. Extension 120 40 45 11 125 80 205 8 -

Total 1200 215 130 84 700 845 1545 21 60


Research articles1. Raychaudhuri, M and Raychaudhuri, S.

2007. Rhizobium inoculation and furrowliming on the yield and nutrient uptake ofgroundnut (Arachis hypogaea) in an acidhill Ultisol. Journal of Indian Society ofSoil Science. 56. 76-79.

2. Datta, K.K., Mandal, S., Tripathi, A.K. andSingh, S.B 2007. Retrospect and prospectof Food Security in North Eastern Hillyregion of India. Agricultural Situation inIndia: Vol. LXIII (10): 37-49.

3. Ganeshkumar, Joshi, P.K., Datta, K.K. andSingh, S.B. 2008. Assessment of EconomicLosses due to Avian Flu in Manipur state,Agricultural Economic Research Review21: 37-47.

Abstracts1. Raychaudhuri Mausumi , Raychaudhuri, S.,

Das, S. N., and Sarkar Dipak 2007. SoilAcidity and Micronutrient status of Manipurvalley and foot hills. Proceedings, NationalSymposium on Soil Science Research:Retrospect and Prospect in the context ofenvironmental quality and food securityduring 7-9 December 2007, pp 101.

2. Raychaudhuri, S. and RaychaudhuriMausumi. 2008 Organic Farming to ReduceGreenhouse Gases Mitigating GlobalWarming. Abstracts, XI Manipur Sciencecongress, held at Manipur University,Canchipur, Imphal during 28-30 March,2008. pp 61.

3. Raychaudhuri Mausumi, Raychaudhuri, S.and Panda, B. B. 2008. Integrated nutrientmanagement in lowland paddy for optimumcrop productivity and soil health. Abstracts,XI Manipur Science congress, held atManipur University, Canchipur, Imphalduring 28-30 March, 2008. pp 80.

4. Raychaudhuri Mausumi and Raychaudhuri,S. 2008. Effect of P sources and phosphatesolubilisers under varied Zn level on yieldattributes, yield and nutrient uptake by paddy

grown in lowlad acid soils. Abstracts, XIManipur Science congress, held at ManipurUniversity, Canchipur, Imphal during 28-30March, 2008. pp 80-81.

5. Bhadana V. P., Singh Jogendra , Sharma P.K. and Singh I. Meghachandra 2007. RiceGenetic Resources of Manipur and ItsUtilization: Past, Present and Future.(Abstract). Workshop on “Rice and FoodSecurity” organized by Government ofNagaland, SASRD, Medziphema and ICARResearch Complex for NEH Region,Nagaland Centre, Jharnapani at Dimapur,Nagaland from 12th – 13th December, 2007.

6. Sharma P. K., Sangle U. R., Bhadana V. P. ,Singh J. and Singh I. M. 2007. BlastDisease-A Real Threat to Rice ProductionSystem in Manipur. (Abstract). Workshop on“Rice and Food Security” organized byGovernment of Nagaland, SASRD,Medziphema and ICAR Research Complexfor NEH Region, Nagaland Centre,Jharnapani at Dimapur, Nagaland from 12th

– 13th December, 2007.7. Amongla C., Singh Jogendra, and Bhadana

Vijai Pal. 2007. Studies on genetic variabilityand character association in rice bean.(Abstract). National Symposium onLegumes for Ecological Sustainability:Emerging Challenges and Opportunities atIndian Institute of Pulses Research, Kanpur,from 3rd-5th November, 2007.

8. Bhadana V. P., Singh Jogendra , Sharma P.K. and Singh I. Meghachandra. 2007. RiceGenetic Resources of Manipur and ItsUtilization: Past, Present and Future.(Abstract). Workshop on “Rice and FoodSecurity” organized by Government ofNagaland, SASRD, Medziphema and ICARResearch Complex for NEH Region,Nagaland Centre, Jharnapani at Dimapur,Nagaland from 12th – 13th December, 2007.

9. Singh I. Meghachandra, Bhadana V. P. ,Singh S. B. and Ngachan S. V. 2007. QualityImprovement of Own Saved Seeds for

PUBLICATIONS


Increased Rice Productivity. (Abstract).Workshop on “Rice and Food Security”organized by Government of Nagaland,SASRD, Medziphema and ICAR ResearchComplex for NEH Region, Nagaland Centre,Jharnapani at Dimapur, Nagaland from 12th

– 13th December, 2007.10.Pattanayak A., Annadurai A., Pal Vijai and

Das S. P. 2007. Production and Productivityof Rice in North East India: Status andConstraint Analysis. (Abstract). Workshopon “Rice and Food Security” organized byGovernment of Nagaland, SASRD,Medziphema and ICAR Research Complexfor NEH Region, Nagaland Centre,Jharnapani at Dimapur, Nagaland from 12th

– 13th December, 2007.11.Sharma P. K., Sangle U. R., Bhadana V. P.,

Singh J.and Singh I. M. 2007. Blast Disease-A Real Threat to Rice Production System inManipur. (Abstract). Workshop on “Rice andFood Security” organized by Government ofNagaland, SASRD, Medziphema and ICARResearch Complex for NEH Region,Nagaland Centre, Jharnapani at Dimapur,Nagaland from 12th – 13th December, 2007.

12.Behera B. K., Bhadana V. P., Singh I. M.and Prakash N. 2007. Studies on Paddy-cum-Fish Culture System in Hills of Manipur.(Abstract). Workshop on “Rice and FoodSecurity” organized by Government ofNagaland, SASRD, Medziphema and ICARResearch Complex for NEH Region,Nagaland Centre, Jharnapani at Dimapur,Nagaland from 12th – 13th December, 2007.

13.Narsimha Rao B., Kumar Sunil K., JhaAnjani Kumar and Roshan R.K. 2007. Effect

of mulching and INM and quality on theyield and quality of pineapple. In. Book ofAbstract: Second Indian HorticultureCongress 2007, Horticultural Society ofIndia, New Delhi. pp. 148

14.Narsimha Rao B., Sunil Kumar,K. 2007.Evaluation of Orange fleshed Sweet Potao(Ipomea batatas (L.) LAM) for growth andtuber yield under Manipur conditions. In.Book of Abstract: Second IndianHorticulture Congress 2007, HorticulturalSociety of India, New Delhi. pp. 182-183

15.Ngachan S.V. and Narsimha Rao.B. 2007.Potentials in Cultivation andCommercialization of Passion fruit(Passiflora edulis) in the North East. In.Book of Abstract: Second IndianHorticulture Congress 2007, HorticulturalSociety of India, New Delhi. pp. 301

16.Narsimha Rao B., Jha Anjani Kumar andSingh I.M. 2008. Sweet potato in hill farmingsystem for sustainability and food security.In. Book of Abstract: National Conferenceon Biodiversity Conservation andSustainable Development, NagpurUniversity, Nagpur-440033, Maharashtra.pp. 92

17.Singh I.M., Narsimha Rao B. and NgachanS.V. 2008. Low cost short term seed storagetechnique for conservation of crop diversity.In. Book of Abstract: National Conferenceon Biodiversity Conservation andSustainable Development, NagpurUniversity, Nagpur-440033, Maharashtra.pp. 115


MIZORAM CENTRE


The maximum average temperature (29.6ºC)was recorded in the month of May and theminimum average temperature (14.6ºC) in January,2007. However, the 5th May was observed as thehottest day of the year with a temperature of 34.0ºCand 17th January was the coldest one with atemperature of 11.8ºC. The maximum relativehumidity 88.2% was observed in July and theminimum 39.6% was recorded in March. The totalannual rainfall recorded during 2007 was 3698 mmwith 156 rainy days. The maximum rainfall of718mm and rainy day (26) was recorded in themonth of August. The maximum rainfall, recorded

in a single day was 108 mm, on 2nd September 2007.Daily weather data viz., temperature (maximum

and minimum), relative humidity (maximum andminimum), wind direction, rainfall and cloudinesswere recorded and the data were sent to IndianMetrological Department, Pune for mathematicalmodel. The weather conditions were predicted fornext four days and a copy out put data were sentback to the centre. Based upon the weatherforecasted, agriculture operation in and aroundKolasib were released as bulletin from the centreto the farmers.

WEATHER

Table 1. Mean monthly weather parameters of ICAR Mizoram Centre, Kolasib, Mizoram for theyear 2007

Month Temperature(0C) Relative humidity Total rainfall No of rainy(mm) days

Min. Max. Min. Max.

January 14.6 21.2 49.8 62.5 - -February 16.8 23.2 51.5 63.7 80.0 6.0March 19.5 26.8 39.6 59.0 30.0 3.0April 21.2 28.2 57.8 71.5 309.5 14.0May 23.1 29.6 62.3 74.1 403.0 16.0June 23.2 28.5 68.0 77.0 670.0 19.0July 22.9 27.4 80.4 88.2 395.5 26.0August 23.1 28.8 75.5 88.1 718.0 26.0September 22.7 28.0 79.1 81.8 705.5 23.0October 21.5 27.2 69.3 81.7 281.5 14.0November 19.9 25.9 69.6 79.3 105.0 6.0December 15.3 22.3 59.1 73.0 - -

Total 3698 153



CROP SCIENCE

RICE

Experiments on variety evaluation for uplandrice, lowland rice, ragi and maize were conductedbut yield data could not be collected due to severerodent infestation during grain filling stage due to‘Mautam’ 2007

Effect of integrated nutrient management inupland rice

The maximum plant height (86.11 cm),maximum number of tillers/ sq.m (263.88),maximum number of grains per panicle (82.55) andgrain yield of rice(3.07 t/ha) were recorded withintegrated management (FYM 10t/ha+ BF +NPK40:30:20 kg/ha), followed by 100% inorganicfarming (80:60:40 kg N, P and K/ha) .

Effect of nutrient supply system throughorganic manures

Application of FYM @15t/ha resulted inmaximum plant height (75.66 cm), number oftillers/ sq.m (235.55), number of grains per panicle(83.11) and yield (2.91 t/ha) followed by pigmanure@ 10t/ha

Weed management in organic rice cultivationRice variety IURON -514 was planted and a

uniform dose of FYM @ 15t/ha was applied with

spacing of 20X10cm produced maximum plantheight (82.33 cm), number of tillers/ sq.m (258.00),number of grains per panicle (102.66) and grainyield point of view (3.33 t/ha), followed by 2 handweeding (HW) alone and 1 HW + Surface mulchingwith farm waste.

INSECTS AND PESTS

Rice yellow stem borer, Scirpophage incertulasWalker, Pyraustidae, Lepidoptera

The yellow stem borer is the dominant and themost destructive one. It is a regular pest in almostall districts of Mizoram. The extent of crop lossvaries from one to nineteen per cent in early-plantedand 25-50 per cent in late planted rice crops.

Striped rice borer, Chilo suppressalis Walk,Crambidae, Lepidoptera

Damage is caused to upland or lowland ricewhen the crop is at the ‘bunting’ or ‘pregnant’ stage.The damage is not easy to see as the plants maystill remain green in colour. The only sign that apest is present may be when the ear fails to emergeor if the rice ear does manage to emerge it may notproduce full grains; such empty ears may be whitein colour.

Rice leaf foldersThree species are present in Mizoram viz.,

Cnaphalocrocis medinalis, M. patnalis, M. ruralis.Of these, C. medinalis was identified as the

Stem borer adult White ear symptom


dominant species in Mizoram The damage iscaused by the caterpillars which fold the leaf bladesinto tubular structures and feed on the green leaftissues within these structures.

Rice earhead bug, Leptocorisa orotorius(Thunb.) and L. acuta, Alydidae, Hemiptera

In Mizoram, 25-40 per cent grains weredamaged due to its infestation.

Earhead bug

Rice Thrips, Stenchaetothrips biformis (Bagnall),Thripidae, Thysanoptera

The rice thrips is a sporadic pest of upland andlowland rice infesting mostly young plants. Theinfestation of thrips was found almost in all districtsof Mizoram.

Rice skipper, Pelopidas mathias F., Hesperiidae,Lepidoptera

Skipper is a one of the important pest of rice,with extensive distribution in rice growing regionsespecially in the upland rice. It is common pest onrice throughout Mizoram.

Rice swarming caterpillar, Spodoptera mauritiaHub., Noctuidae, Lepidoptera

The rice swarming caterpillar S. mauritia is a

sporadic pest which occasionally causes seriousloss to rice crops in almost all districts of Mizoram.

Green leafhoppers (GLH), Nephoteltix spp.,Cicadellidae, Hemiptera

Nephoteltix virescens was identified as thedominant species in Mizoram. When the epidemicis severe, 100 per cent yield loss can occur.

White backed planthopper, Sogatella furcifera(Horvath), Delphacidae, Hemiptera

The white backed plant hopper (WBPH) hasemerged as a major pest of rice in the recent yearsdestroying sizeable proportions of the crop. Thisoccurs in both upland and lowland riceenvironments.

White grubs, Holotrichia spp., Melolonthidae,Coleoptera

The grub is about one half or an inch in lengthand may be found in the soil beneath the damagerice plants.

Gall midge, Orseolia oryza (Wood-Mason),Cecidomyiidae, Diptera

The yield loss due to gall midge varies from 3to 70 per cent.

Rice Whorl Maggot: Hydrellia philippinaFerino, Ephydridae, Diptera

In Mizoram, it caused 5 to 10 per cent yieldloss on the first crop during May to September.The possible reason for the reported yield loss maybe due to the inability of the plants to fully recoverfrom the whorl maggot damage.

Other insect pests of riceSome insects like orange winged hopper, pollen

feeding beetles, etc. are predominant pests in ricegrowing areas of Mizoram.

Orange winged hopper Pollen feeding beetles


Table Varietal screening of insect pests of rice

Name of the insect pests Rice varieties

RCPL-76 RCM-11 RCPL-1-126 RCPL-1-122 RCM-22 RCM-18

Rice stem borer - * - - - -Rice leaf folder * * * * * *WBPH * * * * * *White leafhopper * * * * * *Thrips - - - - * -Green leaf hopper - * * * - -Blue leaf hopper - * - - - -Grass hopper * * * * * *Flea beetle - * * * * *Pollen feeding beetle - * - * - -Spider * * * * * *Natural enemies * - - - - -

MAIZE


Effect of integrated nutrient managementpractices in maize

The maize crop with a row to row spacing of50cm and 20 cm plant to plant produced maximumplant height (202 cm), cob length (17.11cm),number of grains per cob (496.66) and the highestgrain yield (5.17 t/ha) with FYM 10t/ha+ BF +NPK40:30:20 kg/ha, followed by 100% inorganicmanagement (80:60:40 kg N, P and K/ha).

Effect of organic manures in maizeThe maximum values for cob length (11.88),

number of grains/cob (363.13) grain yield (37.11q/ha) were recorded with FYM @15t/ha, followedby pig manure @ 10t/ha (10.77).

Weed management in organic maize cultivationMaize variety RCM 1-1 was planted following

a spacing of 50X20 cm and a uniform dose of FYM@ 15t/ha was applied. The maximum values forcob length (19.00 cm), number of grains/ cob(458.33) and grain yield were recorded with staleseed bed + 2 hand weeding (HW) and 1 HW +surface mulching with farm waste.

INSECTS AND PESTSMaize stem borer, cob borer and aphids were

the major insect pests of maize both in Jhum andterraced fields in Mizoram. Termites were alsofound in the early crop stage. The incidence of pinkborer was very low. Maize stem borer infestationwas seen usually a month after sowing. The pestcaused windowing and dead hearts. The infestationwas noticed till harvest. The caterpillar wasyellowish brown with brown head.

Stem borer symptoms


PULSES

Lentil

Varietal evaluation trial on lentil in foot hillsEighteen varieties were tested. The maximum

plant height (71.00 cm) was recorded with varietyL7-714. Maximum number of branches/ plant (6.2)and the highest seed yield 1.0 t/ha was recordedwith variety L7-710.

Varietal evaluation trial on lentil in foot hillsNineteen entries were evaluated. The maximum

plant height (68.1 cm) was recorded with varietyL7-829. Maximum number of branches/ plant(10.8) with variety L7-802 and highest seed yield(2.9 t/ha) was recorded with variety L7-829

Field pea

Varietal evaluation trial on field peaTwenty varieties evaluated. The highest grain

yield was recorded with variety P7-672 (3.0 t/ha)followed by P7-651(2.5 t/ha).The maximum plantheight (109.7 cm) was recorded with variety P7-663. Maximum number of branches / plant (11.1)was recorded with variety P7-676. Maximumnumber of pods/ plant (86.00) was recorded withP7-676.

INSECT AND PESTS

Red gramPod boring weevil, stem borer, pod fly were the

major insect pests of red gram. Among these insectpests, pod boring weevil was serious pest on this

crop. Pod boring weevil alone caused 70 to 80 percent damage to the pods and 40-50 per cent to thegrains.

LentilPod borer, leafhoppers and aphids were the

major insect pests of lentil in Mizoram.Leafhoppers and aphids sucked the sap from theplants and caused yield loss up to 10-15 per cent.Some of the insects like ash weevil, grasshopper,etc were minor insect pests.

PeaPod borers, plume moth, pod fly, blue butterflies

were recorded as major insect pests of pea inMizoram.

Green gram/black gram/rice beanBlister beetle was the most serious pest of green

gram and caused yield loss up to 25-30 per cent.The insect pests of green gram recorded were stemfly, blister beetle, flea beetle, aphids, jassids, leaffolder, green shield bug, leaf footed bug, pod bug,grasshopper and semilooper.

Lab-labBlister beetle was the most serious pest and

caused yield loss up to 30-40 per cent. The majorpests of lab-lab recorded were semilooper, podborer, leaf folder, blue beetle, pod bug, blisterbeetle, aphids and pod boring weevil. Some of theminor insect pests were hairy caterpillars and ashweevil.

Cow peaThe major insect pests of cow pea recorded were

pod bug, pod boring weevil, blister beetle and hairycaterpillar. Cow bug was considered as minor insectpests.

Adult of pod boring weevil Grub of pod boring weevil


OILSEEDS


Varietal evaluation trial on confectionarygroundnut

Eight varieties were evaluated with spacing of45 cm X 10 cm. A uniform dose of FYM @ 10t/hawas applied. Maximum pod yield 2.2 t/ha wasrecorded with variety ICGS-76 followed by M-13(2.2 t/ha). Maximum plant height (70.9 cm) wasrecorded with variety ICGV-86590. Maximumnumber of pods/ plant (22.7) was recorded withvariety M-13.

Front line demonstration on groundnutFront line demonstrations were conducted at the

research farm in collaboration with the NRCGJunagarh.

INSECTS AND PESTS

MustardMore than 30 insect pests were found to infest

the mustard viz., mustard sawfly, cabbagebutterflies, flea beetle, pod borer, aphids, podsucking bug, etc. Mustard aphids are the main pestof mustard causing 25-30 per cent reduction inyield. Cabbage butterflies are the common insectpest causing yield loss to the mustard crop. Mustardsawfly is a serious pest on seedling stage. Fleabeetles were found throughout the cropping season.

GroundnutGroundnut was damaged by a number insect

pests of which hairy caterpillar, leaf miner, leafwebber, blister beetle, aphids, white grubs, earwig,termites, were important pests. The leaf miner wasvery serious pest and it caused yield loss up to 20-25 per cent. The soil insect like termites, earwigand white grub were major yield limiting factors.

Hairy caterpillar

SoybeanIn Soybean stem fly, leaf webber/folder, aphids,

etc. were the most destructive insect pests. These

folders, voracious feeders caused loss in soybeanyield up to 10 per cent during kharif season.Soybean stem fly on soybean caused 15-20 per centyield loss.

FRUITS

INSECTS AND PESTS

CitrusIn the north eastern hilly region 26 species have

been recorded attacking citrus. Insect pestsattacking citrus (Khasi mandarin) are citrus leafminer (P. citrella Stainton), lemon butterfly(Papillio demoleus L.), scale and mealy bug.

Citrus leaf miner, Phyllocnistis citrella(Stainton), Gracillariidae, Lepidoptera

Citrus leaf miner larvae feed by creating shallowtunnels, referred to as serpentine mines, in youngleaves. Usually only one leaf mine is present perleaf but heavy infestations may have 2 or 3 minesper leaf; up to 9 mines on large leaves have beenfound in Mizoram.

Citrus or lemon butterfly, Papilio demolious L.,Papilionidae, Lepidoptera

Infestation was more in nursery and youngplantations where the seedlings and new flusheswere defoliated.

Scale insect, Aonidiella auriantii Maskell,Diaspididae, Hemipetra

More than 50 species of scales have beenrecorded feeding on citrus. Scales are moreprevalent in the temperate conditions. The softscales the have no separate cover but sometimes ahard skin or a protective waxy secretion.

Citrus scales are of two distinct types-armouredscales, which have hard cover separate from thebody providing protection to the body underneath.

Mealy bug, Planoccus citri Risso,Pseudococcidae, Hemiptera

Mealy bugs are another group of insects withserious consequences. Here, the seedlings and


leaves are attacked. Citrus mealy bug, the mostcommon species, has a pinkish body that is visiblethrough the powdery wax. The filaments aroundits margins are not appreciably longer at theposterior end.

BananaBanana is the second most important crop in

Mizoram. The most important insect pests ofbanana recorded were leaf and fruit scaring beetle,rhizome weevil, pseudostem weevil, skipper andaphids. Passion Fruit

The most important insect pests recorded werefruit flies, vine bug, stink bug, leaf beetle, etc. Iffruits are punctured when nearly mature, the onlyeffect is an external scar and it cause yield loss upto 10-15 per cent damage to the fruits of the passionfruit.

Fruit fly damage

PapayaThe most important pests recorded were weevil,

mite, etc. In the nursery leaf folder was the mostimportant insect pests.

Leaf and fruit beetle(Brown)

Leaf and fruit beetledamage

Leaf and fruit beetle(Black)

Weevil damage

Grub of pseudostemweevil

Pupa of pseudostemweevil

Adult emerging fromcoccon

Weevil damage

Skipper parasitoidemerging fromskipper pupa

Pupa of banana skipper

Weevil Leaf folder


GuavaGuava was found infested by more than 25

insect pests in Mizoram and among them guavatrunk borer, scale, fruit sucking moth and fruit flieswere the most serious pests. The trunk borer lossesin the guava orchard ranged from 25-75 per cent.The fruit sucking moths are major yield and qualitylimiting factor in guava cultivation. Some non-insect pests like rat are also causing damage to theguava fruits. Tea mosquito bug was the major insectpests present almost throughout the period and itcaused yield loss up to 15-20 per cent.

Mite Mite damage

Mite damage (webbing)

MangoMost important and serious pests of mango in

Mizoram were stone weevil, scale insect, fruit flies,leaf webber, stem borer, leaf gall, shoot borer, etc.Some insect pests like shoot borer, leaf webber,leaf twisting weevil were of minor importance.

LitchiIndigenous varieties are common and grown in

the lower altitude of the region. Fruit and stoneborer, sucking bug, leaf webber, mite, etc. werethe most serious pest of litchi in Mizoram. The fruitand stone borer damage was recorded up to 25 percent in the litchi orchard.

Trunk borer symptoms Trunkborer grub

Fruit sucking moth and its damage symptom

VEGETABLES

INSECTS AND PESTS

TomatoInsect pests of tomato recorded damaging were

fruit borer, thrips, aphids, jassids, leaf miner, etc.Fruit borer caused yield loss up to 20-25 per centin Mizoram.

Tomato fruit borer and its damage symptoms


Chilli / CapsicumThe major insect pest recorded aphids, fruit

flies, scale, mealy bugs, whitefly, stink bug, fleabeetle, etc. Both nymphs and adults can causesevere damage to the crop. Fruit fly was the mostimportant insect pest of chilly in Mizoram.

BhendiThis crop is grown widely in Jhum as well as

terraced lands. Major insect pests of bhendirecorded were fruit borer, shoot borer, flowerbeetle, jassids, aphids, semilooper, leaf roller, fruitbugs, etc. Blister beetle caused more than 50-100% loss . Ash weevil and flea beetle were alsorecorded as major insect of bhendi in Mizoram.

BrinjalKey pests responsible for qualitative and

quantitative losses were fruit and shoot boresr.Some other insect pests like aphids, jassids, mealybug, scale, flea beetle, epilachna beetle, etc. werealso considered as major insect pests..

BeansDifferent types of beans are grown for

vegetables in Mizoram. The main pests recordedwere aphid, stem fly, flea beetle, blister beetle,epilachna beetle, hopper, etc. Blister beetle was oneof the major insect pests.It caused yield loss up to25-50 per cent.

Cole cropsInsect pests recorded on cole crops were

cabbage butterfly, cabbage semilooper, diamondback moth, hairy caterpillar, head borer, aphids,flea beetle, painted bug, sawfly, etc. Cabbagebutterfly was the most important insect pests ofcole crops.

INTEGRATED NUTRIENT MANAGEMENTIN VEGETABLES

Integrated nutrient management in cabbageIntegrated nutrient management (INM) trial was

conducted to examine the response of fertilizer andvermicompost either alone or in combination ongrowth, yield and quality traits of cabbage (Table:1). Five treatment combinations were

T-1 100 % fertilizer + 0 % vermicompostT-2 75 % fertilizer + 25 % vermicompostT-3 50% fertilizer + 50 % vermicompostT-4 25 % fertilizer + 75 % vermicompostT-5 0 % fertilizer + 100 % vermicompost• Fertilizer dose @ 100: 60: 60 kg NPK/ ha

and Vermicompost dose @ 15 t/ haOne month old seedlings of cultivar Blue

Diamond were transplanted on 07.12.2007 intriplicate. The spacing and bed size was kept at 50x 50 cm and 4 x 2 m, respectively. Gross plantweight and net head weight were higher in all thetreatments as compared to vermicompost alone.Harvest index was highest in fertilizer only (T-1)but it is at par with T-2, T-3 and T-4 treatment. Therewas no significant response for any treatments onthe number of non-wrapper leaves. Headcompactness was directly associated with the longstay in field, shelf life and transportability of head.Its compactness showed positive association withthe amount of vermicompost applied. The studyrevealed that integration of vermicompost alongwith fertilizer (T-3 and T-4) enhances the yieldpotential and quality of head.

Table 1. Response of INM on growth, yield andquality parameters of cabbage

Treatment Gross Net Harvest Leaf Headplant head index number compact-weight weight (%) ness(g) (g)

T-1 2207 1608 73.0 12.5 36.0T-2 2234 1594 71.4 12.1 40.5T-3 2217 1587 71.6 12.1 43.4T-4 2187 1448 66.2 12.4 44.2T-5 1701 1044 61.4 12.1 45.4Average 2109 1456 68.7 12.2 41.9(P = 0.05) 77 133 7.6 NS 5.8

Integrated nutrient management in tomatoThe treatments were same as INM in cabbage.

Data are presented in Table 2.One month old seedlings of F1 hybrid Avinash-

2 were transplanted following randomized blockdesign in triplicate on 03rd December, 2007. Theplant spacing and bed size was kept at 50 x 50 cmand 4 x 2 m, respectively. It was visual that T-5treatment has less chlorophyll in their leaves. Alsofruiting period was shorter as compare to other


treatments showing the high response of hybrid tonitrogenous fertilizer. There was no significantresponses of treatments on stem thickness, specificleaf weight and fruit size. Non-significance of fruitsize revealed that vermicompost had no effect oncell expansion and or cell division of fruits. Plantheight, single leaf area, single leaf fresh weight,fruit number and fruit yield/ plant had significantresponse as compare to vermicompost alone. Singlefruit weight was highest in integrated/ combinationtreatments only that might be due to high fruitdensity and TSS. The fruit density, TSS and postharvest life of fruits (fruit quality) increased withincrease in vermicompost quantity. Post harvest lifeof fruit increased by 90-250 % with the applicationof vermicompost as compare to fertilizer alone,especially in summer tomato. The present studyindicated that integration of vermicompost alongwith fertilizer (T-3 and T-4) enhance the growth ofplant, yield potential and quality of fruit. (Table2).

Evaluation of tomato cultivars during summerseason

One month old seedlings of five cultivars weretransplanted on 12th January, 2007 in triplicate. Thespacing and bed size was kept at 50 x 50 cm and 4x 2 m, respectively. The number of fruits/ plantwas recorded highest in Avinash-2 which is at parwith Swaraksha but total yield/ plant was highestin Avinash-2 because of larger fruit size. Swarakshais highly susceptible to blossom end rot due tocalcium deficiency and it is more visuallyconspicuous with increase in temperature. (Table3).

Table 3. Performance of tomato cultivars duringsummer season

Cultivar No. of Single Fruit Disease reactionfruits/ fruit yield/plant weight plant

(g) (g)

Sel-3 16.4 45.1 738 -Shivam 18.7 40.5 757 -No-3560 25.5 33.3 853 Susceptible to bacterial

wilt during September-October transplantingonly.

Swaraksha 28.5 54.2 1540 Susceptible to blossomend rot

Avinash-2 32.1 64.9 2088 -Avg 24.2 47.6 1195 -(P = 0.05) 4.1 4.2 308 -

Mulching in tomatoThe average annual rainfall of Mizoram is

around 351 cm but main vegetable growing season(October-April) receives only 11.4 % of total(2007-08). Due to this, winter season vegetablesface the problem of water scarcity. Keeping this

Table: 2 Response of INM on growth, yield and quality of tomato

Treatment Plant Stem Single Single Specific Fruit Single Fruit Fruit Fruit TSS Postheight thickness leaf leaf leaf number/ fruit yield/ size density (Brix) harvest(cm) (mm) area fresh weight plant weight plant (cm2) (g/ m3) life

(cm2) weight (g/ cm2) (g) (kg) (day)(g)

T-1 87.7 14.1 30.6 902.3 30.0 33.7 79.2 2.658 26.4 0.792 4.3 6.3T-2 85.6 14.3 34.1 935.7 27.5 33.1 85.4 2.839 30.6 0.894 4.3 12.0T-3 90.3 14.7 32.9 905.0 27.7 32.8 88.9 2.939 31.0 0.907 4.5 13.7T-4 96.4 13.6 34.2 915.7 26.8 27.3 82.6 2.266 28.6 0.908 5.2 14.0T-5 80.5 13.8 24.8 664.3 26.7 21.0 77.3 1.628 27.8 0.971 5.1 16.0Avg. 88.1 14.1 31.32 864.6 27.74 29.58 82.68 2.466 28.88 0.8944 4.68 12.4(P = 0.05) 5.7 NS 5.0 113.3 NS 6.2 4.8 0.605 NS 0.038 0.6 2.1

Blossom end rot


problem in mind, an experiment of mulching wasdesigned to examine water use efficiency and affecton growth and development of tomato plants andfruits (Table 4). Three treatments were non-mulched (No watering after seedlingestablishment), mulched (Mulching with locallyavailable dried grasses and no watering afterseedling establishment) and irrigated (Need basedwatering). Twenty five days old seedlings cv. Siouxwere transplanted on 07th December, 2007. Thespacing and bed size were kept at 50 x 50 cm and 4x 2 m, respectively. There was no effect oftreatments on plant height, stem thickness andspecific leaf weight. Leaf area and fresh leaf weightwere highest in mulched plot which was at par withirrigated plot. Fruit size was recorded lowest innon-mulched but there was no significant increaseby mulching. Mulching treatment had positiveeffect on fruit number, fruit weight and total yield/plant by 35-100 %. The present study reveals thattomato cultivation will be profitable by practicingmulching with or without watering after seedlingestablishment.

Effect of different time of sowing and varietieson radish

An experiment was designed to examine theeffect of different varieties and differential sowingtime on growth and development of leaf and root(Table 5) with the objective to select the suitablevarieties and proper time of sowing for commercialcultivation. Three varieties namely Pusa Himani,Japanese White and Arka Nishant were sown on10th December, 2007 (S1) and 20h December, 2007(S2) for evaluation of performance. Seeds weresown on 40 cm spaced ridge and plant to plantspacing was maintained at 4 cm for properdevelopment of roots. Experiment was designedwith three replications each having ten ridges of 3m length. Harvest index and root/ leaf ratio werehighest for Pusa Himani followed by JapaneseWhite and Arka Nishant. Both the parameters arepositively associated with root yield which weredecreased by late sowing. The performance ofJapanese White was more stable than other twovarieties. 100 % bolting was noticed in ArkaNishant which is undesirable trait for table purposecultivation of radish.

Table 4. Effect of mulching and watering on yield and yield attributing parameters in tomato

Treatment Plant Stem Single Single Specific Fruit Single Fruit Fruitheight thickness leaf are leaf leaf number/ fruit yield/ size(cm) (mm) (cm2) fresh weight plant weight plant (cm2)

weight (g) (g/ cm2) (g) (kg)

Non-mulched 30.0 10.2 12.8 0.276 21.7 10.3 47.4 0.489 20.3Mulched 27.5 13.5 30.4 0.872 29.2 17.4 61.5 1.077 23.1Irrigated 27.7 12.4 28.4 0.870 31.2 19.5 93.0 1.802 28.2Avg 28.4 12.0 23.9 0.673 27.4 15.7 67.3 1.123 23.9(P = 0.05) NS NS 11.7 0.086 NS 5.7 12.4 0.507 4.0

Non-mulched

Mulched


Chow-chow (Sechium edule)Chow-chow nursery was raised in poly bags and

transplanted in field to study the biology, genetics,incidence of pest and diseases, development ofpackage of practices and post harvest life of fruits.

Table 5. Effect of time of sowing and varieties on root yield and yield attributing traits in radish

Treatment Root Leaf Total Harvest Root/ Root Leaf Rootweight weight biomass index leaf length length diameter(g) (g) (g) (%) weight (cm) (cm) (mm)

ratio

Pusa Himani S1 103.5 30.1 133.6 77.5 3.45 21.7 25.9 28.3S2 30.0 14.9 44.9 66.8 2.03 12.8 22.4 18.5

Japanese White S1 102.9 39.8 142.7 72.2 2.66 15.7 31.1 29.7S2 65.0 31.0 95.9 67.8 2.11 14.3 30.0 23.7

Arka Nishant S1 61.4 52.5 113.9 53.8 1.18 11.7 38.9 30.7S2 22.7 33.0 55.7 40.8 0.69 8.3 33.4 22.5

Avg.(P = 0.05) 64.3 33.6 97.8 63.2 2.02 14.1 30.3 25.68.3 5.7 8.6 4.2 0.50 2.8 5.5 5.2

TECHNOLOGY MISSION (MM-I)

Technology Mission (Mini Mission – I)Integrated development of horticulture in north

eastern states including Sikkim, Jammu & Kashmir,and Himachal Pradesh.

Programme I Production of nucleus/ basic seedand planting material of horticultural crops.

Table 1. Quantity of different planting materialsproduced

Crop Variety Type of Quantitymaterial

Citrus Khasi Mandarin Seedling 10,000 nos.Banana Giant Cavendish Sucker 10,000 nos.Passion fruit Purple and Seedlings 1,000 nos.

Yellow & cuttingsPapaya Pusa Nanha & Seedlings 2,000

LocalGinger Nadia and Rhizome 1.5t

ThinglaidumTurmeric Megha Turmeric Rhizome 3.5t.

(RCT-1)Tomato TO1458, Sioux, Seed 300g.

Sel-3, Avinash-2& Bankim Ruby

Programme IIStandardization of production and protection

technologies.

Banana1. Assessment of growth and yield performanceof banana cv. Giant Cavendish with differentbio-fertilizers.

Six different treatment combinations of bio-fertilizers viz., Azospirillum, Azotobacter and PSBwere evaluated. A uniform dose @15 kg FYM/plantand bio-fertilizers @20 ml/plant was applied. Thedata collection is in progress.

Table 2. Effect of bio-fertilizers on growth ofbanana cv. Giant Cavendish

Treatments Pseudo Pseudo- No. of No. of Days-stem stem suckers func- toheight girth tional shooting

leaves

Control 186.67 53.27 4.67 11.33 282.67Azotobacter 231.00 57.00 4.67 11.67 269.00Azospirillum 233.00 56.20 4.33 12.00 272.67PSB 227.33 56.33 5.33 12.33 267.00Azotobacter 243.00 62.00 5.00 13.67 258.00+ PSBAzospirillum 245.33 63.00 5.33 13.33 256.33+ PSBCD(P=0.05) 10.90 4.40 N.S N.S 6.86

2. Assessment of growth and quality of tissue-cultured banana cv.Grand naine

Tissue cultured plants (150 nos.) of banana var.Grand Naine were planted in the month of July2005 and 100 nos in the month of June 2006 forevaluating its growth and quality parameters under


Mizoram conditions at ICAR Research Farm. Dataare presented in Table 3.

Table 3. Physico-chemical parameters of tissue-cultured banana cv. Grand Naine

Plant height 2.10 m.Plant girth 66.5 cmNo. of functional leaves 14.00Leaf area 1.03m2

No. of suckers 3Days to shooting 272 daysWeight of bunch 33 kgNo. of hands 9No. of fingers 182TSS 22.5 o BrixAcidity 0.21 %Ascorbic acid 13.4 mg/100 gReducing sugar 7.3 %Total sugar 15.5 %

Passion fruit

Assessment of growth and yield performanceof passion fruit var Purple with different bio-fertilizers.

Assessment of growth and yield performanceof passion fruit variety Purple with sixcombinations of different bio-fertilizers viz.,Azospirillum, Azotobacter and PSB was started inthe month of July, 2007. Uniform dose of 10 kgFYM and 20 ml of bio-fertilizers were applied ineach plant. The Data are presented in table 4

Programme IIITechnology refinement and imparting training.

1. Khasi Mandarina) Rejuvenation of declining Khasi MandarinOrchards in Bualpui and Thingdawl Villages

Rejuvenation schedule was applied inpreviously selected orchards of Bualpui andThingdawl Villages. Khasi mandarin plantsshowed increase in growth and yield parameters.Experiment is in progress in both orchards.

Table 5. Success story of farmers in Thingdawland Bualpui Village

Particulars Orchard-1 Orchads-2

Name of the farmer Pu.Zonunthara Pu. HmingaKhiangte Varte

Total no. of plants 125 255Yield before adopting 37.37 fruits 37.13 fruitsrejuvenationprogramme per plant per plantYield after adopting 125.65 fruits 139.35 fruitsrejuvenationprogramme per plant per plantIncome before adopting Rs. 7,500/- Rs.18,500/-rejuvenation programmeIncome after adopting Rs. 31400/- Rs53,000/-rejuvenationprogramme

b)Demonstration of high density planting ofKhasi Mandarin in farmer’s field

One hundred Khasi mandarins were planted at4 X 4 m in farmer’s field in the month of June

Table 4. Effect of bio-fertilizer on growth and quality of passion fruit var. Purple

Observations Treatment

Control Azotobacter Azospirillum PSB Azotobacter Azospirillum SEm± CD+ PSB + PSB (P=0.05)

Length of vine (m) 1.35 1.58 1.62 1.54 1.85 1.89 0.05 0.11Girth of main stem (cm.) 4.60 4.83 4.90 5.10 6.13 6.28 0.19 0.42No. of branches 2.33 3.33 4.00 3.33 4.33 4.67 NS NSNo. of leaves/ branch 26.67 32.00 33.00 31.33 37.00 36.33 NS NSLeaf area(cm.2) 143.00 171.00 176.67 171.67 195.00 200.33 15.51 34.56No of fruits 70.00 103.00 104.33 105.00 118.33 120.00 3.52 7.84Fruit weight (g.) 31.67 39.00 42.00 38.33 47.00 47.00 2.16 4.81Fruit volume 39.33 49.00 52.00 54.00 64.33 64.67 3.12 6.94Juice (%) 25.83 30.73 30.97 29.77 34.50 33.67 1.36 3.03TSS (%) 15.53 16.47 16.50 16.50 17.23 17.33 0.29 0.64Acidity (%) 2.48 2.39 2.40 2.40 2.21 2.24 0.03 0.07Ascorbic acid (mg/100ml) 32.77 36.17 36.90 36.77 40.50 40.67 1.32 2.95Reducing Sugar (%) 7.23 7.49 7.51 7.53 7.71 7.74 0.04 0.09Total sugar (%) 10.83 11.15 11.14 11.2 11.44 11.50 0.07 0.16


2006. The plants have attained the average plantheight 1.87m, stem girth 10.4cm and leaf area 18.24cm2.

c) Assessment of growth and yield performanceof Khasi mandarin under integrated nutrientmanagement trial at Kawnpui Village

Treatments with different combinations ofnutrients (organic and inorganic) were applied inthree Khasi mandarin orchards in farmers’ field atKawnpui block. The pooled data of experiment aregiven in Table 6.

d) Demonstration on foliar application of micronutrients in farmer’s field

Demonstration on foliar application of micro-nutrients viz., ZnSo4, MnSo4 and CuSo4 and theircombinations were carried out in two Khasimandarin orchards at Kawnpui block in farmer’sfield. The data are presented in Table 7.

2. Bananaa) Demonstration on improved technology ofbanana production on farmers’ field

Two banana orchards were selected for carryingout demonstration on improved technology of

Table 6. Effect of different fertilizers and manures and its combination on growth, yield andquality of Khasi mandarin

Treatments Seasonal incremental No of Physico- chemical parameters of fruitsvegetative growth fruits/

plantPlant Plant Canopy Fruits Fruit Fruit Fruit Juice TSS Acidity Ascorbic Reducing Totalheight girth volume weight length diameter volume (%) (%) (%) acid sugar sugar(cm.) (cm.) (m3) (g) (cm.) (cm.) (ml.) (mg/ (%) (%)

100m)l

FYM (F) 28.00 1.53 0.073 258.33 98.33 5.52 5.63 104.67 44.19 9.70 0.49 36.67 5.32 7.14Vermi compost (V) 30.75 1.53 0.070 250.00 99.43 5.53 5.64 105.33 44.00 9.74 0.49 36.33 5.37 7.15Poultry manure (P) 28.50 1.50 0.063 264.67 105.47 5.58 5.69 111.67 44.08 9.84 0.50 37.33 5.40 7.19NPK 32.00 1.73 0.084 305.33 108.23 5.60 5.72 115.33 44.38 9.92 0.47 34.00 5.43 7.23NPK+V 41.50 2.13 0.212 362.67 139.53 5.84 5.95 149.33 47.42 10.67 0.35 37.67 5.67 7.54NPK+P 41.23 2.00 0.206 378.33 137.70 5.87 6.00 147.67 47.30 10.73 0.36 35.00 5.69 7.58NPK+F 41.83 2.10 0.209 371.67 138.53 5.86 6.01 154.67 47.33 10.67 0.37 38.00 5.70 7.60V+P 37.25 1.73 0.127 326.67 124.33 5.76 5.85 132.33 45.83 10.26 0.42 39.00 5.59 7.42F+V 36.00 1.70 0.123 320.00 121.33 5.75 5.84 130.67 46.17 10.30 0.42 39.00 5.62 7.39F+P 36.25 1.67 0.129 316.67 122.33 5.73 5.86 132.00 45.92 10.31 0.41 36.67 5.64 7.44Control 21.58 1.10 0.035 116.67 72.43 5.15 5.21 75.67 42.67 9.34 0.60 33.33 4.82 6.82SEm± 1.26 0.22 0.0093 20.75 5.25 0.04 0.04 7.76 0.58 0.18 0.02 4.10 0.13 0.06CD(P=0.05) 2.63 0.45 0.0194 43.28 10.95 0.08 0.09 16.20 1.21 0.37 0.04 8.56 0.27 0.12

Table 7. Effect of micro-nutrients on physico-chemical parameters of Khasi mandarin

Treatments No of Fruit Fruit Fruit Juice Fruit TSS Acidity Ascorbic Reducing Totalfruits weight length diameter (%) volume (%) (%) acid sugar sugar

(g.) (cm.) (cm.) (mg/ % %100ml)

ZnSo4 (T1) 309.67 104.00 5.13 5.23 45.65 112.00 10.12 0.49 28.00 4.79 7.23MnSo4 (T2) 305.33 102.39 5.09 5.23 45.75 109.00 10.18 0.50 27.50 4.84 7.25CuSo4 (T3) 297.67 102.87 5.09 5.23 45.70 109.33 10.15 0.49 27.50 4.81 7.29Zn+Cu+Mn (T4) 374.00 135.67 5.60 5.65 48.80 145.67 10.88 0.41 21.33 5.42 7.74Zn+Cu (T5) 338.00 122.33 5.37 5.48 46.98 131.67 10.49 0.45 24.83 5.04 7.47Zn+Mn (T6) 330.33 116.83 5.36 5.48 46.80 125.00 10.50 0.44 25.17 5.05 7.51MN+Cu (T7) 337.67 116.67 5.32 5.44 47.03 123.67 10.46 0.44 24.67 5.12 7.45Control (T8) 260.67 83.67 4.86 4.97 44.25 91.33 9.82 0.51 31.61 4.51 6.99CD(P=0.05) 19.22 8.91 0.13 0.17 0.79 8.40 0.14 0.05 4.01 0.20 0.14


banana production. The data are presented in table8.

Table 8. Growth parameters of Giant Cavendishon farmer’s field (2007-08)

Plant height : 2.1 m.Plant girth : 57 cm.No. of functional leaves : 12.33Leaf area : 0.98 m2

No. of suckers : 3.33Day to shooting : 273Weight of bunch : 18.5 kgNo. of fingers : 92Weight of finger : 160 gmT.S.S : 24.5oBrixAcidity : 0.26 %Ascorbic acid : 12.3 mg/ 100gReducing sugar : 8.3 %Total sugar : 16.5 %

3. Passion fruita)Demonstration on improved technologies ofpassion fruit var. Purple and Giant granadillaon farner’s field

An orchard was selected at Thingdawl block tocarry out demonstration on improved technologiesof passion fruit production in the year 2005. Resultsobtained form demonstration are presented in table9

Table 9. Assessment of growth, yield and qualityof passion fruit on farmer’s field

Parameter Variety GaintPurple type granadilla(Passiflora (Passifloraedulis) quadrangularis)

Number of branches 5 6No of fruits/vine 175 45Fruit weight(g) 47.8 720Volume of fruit (cc) 68 796Peel weight(g) 20 546.3Pulp weight(g) 25.3 131.11Juice (%) 31.5 14.30Acidity (%) 2.8 1.81TSS (%) 17.9 13.8Total sugar (%) 12.6 4.9Ascorbic acid (mg/100ml) 46.00 39.00Seed weight (g) 15.60 21.70

Training conductedSix training programmes on production

technology of passion fruit, banana, papaya, citrusand winter vegetables were conducted during 2007-08.

SPICES

INSECT AND PESTS

TurmericStem borer was found to cause damage up to

30 per cent to shoots in turmeric.The major insectpests were stem borer/rhizome borer, thrips,skipper, aphids and chrysomelid beetles.

GingerThe major insect pests were stem borer/rhizome

borer, thrips, skipper, chrysomelid beetles, etc.Skipper was one of the most destructive pests ofginger and it caused damage more than 10-15 percent to ginger crop in Mizoram. Stem borer werefound to cause damage up to 30 per cent to shoots.

Skipper and its damage

Dead heart symptom byrhizome borer


INTEGRATED FARMINGSYSTEM

Assessment of technology on watershed basedintegrated farming systems in north eastern hillsregion

Horti – Silvi-pastoral system

Banana Banana var. Giant Cavendish andGrand Naine performed better withthe yield of 20 t/ha and 30.0t/ha,respectively.

Peach Peach var. TA 170 and Flordasunstarted bearing and produced 12.0and 16.0 fruits/plant, respectively.

Local Aonla 100 seedlings of Aonla were plantedduring 2004 and they attained theheight of 2.5m with the tree spreadof 3.0m.

Guava About 150 plants of guava var.Allahabad Safeda are producing65.0 fruits /plant with the fruitweight of 102.0g and yield of 10.2t/ha

Passion Fruit About 150 seedlings of purplepassion fruit are producing 85.0fruit/vine/year. The fruit weight was38.5 g and fruit yield was 4.0t/ha.

Mandarin One year old plants of Khasimandarin attained the height of1.2m.

Hatkara One hundred hatkara was planted in2005 but only 70 % plants aresurviving. Plants attained the heightof 1.0m.

Pineapple Thirty thousand suckers of Kewwere planted in double row system.The fruit weight was 500g/fruit andyield was 20 t/ha.

Tree bean Parkia roxberghii is bearing 64.0pods /plant

Agro-forestryData recording on Teak and Tung planted during

1996 – 97 are in progress.

Soil and water ConservationThree gauging stations were installed during

1996 -97 and are now in process of revival afterrepairing etc. for collecting data on run off and soilerosion.

Agri- Horti System

RiceRice variety IURON -514 was sown during 2nd

week of May, 2006. Among different treatments,application of NPK @ 60: 60:40 kg/ha + Lime @1.0t/ha has recorded maximum grain yield (4.80t/ha)

MaizeMaize variety RCM 1-1 was sown in the FSRP

block during first week of May, 2006 amongdifferent treatments application of NPK @ 60:60:40 kg/ha + Lime @ 1.0t/ha has recordedmaximum grain yield (5.10t/ha).

SoybeanSoybean variety JS-80-21 was sown during

fourth week of May, 2006. The seeds were sownby treating with bio-fertilizers and application oflime was done @1.0t/ha. The crop recorded anaverage seed yield of 1.8 t/ha.

TurmericTurmeric var. RCT-1 was planted in one acre

land. The average yield of turmeric was 20t/ha.

GingerGinger var. Nadia performed well and gave a

yield of 16t/ha.

Dairy componentA total number of seven cows, three heifers and

eight calves are maintained in the dairy unit. Thelactating and pregnant cows were stall fed withNapier, Para grass, Congo signal etc where as theheifers were allowed for grazing (8h per day).


ANIMAL SCIENCE

PIGTwo Large White Yorkshire (LWY) sows were

reared in the farm for sexual maturity studies; theaverage age at sexual maturity was found to be 8.5months with the age at first farrowing was 12.5months. The average litter size was 9.5 and 10,respectively for the sows with the individual litterweight of 1.28 and 1.35kgs, respectively.

POULTRY

Performance of Vanaraja dual-purpose birdsThe average hatchability of Vanaraja eggs was

found to be about 75.23% and chicks were sold asday old @ Rs. 25/chick. At least 1203 chicks werehatched during the period and 1074 chicks weresold to the farmers in and around Kolasib District.A study was undertaken for both the parent stockand F1 to assess the laying capacity and peak layingperiod and maximum body weight gain of Vanarajabirds under ICAR farm conditions. Theperformance with respect to the age at first lay,average annual egg production per bird, averageegg weight, trend of egg production and age ofmaximum body weight gain were assessed. Theage at first lay of pure line and F1 were on 28 weekswhile the body weight at the start of lay was around2.3 kg. The contemporary body weight of pure linematured males at 28 weeks was around 3.0 kgwhere as in F1 the body weight was found to be2.7 kgs.

Table Pure line Vanaraja chicks mortality upto 8 weeks of age

Particulars

No. of chicks procured 250Transit Mortality 19Mortality up to 8 weeks of age 24Total Mortality from day old up to 438weeks of age.Survivability up to 8th weeks of Age. 231 (82.8%)

NATIONAL AGRICULTURALINNOVATION PROJECT

Project: Livelihood Improvement andEmpowerment of Rural Poor ThroughSustainable Farming Systems in North EastIndia

Programme I:Introduction and Development of IntegratedFarming System Technology

Farmers and sites were selected for socio-economic survey and implementation of IntegratedFarming System Technology (IFST) at Theivavillage (District; Saiha). Those farmers, who ownedland in the selected village, were chosen forimplementation of IFST. Different spots or placewere selected in the selected site for runningdifferent components of IFST such as crophusbandry (agricultural crops, horticultural crops,agro-forestry, etc.), animal husbandry (cow, goat,fishery, pig, etc.), water harvesting structures andirrigation facilities. Agreement between land holderand ICAR, Mizoram Centre were made for smoothrunning of IFST.A pro-forma was developed forrecording observations on different parameters.Cleaning and preparation for terracing were doneat Theiva Village, Saiha.


NAGALANDCENTRE


The weather data for year 2007-08 was recordedat Agromet Advisory Service Unit of the centrelocated in the campus. The maximum and minimumtemperature was recorded during June-July, 2007and January-February, 2008 respectively. Therelative humidity was recorded 78-86 % during theperiod. The rainfall was recorded 2064.2 mm withmaximum during August, 2007 (500.3 mm) whichwas nearly 25 % of total rainfall received during

WEATHER

Table1.Weather observation as recorded at ICAR Jharnapani during April, 07 to March, 08

Month Temperature 0C RH % Evaporation Rainfall Total Sunshine(mm) (mm) hour

Max Min

April, 07 29.30 19.0 78.0 77.0 120.2 155.6

May, 07 31.20 22.0 83.0 88.1 143.7 127.0

June, 07 31.30 24.0 84.0 118.5 355.6 092.5

July,07 31.40 25.0 85.0 106.3 322.7 077.1

August, 07 31.20 24.4 86.0 190.4 500.3 122.0

September, 07 30.20 23.0 85.0 87.4 214.0 093.1

October, 07 29.00 20.1 85.0 73.4 198.9 205.2

November,07 26.00 16.0 83.0 39.3 076.0 160.0

December, 07 22.30 11.0 80.0 28.3 014.5 187.3

January, 08 22.00 10.0 78.0 35.6 030.1 144.1

February,08 22.40 10.0 78.0 32.3 014.2 163.5

March,08 16.20 14.2 80.0 62.1 074.0 166.2

Total 938.7 2064.2

the year. The total monthly evaporation wasrecorded less than total monthly rainfall duringrespective months except during four monthsDecember to March, 2008. The maximum sunshinehour was observed only during October monthwhen sky was clear, comparatively lesser sunshinewas recorded during rainy season (June toSeptember).


RICE

LOWLAND RICE TRIALSeven lines were tested under fine grain lowland

rice. Growth, yield attributes are depicted in Table1for perusal. Maximum yield (62.00 q/ha) wasrecorded in RCPL 1-121. The next best line underfine grain were RCPL 1-73, RCPL 1-76 and RCPL1-118.

RCRT fine grain genotypes

RCRT UPLAND TRIALEntry RCPL 1-115 showed maximum yield

potential, followed by RCPL 1-113, BHALUM- 2and RCPL 1-117 under upland conditions (Table2).


CROP SCIENCE

Table 1. Yield attributes and yield data of fine grain lines

Varieties Pant height No. of effective Panicle No. of grains / Test weight Yieldcm tillers length (cms) panicle (gms) (t/ha)

RCPL 1-73 103.85 a 26.33 b 27.3a 130.0 a 23.23 a 4.18 a

RCPL 1-75 111.06 a 15.0 a 28.1 ab 161.67 a 29.06 a 3.26RCPL 1-76 106.87 a 23.67 ab 26.73 a 138.67 a 23.34 a 4.13 a

RCPL 1-118 116.86 b 26.67 b 28.03 ab 121.33 a 23.46 a 4.13 a

RCPL 1-119 165.27 c 25.33 a 27.07 ab 178.0 a 15.74 a 2.60RCPL 1-120 163.37 c 17.0 ab 31.23 c 147.67 a 17.21 a 2.20RCPL 1-121 122.31 b 16.0 ab 29.97 bc 236.0 b 27.18 a 6.20

Means followed by same letter are not significantly (P=0.05) different in a column.

Table 2. Yield attributes and yield data of upland lines

Varieties No. of effective Plant height Panicle No. of grains / Test weight Yieldtillers (cm) length (cm) panicle (g) (t/ha)

RCPL 1-113 7.67 a 102.07 ab 24.67 bc 169.67 bc 28.20 a 2.71 c

RCPL 1-45 6.0 a 112.23 c 25.17 bc 120.33 a 35.67 2.08 bc

RCPL 1-46 6.33 a 99.33 ab 26.83 c 182.33 c 27.43 a 2.13 RCPL 1-114 11.33 92.87 a 23.13 ab 128.67 ab 27.46 a 1.81 BHALUM- 2 4.33 a 92.57 a 21.73 a 121.67 a 30.07 a 2.65 c

RCPL 1-115 8.0 a 104.40 21.73 a 120.67 a 29.26 a 3.06 d

BHALUM- 1 6.33 a 92.0 a 24.90 abc 146.33 a 29.83 a 1.58 a

RCPL 1-116 5.33 a 99.43 ab 22.80 abc 153.67 a 25.66 a 2.00 b

RCPL 1-117 13.67 115.0 d 24.37 abc 120.33 a 30.63 a 2.61 c



RCRT/AROMATIC/07Nine lines were evaluated under aromatic

category and yield potential was observed between2.8-5.3 t/ha under lowland conditions. The best linefound was IET 16313, the high yield potential ofthis line may be correlated with more (200) no. ofgrains/panicle. The next best lines were observedare RCM- 16, IET- 17281, IET- 17276 and RCM-17.

Table 3. Yield attributes and yield data of aromatic lines


IET- 16313 16.67 a 106.62 a 27.53 a 225.0 c 25.06 a 5.39 d

IET- 17281 21.33 c 103.56 a 27.53 a 116.0 a 24.06 a 4.29 b

IET- 17276 18.67 b 113.53 b 26.97 a 132.33 a 27.91 a 4.05 b

IET- 17278 14.33 a 105.13 a 27.70 a 153.33 a 24.13 a 3.89 b

IET- 16332 13.33 a 115.71 c 28.67 a 146.0 a 26.89 a 3.79 b

RCM- 14 17.67 a 127.20 e 26.87 a 105.33 a 21.06 a 3.23 a

RCM- 15 13.0 a 123.24 d 29.40 a 191.33 b 20.78 a 2.81 a

RCM- 16 12.33 a 104.02 a 26.97 a 190.33 b 25.93 a 4.45 c

RCM- 17 12.67 a 125.60 d 26.97 a 186.0 b 31.25 4.07 b


Table 4.Yield attributes and yield data of lowland lines


IET-18581 14.33 145.00 c 24.70 139.00 27.65 3.18RCM- 22 13.00 106.96 a 26.63 188.33 23.72 4.15IET-18582 14.33 142.68 c 28.97 195.00 23.87 4.87RCM- 11 25.33 121.82 b 27.30 185.00 25.29 6.57BM- 9820 6.67 107.49 a 24.20 197.67 24.73 5.31RCM- 20 14.33 109.98 a 25.97 157.67 24.47 4.49RCM- 19 13.33 106.04 a 25.07 163.67 24.02 3.60IET- 18571 16.33 110.0 a 28.07 158.67 25.18 5.31Lampnah 13.67 124.83 b 27.00 157.33 23.78 4.10IET- 18564 16.67 141.0 23.97 119.67 27.82 2.12RCM- 21 11.00 102.60 a 26.50 168.00 26.19 3.86RCM- 18 16.33 128.21 b 25.67 127.67 22.25 4.15Shahsarang 13.33 126.25 b 26.80 166.67 23.29 5.31


RCRT/LOWLAND/07Thirteen lines were evaluated under lowland

conditions. RCM -11 recorded maximum yieldpotential of 6.57 t/ha. Other potential varietiesunder lowland conditions were BM- 9820, IET-18571, Shah Sarang, IET-18582, RCM- 20 andLampnah.


FIBRE CROPS

Linseed variety evaluation trial during rabiseason 2007-08.

Under AICRP on linseed, 15 promising lineswere evaluated under irrigated conditions. Thespacing was 25 cm x 8 cm between the rows andplants respectively. Maximum no. of plant (56.33)/m2 was recorded in line 070213. However, days toflowering and maturity did not differ significantlyamong the entries. The line no. 070213 recorded

the highest yield (1819.98 kg/ha), highest no. ofcapsules/plant (220) and no of seeds /capsule (12).

Initial evaluation trial (IVT) was also taken with13 linseed lines under rainfed conditions as mostof the arable lands in Nagaland are rain fed. Lineno. 070105 was found best in terms of yield(1279.98 kg/ha). The other growth and yieldattributes (no. of plants/m2, no. of capsules/plantand no. of seeds /plant) were also significantlyhigher in this line. However, line no. 070113matured early (129 days) and recorded less no ofdays (73) to flowering.

Table 1. Performance of various linseed cultivars/varieties under irrigated foothills

Culture/ Final plant Days to Days to Av. no. of Av. No. 1000 grain Grain yieldvariety stand / flowering maturity capsules/ of seed / wt. (g) kg/ha

square meter plant capsule

070201 44.33 102 162 202 10 6.10 1067.66070202 52.33 100 160 208 12 6.50 1580.00070203 36.00 102 162 85 8 6.60 1067.66070204 35.66 101 161 92 10 6.20 1220.00070205 51.33 98 165 210 10 6.80 1600.00070206 35.00 95 164 110 11 6.10 853.00070207 32.00 94 162 112 12 6.15 1086.65070208 37.00 96 163 115 10 6.25 1066.66070209 41.66 100 164 215 8 6.20 1619.98070210 37.33 101 165 150 6 6.50 1113.32070211 41.00 98 168 160 10 6.60 1266.65070212 42.66 98 162 145 12 6.50 1306.65070213 56.33 97 163 220 16 6.50 1819.98070214 38.33 99 164 150 8 6.50 1086.66070215 51.00 100 165 201 12 7.10 1333.32(P=0.05) 4.10 NS NS 14.21 085 NS 120.50

Table 2. Performance of various linseed lines under rainfed condition

Culture/ Final plant Days to Days to Av. no. of Av. No. 1000 grain Grain yieldvariety stand / flowering maturity capsules/ of seed / wt. (g) kg/ha

square meter plant capsule

070101 42.33 92 146 92 8 6.21 1113.32070102 36.33 96 146 85 10 6.25 786.66070103 37.33 86 144 86 11 6.27 873.33070104 37.00 92 146 98 8 6.58 919.99070105 59.00 83 146 450 16 7.50 1279.98070106 44.00 73 144 125 12 6.30 833.32070107 48.66 93 145 115 10 6.66 766.65070108 51.00 79 146 126 10 6.89 773.33070109 62.66 96 146 142 8 7.10 846.66070110 50.67 70 146 145 12 7.20 1000.00070111 36.66 82 146 142 11 7.15 1133.22070112 45.33 83 146 132 12 7.00 1000.00070113 48.33 73 129 115 14 7.00 1086.66(P= 0.05) 4.50 7.52 14.40 12.21 9.23 NS 90.52


IVT Irrigated

IVT Rainfed

CROPPING SYSTEMS

Integrated nutrient management on paddyThe experiment was conducted in split plot

design with three replications. The soil of theexperiment site is slightly loamy clay, acidic inreaction with pH 4.90-5.50 and deficient innitrogen, moderate in phosphorus with fare amountof fixed phosphorus, moderate to high in availablepotash. The initial average soil fertility level werefound with organic carbon, nitrogen, phosphorusand potash of 1.95, 236.20 kg /ha, 12.30 kg/ha and200.20 kg/ha respectively.

The main plot treatments consisted ofcombination of organic sources as crop residues(M1), FYM (M2), biofertilizer (M3) and mixed of

crop residues, FYM, biofertilizer-PSM andAzospirillum (M4) and sub plot treatments werecontrol (S1), 50% NPK (S2), 75% NPK (S3) and100% NPK (S4).The plant height was statisticallyat par in M1,M4 and M3 but it was significantlyhigher in M2. Improvement on no. of grain /panicleand panicle length was observed in M4. Grain andbiological yield was observed higher in M4 but atpar with M3. The similar trend was also observedin subplot except in plant height and panicle length.Further in main plot treatments non significanteffect was on days to 50 % flowering and testweight but significant effect was observed insubplot treatments on test weight.

Experiment on INM in paddy based croppingsystem

Number of effective tillers and test weight wasstatistically at par with treatments, plant height,panicle length, grain and biological yield werebetter under biofertilizer and combination of crop


residues, FYM and biofertilizers in main plottreatments. In subplots treatments higher doses offertilizer was less responsive in terms of no. of grainper panicle, grain and biological yield.

FYM alone showed significantly higher plantheight of maize at harvest time, but there wasstatistically at par effect of various treatments onno. of plants/m . With higher doses of fertilizeralong with organic combination comparativelyhigher no. of cobs/plant was recorded but in organiccombination of treatment there was no effect onno. of cob/plant. Combination of crop residues,FYM and biofertilizers recorded maximum grainand biological yield in maize.In inorganictreatment, significant difference was observed

among control, 50 %, 75 % and 100 % ofrecommended doses of fertilizers (RDF).

Integrated Nutrient Management in maize-French bean cropping system

The French bean (Phaseolus vulgaris L.) wastaken as subsequent crop in maize based croppingsystem.

Crop residues and combination of FYM,biofertilizers and crop residues recorded maximumincrease in plant height over FYM and biofertilizeralone in French bean. The better response in cropresidues treatment may be due to more availabilityof nutrient through mineralization process of thecrop residues left in previous crop of paddy. There

Table 1. Yield and yield attributes of paddy under different INM treatments

Treatments Plant height No. of Panicle No. of grains Test Grain Biological(cm) effective tillers length (cm) /panicle weight(g) yield (t/ha) yield (t/ha)

Main PlotM1 116.19 b 15.36a 23.00 205.83 25.20 a 3.58 7.02M2 110.67 a 14.97 a 25.43 a 191.08 a 26.80 a 4.23 8.52M3 113.91 ab 14.63 a 26.05 a 180.17 a 25.90 a 4.45 a 9.03 a

M4 116.58 b 15.75 a 27.00 ab 239.16 26.95 a 4.57 a 9.25 a

Sub plotS1 109.69 a 14.19 a 22.32 194.75 a 24.50 a 3.81 8.02S2 112.75 ab 15.61 a 24.98 a 190.58 a 26.30 a 4.35 8.75 a

S3 116.30 bc 15.69 a 25.91 a 219.83 b 26.90 a 4.25 a 8.52 a

S4 118.60 c 15.22 a 26.57 211.08 b 27.10 a 4.42 a 9.02 a


Table 2. Yield and yield attributes of maize under different INM treatments

Treatments Plant No. of Number Number Number Test Grain Biologicalheight plants/ of cobs / of rows/ of kernels/ weight yield yield(cm) at m plant cob row (g) (t/ha) (t/ha)harvest

Main PlotM1 217.77 a 4.42 a 1.25 a 8.78 14.33 a 230.85 1.94 a 5.31a

M2 245.20 4.33 a 1.47 a 11.80 ab 19.11 255.12 a 2.16 6.04M3 212.42 a 4.42 a 1.28 a 10.33 a 11.97 a 253.42 a 1.98 a 5.30 a

M4 217.42 a 4.58 a 1.53 a 11.00 ab 9.22 255.70 a 2.43 5.97Sub plotS1 201.36 4.25 a 1.11 a 10.33 a 13.47 a 251.31 1.23 3.12S2 227.50 a 4.50 a 1.42 ab 10.88 a 13.08 a 244.67 a 2.28 6.37S3 232.33 a 4.42 a 1.39 ab 10.25 a 13.97 a 255.27 2.38 6.63S4 231.61 a 4.58 a 1.61 b 10.44 a 14.11 a 243.85 a 2.62 6.50



was no effect of treatment in main and subplot onno. of plants per meter row length and no. ofbranches/plant. However, higher no. of pods perpant was recorded in combination of FYM,biofertilizer and crop residues. 75 % RDF wasrecorded statically at par no. of pods/ plant and no.of seeds/ pod. Maximum grain and biological yieldwas recorded in biofertilizer and 75 % RDF whichwas observed non significant over biofertilizer,FYM alone and also over 100 % RDF in Frenchbean.

Table3. Growth parameters of French bean in response to residual effect of integrated nutrientmanagement

Treatments Plant No. of No. of Days to Number Number Grain Biologicalheight plants/m branches/ 50 % of pods/ of seeds/ yield yield(cm) at plant flowering plant pod (t/ha) (t/ha)harvest

Main PlotM1 47.55 b 18.25 a 3.83 a 34.00 a 9.08 a 6.25 a 1.16 a 3.78 a

M2 43.61 a 18.75 a 3.50 a 34.00 a 10.58 b 6.08 a 1.21 b 4.04 b

M3 41.63 a 18.50 a 3.58 a 34.08 a 10.50 a 6.83 b 1.25 b 4.08 b

M4 47.24 b 18.75 a 3.83 a 34.18 a 13.58 c 7.17 b 1.24 b 4.14 b

Sub plotS1 42.74 a 18.00 a 3.67 a 33.75 a 7.83 a 5.92 a 1.01 3.58S2 46.20 b 17.75 a 3.75 a 34.09 a 9.33 a 6.08 a 1.17 a 3.81S3 44.97 ab 19.00 a 3.67 a 34.33 a 12.20 b 67.75 b 1.27 a 4.13 a

S4 46.13 b 18.75 a 3.67 a 34.08 a 11.42 b 7.58 b 1.26 a 4.23 a


ORGANIC FARMING

Development of package of practices for organicfarming in Nagaland

Experiments were carried out in paddy, soybean,groundnut and maize with varieties Tekke, JS 335,ICGS 76 and Vijay composite, respectively during2007-08. The treatments consisted of pure organic@5 t/ha + green manure @2.5 t/ha, farmer’spractice (traditional), pure chemical (100%) andintegration of organic and inorganic inputs.Theresults have been depicted in tables1-14.

Groundnut

Table 1. Plant height (cm) in groundnut cvICGS-76 at different growth stages

Treatments Plant height (cm)

30 DAS 60 DAS 90 DAS

Pure organic 29.40a 62.35 ab 84.39Traditional 31.27 a 69.30 74.23Pure chemical 23.77 59.80 a b 99.43Integrated 26.67 59.23 a 80.81

At 90 days after sowing pure chemical wasrecorded with maximum plant height but at 30 and60 DAS pure organic was also recorded with equaleffect on plant height that of chemical agriculture.Maximum no. of branches per at 90 DAs wasrecorded in pure organic treatments. Integrated

Table 2. No. of branches in groundnut cv ICGS-76 at different growth stages

Treatments No. of branches

At 30 DAS At 60 DAS At 90 DAS

Pure organic 9.50 a 13.34 ab 19.60 b

Traditional 9.50 a 13.23 ab 17.47 ab

Pure chemical 9.50 a 12.38 a 16.57 a

Integrated 8.72 a 14.69 18.10 ab


agriculture recorded maximum yield andbiological yield and organic agriculture was foundsuperior over traditional practices of nutrientmanagement.

Table 3. Days to first, 50 % and 100 % floweringin groundnut cv. ICGS-76

Treatments Number of days to flowering

First 50 % 100 % Days toflowering flowering flowering maturity

Pure organic 22 29 34 134Traditional 24 31 35 133Pure chemical 31 33 37 133Integrated 30 34 38 132

Maize

Table 5. Plant height (cm) of maize at differentgrowth stages under variouscombination of organic and inorganictreatments


30 DAS At 60 DAS At 90 DAS

Pure organic 102.47 245.00 a 262.83Traditional 87.57 246.13 a 275.37Pure chemical 72.00 a 182.97 b 191.40 a

Integrated 73.30 a 188.13 ab 193.13 a

Table 6. Days to first, 50 % and 100 % floweringof maize at different growth stagesunder various combination of organicand inorganic treatments




Maize crop had also performed better underorganic treatments over traditional practices (Table7) but higher yield was recorded in integrated andchemical agriculture.

Table 4. Yield and yield attributes of groundnut

Treatments No. of Total no. No. of Pod weight/ Pod Biologicalplants at of pods / kernels/ plant yield yieldharvest plant pod (g) (t/ha) (t/ha)

Pure organic 28.20 a 59.02 a 2.66 a 43.47 2.78 8.10Traditional 26.30 a 22.73 2.11 30.20 1.94 5.72Pure chemical 25.20 a 58.67 a 2.77 a 39.23 3.30 9.82Integrated 26.20 a 67.50 3.00 a 47.37 3.61 10.59

Means followed by same letter are not significantly (P=0.05) different in a column


Paddy

Table8. Plant height (cm) of upland paddy atdifferent growth stages



Pure organic 49.08 a 62.35 ab 106.71Traditional 48.17 a 69.30 b 100.71Pure chemical 44.00 59.80 ab 113.52Integrated 48.56 a 59.23 a 120.33

Table 9. No. of tillers/hill of upland paddy atdifferent growth stages

Treatments No. of tillers/hill

30 DAS 60 DAS 90 DAS

Pure organic 8.26 c 20.83 22.47 a

Traditional 7.84 bc 24.93 a 23.33 a

Pure chemical 7.17 ab 25.80 a 17.27 a

Integrated 6.72 a 19.70 29.70

Table 10. Days to first, 50 % and 100 %flowering in upland paddy




Table 11. Yield attributes and yield data ofupland paddy

Treatments Panicle No. of Test Grain Biologicallength grains/ weight yield yield(cm) panicle (g) (t/ha) (t/ha)

Pure organic 26.21 a 197.53 a 26.20 3.37 6.63Traditional 26.26 a 189.57 25.20 2.59 5.16Pure chemical 27.75 b 202.20 a 26.30 4.0 a 8.12Integrated 27.59 b 215.67 26.00 4.16 a 8.76

Means followed by same letter are not significantly (P=0.05) differentin the column.

Observations on rice crop under uplandconditions had been given in table 8-11, maximum,no. of tillers per hill integrated agriculture (Table8). The no. of days from first flowering to maturitywere between 75-113 (Table 10) under differenttreatments, generally there was no effect oftreatment on flowering and attainment of maturity.Significant difference was observed among alltreatments on grain yield of rice. But organictreatments resulted in higher yield over traditionalpractices.

Soybean

Soybean var. JS 335 was also taken undervarious production systems to see comparativeproductivity levels (table 12-14). There was morethan 35 % yield advantage under organic soybeanproduction than under traditional farmers’practices.

Table 7. Yield attributes and yield data of maize at different growth stages under variouscombinations of organic and inorganic treatments

Treatment No. of plant No. of No. of No. of Grain Biologicalbearing cobs/ rows/ kernels yield / yieldcobs /m2 at plant cob /row ha (t/ha) (q/ha)harvest

Pure organic 12 a 2.33 12.40 a 36.00 2.24 6.23Traditional 12 a 2.00 a 14.20 34.60 a 1.44 4.26Pure chemical 15 2.00 a 12.80 a 34.60 a 2.87 a 7.10 a

Integrated 12 a 2.00 a 13.20 34.2 a 2.73 a 6.70 a

Means followed by same letter are not significantly (P=0.05) different in a column


Table12. Plant height (cm) of soybean cv. JS335 at different growth stages undervarious combination of organic andinorganic treatments



Pure organic 45.23 b 87.67 93.97 a

Traditional 40.80 a 82.00 95.80 a

Pure chemical 43.25 ab 73.45 92.57 a

Integrated 48.63 78.37 98.83

Table 13. Days to first, 50 % and 100 %flowering of maize at different growthstages under various combination oforganic and inorganic treatments




Table 14. Yield attributes and yield data of maize at different growth stages under variouscombinations of organic and inorganic treatments

Treatments Plants No. of No. of seeds No. of Grain Yield Biological/m2 pods/plant /pod branches (t/ha) yield (t/ha)

Pure organic 15.0 a 116.67 2.67 7.33 1.46 4.31Traditional 16.0 a 161.00 a 3.00 a 8.00 a 1.03 3.15Pure chemical 15.0 a 158.72 a 3.00 a 8.42 a 1.79 5.22Integrated 16.0 a 169.67 3.00 a 9.33 1.93 5.85


OILSEEDS

Variety evaluation trial on rapeseed, mustardand toria

In collaboration with National Research Centreon Rapeseed and Mustard, potential lines were

evaluated under foothills of Nagaland. Sez-2 wasfound comparatively better in yield (2.1 t/ha). Intoria group, four varieties were evaluated and theiryield potential ranged from 0.85 to 1.1 t/ha. PT303 showed maximum yield potential (1.1 t/ha)under rain fed conditions of foothills of Nagaland.

Table 1. Growth and yield attributes of different mustard lines

Varieties Plant Days Days to No. of No. of No. of Length No. of Yieldheight to 50 % maturity plants branches siliqua/ of seeds/ (t/ha)(cm) at flowering /m2 / plant plant siliqua siliqua90DAS (cm)

Sej- 2 146.67 49.0 115.0 17 5.33 104.33 4.48 8.80 2.1PT-507 95.0 32.0 76.0 22 2.67 38.33 5.16 17.80 0.25JD- 6 111.27 53.0 116.0 15 5.33 134.67 3.90 8.40 0.80Bhawani (Toria) 100.20 28.0 78.0 15 5.33 91.00 6.40 15.00 0.50Kanti. 126.65 49 110 13 7.44 177.67 4.51 9.53 0.61NDRE-4 119.24 31 108 15 6.44 140.00 3.91 8.20 1.05CD at (P= 0.05) 10.30 3.52 8.12 1.62 0.41 8.50 0.45 1.25 0.09


Table 2. Growth and yield attributes of different mustard lines

Varieties Plant Days Days to No. of No. of No. of Length No. of Yieldheight to 50 % maturity plants branches siliqua/ of seeds/ (t/ha)(cm) at flowering /m2 / plant plant siliqua siliqua90DAS (cm)

PT-507 149.97 32 98 10 8.33 162.67 6.26 15.00 0.85PT-507 144.93 34 102 13 11.33 105.00 5.96 13.60 0.98 PT-303 132.13 32 98 17 22.00 322.67 5.96 11.80 1.10 PT-303 136.20 32 98 17 10.67 212.00 5.64 13.80 1.00CD at (P= 0.05) 13.20 NS NS 1.32 1.30 18.50 NS 1.32 0.10

VEGETABLES

Development of organic farming practices fortomato and cabbage

Popular variety of tomato (NS-812) and cabbage(Pride of India) were grown in a plot size of 2m x2m. Organic manures were applied @ 3.5 kg/m2

while synthetic fertilizers were applied @ 100 N:60 P: 60 K kg/ha. All standard agronomic practiceswere followed.

Maximum plant height (68.33 cm) and numberof branches/plant (11.15) were recorded withvermicompost which was on par with that ofchemical fertilizer (65.67 cm & 10.67) and poultrymanure (63.35 cm & 9.65). For all the traits studied,cattle manure, pig manure and rabbit manuretreatments were found to be inferior. Fruit yieldwas also recorded maximum (32.5.t/ha) with theapplication of vermicompost and found on par withchemical fertilizer.

Table 1. Effect of organic manures on growthand yield of tomato cv. NS-812

Treatments Plant No. of No. of Yieldheight branches fruits (t/ha)(cm) per / plant

plant

Cattle manure 57.67 9.23 32.67 28.98Pig manure 55.50 8.57 33.08 27.64Rabbit manure 52.87 7.80 30.85 25.75Vermi compost 68.33 11.15 41.33 32.55Poultry manure 63.35 9.65 37.65 29.42Inorganic Fertilizer 65.67 10.67 39.40 31.86Control 46.27 6.25 22.54 21.56 CD at (P= 0.05) 7.45 0.89 7.62 2.54

In case of cabbage cv. Pride of India also,maximum plant height (34.62 cm), number of outerleaves (11.36) and yield (310.65 q/ha) was obtainedwith the application of vermicompost, which wasclosely followed by chemical fertilizer and poultrymanure.

Table 2. Effect of organic manures on growthand yield of cabbage cv. Pride of India

Treatments Plant No. of Yieldheight outer (t/ha)(cm) leaves

Cattle manure 28.85 8.50 27.03Pig manure 28.00 8.34 26.42Rabbit manure 29.04 8.94 27.85Vermi compost 34.62 11.36 31.07Poultry manure 31.57 9.86 28.95Inorganic Fertilizer 33.87 10.55 30.67Control 21.87 6.22 20.88CD at (P= 0.05) 2.84 0.63 2.45

Ecology, management and insecticidal controlof blister beetle in bhindi

Seasonal incidence of blister beetle, Mylabrispustulata on okra cultivar Arka Anamika wasstudied. The initial attack was observed during 2nd

week of June and gradually the peak populationwas recorded in 2nd week of July. The crops sownin May and June were severely affected ascompared to March-April grown crops. Applicationof Malathion dust (25 kg/ha) reduced more than74% of adult beetle activity. However, the treatmentwas ineffective during rainy days. Treatments likeChlorpyriphos (0.05%), Endosulfan (0.07%),Cypermethrin (0.02%), neem oil (0.2%) and cattle


urine (5ml/ litre water) were not effective.Chemical treatments were more effective than eco-friendly means to reduce the adult population. Itcan be safely conclude that bhindi should be sownduring March – April not only to escape the pestbut also to fetch premium market price prevailingfor the early crop.

Evaluation of orange fleshed sweet potatovarieties

Six orange fleshed clones obtained fromCTCRI, Bhubaneshwar were evaluated underfoothills of Nagaland during 2007. The orangefleshed varieties are rich in â-carotene. Theexperiment was laid out in an RBD with fourreplications. 30cm vine cuttings were planted at aspacing of 40X20cm.

Results revealed that (Table 3) highermarketable yield was recorded in Gouri (30.8 t/ha) followed by Acc. No. 187017-2 (19.1 t/ha).

Higher vine length and lesser number of branches/ plant were recorded in Acc. No. 187017-1 (291cm& 7.8) as compared to Gouri (172.3 & 11.0)indicating that the number of vines were inverselyproportional to the length of vine. Similarly, highernumber of tubers/ vine was recorded in Gouri (5.1)as compared to Sankar (2.5) which indicates thatthe number of tuber/ vine contributed more thanother parameters to yield.

Among the genotypes evaluated, Gouri and Acc.No. 187017-1 were found to be the best sweetpotato lines for marketable tuber yield.

Evaluation of short duration cassava varietiesAn experiment with seven improved short

duration varieties viz., Sree Vijaya, Sree Jaya, H-165, H- 226, Sree Prakash, Sree Visakham andMegha 36 along with a local, each at 100cm X75cm was laid out in an RBD with threereplications to see their vegetative growthperformances. Results indicated that the length of

Table 3. Evaluation of orange fleshed sweet potato for growth and tuber yield

Genotypes Vine length No. of vines Tuber No. of tuber Marketable(cm) / plant length (cm) / plant yield (t/ha)

Gouri 172.3 11.2 14.0 5.10 30.8420027 186.7 8.4 9.4 1.97 9.2St 14 210.7 7.7 10.4 2.12 13.1187017-1 291.3 6.5 14.8 1.72 19.1Sree Arun 181.6 10.0 13.9 2.12 17.4Sankar 265.6 7.8 12.6 2.50 10.5CD at (P= 0.05) 48.28 4.2 4.7 0.89 7.6

Table 4. Yield characteristics of short duration tapioca varieties

Variety Tuber length Girth of No. of tubers Weight of Marketable(cm) tuber (cm) / plant tuber/ plant (kg) yield(t/ha)

Sree Vijaya 19.5 15.9 5.7 1.95 25.9Sree Jaya 37.6 14.5 3.0 1.60 21.3H- 165 29.2 20.3 5.2 3.10 42.6H- 226 31.9 17.4 6.0 3.70 49.9Sree Prakash 25.6 17.5 6.0 2.60 34.6H- 1687 28.0 23.3 4.3 2.10 29.5Megha 36 38.2 15.9 8.0 4.20 56.5Local 37.0 21.8 5.5 2.70 35.9CD at (P= 0.05) 6.8 4.3 0.73 0.31 5.86


tuber was maximum in Megha 36 (38.2cm)followed by Sree Jaya (37.6cm) and local (37.0cm)and lowest in Sree Vijaya (19.5cm). Higher girthof tuber was recorded in H-165 (20.25cm) andlowest in Sree Jaya (14.5cm). Number of tubersper plant were more in Megha 36 (8) followed byH- 226 and Sree Prakash (6 each). Highestmarketable yield was recorded in Megha 36 (56.5t/ha) followed by H- 226 (49.9 t/ha).

Evaluation of brinjal germplasm for bacterialwilt resistance/ tolerance under Nagalandconditions

Seven promising lines developed throughhybridization breeding followed by selection atManipur Centre of the Institute, were evaluated ina replicated trial at Nagaland Centre with ArkaKeshav (resistant variety from IIHR, Bangalore)as local check. The results indicated that Sel.1 (7x8)came to flowering in 55.3 days and was the earliest.Sel. 2 (4 x 7) and Sel. 3 (5x9) had maximum numberof primary branches (4.6 each) closely followedby Sel. 7 (4.5) and Sel. 1 (4.4). The maximum fruitlength (18.53 cm) was recorded in Sel.1. Sel 2,which bears oval type fruits, recorded maximumgirth (5.7 cm). All the lines are clustered bearingtype, high yielding and resistant/ tolerant tobacterial wilt disease.

Efficacy of biofertilizers on growth and yield ofonion

In an experiment to see the efficacy ofbiofertilizers on onion cultivar N-2-4-1,Azospirillum brasilense and Azotobacterchroococum were applied singly and incombination with reduced fertilizer dosage. Theexperiment had 13 treatment combinations in RBDin 2 replications. It was observed that thebiofertilizer inoculum could supplement almost25% of the N requirement of the crop. Thoughvegetative and yield characteristics were recordedmaximum with 100%N + biofertilizercombinations (T12) yet they were similar to 75% N+ combined biofertilizer (T11) and 100%N (T3).Azospirillum seems to be more efficient in acidicsoil conditions than Azotobacter. The reducednitrogen dosage (chemical fertilizer) has initiatedthe neck fall early (by 15-20 days) as compared tofull recommended N dosage. This may be due tothe fact that with higher N dosage the neckthickness is also increased. Reduced nitrogendosage can be one of the strategies to maneuverthe maturity period suiting to our needs of earlyharvest especially in areas where early rains are arule rather than exception.

Table 5. Performance of brinjal germplasm under Nagaland conditions

Selections Plant height Avg. no. of Days to 50% Avg. fruit Avg. girth Productivity(cm) branches flowering length (cm) of fruit(cm) (t/ha)

1x7 (Sel 5) 50.9 3.2 59.7 11.93 8.4 14.85x9 (Sel 3) 57.4 4.6 56.0 12.67 10.4 21.57x8 (Sel 1) 64.4 4.4 55.3 18.53 8.2 20.54x7 (Sel 2) 55.1 4.6 60.7 8.76 12.2 18.64x9 (Sel 7) 54.5 4.5 60.0 12.15 9.9 15.93x9 (Sel 6) 57.8 2.9 61.0 14.70 11.1 14.73x8 (Sel 4) 50.8 3.6 59.0 10.26 8.8 21.7Arka Keshav 53.9 4.3 57.7 11.73 10.0 19.5CD at (P= 0.05) 5.86 0.68 6.15 1.26 1.34 2.27


Table 6. Efficacy of biofertilizers on onion cv.N-2-4-1

Treatment Plant No. of Shoot Avg. Horizontal Vertical Yieldheight leaves girth bulb diameter diameter (t/ha)(cm) /plant (mm) wt. (g) (cm) (cm)

T1 – 50% N 50.6 8.5 14.86 42.0 5.52 4.21 18.25T2 – 75% N 54.5 9.5 14.70 54.0 6.07 4.56 21.88T3 – 100% N 59.2 10.0 15.79 65.0 6.63 4.88 30.50T4 - T1 + Azotobacter 52.63 8.9 14..71 42.0 5.81 4.41 16.38T5 - T2 + Azotobacter 54.14 9.6 14.54 59.0 6.03 4.55 19.50T6 - T3 + Azotobacter 58.20 9.4 16.49 64.5 6.65 4.83 29.63T7 - T1 + Azospirillum 55.4 9.3 14.69 56.8 6.21 4.72 23.13T8 - T2 + Azospirillum 57.60 9.6 16.55 65.0 6.50 4.86 33.75T9 - T3 + Azospirillum 58.16 9.7 16.89 67.0 6.58 4.78 35.75T10 - T1 + Azotobacter + Azospirillum 56.93 9.3 15.32 58.5 5.95 4.85 27.13T11 - T2 + Azotobacter + Azospirillum 59.82 10.0 17.13 68.0 6.49 4.92 36.25T12 - T3 + Azotobacter + Azospirillum 60.34 10.4 17.14 70.0 6.63 5.09 38.13T13 – Control (no chemical & biofertilizers) 48.6 8.4 13.15 41.0 5.10 4.08 13.50CD at (P= 0.05) 4.62 1.21 1.86 5.42 0.62 0.41 4.83

ANIMAL SCIENCES

ANIMAL REPRODUCTION

Characterization of growth related genes inNagaland local and crossbred pigs

Genomic DNA was isolated from whole bloodof Nagaland local and crossbred pig. The specificprimers were used for PCR amplification of GH,GHRH and LH genes in Nagaland local pig breeds.All the three genes were successfully amplifiedfrom the genomic DNA.

Fig. 1. Agarose gel showing PCR amplification ofgrowth hormone (GH) gene (605 bp) in pig. Lane

M: 100 bp marker; Lane 1-2: Nagaland local,Lane 3-4: Hampshire cross, Lane 5-6: Large WhiteYorkshire cross, Lane 7-8: Large Black cross and

Lane 9-10: Assam local

Fig. 2. Agarose gel showing PCR amplification ofgrowth hormone-releasing hormone (GHRH) gene(455 bp) in pig. Lane M: 100 bp marker; Lane 1-

2: Nagaland local, Lane 3-4: Hampshire cross,Lane 5-6: Large White Yorkshire cross, Lane 7-8:

Large Black cross and Lane 9-10: Assam local

Fig. 3. Agarose gel showing PCR amplification ofLuteinizing hormone (LH) gene (700 bp) in pig.

Lane M: 100 bp marker; Lane 1: Nagaland local,Lane 2: Hampshire cross, Lane 3: Large White

Yorkshire cross and Lane 4: Large Blackcrossbred

1 2 3 4 5 6 7 8 9 10 M

500 bp

M 1 2 3 4 5 6 7 8 9 10

500 bp

500 bp

M 1 2 3 4


Studies on early sexual maturity of non-descriptNaga local pigs

A total of 12 local Naga boars aged between 45and 91 days and 2.3 to 3.4 kg were divided intotwo groups (group-I and II) based on their age.Group I pigs consisted of six animals aged 53±7days (range= 45 to 61 days) and 2.4±0.41 kg(range=2.3 to 2.6 kg). Testes including theepididymis were collected from all experimentalboars through open surgical method of castration.The right and left epididymis were trimmed offfrom the body of the testes and semen samples werecollected from three parts of the epididymis througha 1.0 cm incision made (with a scalpel blade) onany of the locations (caput, corpus and cauda ofthe epididymis). Sperm cells were removed fromthe cauda epididymis with a Pasteur pipette. Theincision of the caput and corpus epididymis flushedwith 2-3 drops of PBS, kept at body temperature.Concentration of spermatozoa in cauda epididymiswas determined by hemocytometer method.

The mean (±SEM) testicular weight, length andbreadth for group I vs II boars were 23.6±2.3 vs32.9±4.6 g, 4.9±0.7 vs 6.4±0.9 cm, and 3.9±0.3

ves 4.1±0.4 cm, respectively. The mean testicularweight and length of group II were higher (P<0.05)than group I animals. The mean (±SEM)concentration of spermatozoa (x 106/ml) in caudaepididymis for group II were higher (P<0.001) thangroup I boars (2303±120 vs 5523±214). Thepercentage of sperm motility increasedsignificantly (P<0.05) from caput through caudaepididymis in both the group-I and II. The spermmotility that recorded for caput, corpus and caudaepididymal spermatozoa for group II weresignificantly higher (P<0.001) than group I boars.

The percentage of live spermatozoa decreased(P<0.01) from caput to corpus and then to caudaepididymis in both the groups. In all three sectionsof the epididymis, the mean percentage of livespermatozoa were significantly higher (P<0.001)in group-II than -I (Table 1). The percentage of headabnormalities decreased (P<0.05) from caput tocorpus but were similar (P>0.05) between corpusand cauda epididymis in group I boars (Table 2).On the other hand, percentage of abnormal headsdecreased significantly (P<0.01) from caput tocorpus and then to cauda epididymis in group II

Table 1. Mean (±SEM) percentage of sperm motility and live spermatozoa recorded in caput,corpus and cauda epididymis of local Naga pig for group-I (n=6) and –II (n=6)

Attributes Epidydimal parts

Caput Corpus Cauda

Group I Group II Group I Group II Group I Group II

Sperm motility 10.0±5.0 30.0±7.6b 13.3±7.3c 45.0±8.3 15.0±4.5 85.0±11.3Live spermatozoa 43.3±7.9a 94.3±7.4b 34.4±6.2c 86.5±9.3d 25.3±5.3e 79.5±8.8f

Table 2. Mean (±SEM) percentage of head, midpiece and tail abnormalities, and abnormal acrosomerecorded in caput, corpus and cauda epididymal spermatozoa of local Naga pig for group-I (n=6) and –II (n=6)

Attributes Epidydimal parts

Caput Corpus Cauda

Group I Group II Group I Group II Group I Group II

Head abnormality 15.2±3.3a 2.2±0.1b 11.3±2.6c 1.1±0.2d 9.7±1.9c 0.6±0.1eMidpiece abnormality 5.6±0.8a 1.7±0.112b 4.1±0.7c 0.70±0.0 3.3±0.7e 0.3±0.0fTail abnormality 7.8±2.1a 5.9±0.9b 6.9±1.2a 4.7±0.7c 4.9±1.1c 4.2±0.7cTotal abnormality 28.6±3.9a 9.8±0.8b 22.3±1.6c 5.5±0.7d 17.9±2.3 5.1±0.8dAbnormal acrosome 79.4±6.5a 43.6±5.9b 67.2±8.9c 22.3±5.2d 54.3±7.6e 5.8±1.2df


animals. In each section of epididymis, group IIboars had significantly lower (P<0.001) incidenceof head abnormalities than group I. The occurrenceof midpiece abnormalities decreased (P<0.01) fromcaput to corpus and then to cauda epididymis inboth group I and II (Table 2). In each individualsection of epididymis, group-I boars had higherincidence (P<0.01) of abnormal midpiece than –II(Table 2). Percentage of abnormal tails were similarfor caput and corpus of groups I and corpus andcauda epididymis of group II (Table 2). LowerIncidence (P<0.01) of tail abnormalities wererecorded in cauda epididymis than caput or corpusof group I boars. Cauda epididymal spermatozoaof group II animals exhibited lower percentage ofabnormal tails than caput or corpus epididymis(Table 2). The caput and corpus epididymis ofgroup II had significantly lower (P<0.01) incidenceof abnormal tails than group I boars .

Acrosome integrityThe incidence of abnormal acrosomes

decreased (P<0.01) from caput through caudaepididymis in both group-I and II. In each sectionof the epididymis, group II had lower (P<0.001)percentage of abnormal acrosomes than group Iboars. The sows kept along with Naga boarsdelivered piglets at 205±5 day following the lastparturition. Based on our farm data, the mean lengthof gestation period in this breed was 115±6 days.As calculated, the sows were conceived at 90±4days post-partum. The body weight of the pigletcastrated at 90 days of age was 3.0±0.3 kg.

Proximal droplets in spermatozoa

ANIMAL HEALTH

Immunostimulation in farm animalsImmunostimulation experiment was conducted

in chicken using twenty commercial broiler birdsof either sex at two weeks of age. Water solubleadjuvant fraction of M.phlei (WSA-MP) was usedas immunostimulator at the dose rate of 10 mg/kgbody weight once weekly for two weeks. TheWSA-MP treated group has shownimmunostimulation with augmented antibodyresponse (7.3 + 0.94 Log2 titer) and cell mediatedimmune response (28.46 + 2.75 % LMI) to theselected S. pulloram antigen. Nonspecificimmunostimulation was evident with increase inphagocytic index of macrophages (196.32 + 6.54%) in the immunostimulated birds (Table 1). Theincrease in specific as well as nonspecific immunityfollowing immunostimulation were statisticallysignificant (P<0.01). No significant adverse effectswere observed on growth and other physiologicalparameters in the experimental birds followinginoculation of WSA-MP.

Table 1. Immunostimulation activities of WSA-MP in chicken

Group Antibody CMI Phagociticresponse response index of(log 2 titer) (% LMI) Macrophage

(%)

A. WSA - MP 7.3 28.46 196.32+ 0.94 + 2.75 + 6.54

B. Control 6.2 18.85 174.26+ 0.77 + 1.91 + 5.73

Managing upland rice landscape for householdfood security and environmental sustainability

1. Experiment: Identification and evaluation ofweed and pest management optionsPaddy cv- Nagaland localEcosystem – sloppy uplandNo. of replication- 5Name of the farmer- Kentipe (Mhainamci village,Jalukie)


Table 1. Effect of weed management in rice

Treatments Plant No. of Weed Grainheight tillers population yield(cm) /plant /m2 (t/ha)

Chemical (2,4D) 105.96a 19.00 a 5.60 2.66 a

Manual 102.88 a 18.80 a 2.00 a 2.81 a

(3 hand weeding)Chemical + 106.08 a 21.40 a 3.20 a 2.85 a

Manual(1 hand weeding)Control 96.38 13.20 19.20 1.33

Means followed by same letter are not significantly (P=0.05)different in a column

Weeds are the major problem under uplandconditions and in Nagaland a sizeable area iscovered by upland rice cultivation. Participatorytrials were conducted at Mhainamci village ofJalukie during 2007-08. Chemical, manual andchemical + manual weeding practices recordedsignificantly higher increase in grain yield overcontrol. Combination of chemical and one handweeding was found to be most economical.

Stem borer is the main pest of paddy crop inNagaland. Under upland sloppy conditions it is notadvisable to use pesticide due to socio-economic,ecological and other reasons. The farmers are alsoreluctant to use for chemicals for pest control. Tofind out suitable non chemical approach, aparticipatory trial was conducted on five farmers’field in 10m x10m plots. Use of bio agent(Trichogramma) in commercial formulation oftricho cards was found superior and the integrated

pest management for rice stem borer was found asmuch effective as application of chemical(Carbofuran 3G).(Table 2)

Table 2. Observations on population of stemborer per meter square

Treatments Jhum land Lowland(upland var. (var.Ranjeet)Bhalum 1)

Stem Grain Stem Grainborer yield borer/ yield/m2 (t/ha) m2 (t/ha)

Chemical 15.80 ab 3.0 a 13.60 a 4.23 a

(carbofuran3G)Biological (Tricho 20.20 b 2.9 a 21.80 b 3.82cards and liquidTrichoderma)IPM 15.20 a 3.0 a 16.00 ab 4.15 a

Control 103.00 c 2.3 107.60 c 3.36

Identification of crop combination that can begrown with under slopping upland

The intercropping in upland rice withleguminous crop was tried under participatorymode, the inter crop of soybean and groundnutrecorded land equivalent ratio of more than one.The yield advantage due to groundnut and soybeanwas 7 and 12 % respectively over sole crop ofupland paddy. Intercropping of legumes also helpedin building the soil fertility.

Under lowland conditions participatory trialwere conducted to find out good varieties underlowland aromatic and non aromatic categories.

Table3. Effect of intercrops on plant height of paddy and soybean at harvest

Intercrop combination Upland paddy (tekke) Intercrop Intercrop Intercroppingsoybean groundnut performance(JS 335) (ICGS 76)

Treatments Plant Effective Grain Grain Grain LERheight tillers yield yield yield(cm) /plant (t/ha) (t/ha) (t/ha)

Paddy+ soybean 98.82 a 13.60 a 2.23 0.88 1.03 1.126Paddy+ groundnut 99.92 a 14.80 ab 1.92 - - 1.07Paddy (sole crop) 100.98 a 15.80 b 2.76 - - -



Among aromatic lines AR-3 recorded maximumgrain yield and among non aromatic lines

Table 4. Evaluation of aromatic and non aromatic lowland lines

Aromatic lowland lines Non aromatic lowland lines

Variety Plant Tillers Yield Variety Plant Tillers Yieldheight /hill (t/ha) height /hill (t/ha)(cm) (cm)

AR-1 100.58 a 17.60 ab 3.47 a JR-2 113.84 a 21.20 a 4.25 a

AR-2 96.70 a 18.40 b 4.13 b Shahsarang 111.76 a 22.40 a 5.12AR-3 92.90 a 22.50 c 4.25 b Ranjeet 120.62 15.40 4.00 a

AR-4 96.98 a 14.60 a 3.41 a Nagaland Special 128.84 21.00 a 3.01Gumdhan 131.88 17.20 ab 2.51


Shahsarang was best (5.1t/ha) followed by JR-2(Table 4).


Research articles1. Jha, Anjani Kumar, Rathore S. S. and Singh

Shamsher 2006. Effect of organic manuresand Rhizobium inoculation on growth andyield of French Bean (Phaseolus vulgarisL.). Indian J. Hill Farming 19(1&2):90-92

2. Jha, Anjani Kumar, Rathore S. S. and SinghShamsher. 2006. Studies on propagation timeof Assam lemon (Citrus limon L.) throughstem cuttings. Indian J. Hill Farming19(1&2):155-157

3. Kumaresan A., Bujarbaruah K.M.,Karunakaran M., Das Anubrata, BardoloiR.K. 2008 Assessment of early sexualmaturity in nondescript local pigs ofnortheast India: Testicular development,spermiogram and in vivo pregnancy.Livestock Science.116, 342-347 .

4. Karunakaran, M., Mondal, M., Rajarajan,K., Karmakar, H.D., Bhatt, B.P., Das, J.,Bora, B., Baruah, K.K., Rajkhowa, C., 2008.Early puberty in local Naga boar of India:assessment through epididymalspermiogram and in vivo pregnancy. AnimalReproduction Science, doi:10.1016/j.anireprosci.2008.02.009 in press

Abstracts1. Narsimha Rao, B., Jha Anjani Kumar,

Sunilkumar K.and Roshan R.K. 2007. Effectof mulching and INM on the yield andquality of pineapple In Souvenir andAbstract- Second Indian HorticultureCongress on Opportunities and Linkages forHorticulture Research and Development (18-21Apr., 2007), ICAR Research Complex forNEH Region, Umiam , Meghalaya. pp148

2. Rathore S.S. and Jha Anjani Kumar. 2007.Studies on spatial intensification of bananaplantation with legume and non legumeintercrop In Souvenir and Abstract- SecondIndian Horticulture Congress onOpportunities and Linkages for HorticultureResearch and Development (18-21 Apr.,2007), ICAR Research Complex for NEHRegion, Umiam , Meghalaya. pp162-163

3. Narsimha Rao, B., Sunilkumar K., JhaAnjani Kumar and Roshan R.K. 2007.Evaluation of orange fleshed sweet potatofor growth and tuber yield under Manipurconditions. In Souvenir and Abstract-Second Indian Horticulture Congress onOpportunities and Linkages for HorticultureResearch and Development (18-21 Apr.,2007), ICAR Research Complex for NEHRegion, Umiam , Meghalaya. pp182-183.

PUBLICATIONS


SIKKIM CENTRE


Meteorological data recorded at the meteorological observatory, Tadong,Gangtok – 737 102 for during April, 2007- March, 2008.

Month Temp (OC) Relative humidity (%) Rainfall Sunshine Evaporation(mm) hours (mm)

Max Min Max Min

Apr.07 24.54 15.27 86.63 52.13 333.70 4.13 3.85May.07 27.90 17.88 85.93 51.93 253.70 4.98 4.64Jun.07 27.22 19.24 88.70 64.56 504.90 1.77 3.77Jul.07 25.79 20.14 91.06 75.48 581.90 1.02 3.21Aug. 07 27.45 20.21 89.90 67.9 428.60 3.00 3.93Sep.07 26.20 18.79 89.93 66.36 595.50 3.20 3.67Oct.07 25.10 16.86 89.06 58.74 122.50 3.43 4.16Nov.07 21.44 11.93 87.00 49.00 37.90 3.30 4.28Dec.07 17.20 8.90 86.19 47.70 0.00 3.03 3.09Jan.08 15.6 7.6 85.4 50.12 9.80 2.56 3.00Feb.08 17.72 7.23 83.41 41.58 05.20 4.48 3.36Mar.08 22.81 12.28 84.06 45.5 4.50 3.62 3.70Average 23.25 14.69 87.27 55.95 2878.2* 3.21 3.72

* Average value for all weather data except for rainfall

WEATHER


RICE

Comparative evaluation of rice in SRI methodwith that of recommended package of practicesunder terrace farming of Sikkim

The experiment on rice was conducted in a splitsplot design to test the efficiency of SRI (Systemsof Rice Intensification) over scientific managementpractices (SMP) under organic conditions inSikkim. Three varieties i.e. Pusa Sugandh-2,Sasharang-1, and Attey were combined with threesystems i.e inorganic, organic equivalent, andcontrol. Two methods of cultivations namely SRIand SMP were assigned to subplot treatments withthree replications. Pusa Sugandh-2 registeredsignificantly higher grain yields (3.53 t/ha) underSMP compared to SRI (3.40 t/ha). However,Sasharang produced significantly higher grain yield(4.7t/ha) in SRI compared to SMP (4.1t/ha). Attey,the dominant local variety proved to besignificantly superior in SRI (3.2 t/ha) to SMP (2.1t/ha). Rice under SRI matured 15 days earliercompared to SMP.

Testing of rice genotypesEight rice varieties viz. Sasharang, Satyaranjan,

Ranjit, Ketakijoha, Aghanibora, Geetanjali, PusaSugandh and Attey were evaluated under organicconditions by applying 10tFYM/ha in RCBD. Theyields recorded by the above varieties were 5.0,


CROP SCIENCE 4.3, 0.5, 0.38, 0.5, 5.0, 3.3 and 1.3 t/ha, respectively.Ketakijoha was found to be susceptible to blast atearly stage where as Ranjit was found to besusceptible to brown leaf spot rice.

INSECT AND PESTS

Eco friendly management of insect pests inorganic rice cultivation

Evaluation of the efficacy of some eco- friendlyinsecticides against insect pests of rice

The bio efficacy of six eco friendly insecticidesviz., Biopower (Beauveria bassiana), Biomagic(Metarhizium anisopliae), Vericel (Verticilliumlecanii), Nimbicidine, Achook and Multineem wasevaluated by taking monocrotophos as checkagainst insect pests of rice. All the insecticidesreduced insect populations and gave higher yieldover untreated control. But in comparison to checkinsecticide monocrotophos the effectiveness of allthe eco friendly insecticides was foundsignificantly inferior. Among the safe insecticides,Nimbicidine @3ml/l was found most effectivefollowed by Achook @3 ml/l for managing stemborer, whorl maggot and leaf folder. Metarhiziumanisopliae and Beauveria bassiana were foundeffective to control the population of gundhi bug.

Studies on population build up of insect pestsof rice and their natural enemies

The population build up of insect pests and theirnatural enemies was studied by taking observationsat fortnightly interval starting from second fortnightof July to first fortnight of November in a fixedplot. The total plot was divided into four plots fortaking various observations. It was observed fromthe study that the stem borer, leaf folder, whorlmaggot and gundhi bug are some important pestsof rice in Sikkim. The stem borer infestation wasfound maximum during August-September (4.54-7.62% DH). The whorl maggot started theinfestation at the initial stage of the crop andSRI vs SMP SMP vs SRI


damaged maximum (24.25 damaged leaves/10hills) in the second fortnight of July. The leaf folderpopulation was found maximum in the month ofAugust. Gundhi bug population was foundmaximum when the crop attained the milky stagein the first fortnight of October (16.40 bugs/10hills). Among the natural enemies the populationof spiders, Apanteles and dragon flies was recordedin the months of August and September but theCoccinellid beetle population was found maximumduring the last fortnight of September.

MAIZE

Breeding for early maturing maize compositesand hybrids suitable for low input farming inSikkim

Twenty composites namely, Early composite,Gujarat makkai-1, Gujarat makkai 2, Kesari, L-174,Megha composite, NAC 6002, NAC 6004,Narmada moti, NLD white, Prabhat, Pratap-1,RCM 1-1, RCM 1-3, Suwan, Vijay, VL 16, VL 41,VL Makka 11 and VL Makkai 88 were evaluatedat ICAR Research Complex for NEH Region,Sikkim Centre Farm Tadong, located at 1350 mamsl, for the last three years (2003-2006) inreplicated trial using organic inputs. The highyielding composites with consistent performancewere NAC 6004 (4.62 t/ha), Suwan (4.25 t/ha),Narmada moti and Gujarat makkai 6 (3.75 t/ha)and VL Sankul Makkai 11 (3.50 t/ha).

Five QPM maize lines received from VPKASAlmora namely FQH 57, FQH 61, FQH 65, FQH69 and FQH 4567 were evaluated along with checks(Vivek hybrid 9, 15 and Vivek sankul 11) duringKharif 2007 under organic condition following 40x30 cm spacing. The entry FQH 57 recorded thehighest yield (4.45 t/ha). The above varieties canbe recommended for the mid hills of Sikkim.

A total of 261 F1 hybrids were synthesisedinvolving a multiple cob bearing Sikkim PrimitiveMaize (known as Murali Makkai) as one of theparent. Evaluation of these hybrids at mid hills

showed that the cross combination Murali makkaix EC 1181 recorded the highest seed yield (5.2 t/ha).

INSECTS AND PESTS

Eco-friendly management of major insect pestsof maize in Sikkim

Two supervised field trials were conductedduring kharif 2007 to study the efficacy of eco-friendly insecticides and locally availablebotanicals viz., Eupatorium odoratum (Banmara),Schima wallichii (Chelaoni), Artemisia vulgaris(Sitapati) and Datura stromanium (Dhaturo) incomparison with standard insecticides carbofuronand monocrotophos against major insect pests ofmaize. Periodical surveys were undertaken toidentify natural enemies in the maize ecosystem.

Incidence of major pest armyworm, Mythimnaseparata and semilooper Plusia signata and minorpests aphid Ropahlosiphum maidis was observed.The results revealed that, among all the treatmentscarbofuron @ 1 kg a.i./ha provided good controlover M. separata and C. partellus. Among the eco-friendly insecticides Pestoneem 0.5 EC @ 1 l/haeffectively checked the population of M. separataand Dipel 8L @ 500 ml/ha provided effectivecontrol of C. partellus and P. signata. The resultsof second field experiment revealed that, amongthe locally available botanicals A. vulgaris(Sitapati) @ 5% extract effectively checked thepopulation of M. separata and P. signata


CROPPING SYSTEMS

Nutrient budgeting and performance evaluationof various Maize-Blackgram –winter crops (pea,coriander, mustard, broccoli, cabbage) basedcropping systems under organic system

Five different cropping systems namely Maize-blackgram-mustard, Maize-blackgram-Pea, Maize-blackgram-cabbage, Maize-black gram-corianderand Maize-black gram-brocoli were evaluatedunder organic conditions with the organicequivalent of the recommended doses of fertilserin RCBD keeping the objective to increase farmincome, cropping intensity and sustainability.Maize composite variety Vivek Sankul Makka-11was sown in March 1st week and harvested in Juneand then black gram (local variety) was sown inJuly and harvested in October and then winter crops(cabbage, mustard, pea, coriander and broccoli)were taken. Maize yields was 4.47 t/ha and theblackgram yield was 0.63 t/ha. The yields of peaseeds, coriander (green leaf), mustard (seeds) ,cabbage and broccoli were found to be 1.33, 9.35,1.28, 42.8 and 7.4t/ha, respectively.

Performance evaluation of soybean –mustard(lai patta) cropping system under organiccondition in Sikkim

A soybean- laipatta (leafy mustard) croppingsystem was tested under organic conditions.Soybean variety PK-1042 was tested during Kharifwith four levels of FYM (0, 5.0, 7.5 and 10.0 t/ha)and during rabi seasons laipatta was sown with anduniform doses of 5 t FYM/ha. Soybean yield of2.26 t/ha was recorded from 10 t FYM/ha whichwas found to be significantly superior over otherlevels. The soybean yields of 2.01, 1.82 and 1.6 t/ha were obtained from application of 7.5, 5.0 and0 t FYM/ha, respectively. Maximum laipatta wasobtained from the residual effect of 10tFYM/ha tosoybean along with application of 5tFYM/ha.Laipatta yields of 12.86, 11.12 and 9.10 t/ha wererecorded from residual effect of 7.5, 5.0 and 0 tFYM/ha to soybean along with 5tFYM/haapplication. After harvest of Laipatta leaves, theplants were allowed to flower and set seed. A seedyield of 0.36, 0.32, 0.26 and 0.24 t/ha were obtainedfrom the residual effects of application of 10, 7.5,

5.0 and 0tFYM/ha to soybean + 5tFYM/ha tolaipatta.

SOIL AND WATER RESOURCES

Identification and standardization of organicsources of nutrition of maize, rice, soybean andbuckwheat

Organic manure was produced by pit methodusing weeds (Artemisia vulgaris, Eupatorium sp.,)leaves (Alnus nepalensis, Schima wallichii), cowdung and soil in the ratio 10: 4: 0.5 + soil. Fullyrotten mixed compost contained N- 2.20 %, P -1.02 % and P- 1.54 %. Mixed compost application@ 5 t/ha was expected to release nearly 80 kg N,50 kg P2O5 and 70 kg K /ha, respectively.

Studies on organic nutrition of maizeVar. Vivek Sankul Makka-11 with Dolomite was

applied for soil acidity management @ 2 t/ha.Mixed compost, neem cake, azophos seedtreatment and vermicompost were applied as soleor in different combinations as various sources oforganic nutrition. Under organic nutrition highestgrain yield was recorded with the treatment ofmixed compost 2.5 t/ ha + neem cake 0.5 t/ha +vermicompost 2.5 t/ha (4550 kg/ha) and Buckwheatgreen manuring + mixed compost 2.5 t/ha (4340kg/ha) as compared to control (1450 kg/ha).

Studies on organic nutrition of soybeanTen treatments as starter dose from chemical

fertilizers, mixed compost, neem cake and dolomitein nine combinations and one no nitrogen controlwere imposed on soybean var. PK-1024 duringkharif 2007. N:P:K @ 30:40:30 was applied aloneand in conjunction with neem cake and dolomite@ 2 t/ha. Neem cake 1 t/ha + mixed compost 2.5 t/ha + dolomite@ 2 t/ha (3300 kg /ha) wasstatistically at par with integrated nutrientmanagement through urea +SSP+MOP @ 30:40:30+ dolomite @ 2 t/ha + Neem cake @ 0.5 t/ha (3120kg/ha).

Studies on organic nutrition of mustardShort duration, high yielding mustard variety

M-27 was sown in November 2007 under organic


nutrient management and was irrigated once at theflowering stage. Mixed compost @ 5 t/ ha +vermicompost @ 1 t/ha + neem cake @ 1 t/ ha +dolomite @ 1 t/ha yielded 940 kg/ha as comparedto 210 kg/ha in no fertilizer control.

Studies on organic nutrition of riceStudies were conducted in kharif 2007 with

three improved rice varieties VL Dhan-61, PusaSugandh II, Pant Dhan-10 and one local check“Attey” under two organic sources of nutritionmixed compost and neem cake to evaluate theirperformance in terms of yield, yield attributes andN-use efficiency in comparison with 3-split ureaapplication. The rice grain yields ranged from 2.1to 3.8 t/ha with mixed compost; 2.4 to 4.6 t/ha withmixed compost and neem cake as compared with2.5 to 4.4 t/ha rice grain yield with 3-split ureaapplication. The no fertilizer control yield rangedfrom 1.23 to 1.78 t/ ha.

Studies on organic nutrition of buckwheatA local cultivar “Mithe” was sown in two

spacings of 20 x 20 and 30 x 30 cm in fourreplications on which six treatments were imposed.Five treatment combinations of mixed compost,neem cake and seed treatment with azophos alongwith control were basally applied at sowing. It wasobserved that higher grain yield was producedunder the 20 x 20 cm spacing as compared to 30 x30 cm. The grain yield of Buckwheat local cultivarunder organic nutrition management through mixedcompost 5 t/ha + neem cake 0.5 t/ ha was 1450 kg/ha and neem cake 1 t/ha + azophos seed treatmentproduced 1120 kg/ha as compared to 1435 kg hathrough N:P:K @ 40: 80: 40 at the end of theconversion period.

FRUITS

Studies on kiwi cultivation for sustainableproduction in Sikkim

Evaluation of germplasm for growth, yield andquality:

Among four varieties, Hayward gave maximumyield (1.22 t/ha) followed by Allison (0.98 t/ha).

Fruit weight was recorded maximum (88g/fruit) inHayward whereas maximum TSS (12.5%) wasrecorded in Allison with acidity 1.1%

Effect of training and pruning time on floweringTwo time cane pruning in July and Nov gave

maximum flowering shoots whereas, fruit set, fruitdrop and yield was not affected by increasedflowering shoots

Efficacy of pollen method on fruit setOut of self cross and manual pollination, self

pollination didn’t result in any fruit set. Whereasopen pollination gave 35% fruit set and manualpollination gave maximum fruit set with superiorquality fruits and higher fruit weight (112g/fruit)

Development of package of practices for thestrawberry production in Sikkim

Varietal evaluation under polyhouse and openconditions

Out of sixteen strawberry varieties evaluatedunder polyhouse and open conditions, maximummarketable yield was recorded in Chandler inpolyhouse (882g/plant) followed by Ofra inpolyhouse (852g/plant). Maximum marketableyield in open cultivation was recorded in Chandler(632g/plant) followed by Ofra (611g/plant).

Environmental conditions on runner productionSixteen varieties were screened in open as well

as polyhouse. Maximum runner production was


recorded in var. Etna (19.00) and minimum inBelruby (16.00) under open condition. Minimumrunner production was recorded in Ofra (5),Chandler (5) and Selva (4) under polyhouse

Effect of environmental conditions on fruitquality

Sixteen polyhouse and open cultivated varietieswere evaluated for fruit quality in terms of TSS/acid. Fruit quality was better under polyhouse thanunder the open conditions. Superior fruit quality(TSS/Acid) was recorded in Chandler (7.42) underpolyhouse followed by Ofra (6.56) , Selva (6.37)and Etna (6.32)

Effect of time of transplanting on fruit andrunner production in open and polyhouseconditions

Ofra and chandler varieties were planted inAugust, September and October. Chandlertransplanted in the month of September gavemaximum fruit yield/plant (982g) with minimumrunner production (4), which was followed bychandler and ofra transplanted in the month ofAugust for maximum fruit yield and minimumrunner production.

Effect of mulching on fruit yield and fruitrotting

Paddy straw, Sacchrum sp, tree leaves and blackpolythene were evaluated along with control (nomulch) for fruit yield and fruit rotting. Sacharumsp. mulching gave 67% marketable yield followedby tree leaves and paddy straw. Plant mortality wasrecorded maximum in black polythene mulchingfollowed by paddy straw (13%). Fruit rotting wasmaximum (55%) in no mulch followed by blackpolythene (27%)

Effect of environmental conditions on diseaseseverity

Under open, polyhouse and low tunnel systemof strawberry production, leaf spot was observedmaximum in open condition (10-50%) followed bylow tunnel (0-15%) and minimum in polyhouse(0-8%). Peak disease appearance was recorded duringMay-June. Severity of leaf spot was recorded morein var. Ofra as compared to Chandler.

VEGETABLES

CHILLI

Characterization and development of organicpackage of practices for local chilli (DalleKhorsani) in Sikkim

Collection and evaluationFifteen germplasm of chilli were collected from

all over Sikkim, West Bengal and south India.Characterization and evaluation is under progress.

Varietal evaluation of cole crops

CABBAGEFour varieties were evaluated for their yield

performance. Among them Bahar performed better


with respect to duration yield and harvest indexfollowed by Krishna. The head weight of Baharwas 25 – 30% more than that of Tekia and Quisto.

Performance of cabbage varieties

Varieties Days to Head Yield Harvestplantingto wt. (t/ha) indexharvesting (kg)

Bahar* 82.4 1.5 40.0 74Quisto 96.7 1.2 35.0 69Tekia 84.5 1.1 33.0 72Krishna 84.3 1.3 37.5 68

*Bahar performed better than other varieties

Performance of cabbage var. Bahar with respectto planting time

Cabbage var. Bahar was planted in differentmonths to assess its performance in differentmonths. It was observed that October planting wasthe most suitable planting time for cabbage as yieldreduced with the delay in planting.

Fig. Variation in the yield(t/ha) of cabbage withthe planting time

CAULIFLOWERTwo varieties were evaluated for their yield

performance. Among them Suwashini performedbetter with respect to duration and yield. Suwashiniout yielded Indam hybrid

Varieties Days to Curd Yield Harvestplantingto wt. (t/ha) indexharvesting (kg)

Suwashini 80.5 1.1 28.5 72Indam Hy. 82.6 1.0 2.65 73

BROCCOLIBroccoli var. Aishwarya was planted in different

months to assess its performance in differentmonths. It was observed that October planting wasthe most suitable planting time for broccoli as headweight reduced with the delay in planting.

Plantingtime Days to Head Yield plantingto wt. (t/ha)harvesting (kg)

October* 72.5 0.4 12.0November 74.2 0.3 10.0December 75.2 0.28 8.0January 74.2 0.25 7.0

Biorational management of insect pests of majorcole crops in sikkim

Three supervised field trials were conductedduring rabi 2007-08 with 7 treatments and 3replications to study the efficacy of locallyavailable botanicals viz., Eupetorium odoratum(Banmara) , Schima wallichii (Chelaoni),Artemisia vulgaris (Sitapati) and Daturastromanium (Dhaturo) against major insect pestsof cabbage, cauliflower and broccoli.

Major pests observed were cutworm (Agrotissp), semilooper ( Trichoplusia ni) and red ant,Dorulus sp. The results revealed that among all

Semilooper

Cutworm


the treatments carbofuron @ 1 kg a.i/ha providedgood control. Among the botanical extracts A.vulgaris @ 5% effectively checked the populationof cutworm and semilooper. Twoentomopathogenic microbes were identified fromthe semilooper.

AGROFORESTRYDevelopment of suitable management practicesfor different agroforestry systems with specialreference to their productivity and sustainability

Sikkim mandarin based AFSTo assess the growth performance of mandarin

and yield of intercrop, the trial with Sikkimmandarin was carried out for sixth consecutive year.Ginger, turmeric, maize and soybean were sownas intercrops in kharif season, whereas mustard wassown in rabi season in association with mandarin.

Ginger with Sikkim mandarin, soybean withSikkim mandarin

The average yield (t/ha) in association with fruittree was; ginger (7.6), turmeric(4.17), maize(2.87),mustard(0.57) and soybean(0.89) and the yields(without tree) were 21.4, 11.47, 3.67, 1.2 and 1.9t/ha respectively. The average height of mandarinwas 3.75 m, girth 26.4cm and spread of canopy1.77 m with intercrop and in control (withoutintercrop) it was height 4.5 girth 30.65cm andcanopy spread 1.97m.The average fruit yield ofmandarin was 9.5 kg/tree with intercrop and15.63kg/tree in control. Stem borer attack wasobserved in Sikkim mandarin trees.

Guava based AFSA trial of intercropping with guava was carried

out for fourth consecutive year to compare theproductivity of different component in AFS.Ginger, maize and soybean were sown as intercropsin kharif season, whereas mustard was sown in rabiseason in association with guava. The averageyields of intercrops were recorded in ginger (4.2 t/ha), turmeric (4.5 t/ha) maize (2.7 t/ha), andmustard (.6 t/ha). The sole yield (without tree) 21.4,11.47, 3.67, 1.2 and 1.9 t/ha respectively. Theaverage fruit yield of guava was 12.5kg/tree incontrol (without under storey crop) and with cropfruit yield (8.5kg/tree) was obtained. Stem borerattack was observed in guava trees.

Large cardamom based AFSEffect of MPTS on growth and yield of largecardamom

In this system large cardamom (Ammomumsubulatum) var. Sawney was planted with fourmultipurpose tree species. During the fifthconsecutive year, growth and yield performanceof large cardamom was recorded with Leucaenaleucocephala. Average no of spike /clump was 9.8,average no. of capsules/spike was 4.8, average no.of capsules/clump was 47.80 and average yield perplant was 36.02g followed by Alnus nepalensiswhere average no of spike /clump was 5.4 , averageno. of capsules/spike was 6.6, average no. ofcapsules/clump was 35.64 and average yield perplant was 27.08g.The minimum yield was recordedwith Ficus hookerii . Average no of spike /clumpwas 3.0, average no. of capsules/spike was 5.25,average no. of capsules/clump was 15.75 andaverage yield per plant was11.97g.


ANIMAL SCIENCES

ANIMAL NUTRITION

Comparative evaluation of different types ofsilages prepared with local fodders of Sikkim

Twelve non-pregnant non-lactating Banpalaewes weighing 31.5 kg were divided into 3 groupsof 4 animals each in a completely randomizeddesign to determine the comparative nutritive valueof silages. The animals in group I was offered maizestover silage whereas in groups II and III, maizestover- nevaro silage (prepared mixing maize stoverand nevaro at 1:1 ratio on as such basis) and maizestover-napier-jungle grass silage (prepared bymixing maize stover, napier and jungle grass at1:1:1 ratio on as such basis) was offered,respectively. The dry matter intake was 32.4, 35.9and 53.0 per kg metabolic body size per day ingroups I, II and III, respectively which wassignificantly (P< 0.05) different from each other.The dry matter digestibility was 47.3, 42.9 and 60.7% in groups I, II and III, respectively.

The dry matter digestibility in group III wassignificantly (P<0.05) higher than groups I and II.However, there was no significant differencebetween groups I and II. Similar trend was observedin organic matter digestibility. The digestibility ofcrude protein was 60.1, 49.6 and 59.2 % in groupsI, II and III, respectively. However, there was nodifference among the groups. The NDF digestibilitywas 57.8, 35.7, and 59.9 percent in groups I, II andIII, respectively which was significantly (P<0.05)higher in groups I and III than group II. However,there was no significant difference in betweengroup I and III. Similar trend was observed inhemicelluloses and cellulose digestibility. Thenitrogen balance per kg metabolic body size perday was 0.15, 0.19 and 0.23 g in groups I, II andIII, respectively which did not differ significantlyamong the groups. It was concluded that maizestover – napier - jungle grass silage was better thanother silages.

Effect of supplementation of spent malt in silagebased ration in sheep

Twelve non-pregnant non-lactating Banpalaewe weighing 26.4 kg were divided into 3 groups

of 4 animals each in a CRD to determine the effecton nutrient utilization due to incorporation of spentmalt in the ration of sheep. The animals in group Iwas offered ad lib maize stover-nevaro silagewhereas in groups II and III 50% and 100% of themaize stover nevaro silage was replaced with spentmalt on dry matter basis, respectively. The drymatter supplemented through spent malt was 0,229.8 and 617.2 g in groups I, II and III, respectivelywhich corresponded to 0, 53.8 and 100 % of thetotal dry matter intake.

Supplementation of spent malt tended toincrease (P = 0.092) dry matter intake where asdry matter, organic matter, neutral detergent fibre,hemicellulose and cellulose digestibility increased(P d” 0.041) linearly). The digestibility of crudeprotein was not affected (P = 0.245) due tosupplementation of spent malt. Nitrogen intake aswell as loss through faeces and urine increased (Pd” 0.008) linearly due to incorporation of spent maltin the ration. However, nitrogen balance wasunaffected (P = 0.559) due to supplementation ofspent malt in the maize stover- nevaro silage basedration. It was concluded that supplementation ofspent malt in maize stover- nevaro based rationincreased nutrient utilization.

Effect of incorporation of nevaro as acomponent on silage quality and supplementaleffect of spent malt to it, on nutrient utilizationin sheep

Twelve non-pregnant non-lactating Banpalaewe weighing 28.7 kg were divided into 3 groupsof 4 animals each in a completely randomizeddesign to determine the effect of graded level ofprotein supplementation due to incorporation ofnevaro leaves and twigs as an ingredient andsupplementation of spent malt on nutrientutilization. The animals in group I was offered adlib maize stover silage, group II ad lib maize stover- nevaro silage and group III ad lib maize stover -nevaro silage supplemented with spent malt. Thedry matter intake in groups II and III wassignificantly higher than group I. However, therewas no significant difference between the groups.The dry matter digestion was 49.7, 42.9 and 54.0% in groups I, II and III, respectively which wassignificantly (P < 0.05) lower in group II than groupIII. However, there was no significant differencebetween group I and II and between group I and


III. Similar trend was observed in organic matterdigestibility. Neutral detergent fibre digestibilitydiffered significantly (P < 0.05) with each otherand was 56.8, 35.7 and 68.3 percent in groups I, IIand III, respectively. Hemicellulose digestibilitywas 67.5, 46.1 and 57.6 percent in groups I, II andIII, respectively which was significantly (P< 0.05)higher in group I than groups II and III. However,there was no significant difference between groupsII and III. Cellulose digestibility was higher(P<0.05) in group I than group II but no significantdifference between groups I and III and between IIand III. The nitrogen balance was 0.09, 0.19 and0.13 g per kg metabolic body size per day whichwas significantly (P<0.05) higher in group II thangroup I. However, there was no significantdifference between groups II and III and between Iand III. It was concluded that the incorporation ofspent malt on maize stover-nevaro silage based dietincreased nutrient utilization in sheep.

Effect of supplementation of spent malt on ricebean based diet on milk production in cow

Seven plots of different sizes located in the farmof ICAR were cultivated with rice bean. The plotswere ploughed in the month of April and were sownin the first week of May with the seed rate of 100kg/ha. Rice bean was harvested in the month ofJuly at pre-flowering stage. No manure was appliedin any plot. The yield on fresh basis was 2.00 kg/m2.

Twelve cows weighing 274.8 ± 6.42 kg withmilk yield 8.7 ± 0.67 kg were divided into 3 groupsof 4 animals in each in a completely randomizeddesign. The animals in group I were offered ad librice bean fodder whereas in groups II and III similarration was offered along with supplementation ofspent malt @10 and 20 kg, respectively. Thesupplementation of spent malt decreased intake ofrice bean linearly (P < 0.001). However, total drymatter intake was unaffected (P = 0.483).Supplementation of spent malt increased dry matterdigestibility as well as milk production per daylinearly (P d” 0.004). It was concluded that spentmalt supplementation in rice bean based ration incow has beneficial effect on milk production.

Evaluation of feeds and fodders of Sikkim interms of their antimethanogenic activities

In vitro fermentation studies in glass syringeswere conducted in fodders available at 4500 and

14000 feet (alpine) altitudes in the presence ofbuffer and inoculums of cow dung (50 g freshlycollected and diluted in 200 ml buffer in thepresence of carbon dioxide) for determination ofmethane production. Approximately 0.25g samplesof Amlisho (Thysanolaena agrostis), Gogun(Saurauia nepaulensis), Kabra (Ficus benjamina),Kimboo (Ribesgta ciale), Nevaro (Ficushookerii)and Barhar (Artocarpus lakoocha),Selenium wallichii, Epilobium wallichaianum,Persicaria nepalensis, Ligularia sp., Bergeniapurpurescens, Megacodon sp. Pedicularismegalantha, Rheum accuminatum, Potentillamicrophylla, Euphorbia sp. or Parnesia sp. wasintroduced in 100 ml glass syringe in triplicate,added 30 ml of inoculum in each syringe and keptin a water bath maintained at 39°C for 96 hours.One set (triplicate) of blank was also runsimultaneously without fodder. Total gasproduction was recorded at 3, 6, 12, 18, 24, 30, 42,48, 72, and 96 hours and at the end 10 ml ofsaturated potassium hydroxide was introduced ineach syringe for absorption of carbon dioxide andrecording of methane production. Amlisho andKimboo produced lowest (P<0.05) quantity ofmethane (fig.1).

Fig.1. Methane production from different typesfodders during in vitro studies

Effect of cutting jungle grasses on yield andavailability of fodders as by-products of varioushorticultural and agricultural crops

Nine plots of 2 m x 1 m size at different placeswere selected and equally divided into two of 1 mx1 m size where naturally grown grasses wereavailable. The grasses grown in half portion i.e. 1m x 1 m area were cut thrice in the month of July,September and December whereas, in the other


half, grasses were cut once in December. The drymatter yield of grasses was 0.829 ± 0.078 and 0.622± 0.129 kg, respectively. It was concluded thatcutting of grasses regularly increased dry matterproduction by 33.28%. Fodders available frombroccoli, radish, finger millet and paddy on drymatter basis were 0.649, 0.161, 0.247 and 0.571kg /m2 area, respectively.

ANIMAL HEALTH

Incidences of mastitisA total of 61 clinical milk samples collected

from bovine mastitis cases in and around Gangtokwere examined for bacterial pathogens. The majorbacterial pathogens recovered wereStaphylococcus, Streptococcus, and E. coli. Theisolates were subjected for antibiogram studyagainst 18 different antibiotic discs. The resultsshowed a varying degree of sensitivity, highestsensitivity was to enrofloxacin followed bychloramphenicol and tetracycline.

Incidences of parasitic fecal examinationA total of 62 yak fecal samples collected from

Gnathang village of east Sikkim were examinedfor enteric pathogens like Salmonella, E.coli. 50%of the samples found positive for E.coli and all thesamples were negative for Salmonella. The sampleswere also screened for Rota virus. All the sampleswere found to be negative for Rotavirus.

Screening of serum samples for brucellosisA total of 32 serum samples collected from dairy

cattle were screened for the presence of Brucellaantibodies by employing RBPT. All the samples

were found negative for Brucella antibodies. Theresults indicated that the herd was free formbrucellosis.

ANIMAL PRODUCTION

Studies on uterine involution and effect ofGnRH and PGF2á on uterine involution and post –partum fertility in cross-bred cows wereundertaken.

The results showed that administration ofGnRH at day 16 and PGF2á at day24 post- partumhastens the uterine involution (33.33 + 2.66 Vs42.66 + 5.89 days ) and resumption of post- partumcyclicity (36.22 + 5.89 Vs 57.16+ 8.36 days ) andthus improves the post partum fertility in cross-bred cows.

Studies on reproductive disorders of bovinesThe salient findings regarding incidence of

different reproductive disorders of cattle in Sikkimrevealed the following observations.Incidence (%) of RDs from total screenedpopulation: 11.00Incidence (%) of RDs from Breedable animals:18.48

Major reproductive disorders: (% of breedablepopln.) % share of total RDs

Anoestrous 6.59 35.69Delayed Maturity 4.98 26.95Abortion 1.60 8.69Repeat Breeding 2.25 12.17Metritis 1.12 6.08


Research articles

1. Bhuya, U., Kalita, H. and Bora, D. K. 2006.Occurrence of rice mealy bug in Assam.Insect Environ. 12(3): 134

2. Brajendra and Kishore, K. 2008. Nutritionalstatus of soils under agri-horti land usesystem in Mizoram. Environment Ecology25: 791-93

3. Dinesh Jhamb, Kumar Suresh , Verma, S.K.,Shektawat, J.S. and Saxena, M.S. 2007Effect of buserelin and progesteroneadministration on conception rate in embryorecipient cows. Indian J. Anim. Sci.. 77:945-949

4. Gugnani, H. C., Paliwal-Joshi, A., Rahman,H., Padhye, A. A., Singh, T. S. K., Das, T.K., Khanal, B., Bajaj, R., Rao, S. andChukhani, R. 2007. Occurrence ofpathogenic fungi in soil of burrows of ratsand of other sites in bamboo plantations inIndia and Nepal. Mycoses 50: 507 -511

5. Haque, N., Toppo S., Saraswat, M. L. andKhan, M. Y. 2008. Effect of feedingLeucaena leucocephala leaves and twigs onenergy utilization by goats. Anim. Feed Sci.and Tech., 142: 330 – 338

6. Kalita, H. 2007. Bio efficacy of certaininsecticides against stem borer and whorlmaggot in rice, Res. on Crops, 8: 678-679.

7. Kishore K., Pathak K A, Shukla Rohit andBharali Rinku 2007. Studies on the effect ofdifferent environments on growth of Khasimandarin. Hort. J. 16 : 13-17.

8. Rahman, H. 2007. Pulsotyping of epidemicand sporadic Salmonella Choleraesuisisolates of Indian origin. Indian J. Anim. Sci.77: 808 -810.

9. Rahman, H., Bhattacharya, M., Rajkhowa,J., Soud, N., Nandankar, U. and Mukherjee,S. 2007. Seroprevalence of infectious bovinerhinotracheitis among yak (Poephagusgrunniens) in India. Indian J. Anim. Sci. 77:793 - 795.

10.Rahman, H., Bhattacharya, M., Rajkhowa,J., Soud, N., Nandankar, U. and Mukherjee,S. 2007. Seroprevalence of brucellosis inyaks (Poephagus grunniens) in India. IndianJ. Anim. Sci. 77: 796 - 798.

11.Rawat, A.K., Kumar Suresh , Saxena, M.S.,Maurya, S.N. and Singh, V. 2007. Effect ofbuserlin on superovulatory response incattle. Indian J. Anim. Reprod. 28 :98-100

12.Rawat, A.K., Kumar Suresh, Saxena, M.S.,Maurya, S.N. and Singh, V. 2007. Effect ofdifferent Estrus Synchronization methods onSuperovulatory Response in Cattle. IndianJ. Anim. Reprod 28 :20-24

13.Sharma, Utsav, Maurya, S.N., Rawat, A.K.,Kumar Suresh and Saxena, M.S. 2007.Relationship of plasma total protein withsuperovulatory response in cattle pretreatedwith hCG. Estradiol valerate and GnRH.Indian J. Vety. Research. 16: 35-39.

14.Sharma, Utsav, Maurya, S.N., Kumar Sureshand Rawat, A.K. 2007. Total plasmacholesterol profile in superovulatedcrossbred cattle. Indian J. Anim. Reprod.28:91-95

15.Kumar Suresh, Saxena, M.S. and Maurya,S.N. 2007. Optimization of concentrationsof DMSO and PROH for vitrification of invitro produced pronucleate buffalo embryos.Indian J. Anim. Reprod. 28 (2):25-29

16.Verma, S.K., Jhamb Dinesh, Kumar Sureshand Saxena, M. S. 2008. Superovulatoryresponse in relation to trace elements(copper, zinc, iron, manganese and cobalt)in embryo donor cattle. Indian J. Anim. Sci.78 :693-695

Popular articles / Leaflets

1. Borah, T. R., Rahman, H., Avasthe, R.K. andToppo, S. 2008 Poisionous and Non-poisionous Mushroom Published by ICARResearch Complex for NEH Region, SikkimCentre, Tadong – 737 102, Gangtok

PUBLICATIONS


2. Borah, T.R. , 2007. Poisonous and Non-poisonous mushroom. Sikkim Express dated18th August 2007 and Sikkim Herald dated27th August 2007.

3. Borah, T.R., 2007. Mushroom- the revenuecrop. Sikkim Express dated 8th October 2007.

4. Haque, N., Toppo, S., Rahman, H., Kumar,S., Chandra, R., and Chatlod, L. 2008.Feeding of Dairy Cattle. Published by ICARResearch Complex for NEH Region, SikkimCentre, Tadong – 737 102, Gangtok

5. Kalita, H. 2007. Bhendi Khetir KitpatangaNiyantran. Sar Batori, The FertilizerAssociation of India, Calcutta.3: 9-11.

6. Kalita, H. 2007. Kabi Khetir Kit Patanga aruBemar Ajar. Sar Batori, The FertilizerAssociation of India, Calcutta.4: 1-2.

7. Karuppaiyan, R. and Rahman, H., Avasthe,R. K., Panda, P. K. 2007. Low cost maizeshellers for Sikkim to reduce drudgery tofarm women. In: Newspaper Sikkim Herald,Gangtok, 25 September 2007, p3.

8. Karuppaiyan, R., Rahman, H., Avasthe,R.K., and Panda, P.K. 2008 Traditional andImproved Crop Varieties Suitable forSikkim. ICAR Research Complex for NEHRegion, Sikkim Centre, Tadong,

9. Karuppaiyan, R., Rameash, K., Avasthe, R.K., Singh, M. and Rahman, H. 2007. Threatto ginger farmers in Sikkim: Soil bornediseases and management measures, p 3. In:Newspapers Now 24 August 2007, Gangtok,p2&3; Sikkim Express, Gangtok., 28 August2007, p 4; Sikkim Herald, 04 September2007.

10.Kishore, K., Ashok Kumar and Rahman, H.2007 Citrus decline and its management.Sikkim Express dt. 18-10-2007.

Conference/ Seminar / Workshop Papers11.Avasthe, R. K. and Karuppaiyan, R. 2007.

Soil and nutrient management for productionof high value cut-flowers under protectedcondition. In: Advanced Technologies for theProduction of Commercial Flower Cropsunder Greenhouse/Polyhouse Conditions.NRC for Orchids, Pakyong, Sikkim, 18-25September, 2007. pp

7. Haque, N., Toppo, Saroj, Saraswat, M. L.and Khan, M. Y. 2008. Effect of feedingLeucaena leucocephala leaves and twigs onenergy intake and nitrogen balance in goats.p33 In:Proc. 8th Indian Veterinary Congressand XV Annual Conference of IAAVR inKolkata from 22 – 24 February, 2008, p 33.

8. Karuppaiyan, R. and Rahman, H. 2007.Strategies for increasing organic riceproductivity in the mid-hills of Sikkim withspecial reference to varietal choice. pp 57-58 In: Rice and Food Security Workshop,Nagaland University, Dimapur, 12-13December 2007 (Abstract).

9. Rahman, H., and Karupaiyan , R. 2008.Edible Vaccine: Prospects and Challenges.Compendium of DBT sponsored training onMolecular Biology and Bioinformatics andtheir Application in Research. February 18-21, 2008 AAU, Guwahati, Assam.

Technical blletine10.Kundan Kishore, Ashok Kumar, H Rahman,

H Kalita, K Rameash and N Monica. 2008Insect pests and diseases of citrus and theirmanagement (In press)

Book chapters1. Avasthe, R. K., Rahman, H., Yashoda, P.,

Karuppaiyan, R., Borah, T. R., and Singh,M. 2007. Organic Farming in Sikkim–Situation Analysis, Technological Optionsand Perspective Planning. pp 39-72 In:Organic Farming Technology in NEHRegion (eds.) Munda, G.C., Ghosh, P.K.,Das, A., Ngachan, S.V. and Bujarbaruah,K.M. ICAR Res. Complex for NEH Region,Shillong.

2. Haque, N., Toppo, Saroj, Rahman, H. andBujarbaruah, K. M. 2008. Feed and fodderresources of northeastern India. pp 132 –142. In: All India Dairy Business Directory(Dairy Year Book 2008). Sadana Publishersand Distributors, G. T. Road, Ghaziabad,New Delhi.

3. Karuppaiyan, R., Rahman, H., Avasthe, R.K.and Kumar, A. 2008 Farm implements andmachineries suitable for Sikkim.. ICAR Res.


Complex for NEH Region, Sikkim Centre,Tadong, 24p.

4. Karuppaiyan, R. Avasthe, R. K. and Rahman,H. 2007. Principles and Methods in OrganicPlant Breeding and its Applicability for CropImprovement in Sikkim. pp.465-486.In:Organic Farming Technology in NEHRegion (Munda, G.C., Ghosh, P.K., Das, A.,

Ngachan, S.V. and Bujarbaruah, K.M. (eds.).ICAR Res. Complex for NEH Region,Shillong

Review article1. Ramesh Chandra, Mahela R.K. and Madke

P.K. 2007. Mithun: A Nature’s gift for NorthEast Hill Region. Indian Dairyman. 59: 25-33.


Fifth Annual Scientist’s Meet of the AINP-GIPwas organized by the ICAR Sikkim CentreICAR Research Complex for NEH Region, SikkimCentre organized the 5th Annual Scientist’ Meet ofthe All India Network programme on GastroIntestinal Parasitism at Gangtok on 22-24 May2007.

Training on Improved Production Technologiesof Sikkim MandarinA training programme on Improved ProductionTechnologies of Sikkim Mandarin under MiniMission-I was organized on 13th August 2007 atSimick Lingjey, East Sikkim. About hundredparticipants from Sikkim including farmers andstudents attended the training programme.

Training on management of insect pests anddiseases of citrusA day long hands-on training programme onManagement of Insect Pests and Diseases of Citrusunder Technology Mission (MM-1) was organizedon 29th November 2007 at ICAR ResearchComplex for NEH Region, Sikkim Centre, Tadong,Gangtok. More than thirty participants includingfarmers, NGOs and SHGs from Yangang (SouthSikkim), Sajong and Rai Mindu (East Sikkim)Blocks, attended the training programme.

Hands-on training on scientific poultryproduction and managementA day long hands-on training programme onScientific Poultry Production and Managementunder National Watershed Development Project forRain-fed Area (NWDPRA) was organized on 5thDecember 2007 at ICAR Research Complex forNEH Region, Sikkim Centre, Gangtok. More than20 participants including farmers Self-Help Groupsfrom Sajong and Rai-Mindu (East Sikkim) Blocksattended the training programme

Field day on mustard at ICAR, Sikkim CentreA day long Field Day on Mustard was organized atICAR Research Complex for NEH Region, SikkimCentre on January 11, 2008. About 40 Farmers fromEast District of Sikkim visited MustardExperimental Field of ICAR, Tadong, Gangtok.

Trainers’ Training on Fruits and VegetablesProcessingA two day long Trainers’ Training on Processingof Fruits and Vegetables under Technology Mission(MM-1) was organized between 21-22nd Jan. 2008at ICAR Research Complex for NEH Region,Sikkim Centre, Tadong, Gangtok. Participants fromdifferent NGOs of East Sikkim attended the trainingprogramme.

Visit of Chief Secretary, Govt. of Sikkim toICAR, Sikkim CentreThe Hon’ble Chief Secretary, Govt. of Sikkim Shri.N.D. Chingapa, IAS visited ICAR ResearchComplex for NEH Region, Sikkim Centre on 23rd

January 2008.

Training on Year Round Vegetable CultivationOne day long training on Year Round VegetableCultivation under NAIP was organized on 4th

February 2008 at ICAR, Sikkim Centre, Tadong,Gangtok. More than fifty participants includingSHGs, farmers and NGOs from Dzongu (NorthSikkim) and from East Sikkim district attended thetraining programme.

Training on Low Cost Silage Making organizedby ICARThe ICAR Research Complex for NEH Region,Sikkim Centre Tadong has organized a-day longtraining on low cost silage making process for thebenefit of farmers under NAIP project. About 20farmers from Dzongu (North District) and 35farmers from East District have participated thetraining.

Launching of World Bank funded NAIP Projectin North DistrictThe Hon’ble Minister for Animal Husbandry,Livestock, Fisheries & Veterinary Services Smt.Kalawati Subba officially launched a World Bankfunded National Agricultural Innovation Project(NAIP) in North Sikkim in a Workshop organizedjointly by the ICAR Research Complex for NEHRegion, Sikkim Centre and Indian CardamomResearch Institute, Spices Board at Mangan on 8th

March 2008.

IMPORTANT EVENTS


1. Smt. Kalawati Subba, Hon’ble Minister forAnimal Husbandry Livestock, Fisheries &Veterinary Services, Food & Civil Suppliesand Consumer Affairs Departments, Govt.of Sikkim on 22nd May 2007

2. Dr. K.M. Bujarbaruah, Deputy DirectorGeneral (Animal Sciences), ICAR, NewDelhi on 22nd May 2007

3. Dr. Lal Krishna, Asistant Director General(Animal Sciences), ICAR, New Delhi on22nd May 2007

4. Dr. Nem Singh, Joint Director (Research),IVRI, Izatnagar & Project Coordinator,AINP-GIP on 22nd May 2007

5. Dr. M.C. Sharma, Joint Director, IVRI,Izatnagar on 22nd May 2007

6. Dr. K.Prabhudas, Project Director, PD-ADMAS, Bangalore on 22nd May 2007

7. Dr. Senthil Kumar, IFS, ManagingDirector, Sikkim Milk Union on 5th

December 2007

8. Sh. N.D. Chingapa, IAS, Chief Secretary,Govt. of Sikkim on 23rd January 2008

9. Sh. R. Telang, Secretary, FS & ADD, Govt.of Sikkim on 4th February 2008

10.Sh. T.W. Barphungpa, IAS, PrincipalSecretary, Dept. of Animal Husbandry,Livestock, Fisheries & Veterinary Serviceson 5th February 2008

11.Sh. Somnath Poudyal, Hon’ble Minister forFood Security and Agricultural DevelopmentDepartment, Govt. of Sikkim on 8th March2008

12.Sh. Hishey Lachungpa, Hon’ble Ministerfor Health Care, Human Service and FamilyWelfare, Govt. of Sikkim on 8th March 2008

13.Sh. Bhim Dhungel, Chairman, Farmers’Welfare Board, Govt. of Sikkim on 8th March2008

14.Dr. V.L. Chopra, former Director Generalof ICAR, Secretary, Dept. of AgriculturalResearch and Education, Member ofPlanning Commission, Govt. of India on 13th

March 2008

15.Dr. K.L. Chadha, Chairman, TechnologyMission MM-I,Chairman, Working Groupon Horticulture (XI Plan), PlanningCommission, G.O.I ; President, TheHorticulture Society of India and FormerDeputy Director General (Hort.), ICAR on14th March 2008

16.Dr. Kirti Singh, Former Chairman, ASRB,Former Vice-Chancellor, Himachal PradeshKrishi Vishwavidyalya, Palampur and IndiraGandhi Krishi Vishwavidyalaya, Raipur on14th March 2008.

VISITORS


TRIPURA CENTRE


Meteorological data (Table 1) as recordedduring 2007-08 contain temperature, relativehumidity, evaporation, sunshine hour, rainfall,cloud coverage, wind direction, wind speed andsoil temperature at different depth of 5cm, 10 cmand 20cm. The maximum and minimumtemperature varied from 25.4 to 340C and 10.5 to25.30C. The total rainfall as recorded was3353.4mm with total evaporation of 1624.8mmthus indicating nearly 48% loss of rainfall asevaporation from the soil surface. It may bepertinent to mention that the total rainfall recordedduring 2007-08 was much higher (52%) than thenormal rainfall (2323.1mm). Sunshine hourunderwent a variation from 2.2 to 8.3 hours and

the wind speed varied from 0.9 to 7.6 km per hour.In the morning, relative humidity was, on anaverage from 41 to 85% and in the afternoon, therelative humidity was from 51 to 75 percent. Thesky was mostly overcast with cloud as indicatedby high octal value during summer and kharifseason. But winter months showed low octal values(around 4) thus indicating the presence of clear sky.Soil temperature was recorded at the differentdepths of 5, 10 and 20cm during morning andafternoon period. Soil temperature showed anincreasing trend along with the depths duringmorning but the reverse trend was noted along withthe depths during afternoon. In general, 5cm depthwas much higher than that recorded duringmorning.

WEATHER

Table 1. Meteorological data of Lembucherra during 2007 -08

Month Max Min Total Total RH RH Wind Soil Temperature (0C) at different depth Cloud Avg Avg WindTemp Temp Rain Evp (Morn) (Even) Speed Coverage Sun Direction

Morning Evening (Octa) shine(0C) (0C) (mm) (mm) (%) (%) Kmph 5 10 20 5 10 20 I II Hr I II

Apr 33.6 24.3 506.7 125.6 78 63 7.6 28.4 30.6 33.2 35.0 33.6 33.2 6 6 6.4 W WMay 34.0 25.3 210.2 127.7 85 66 4.1 29.7 30.6 31.2 37.6 35.7 33.5 6 6 6.9 W SWJun 32.6 25.0 745.4 108.7 83 69 6.5 28.4 29.2 29.8 33.3 32.0 30.8 7 7 3.5 W WJul 32.1 23.3 908.6 114.9 71 68 6.6 28.1 28.8 29.5 32.7 31.5 30.7 7 6 3.1 W SWAug 32.4 22.4 279.2 134.8 62 69 4.2 29.0 29.6 30.6 34.6 33.0 31.9 6 6 4.9 N WSep 32.0 21.7 202.6 176.3 57 71 4.8 28.9 29.5 30.6 34.4 33.2 32.0 6 5 2.2 W WOct 31.4 21.4 263.4 182.5 57 72 4.1 28.5 29.0 29.7 34.6 34.6 31.9 5 5 5.2 SW NWNov 29.4 20.0 105.0 137.0 55 72 8.1 25.9 26.5 27.3 31.1 30.1 29.1 4 4 5.9 NW NWDec 25.4 13.3 000.0 136.6 57 75 1.0 19.5 20.4 21.1 28.4 26.2 24.2 4 4 3.9 SW WJan 25.1 10.5 051.4 123.8 41 51 0.9 16.7 17.5 18.3 26.6 24.6 22.4 4 4 5.9 W NWFeb 26.4 11.9 012.8 115.7 32 54 2.0 17.1 18.1 19.2 26.9 24.5 22.4 4 4 6.1 W NWMar 31.4 19.3 068.1 141.2 63 57 2.2 24.0 24.9 25.9 33.8 31.6 29.7 5 4 8.3 W NWAvg 30.5 19.9 62 66 5.2 25.4 26.2 27.1 32.4 30.9 29.3 5 5 5.2Total 3353.4 1624.8

I: Morning (0630hr), II: Evening (1330hr) N: Northerly, NW: North westerly, SW: South westerly, W: West


RICE

RICE IMPROVEMENT PROGRAMME

Hybridization and selectionThirty seven cross progeny from various crosses

were evaluated on the basis of plant height,maturity, number of panicle, plant yield and grainquality.

A single tube Allele Specific Amplification(PCR-ASA) by using four primers designed froma putative BAD2 gene (non-functional betainealdehyde dehydrogenase 2 (BAD2) enzyme,resulted from a 8bp deletion in a gene (fgr) presenton chromosome 8 showed that Basmati370 andBinni were having a 257bp fragment while non-aromatic Pyzum gave a 355bp fragment. A 580bpfragment was present in all the lines, consideredas indicator of successful PCR reaction. Twosegregants (line 2 and line 3) of Basmati370/Pyzumcross were carrying both the bands (257bp and355bp) and detected as heterozygote for that trait(Fig. 1). Some seeds of line 2 and line 3 ofBasmati370/Pyzum cross were found aromatic(scale 1) and some of them were non-aromatic(Scale 0). Others were found homozygous withonly one allele (355bp) found in non-aromaticgenotypes. Three segregants belonging to Pyzum/Binni cross were carrying 257bp amplicon. The


CROP SCIENCE scale value of aroma in F5 grains showed thelinearity with marker as expected.

Maintenance and purification of germplasmThirty lines including local landraces, upland

and lowland varieties from Tripura as well as fromother states were raised in kharif season of 2007and mass selection was done for their purification.

AICRP on Rice ImprovementThree trials in kharif and one trial in boro seasonwere conducted during 2007-2008.

1. IVT Early Direct seeded: The highest yieldwas given by IET-20496, against best checkAnnada followed by IET-19837 (2885 kg/ha) and IET-19852 (TRC-87-251) (2750 kg/ha).

2. IVT Early Transplanted: When all thoseentries under IVT Early direct seeded weretaken in transplanted condition, 26 entrieswere performed better than best check,NDR-97 (3270 kg/ha). The highest seedyield was given by IET-19837 (5530 kg/ha)which was followed by IET-20507 (5290 kg/ha), IET-20509 (5175 kg/ha) and IET-19852(4750 kg/ha).

3. National semi deep water screening nursery:60 entries were screened under NSDWSN.Seed yield of 12 lines exceeded best check,Purnendu (4930 kg/ha). The highest yielderwas found IET-20372 (7100 kg/ha). This wasfollowed by IET-20376 (7045 kg/ha), IET-20359 (TRC-229-F-41-1) (6975 kg/ha) andIET-20366 (6950 kg/ha).

VARIETAL IMPROVEMENT

TRC – 87 – 251 (IET 19852) and TRC – 87 –251– 1 (IET 20489)

Two very early rice variety suitable for allseason developed from a cross Ngoba x Garomality.The line is suitable for both direct seeded andtransplanted condition, drought tolerant with

Fig. 1. A single tube Allele Specific Amplificationwith primers derived from BAD2 gene for

detection of aroma (fgr) in rice varieties and theircrosses, viz., B: Basmati-370; P: Pyzum, 1-12:

Segregants of Basmati370/Pyzum and M: 100 bpDNA ladder


average upland yield 25-28 q/ ha and lowland yield42-44 q/ ha. Matures in 85 days under direct seededcondition and in 105 days under transplantedcondition. Plant height is 90cm.

TRC-87-251 ranked 1st at National level underAICRP on Rice IVT-VE TP 2006The entry produced highest yield at Coimbatore(6348 kg / ha).The entry was retested in IVT Early 2007The entry was found promising under direct

seeded condition at drought affected locations.Another selection from the same cross TRC – 87 –251 –1 was found promising at both droughtaffected and normal locations.

TRC – 87 – 251 –1 (IET 24089) was also foundpromising under normal locations in Region 3

The two entries also performed well in IVTEarly in Transplanted condition.

An entry TRC –229 – F – 41 – 1 , a selectionfrom a cross Jagannath and BG –90 –2, wasnominated to National Semi Deep Water ScreeningNursery (NSDWSN), kharif 2007.

TRC – 87 –251 –1

IRRI – INDIA Upland Shuttle BreedingNetwork ProjectURSBN AMYT 2007 - Conclusions

• Genotype x site interaction was large andsignificant, even after partitioning for yield.

• VL3288, DDR 117, RR 347-5 and RR 427-21 BL-2 performed well in both high andlow yielding environments

• RR 427-21 BL-2 and RR 383-21 performedwell in the high yielding group and IC267974 and DDR 117 performed well in low-yielding group.

URSBN 2007 PMYTURSBN PMYT 2006• BAU GVT 464-07, BAU GVT 465-07, BAU

399-02, BAU 175-90, BAU 446-06,BVD110, RR 617-1, NDR 1054-4-1 andBAU 461-06 yielded well in all groups.

• RRU 2840, NDR 1131, BVD 110 and VL30242 performed well in medium and lowsite groups.

• BAU 438-06-4, BAU 404-02, BAU GVT465-07, NDR 1131, and RR 616-1 did wellin the medium yielding sites.

• IR 81025-B-311-B, NDR 1131 yielded wellin low yielding sites.

URSBN 2007 ARVT

Nutrient availability in soils and uptake in rice A field experiment on rice ( var. NDR -97) was

conducted with the treatments consisting of fourmain plot ( T0 – control), T1- Gliricidia leaf (5t/ha), T2-Cattle manure (5 t/ha),T3-PSB (Bacilluspolymixa) + Azospirillum,T4-Gliricidia leaf+Biofertilizer + cattle manure and four sub plots(A- 0,B-50% NPK,C-75% NPK,D-100 % NPK(60:30:30).

From the perusal of the data as presented inTable1, it is evident that organic carbon increasedfrom 0.59 to 0.81 %, available nitrogen from 232to 646 kg /ha, available phosphorus from 41 to 84kg/ha and available potassium from 90 to 120 kg/ha in soils under the effect of leaf/FYM andbiofertilizer. In other treatment, inconsistentchanges in nutrient availability were noted.

Maximum uptake in N, P, K and Ca wasrecorded in 100 % NPK in combination with leaf/

PVS with top 10 entries from AMYT 2006 underjhum in Rajnagar Agri. Sub Division


manure/biofertilizer. The uptake of N,P,K and Cain T4 with 100 % NPK were raised from 25.4 to47.2 ,2.26 to 5.41, 1.70 to 6.56 and 0.39 to 1.06kg/ha from control.

On the other hand, micronutrient uptake ( g/ha)after the application of amendments underwent aninconsistent variation from 65 to 801 g/ha in zinc,24 to 179 g/ha in Cu, 85 to 247 g/ha in Mn and 410to 1075 g/ha.

Uptake in N,P,K and Ca underwent a variationfrom 72.86 to 125.51,6.29 to 17.89,6.61 to 10.26and 3.28 to 17.71 kg/ha , respectively.

On the other hand, the micronutrient availabilityin rice straw showed a variation from 0.034 to3.27,0.06 to 0.13, 0.13 to1.37 and 1.33 to 5.49 kg/ha in Zn, Cu, Mn and Fe, respectively.

Effect of leaf sources from hedge plantationAs a hedge plantation on the terrace riser, some

trees ,viz., Leucaena leucocephala, Tephrosiacandida and Gliricidia maculata were raised andgreen leaf( 10 t/ha) with 50% before sowing of thecrop and 50% as leaf mulch were applied in theterrace. The productivity of upland rice (var. TRC-87-251) in the terraces are presented below.

Effect of leaf on the productivity of upland rice(t/ha)

It is indicated that the maximum production ofgrain yield of upland rice (1.89 t/ha) could beobtained after the application of Leucaena leaf (10t/ha) followed by Tephrosia and Gliricidia. On theother hand, the maximum production in straw yieldof upland rice was noted after the application ofGiricidia leaf. The increase in grain yield after

the application of leaf sources as compared tofertilizer dose varied from 17 to 96%

Fig. 2.Per cent increase in grain yield of rice overfertilizer

SEED PRODUCTION

Following are the foundation class TFL seedproduced on farmer’s field by the ICARResearch Complex

Rice

Sl. Variety Quantity of foundationNo. class TFL Seed produced

1 BPT 5204 900 kg2 Naveen 2500 kg3 Pusa 44 75 kg4 TRC 87-251 1250 kg5 TRC 229 F-41 80 kg6 TRC 2005-1 600 kg

Table 1. Nutrient availability in soils of upland rice under INM

Treatment Control 50% NPK 75% NPK 100% NPK

O. Av nutrients O. Av. nutrients O. Av. nutrients O. Av. nutrientscarbon (kg/ha) Carbon (kg/ha) carbon (kg/ha) Carbon (kg/ha)(%) (%) (%) (%)

N P K N P K N P K N P K

T0 0.59 232 41 90 0.54 297 59 120 0.75 316 46 120 0.65 391 47 120T1 0.71 622 75 120 0.68 622 64 154 068 615 72 138 0.67 609 48 182T2 0.72 249 54 105 0.69 603 54 123 0.67 503 54 129 0.59 503 64 165T3 0.75 628 63 110 0.68 535 88 129 0.63 566 111 138 0.44 559 98 155T4 0.81 646 84 120 0.45 615 62 135 0.63 628 75 155 0.57 646 79 165


Foundation seed production of paddy throughDept. of Agriculture, Govt. of Tripura(Registered Seed Growers Programme)

Breeder Seed (30 kg) of variety BPT 5204 andNaveen (90 kg) was given through Superintendentof Agriculure, Bishalgarh, West Tripura forFoundation seed programme under Registered SeedGrowers Programme of Dept. of Agricultuere,Govt. of Tripura.

Breeder seed supplied to Director, Dept. ofAgriculture, Govt. of Tripura, Tripura

In total seed worth of Rs. 58, 490 / - wassupplied to the Dept. of Agriculture, Govt. ofTripura.

MAIZE

MAIZE IMPROVEMENT PROGRAMME

1. Production of breeder seed for AICRP, ZonalTrial, State multilocational trial and NAIPproject

a. Breeder seeds of 50kg of TRM-5-OY, 30kgof TRM-11, 25kg of TRM-6 and 25kg ofTRM-5-LY have been produced.

b. TRM-5-OY and TRM-11 has beennominated for IVT Early and medium earlytrial in rabi season under AICRP in 2007.

c. TRM-5-OY-1 and TRM-6-1 has beennominated for IVT Early in kharif season in2008.

d. TRM-5-OY and TRM-11 has beennominated in Zonal (I) trial in 2008.

f. Seed of TRM-5-OY and TRM-11 has beengiven to State Agricultural Directorate formultilocational trial in Tripura in 2008.

g. 20 kg seed of TRM-5-OY has been given tofarmers in Dhalai district under NAIP projecton Livelihood development.

2. Regional trial for detection of early maturityhigh yielding maize composite

Maize varieties developed at this Institute wereevaluated in rabi season in Tripura in randomizedblock design. Highest mean seed yield was givenby TRM-11 in average 86 days maturity. The

average seed yield of all tested varieties is presentedbelow.

a. TRM-11: 4460kg/hab. TRM-5-OY: 4360kg/hac. RCM-1-3: 4270kg/had. TRM-5-LY: 4250kg/hae. RCM-1-1: 4080kg/haf. TRM-6: 4000kg/hag. TRM-10: 3610kg/hah. RCM-1-2: 3380kg/ha

AICRP on MaizeIVT early and medium early maturity group trial

in rabi season of 2007-2008 has been conductedunder late sown condition. 17 entries were sownin 3 replications. IVT 124 has given the highestseed yield of 7560kg/ha. This was followed byentry no 126 (6250kg/ha), entry number 130(4893kg/ha), entry 122 (4810kg/ha) and entry 133(4470kg/ha).

SEED PRODUCTION

Maize

Sl. Developed line Yield potential SeedNo. (Kg / ha) produced

(kg)

1 TRM-5-OY 4500-5000 722 TRM-6 4500-5000 653 TRM-11 4200-4500 404 TRM-5-LY 4000-4300 44


PULSES

PULSES IMPROVEMENT PROGRAMME

Varietal ImprovementA field pea line TRCP-8 developed from a

cross T 163 x DMR 4 was promoted to AVT 2FIELDPEA TALL rabi 2007–08.

• The developed line has yield potential of2150 –2400 kg / ha.

• Matures in 86 days under Tripura condition.• High grain yield (Yield superiority of 29 .7

% over Rachna, 41. 2 % over DMR –7 and61 . 6% over IPFD 1-10 in NHZ).

• Resistant to rust and moderately resistant topowdery mildew.

• Tolerant to pod borer and stem fly.• Tolerant to M. incognita and moderately

resistant to M. javanica.• Medium bold seed size (18.4 gm) with

round, smooth and straw white colouredseed.

Another entry TRCP 9 , which was promotedto AVT 1 in 2007-08 has also been promoted toAVT 2 on the basis of more than 10% yieldsuperiority over the best check in 2007-08 trials.

Green gram ( var. Ratna)Green gram var. Ratna : The application of

Biofertilizer (Rhizobium + Bacillus firmus) and10 t cowdung /ha with 50% NPK could producethe maximum yield of green gram from 0.35 to 1.59t/ha.

AICRP ON MULLaRPAICRP MULLaRP trials were conducted in

three seasons viz. Spring/ Summer, Kharif and rabi.In Spring / Summer - one trial on Mungbean wasconducted. In kharif 5 trials viz. Mungbean IVT,AVT 1 & AVT 2, Urdbean IVT and Special PreRabi trial were conducted. In rabi season 5 trialsviz. Fieldpea Tall IVT, AVT 1 & AVT 2 ; FieldpeaDwarf IVT and AVT 1 were conducted.Performance of the various trials was reportedthrough Annual Report of MULLaRP.

OILSEEDS

OILSEED IMPROVEMENT PROGRAMMERapeseed-Mustard

TRC-T-1-1-5-1 (TCN-06-19A) secured firstposition in IVT (Rainfed) Zone V under All IndiaCoordinated Programmme trials on Rapeseed-Mustard in 2007-2008. This line gave average seedyield of 893kg/ha in rainfed condition. This entryhas been promoted to AVT-1.

Six Indian Mustard varieties (Pusa Agrani, PusaTarak, Pusa Jaikrishan, JD-6, Kranti and Parbati)were raised in randomized block design forevaluating their performance under irrigatedcondition in Tripura. Pusa Agrani (9q/ha) and PusaTarak (8.6q/ha) were found superior.

TRC-T-1-1-5-1 is a Toria line, stood first in IVT(rainfed) Toria Zone V

AICRP on Rapeseed-MustardIVT and AVT trials in Yellow sarson and IVT

in Toria were conducted during 2007-2008 inrandomized block design (RBD).

a. IVT Toria: TCN-07-11 (1434.4 kg/ha) andTCN-07-19A (1422.0 kg/ha) were foundpromising with significant higher yield thancheck variety JD-6 (1308.5 kg/ha).

b. IVT Yellow sarson: YSCN-07-12 (718kg/ha) and YSCN-07-10 (687 kg/ha) were foundsuperior than others.

c. AVT Yellow sarson: YSCN-07-18 (1608.8 kg/ha) and YSCN-07-16 (1499.5 kg/ha) werefound superior to others in respect of seedyield.


Soil Test Crop ResponseCrop : Bhindi – MustardThe nutrient status of the fertility gradient

maintained in the plot was as follows.Low Fertlity – 553 kg N, 8.70 kg P and

183 kg K/haMedium Fertlity – 565 kg N,14 kg P,231 kg

K /haHigh Fertility – 634 kg N, 19 kg P and 231

kg K/haVery High Fertility – 721 kg N,36 kg P and 483

kg K /ha

Productivity ( t/ha) of bhindi ( var.Hybrid Okra152) under fertility gradient

It is indicated from the data that the fertilizerdose for the maximum production of bhindi wasN3P2K2 (160 N,70 P and 60 K kg/ha), N2P2K1( 120N,70 P and 30 K kg/ha), T13-N3P2K1(160 N ,70 Pand 30 K kg/ha) in low, medium and high/veryhigh fertility gradient, respectively. The responseof fertilizers in increasing the productivity of bhindiunder variable fertility gradient revealed that theincrease in productivity as compared to control is

found to vary from 58. 8 to 146. 5 %, the highestbeing recorded in soils of low fertility and thelowest in soils of medium fertility (Fig.1).

Maximum rise in mustard ( var. Pusha Agrunie)was noted after the application of Tephrosia leaf(1.85 t/ha) followed by Gliricidia leaf (0.91 t/ha)and Leucaena leaf ( 0.49 t/ha) (Table 1). Aconsiderable rise in mustard from 131 to 403 %over fertilizer after the application of leafamendment (Fig.2) was noted.

Fig. 2. Per cent increase in mustard over fertilizer

It is observed that the application of Tephrosialeaf could produce the maximum rise in seed yield(1.48 t/ha) and haulm yield (8.73 t/ha) of sesamum(var. B-67) followed by Gliricidia leaf andLeucaena leaf. As compared with fertilizer,Tephrosia leaf could have 24 % and 20 % rise inseed and haulm yield of sesamum, respectively(Table 2).

GroundnutIn all 96 core collection of groundnut

germplasms were evaluated for their diseasereaction under natural conditions of Tripura. Thediseases, like leaf spot, rust, wilt and stem rotdiseases were found as predominant during kharif

Table. Effect of leaf on the productivity of mustard (kg/ha)

Treatment Leucaena leaf Tephrosia leaf Gliricidia leaf

Seed Haulm Seed Haulm Seed Haulm

Fertilizer without leaf (40:20:20) 213 838 525 2013 181 1063Green leaf(10 t/ha) 494 1925 1850 3188 912 2463CD ( 5%)Type of leaf 320 830Leaf amendment 254 1123Interaction 413 1257

Fig. 1. Per cent increase in bhindi in soils undervariable fertility


crop season. During this year both leaf spot andrust were appeared in all the genotypes of corecollection in less intensity [1.77–2.63 (leaf spot)and 1.78-2.43 (rust) in 1-9 point scale where 1 ishealthy and 9 is 100% infection]. On the other hand,wilt and stem rot were appeared in certaingenotypes and their intensity were found more infertilized field along with liming as perrecommendation. Wilt disease infestation was more(5% or above) in the genotypes, NRCG 3648,NRCG 12334, NRCG 10969, NRCG 12523,NRCG 11450, NRCG 11711, NRCG 12700, NRCG11551 and NRCG 12065. The stem rot disease wasvery severe (10% or more infection) in thegenotypes, NRCG 12581, NRCG 11942, NRCG12657, NRCG 12334, NRCG 11656, NRCG 12850,NRCG 12700, NRCG 12423, NRCG 10969,NRCG 12523, NRCG 12630, NRCG 1086, NRCG11646, NRCG 12437 and NRCG 1157.

Table 3. Mean disease incidences in ninety sixcore collection of groundnut genotypesduring 2007-08

Disease and Fertilized Unfertilizedrating scale with liming

Leaf spot 1.72 (+ 0.40) 2.63 (+ 0.87)(1-9 point scale)Rust (1-9 point scale) 1.78 (+ 0.74) 2.43 (+ 1.30)Wilt (%) 2.21 (+ 1.00) 1.85 (+ 0.93)Stem rot (%) 7.76 (+ 4.19) 5.76 (+ 3.65)

Figures in parentheses are SDs.

SesameThree black seeded sesame varieties, viz. TRC-

til-1-8-1, B-67 and local (jhum til) grown in Tripurawere characterized by using standard descriptorsin pre-kharif season (Table 4).

Table 4. Characterization of black seededsesame varieties under Tripuracondition

Characters TRC-til-1-8-1 B-67 Tripuralocal(Jhum til)

Early plant vigour Good Good PoorBranching habit Basal branch Basal Top

branch branchStem hairiness Sparse Sparse GlabrousDays to 50% 52 55 80flowering (days)Flower colour White with White with White with

light shed light shed light shedCorolla hairiness Hairy Hairy HairyNumber of one one onecapsules perleaf axilCapsule length 2.5 2.58 2.24(cm)No. of capsule 164.4 134.8 125per plantDensity of High High Sparsecapsule hairCapsule shape Narrow Narrow Narrow

oblong oblong oblongNumber of locules 4 4 4per capsulePlant height (cm) 140.6 132.25 149.8Inter-node length 2.93 3.66 4.0(cm)Days to 80% 85 88 115maturityNumber of Seed 60.6 58.6 61per capsuleSeed coat colour Black Black BlackNumber of 5.2 5.0 5.0branches100 seed weightSeed yieldper plantOil content (%) 42 41 44

Table 2. Effect of leaf on the productivity of sesamum (t/ha)

Treatment Leucaena leaf Tephrosia leaf Gliricidia leaf

Seed Haulm Seed Haulm Seed Haulm

Fertilizer without leaf (40:30:30) 1.18 5.85 1.19 7.28 1.32 5.75Green leaf(10 t/ha) 0.98 6.70 1.48 8.73 1.20 4.90CD ( 5%)Type of leaf 0.15 1.23Leaf amendment 0.13 NSInteraction NS NS


AICRP on sesame improvementDue to congenial weather condition, there was

huge incidence of root rot and seedling damage in2007 kharif and post kharif season. This was mainlydue to heavy rainfall and cloudy conditionprevailed for longer time. The highest seed yieldwas given by AVT-07-13 (465 kg/ha), followed byAVT-07-6 (410 kg/ha) and AVT-07-9 (398 kg/ha).

SEED PRODUCTION

Sesame

Developed Line Yield Potential Seed Produced(Kg / ha) (kg)

TRC-til-1-8-1 1000-1200 18

Table . Toria

Developed Line Yield Potential Seed Produced(Kg / ha) (kg)

TRC-T-1-1-5-1 1300-1350 24

ORGANIC FARMING

DEMONSTRATION OF ORGANIC INPUTS

On farm field experimentA field experiment was conducted in ICAR

Research farm with Turmeric (var. local) as testcrop grown under mango plantation with organicinputs such as cattledung manure and biofertilizer.The overall productivity of turmeric in the fieldexperiment was comparatively low.The applicationof FYM @ 5t/ha could produce the high yield ofrhizome /plant from 85 to 140 g and motherrhizome from47 to 63 g/plant. The combinedapplication of FYM @5t/ha and Azatobacter @5kg/ha could produce the rhizome from 0.88 to 3.96t/ha and mother rhizome from 0.91 to1.05 t/ha.

Off farm vegetable productionThe demonstration of organic inputs was also

organized off farm in some of selected farmers’plot at Mohanpur block in West Tripura. Vegetablessuch as cabbage(var. BC-76), tomato (var. AllRounder), potato (TPS) and bhindi (var.okra 152)were grown. Organic inputs, viz., cattledungmanure, biofertilizer, neem based insecticide wereused for the production of vegetables. Cowdungwas applied 10-15 days ahead of vegetable plantingin main plot from nursery bed. On the other hand,biofertilizer 1 kg each of PSB and Azotobacter for1 kani (0.16 ha) of land was mixed with 25 kg ofcowdung and thereafter applied to the plot. Theproductivity of vegetables obtained in the farmersplot is presented in Table 1.

Table 1. Productivity (t/ha) of vegetables under organic inputs

Farmer’s name Block Village Cabbage Tomato Potato Bhindi

Dulal Das Mohanpur South Taranagar 52.12 - 14.3 10.2Sankar Acharya -Do- -Do- 56.25 45 12.5 9.75Rabindra Debnath -Do- -Do- 43.75 - 10.5 9.05Mrinal Biswas -Do- -Do- 31.25 - 15.6 -Tapan Biswas -Do- -Do- - - - 9.80Bhajan Das -Do- -Do - - - 8.5Narayan Biswas -Do- -Do- - - - 9.45Mean 45.84 45 13.23 9.46


Economics of vegetable productionThe economics of vegetable production under

organic inputs was ascertained and the data arepresented in Table 2 & 3. It is indicated that thenet profit was maximum in hybrid tomatoproduction (Rs 2,25,000/ha) with benefit/cost ratioaround 1 :6.32 followed by cabbage, potato andbhindi.

Table 2. Economics of vegetable production

Crop Cost of Gross Net Benefit /cultivation profit profit cost(Rs/ha) (Rs/ha)a (Rs/ha) ratio

Cabbage 40,428/- 1,32,108/- 91,680/- 1:3.27Tomato 42,318/- 2,67,318/- 2,25,000/- 1:6.32Potato 40,278/- 1,19,658/- 79,380/- 1:2.97Bhindi 43,278/- 81,118/- 37,840/- 1:1.87

aSale price of cabbage ( Rs2/kg),tomato (Rs5/kg),potato (Rs6/kg) and bhindi (Rs 4/kg).

Table 3. Cost of cultivation (Rs/ha)

Labour (187.5 mandays) - Rs18,750/-

SeedCabbage (300 g/ha) - Rs 3150/-Tomato (120 g/ha) - Rs 5040/-Potato ( 100 g TPS/ha) - Rs3000/-Bhindi (5 kg/ha) - Rs 6000/-Manure - Rs11,250/-Biofertilizer (5 kg/ha) - Rs900/-Neem pesticide (1.5 l/ha) - Rs378/-Ploughing - Rs 6000/-

Cabbage production under organic inputs in avillage

Potato production from TPS under organic inputsin a village

Tomato production under organic inputsFarmers displaying their organic produce


FRUITS

Development of production technology for yearround production of pineapple under Tripuraconditions

Evaluation of pineapple cv. Mauritius andAmritha

Mauritius and Amritha (an hybrid of Ripleyqueen x Kew followed by selection) variety ofPineapple were introduced from Kerala AgricultureUniversity, Trissur, during October 2005. Theearliest flowering (January 2nd week) was observedin Mauritius whereas it was February 2nd week inAmritha. The earliest fruit ripening was noticed inMauritius followed by Amritha during Ist and 2nd

week of June respectively. The average fruit weightof Mauritius was 1.2kg whereas it was 0.650kg inAmritha. TSS was 17.8 brix in Mauritius and 18.8brix in Amritha. The fruit quality of Amritha wasbetter in comparison to Mauritius. The crown sizeand weight was lowest in Amritha compared toMauritius. The production of slips, and suckers washigher in Mauritius whereas some of the plant ofAmritha did not produce even a single slip.

Amritha fruits Mauritius fruits

Influence of light intensity on fruiting and fruitquality with plant densities under various AFSmodels

Four plant spacing (30x45x60cm, 30x45x75cm,30x60x75cm and 30x45x90cm) were taken forinvestigation with Kew cultivar to find out theinfluence on fruit quality under Leuceana, Albizzia,Acacia and Michelia spp. based established agroforestry models. The light intensity was in the rangeof 28,500 lux to 69,500 lux between 10 AM-

2.00PM during March 2008. The flowering wasobserved in each block. However, earliestflowering was noticed under Leuceana where lightintensity was comparatively high. The fruitingpercent was highest in open areas (without AFSmodls).The experiment is continuing for qualityanalysis.

High density of pineappleA Comprehensive report of the project was

developed and likely to be submitted during June2008 for year round production of pineapple inTripura including quality improvement.

Improvement of fruit quality and productivityof litchi, banana and papaya

Evaluation of improved varieties of litchi.Eight varieties of litchi viz. China, Shahi,

Swarnaroopa, Early Bedana, late Bedana, RoseScented, Bombai and Seedless were introducedfrom ICAR, Ranchi. The plant canopy was alsobetter in Shahi, China, Purbi and Swarnaroopa. Thefruit size and weight (21.6g) was noticedsignificantly higher in china over other cultivarstaken under investigation. The quality parameterviz. pulp 72%, TSS 10.5brix and fruit size washighest in Shahi followed by Bombai andSwarnaroopa. The late ripening were noticed in latebedana, china and swarnaroopa with higherinfestation of litchi fruit borer.

Response of foliar feeding of micronutrientduring fruit growth and development

The response of foliar feeding of micronutrienton fruit retention and its quality. Fourconcentrations of ZnSo4 and CaCl2 (0.2, 0.4, 0.6,0.8 and 0.5,1.0, 1.5, 2.0 % of ZnSo4 and CaCl2respectively) were sprayed twice i.e. last week ofMarch and 1st week of April 2007. The foliarfeeding of 0.6% ZnSo4+1% calcium chloride weremost effective to reduce the fruit cracking and alsoenhanced fruit retention up to 10-12%. The fruitripening was delayed by one week under foliarfeeded treatments compared to control. The averagefruit weight was highest (19.6g) under 0.6%Znso4+1% calcium chloride. The TSS of fruits wasalso higher in foliar feeded plants and aril percent


(78.2% by weight) was significantly higher in 0.6%Znso4+1% calcium chloride.

Uniform ripening and quality fruits of litchi

Effect of mulching on fruit quality and yield oflitchi (Litchi chinensis L) cv. Bombai

An experiment was conducted during 2004-07to improve the productivity of orchard and fertilityof soil on 10-year-old bearing trees of Litchi cv.Bombai. The effects of mulches were significanton growth of trees; fruit cracking and fruit yield.The Fruit yield in Gliricidia mulch was 2.865 t/hafollowed by1.995 t/ha under chhan mulch, whereasthe lowest fruit yield (1.613 t/ha) was noticed underunmulched trees. However, the Gliricdia mulchingwas significantly effective on tree height, canopy,and shoot growth, fruit cracking and yields of fruitsas compared to other mulches and control.

Genetic variability of litchi (Litchi chinensis L.)in Tripura

An extensive exploration conducted in all fourdistricts West, South, North and Dhalai forcollection of fruits and their analysis. Theobservations indicate considerable variability in itsfruit shape oval, round and oblong. The significantcorrelation of fruit weight versus fruit length anddiameter, pulp weight versus length and diameterof fruit suggested the scope for direct and indirecteffective selection for further improvement. Theskin colour of fruit is light red, light pink, pink andpale pink, fruit weight (12.7-29.6g), stone weight(4.3-18.65g), fruit length (2.2-3.8 and fruit diameter(2.1 to 5.8 cm). The moisture content (77% to84.5%), T. S. S- (5-14%), pH (3.0-3.g), juice in

aril (58.2-84.6%), Vitamin C (35.6-65.2 mg/100g).The total sugar (6.75-16.3%) was recorded amonginvestigated genotypes of litchi. The variabilityobserved during investigation indicates forselection of superior genotypes to develop earlymaturing verities of litchi for the region.

Variability in litchi fruits

Influence of nutrition and VAM on fruit qualityand yield of papaya (Carica papaya L.) cv. Pusadelicious.

An experiment was carried out to find out theinfluence of nutrition and VAM on Papaya (Caricapapaya L.) cv. Pusa delicious for maximum fruityield and quality. The one third N and full amountof PK & rhizogold (VAM) were applied just beforeplanting of papaya seedling as basal dose and restN in two split doses. Maximum fruit yield 61.28kg/plant was observed under full dose of NPK+10grhizogold followed by 59.62kg/plant underNPK+15g rhizogold. The fruit quality and yieldwas significantly higher under each treatment overcontrol.

Papaya fruits


Evaluation of acid lime (Citrus aurantifolia)cultivars under Tripura condition

Four improved cultivars viz. Vikram, Pramalini,Saisarbai and Baramasi local were planted in 2004in the experimental farm of the Centre atLembucherra to study their performance. Theaverage number of fruits 165/plant wassignificantly higher in compared to Pramalini,Vikram and Saisarbati. The average fruit weightwas 45.6g in Pramalini followed by 41.5 and 38.9gin vikram and saisarbati respectively. Among fourevaluated cultivar pramalini was best consideringthe overall characters followed by saisarbati,vikram and baramasi local.

Evaluation of sweet orange (Citrus sinensis) cv.Mosambi

The Mosambi (Citrus sinensis) were introducedat the Centre from NRC, Citrus, at Nagpur andgrowth was excellent. The flowering was noticedduring last week of February 2007 and heavy fruitset was observed 2007-08. Fruit yield was 85 fruits/plant at 4year age. The average fruit weight was210.6g and TSS was 9.8 brix.

Mosambi fruits at maturity

AonlaThe six variety viz. Kanchan, Chakaiya and NA-

7, NA-5, NA-8 and NA-10 were introduced during2005-06. The survival was excellent. The floweringwas noticed during February last week to last weekof March 2008 under each cultivar of Aonla. Fruitset and development is in process.

BaelDuring 2006-07 three germplasm of bael i.e.

NB-5, NB-6 and NB-9 were introduced. Thesurvival was 90% in each cultivar.

Variability in bael fruits

Development of wasteland through agroforestry models in Tripura

1) Total 12 AFS models were developed e.g.Mango based, bael, Aonla based AFS, Litchibased AFS, Dalchini based AFS, Leuceana,Albizzia, Acacia, Sal and pineapple basedmodel, and Coconut +Pulse based AFS.

2) One aquaculture based AFS model was alsodeveloped during this period.

3) The total area covered under this programmewas about 27ha. (10 institutinal+17 farmersand community land).

4) Two Horticulture based farming systemmodels were established with a combinationof Pineapple, Banana, Karonda, Lemon,Guava and vegetables Cowpea, French bean,Indian bean, Bottle gourd as intercrops. Thecrops are under establishment.

Fruiting in saisarbati acidlime

Fruits of cv. Vikram


VEGETABLES

RESEARCH ON VEGETABLE

Tomato DiseasesIntegrated management of bacterial wilt

Integrated application of host resistance, soildisinfection and rectification and biocontrol agentboth as seed and seedling treatment and fieldapplication along with cow dung manure wasevaluated to manage the bacterial wilt disease intomato. The results indicated that the diseaseintensity was reduced considerably when lime wasused as a component of treatments (Table).However, still there was considerable number ofplants infected, when compared with susceptiblevariety. Further, addition of lime reduced both fruitnumber and weight.

Effects of leaf curl disease in tomatoAlong with bacterial wilt leaf curl disease was

found as very severe under Tilla land conditionsof Tripura. In a separate study eleven varieties oftomato were evaluated for resistance against wiltand leaf curl diseases simultaneously. The wiltdisease was very high in Sel-1 and low in CKVT-17, Arka Abha, BT-117-5-3-1 and BT-1 varieties.The leaf curl was comparatively less in Type-1,Arka Abha, Arka Alok and BT-117-5-3-1, while,that was highest in BT-1 with PI 86.67% and PDI80.83%.

The loss of fruit number and fruit yield due toleaf curl disease was observed in plants, howeverextent varied with intensities (healthy = noinfection at the time of fruit setting, moderate =about 50% of the plant shows symptoms and high= plants are severely affected showing 100% leaveswith curly symptoms) of the disease.

Moderate infection High infectionof leaf curl of leaf curl

Brinjal

Integrated management of bacterial wiltLike tomato, similar set of treatments was

evolved. The results indicated that although somereduction of disease incidence occurred in adoptingall types of integrated system of managementpractices, none of the treatments as mentionedearlier with tomato, except the use of resistantcultivar, was effective economically. Since,supplementation of lime decreased fruit yieldconsiderably (Table 1).

Table 1. Effect of integrated management practices on the control of bacterial wilt in tomato

Treatment* Resistant (BT-10) Susceptible (Sel-1)

Wilt% No of Wt. of Wilt% No of Wt. oftomato tomato (kg) tomato tomato

Lime + Pf 0( + 0) 372(+18) 19.667(+1.911) 27.8(+9.26) 381(+51) 13.467(+2.522)Lime + Bleaching + Pf 2.8( + 3.7) 361(+31) 15.350(+3.100) 25.0(+16.7) 379(+8) 14.567(+0.278)Bleaching + Pf 5.5(SD +3.7) 452(+13) 25.983(+1.655) 33.3(+5.5) 470(+98) 18.033(+5.644)Control (Without any treatment)11.1(+9.3) 401(+45) 26.817(+2.411) 36.1(+3.7) 469(+20) 16.817(+ 0.211)

Figures in parentheses are standard deviation.

* Lime + Pf = Lime application in soil along with seed and seedling treatment and soil application of Pseudomonus fluorescensLime + Bleaching + Pf = Lime and bleaching powder application in soil along with seed and seedling treatment and soilapplication of Pseudomonus fluorescensBleaching + Pf = Bleaching powder application in soil along with seed and seedling treatment and soil application ofPseudomonus fluorescens


Performances of different wilt resistant varietiesof brinjal

Rainy Season: One set of experiment wasconducted by adding one kg decomposedmushroom waste per plant along with cow dungmanure as usual. In another set only cow dungmanure was applied. Four varities, Singnath, BB-40, BB64 and Green Round (with white mosaiccolouration) were planted in three replicated plot.Singnath was least affected by wilt among the four.The resistance to wilt became less with the age ofthe plants. Singnath, BB-40 and BB-64 showedresistance to wilt up to 3 months aftertransplantation and gave better yield of fruits whilethe plants were supplemented with mushroomwaste at the rate of 1kg/plant.

Winter season: Six wilt tolerant varieties, viz.Pongal Pink, Singnath, Green Round, JC-7, Jhuri(Pusa purple cluster) and BB-64 of brinjal weretransplanted along with the susceptible variety,Pongal Green. The variety, Jhuri, performed thebest both in disease reaction and yield during winterseason producing 26.07mt/ha fruit yield whichabout 1.5 fold more than that of control. Other,varieties, like Green Round and BB-64 alsoperformed well and showed tolerant to wilt diseaseduring that season.

Development of bacterial wilt resistant lines intomato and brinjal in TripuraTomato hybridization programme

The seeds from F1 progenies of Tripura Local xH-24, Tripura Local x Arka Abha and Tripura Localx TLBRH-5 were sown to study the performanceof F2 / segregating populations. About 300 plantswere raised in each F1 progenies and in F2 onlythe high yielding and bacterial wilt resistantprogenies were selected for selfing and advancingthe lines to next generation. There were groups ofprogenies viz., 1. Determinate (Dwarf), 2.Indeterminate (ID) and 3. Semi determinate(SD).The performance of segregating populationis presented in Table 2.

Purification of brinjal linesTwo brinjal lines have been promoted AVT-IITwo brinjal varieties were submitted to AICRP

06 (Vegetables). The results of AICRP IET -2006are as follows; the minimum disease incidence was

Table 2. Performance of segregatingpopulations (F2) of Tomato in rabi 2007.

Plant Plant No.of No.of Mean Diseasenumber type cluster fruits/ fruit reaction

cluster weight(g)

a. Local X Arka Abha

10 SD 27 5-6 45.50 R12 D 18 5-6 24.50 R1 SD 37 4-6 62.40 R13 SD 17 5-6 51.40 R3 ID 23 5-6 41.20 R42 SD 26 4-6 50.20 R70 ID 26 5-6 45.60 R7 SD 29 4-6 65.20 R17 SD 20 5-6 35.50 R8 SD 25 5-6 45.80 R6 SD 21 5-6 52.20 R24 SD 29 4-6 59.80 R

b. Local x H-24

4 SD 15 5-6 24.00 R5 D 25 5-6 18.60 R19 ID 17 4-6 30.00 R7 SD 12 5-6 24.40 R20 ID 24 5-6 30.00 R10 SD 20 4-6 18.00 R11 SD 18 5-6 30.50 R18 ID 29 4-6 32.00 R6 SD 36 5-6 22.00 R22 D 27 5-6 36.00 R16 SD 11 5-6 45.20 R15 ID 26 4-6 38.50 R108 ID 31 4-6 34.60 R

Local X TLBRH-5

34 ID 37 5-6 16.00 R35 ID 26 5-6 16.00 R1 ID 50 5-6 30.00 R24 ID 37 5-6 24.00 R5 SD 19 5-6 20.00 R29 SD 34 5-6 28.00 R11 ID 37 5-6 26.00 R14 D 24 5-6 12.00 R

SD- Semi DeterminateID- IndeterminateD- Determinate

recorded in Singnath (2.0%) and Bolonath (7%) atBarapani. At IIHR, Bangalore, highest yield of36.8t/ha was recorded in Singnath without anydisease incidence. These varieties have also


performed well in AVT-I 2007 in four centres.Hence, these two varieties have been promoted toAVT-II2008.

Determinate progeny Indeterminateprogeny

Fig. 3. Singnath (bacterial wilt resistant brinjal)

Organic farming approaches* The highest marketable head yield of

cabbage was recorded (3.08kg) with theapplication of FYM @ 1kg+ PM@2kg+Glyricidia @ 2kg/ 4 Sq.m followed by 2.17kg with the application of FYM @ 4kg+PM@2kg+ glyricidia @ 2kg/ 4 Sq.m. Thenumber outer leaves are positively correlatedwith the total plant yield as well asmarketable yield. However, it was found thatthe increase quantity of organic manures didnot increase the yield. The same organictreatment also performed well in case ofcauliflower.

* The highest yield of brinjal was recorded(45.76t/ha) with the application of 2.5 t/haglyricidia+8.75 t/ha FYM followed by withthe application of [email protected] t/ha +FYM @ 5.00 t/ha + poultry manure 5.00 t/ha (42.2 t/ha). For controlling fruit and shoot

borer, the IPM methods like planting refugecrop (more susceptible varieties) on theborder, shoot clippings (3 times in a year)and pheromone trap @ 15 ha was found tobe successful for organic production of thebrinjal.

AICRP on vegetables

Ash gourdThe ash gourd varieties such as IVAG-90 and

TRC-AG-1 were found be high yielding withmosaic resistance. The varieties such as RCAG,Indu and PAG-72 were highly susceptible tomosaic.

KakrolAbout four local kakrol germplasm have been

collected and evaluated for yield and otherattributes and the highest yield was recorded inLocal -1 (2.92 kg/plant) and the least yield wasnoted in Local-3 (1.76 kg/plant).

Indian Bean

GoldyThe variety “Goldy” supplied by Ankur Seeds

(Pvt) Ltd, produced first flowering on 34th day ofthe sowing. The average plant height (65cm), no.ofspikes plant (6-9), no. of pod/spike (6-8) and yield/plant (150-180g) was also recorded. This varietycan be planted at spacing of 45 x 45 cm (50000plants/ha). This variety was found to be photoinsensitive under Tripura condition.

“Goldy”

Brinjala. Brinjal (long) AVT-1 Out of 5 varieties tested, the highest yield wasrecorded in PB-69 (10.33 t/ha) followed by PB-70


(10.05 t/ha). All varieties were found susceptibleto bacterial wilt and the mortality percentage wasranging from 20.16 to 53.33 percent.

b. Brinjal (long) AVT-IIOut of 4 varieties tested, the highest yield was

recorded in SH-SB-101 (14.26 t/ha) followed byHLB-25 (11.28 t/ha). All varieties were foundsusceptible to bacterial wilt. The least diseaseincidence was recorded in SH-SB-101 (6.00%).

c. Brinjal (long) IETOut of 4 varieties tested, the highest yield was

recorded in BCB-11 (12.86 t/ha) followed by HLB-25 (10.40 t/ha). All varieties were found susceptibleto bacterial wilt and the mortality percentage wasranging from 21.38 to 53.33 percent.

d. Brinjal (bacterial wilt) AVT-IOut of 6 varieties tested, the highest yield was

recorded in Bolonath (44.67 t/ha) followed bySingnath (43.15 t/ha). The varieties such asSingnath and Bolonath were found resistant tobacterial wilt as compared to the standard check.

E. Tomato

a. Tomato (TLCV, IET)-07Out of 5 varieties tested, the highest yield was

recorded in TLBRH-6 (58.59 t/ha) followed byTBK-0113 (35.36 t/ha). The least disease incidencewas recorded in TBK-0113(1.66 %) and Tai-04-000778 (3.60%). The variety TLBRH-6 was foundto be resistant to leaf curl.

b. Tomato (bacterial wilt, AVT-I )-07Out of 5 varieties tested, the highest yield was

recorded in BT-106 (26.10 t/ha) followed by LE 1-2 (23.60 t/ha). The least disease incidence wasrecorded in LE 1-2 (2.00 %) and LE-626 (3.66%).

c. Tomato (bacterial wilt, IET) -07Out of 5 varieties tested, the highest yield was

recorded in BMZ-21 (29.30 t/ha) followed by BT-317 (23.43 t/ha). The least disease incidence wasrecorded in BMZ-21 (2.00 %) and BT-317(19.33%).

TUBER CROPSDevelopment and transfer of tuber cropstechnologies in NE States

TapiocaOut of eight varieties tested (Third year), the

varieties such as H-1687, H-226, H-165, Sree jayaand Tripura local (A variant of M-4, branchingtype) were found high yielding.

Sweet potatoOut of 7 varieties tested, the varieties such as

Gouri (1.53kg/plant), 440038 (1.65 kg/plant) andSankar (1.55kg/plant) were found high yielding.

ColocasiaSeven local varieties have been collected and

evaluated for the yield and other parameters alongwith check (Muktakeshi). The highest yield (3.25-3.60) was recorded in Tripura local- 2, which is abunda type and Muktakeshi yield was less (0.27-0.34 kg/plant). The Muktakeshi was found to beresistant to leaf blight as compared to othervarieties.

Local colocasia germplasm

The highest corm yield was recorded (5.67 kg)with the application of FYM @5 kg /pit + 25 gRhizagold followed by 4.50 kg with the application


of poultry manure @ 5 kg/pit + 20g Rhizagold ascompared to control (1.85kg)

Organic farming in elephant foot yam

Participatory demonstration of tuber cropstechnologies for livelihood opportunities intribal areas of west Tripura

Survey of the tribal areasThe survey was conducted on September 3rd

week and October 1st week in Mohanpur Block ofwest Tripura to select the tribal farmers and to studytheir living standards. In Bishalgah Block, twotribal villages viz., Bankshipara and Tuijiling andfrom Mohanpur Block four tribal villages viz., 1.Samburam para. 2. Balaram choudhury para,3.J.M.Para, and 4. Mohanpur.The farmers are cultivating the local, poor yieldingvarieties of tapioca, sweet potato, greater yam andelephant foot yam.

Collection of high yielding varietiesThe ICAR Tripura Centre, Lembucherra, has

taken effort to introduce high yielding and highstarch varieties of cassava, high yielding Greateryam, high â- carotene rich varieties of sweet potatoand low acrid/non acrid varieties of elephant footyam. All those varieties have been collected fromCentral Tuber Crops Research Institute, RegionalCentre, Bhubaneshwar, Orissa.

Multiplication of planting materialsThe ICAR Tripura Centre, Lembucherra, has

multiplied the high yielding and high starchvarieties of cassava, high yielding Greater yam,high â- carotene rich varieties of sweet potato andlow acrid/non acrid varieties of elephant foot yamfor the distribution to the beneficiaries.

Distribution of sweet potato cuttingsThe β- carotene rich varieties of sweet potato

like Gouri, 440038 and Sankar were distributed(12000 no) to the tribal farmers in October, 2007and in April 2008, the high yielding tuber cropssuch as cassava (6000 no.of cuttings), elephant footyam (7500 no.of cut pieces and corm), sweet potato(9000 no.of vine cuttings) and greater yam (6000no.of cuttings) were distributed to the beneficiaries.Besides, about 20 farmers from Bishramganj areashave collected tuber crops planting materials (50,100, 25, 25 no.of planting materials of cassava,sweet potato, elephant foot yam and greater yam,respectively) for planting as intercrop in the rubbergarden. The data on yield and local peoplepreference will be recorded in December 2008.

Distribution of planting materials

Exhibition of tuber


WATER QUALITY

Water was collected from different sources inWest Tripura and thereafter analysed to find outthe contents of some elements in order to find outthe quality parameter of water resources aspopulation increase and overall developmentalactivities have resulted in the pollution of water invarious ways. Total no. of water samples analysedare 28 collected from 9 blocks and AgartalaMunicipal area . The analytical data are presentedbelow.

From the perusal of the data presented in Table,it is indicated that pH of water showed a variationfrom 6.11 to 7.68 and the maximum permissiblepH is around 6.5 to 8.5. So, pH of drinking water

in some places is not upto the permissible limit.Concentration of nitrate, phosphate, potassium andcalcium in water samples varied from 1.0 to 7.2mg/L, 0.04 to 1.43, 0.09 to 2.24 and 0.64 to 11.48mg/L, respectively. Nitrate contamination may turnout to be problematic if the concentration is above10 mg/L NO3-N or 45 mg/L NO3 (Table 1).

Contents of microelements in water arepresented in Table 2. Contents of Zn, Cu, Mn andFe varied from trace to 129, trace to 11, trace to990 and trace to 4205 μg/L. According to WHOstandard, the maximum permissible limit formicroelements in water is 5 mg/L ( Zn), 0.2 mg/L(Cu), 2 mg/L(Mn) and 0.3 mg/L(Fe). Some of thewater samples analysed here are having a highcontent of iron contamination.

Table 1. Estimation of some macroelements in water samples

Block Place ( Village) Type of water pH Nitrate Phosphate Potassium Calcium(mg/L) (mg/L) (mg/L) (mg/L)

Dukli Amtali Drinking water 6.25 4.4 0.10 0.27 3.19Dukli Amtali Irrigation water 7.21 1.5 0.04 0.34 3.19Dukli Amtali Pond water 7.16 1.4 0.06 0.41 0.64Jirania Dudhpatil Irrigation water 7.49 3.0 1.43 0.48 4.94Bamutia Rangutia -Do- 7.43 1.2 0.51 0.16 4.47Jirania Champaknagar -Do- 7.68 1.0 0.40 0.27 3.19Kalyanpur Ghilatali -Do- 7.08 7.2 0.03 2.24 11.48Bishalgarh Nabinagar Drinking water 6.75 1.4 0.05 0.20 4.2Bishalgarh Nabinagar Pond water 7.81 1.8 0.17 0.99 4.2Bishalgarh Nabinagar Irrigation water 6.11 1.2 0.12 0.03 4.2Bishalgarh Durganagar Drinking wate 6.25 3.0 0.21 0.23 2.1Bishalgarh Durganagar Pond water 7.08 2.8 0.12 0.78 2.1Bishalgarh Durganagar Irrigation water 7.14 1.0 0.30 0.38 3.2Boxnagar Boxnagar Drinking water 6.15 3.7 0.05 0.06 5.3Boxnagar Boxnagar Pond water 7.24 1.4 0.12 1.31 3.2Boxnagar Boxnagar Irrigation water 7.58 1.9 0.05 0.20 4.2Agartala Municipality Kalikapur Drinking water 6.44 2.5 0.12 0.09 3.2Agartala Municipality Kalikapur Pond water 6.75 3.7 0.15 1.51 6.3Agartala Municipality Kalikapur Irrigation water 6.35 3.5 0.15 0.44 6.3Sonamura Sonamura Drinking wate 6.50 3.1 0.04 0.09 4.2Sonamura Sonamura Pond wate 7.60 4.3 0.22 0.41 2.1Sonamura Sonamura Irrigation water 6.23 2.5 0.04 0.17 1.1Dhanpur Dhanpur Drinking water 6.22 1.7 0.06 0.20 1.1Dhanpur Dhanpur Pond water 6.85 2.4 0.08 1.65 7.4Dhanpur Dhanpur Irrigation water 6.77 3.2 0.08 0.20 3.2Kathalia Kathalia Drinking wate 6.25 2.0 0.04 0.23 2.1Kathalia Kathalia Pond wate 7.45 2.1 0.11 1.97 10.5Kathalia Kathalia Irrigation water 7.22 1.4 0.04 0.26 2.1


Table 2. Contents of some microelements( µg/L) in water

Block Place ( Village) Type of water Zn Cu Mn Fe

Dukli Amtali Drinking water Trace 7 112 145Dukli Amtali Irrigation water Trace 9 116 42Dukli Amtali Pond water 27 10 134 1370Jirania Dudhpatil Irrigation water Trace 6 Trace 3210Bamutia Rangutia -Do- 3 Trace Trace 334Jirania Champaknagar -Do- 23 Trace 11 62Kalyanpur Ghilatali -Do- 41 11 11 62Bishalgarh Nabinagar Drinking water 34 Trace 70 172Bishalgarh Nabinagar Pond water 9 2 38 67Bishalgarh Nabinagar Irrigation water 16 1 46 363Bishalgarh Durganagar Drinking wate 22 Trace 481 112Bishalgarh Durganagar Pond wate 36 Trace 77 76Bishalgarh Durganagar Irrigation water 129 9 55 4205Boxnagar Boxnagar Drinking water 90 Trace 55 227Boxnagar Boxnagar Pond water 33 Trace 58 1257Boxnagar Boxnagar Irrigation water 10 Trace 46 415Agartala Municipality Kalikapur Drinking water 19 Trace 249 104Agartala Municipality Kalikapur Pond water 47 Trace 990 2286Agartala Municipality Kalikapur Irrigation water 7 Trace 118 268Sonamura Sonamura Drinking water 9 Trace 59 415Sonamura Sonamura Pond water 23 Trace 15 2200Sonamura Sonamura Irrigation water 7 Trace 2 1106Dhanpur Dhanpur Drinking water 10 Trace 6 TraceDhanpur Dhanpur Pond water 19 Trace 28 242Dhanpur Dhanpur Irrigation water 18 Trace Trace TraceKathalia Kathalia Drinking wate 28 Trace 737 TraceKathalia Kathalia Pond wate 9 Trace 65 TraceKathalia Kathalia Irrigation water 21 Trace 17 Trace

SOIL HEALTH CARD

NABARD Project: Introduction of soil healthcard

A project on “Introduction of soil health card”sanctioned by NABARD was initiated to preparesoil health card from members of Farmers’ cluband altogether 539 soil samples were collected from26 farmers’ club existing in West Tripura and outof which 132 nos of card is ready for distributionamong the farmers. On the basis of soil test valuesfrom very low to very high nutrient values, fertilizerrecommendation of various crops grown in theirplot is also mentioned in the card. Following is thesample of soil health card as prepared.

Soil health card

Farmer/Person ID Land/Soil Information

Name Nabakumar Land Low Land 2 KaniSarkar Topography land Area

Village Amtali Irrigation Avail- Soil SandyFacility able Texture loam

Block Dukli Sample 07/ Soil 2-3 mCollection 02/ DepthDate 08

District West Last July Crop RiceTripura Crop 2007

GrownFarmer’s Naba- Last Juneclub jagaran Fertilizer ‘07

Application


Soil test results

Sl. No. Parameters Soil test Soil test ratingvalue

Very low Low Medium High Very high

1 Soil pH 5.22 < 4.5 4.5-5.0 √ 5.2-5.5 5.6-6.0 6.1-6.52. Per cent organic carbon 0.62 <0.4 0.4-0.6 √ 0.6-0.75 0.75-1.5 >1.53. Nitrogen (kg/Kani) 45 16 16-32 √ 32-48 48-64 64-804. Phosphorus( -Do) 1.76 <0.8 0.8-1.6 √ 1.6-2.4 2.4-3.2 3.2-4.0 & more5. Potasssium(-Do) 10.5 <12 12-24 24-36 36-48 48-60 & more6. Calcium(- Do) 72 √ <105 105-150 150-200 200-300 >3007. Sulphur ( -Do) 4.03 <3.5 √ 3.5-5.0 5.0-8.0 8.0-11.0 >11.08. Iron (ppm) 12 <4 4-6 √ 6-12 12-20 >209. Manganese (- Do) 9 <2 2-5 √ 5-10 10-15 >1510. Copper (- Do) 1.58 <0.2 0.2-0.4 0.4-0.5 √ 0.5-1.5 >1.511. Zinc ( -Do) 2.04 <0.4 0.4-0.5 0.5-1.0 √ 1.0-2.0 >2.0

Fertilizer {kg/Kani(0.16 ha)} Recommendation

Crop – high yielding paddy ( 80:40:40)

Fertilizer/Amendment Quantity(kg/kani)

Urea 17SSP 24MOP 11Cowdung 800-1000Biofertlizer (Azotobacter/PSB) 0.6-1.0Micronutrient (Zinc) 1.5-2.0

MUSHROOM

Oyster mushroomThe oyster mushrooms, Pleurotus sajor-caju, P.

flabellatus and P. florida, developed fruit bodies inevery month through out the year (Fig. 1). All thethree species performed well under Tripuracondition. The period from September to Januarywas more favourable for fructification than others,although, the mushroom fruit body yield during theperiod w.e.f. May to August was considerable. Theyield of mushroom was very low during the months,April, February and March. The low production inthe months was mainly attributed with hightemperature and low relative humidity inatmosphere.

Fig. 1. Oyster mushroom production patterns inTripura during 2007-08.

The efficacy of different agricultural residuesand their combinations, such as, gram haulms,paddy straw + blackgram pod shell (1:1), groundnuthaulms, maize stalk and paddy straw (control), wasstudied (Table 1). It was found that paddy strawmixed with blackgram pod shell, paddy straw aloneand maize stalk were very good substrate forcultivating oyster (Pleurotus flabellatus)mushroom.

The influence of vermicompost on theproduction of oyster mushroom was studied withPleurotus florida (Table 2). It was observed thatvermicompost while used either as sterilized orunsterilized increased production of mushroomduring unfavourable season (March) of mushroomgrowth.


Table 1. Effect of different substrates on theproduction of oyster (Pleurotusflabellatus) mushroom

Substrate Date of Days Yield Biologicalspawning required (g/kg efficiency

for first substrate) (%)harvest

Gram haulms 22.11.07 23 430 43.00Paddy straw + 22.11.07 28 900 90.00Blackgram podshell (0.5kg + 0.5kg)Groundnut 22.11.07 31 263.33 26.33haulmsMaize stalk 22.11.07 20 700 70.00Paddy straw 22.11.07 25 856.67 85.66(Control)

Table 2. Effect of vermicompost supplement-ation on the production of oyster (P.florida) mushroom

Substrate Date of Days Yield Biologicalspawning required (g/kg efficiency

for first substrate) (%)harvest

Paddy straw + 4.3.08 20 566.67 56.67Vermicompost(sterilized)Paddy straw + 4.3.08 19 630.00 63.00Vermicompost(unsterilized)Paddy straw 4.3.08 25 241.67 24.10(withoutamendment)Control

Influence of different types and sizes of bedson the production of oyster mushroom (P.flabellatus) was studied (Fig.2). The results showedthat cylindrical bed prepared by polythene bag (16"x 20") with intact straw was the best with 70.22%BE.

Fig.2. P. flabellatus on P. flabellatus oncylindrical bed cuboid bed

Paddy straw mushroomPaddy straw mushroom (Volvariella volvacea),

the most popular edible mushroom of SoutheastAsian countries, was cultivated well on cut paddystraw treated with chemical disinfectants andforming 1 cu ft cube-bed during the period fromApril to November, 2007 in Tripura. The mushroomshowed better yield during the period from June toOctober (Fig.3). It was also observed that in Tripuraall the fruit bodies developed in one flush of 1-3days time period span and there was no further flushof fruit bodies. This finding is quite distinct asdevelopment of fruit bodies of paddy strawmushroom in two to three flashes at seven to eightdays intervals are common in all most all thetropical places.

Fig. 3. Month wise production pattern of paddystraw mushroom under Tripura condition

The mushroom production on pea pod shell andrajmash pod shell was at par with paddy straw,although in both the cases fruit developed latter thanthat of paddy straw. These two agricultural residueswere found equally good and additional newsubstrate materials of V. volvacea.

In pea haulms, the mycelia of V. volvacea grewvery well and covered the substrate as with whitishmycelial mat within 6-7 days but the fruit bodyformation was less than that of paddy straw. Therest of the other substrates were poor yielder thanpaddy straw.

Milky mushroomMilky mushroom (Calocybe indica), also known

as ‘Dudh chhata’, was cultivated during the periodApril to November, 2007 in ICAR, Tripura. Themushroom did not produce its fruit body in


November. The mushroom production was betterduring June to August with a peak in July, 2007(Fig.4).

Fig. 4. Production pattern of milky mushroom inTripura

AGROFORESTRY

Multipurpose tree species suitable forsubtropical humid climate were planted in anagroforestry arboretum in Tripura. MPTs aredivided into three groups in the planting geometry.

Group-I (2m x 2m spacing)1. Akashmoni (Acacia auriculiformis, A.

Cunn.) 2. Mulberry (Morus alba, Linn) 3.Subabul (Leucaena leucocephala, Lank) 4.Shisam (Dalbergia sissoo, Roxb.).

Group-II (3m x 3m spacing)1. Gliricida (Gliricidia maculate, H.B. & K.)

2. Neem (Azadirachta indica, A. Juss) 3.Champa (Michelia champaca, Linn) 4.Safeda (Eucalyptus hybrid, L. Herit.).

Group-III (4m x 4m spacing)1. Teak (Tectona grandis, Linn) 2. Gamahar

(Gmelina arborea, Linn) 3. Raintree(Samania saman,Jacq.) 4. White Siris(Albizzia procera, Linn).

1. Growth characteristics

Table 1. Growth characteristic of MPTS after20 years of age

MPTS Tree Basal Girth atheight girth breast(m) (cm) height (cm)

Morus alba 5.2 39.64 33.22Leucaena leucocephala 11.28 53.15 46.22Dalbergia sissoo 12.75 68.05 59.65Gliricidia maculata 8.50 46.48 40.97Azadirachta indica 8.32 47.50 41.28Michelia champaca 14.84 83.80 71.73Eucalyptus hybrid 25.61 98.20 90.28Tectona grandis 13.26 82.40 67.8Gmelina arborea 12.45 89.15 75.02Samania saman 11.59 81.17 70.25Albizzia procera 14.60 89.57 77.72Mean 12.58 70.83 61.29SE (±) 9.38 4.97 8.33CD (5%) 18.38 9.74 16.32

It is noted that Eucalyptus hybrid attained themaximum height of 25.61 m followed by Micheliachampaca ( 14.84 m), Albizzia procera ( 14.60 m),Tectona grandis (13.26 m) and Gmelina arborea(12.45 m). Basal girth and girth at breast heightwere maximum in Eucalyptus hybrid and minimumin Morus alba.

2. Crop productivityUnder silvi –horticulture trial, pineapple,

turmeric and dioscorea alata were grown inassociation with tree species and the cropproductivity as recorded under the tree species arepresented below (Table 2).

Table 2. Productivity of pineapple

Tree species Fruit weight Productivity(g) /plant (t/ha)

Tectona grandis 591 19.09Samania saman 620 13.13Gmelina arborea 760 14.42Michelia champaca 790 10.86Eucalyptus hybrid 720 6.06Azadirachta indica 750 7.68Albizzia procera 690 9.98Gliricidia maculata 700 9.11Morus alba 680 5.97Mean 630 9.63


Dioscorea alata was grown under the treespecies and productivity varied from 0.88 to 4.45 t/ha showing the highest productivity underAzadirachta indica .

Turmeric was also grown under the tree speciesand the productivity underwent a variation from1.75 to 11.50 t/ha.

3. NABARD project on agroforestryThe project on demonstration of agroforestry

for organic food production in Tripura financed byNABARD is under implementation by ICAR,Tripura centre among the farmers of Mohanpurblock. Pineapple has been planted in 5 farmers plothaving tree species Gmelina arborea, Tectonagrandis,Hevea brasilliensis and Acaciaauriculiformis. The total area under pineappleplantation is about 1.06 acre.

A view of pineapple plantation in farmer’s plot

4. Productivity of jatropha

A. Progeny trialIn the progeny trial, 18 seed sources of jatropha

were planted in the 9th May,2006. After 1 year and4 months of planting, seed source from Dimapara(South Garo Hills) showed the maximum basaldiameter and the least diameter was shown by theseed source from East Garo Hills. No. of branchesin non pruned jatropha varied from 11.66 to 39.66.On 50 and 75% pruning, the no.of branches wereraised to 23.0 to 44.66 and 20.66 to 59.0,respectively. Seed sources from Dimapara (SouthGaro Hills), Tura (West Garo Hills), Hamirpur

(Himachal Pradesh) and Udaipur ( Rajasthan)showed high no.of branches ( 50-59) on pruning(75%).

The average wt of fruit was observed to varyfrom 8.0 to 60.17 g with seed wt from 3.57 to 29.58g.

B. Agri-silviculture trialIn the agri-silviculture trial planted in the 9th

May’06 in spacing of 4 x 3 m, sesamum ( var. B-67) and bhindi ( var.BRO-6) were grown. Fromthe perusal of growth characteristics estimated on1st December’07), it is observed that basal diameterof the jatropha varied from 3.97 to 5.88 cm andcollar diameter varied from 2.06 to 2.74 cm. No.of branches were 10. 66 to 33.22.

Fruit and seed wt of jatropha planted in agri-silvi culture trial were presented in Table 3. Fruitwt varied from 7.0 to 25.0 with seed wt from 3.75to 12.0 in agri-silvi culture trial.

Table 3. Fruit and seed wt of jatropha in agri-silvi culture trial (9th August’07)

Seed source Average Averagewt of fruit wt of seed/plant (g) /plant (g)

Ri-Bhoi (Mawhati) 25.0 12.0Ri-Bhoi (Mawlasni) 13.0 9.0Mendipathar (East Garo Hills) 19.5 10.33Dimapara (South Garo Hills) 10.77 7.11Udaipur (South Tripura) 7.0 3.75

The productivity of crops grown in agri-silviculture trial is presented in Table 4.

Table 4 . Productivity of crops ( q/ha)

Seed source Sesamum Bhindi( q/ha) (q/ha)

Dharmanagar (North Tripura) 9.91 -Udaipur (South Tripura) 8.42 -Dimapara (South Garo Hills) 6.45 -Ri-Bhoi (Mawhati) - 10.32Mendipathar (East Garo Hills) - 8.38Ri-Bhoi (Mawlasni) - 8.70

C. Package of practicesIn package of practices trial with the fertilizer

dose of 26 g urea, 100 g SSP, 16 g MOP and 1 kg


cowdung /plant. Basal diameter underwent avariation from 3.07 to 4.88 cm and collar diametershowed a variation from 1.52 to 2.55 cm. No.ofbranches are varying from 4.44 to 30.88.

D. Growth characteristics of new plantationThe oil content of jatropha samples collected

from different places of Tripura, Meghalaya andMaharashtra was estimated and the data arepresented in Tables 5,6 and 7.

Sample with seed oil < 30 %

Table 5. Oil content of jatropha seed

Sample % of seed oilcontent

Sonamur (Nidya) 29.71Shantir bazaar (Trijunction) 26.89Baikhora(Sachirambari) 26.83Jolaibari 29.59

Sample with seed oil 30-35%


Sample % of seed oilcontent

Bisramganj 32.96Sonamura (Kathalia) 32.42Belonia(Kasari) 30.17Belonia (Borpather) 30.82Sonamura(Baghairchar) 34.89Shantirbazar (Subhash Colony) 33.43Maharashtra 34.68Meghalaya (Shillong) 31.30

Sample with seed oil >35%


Sample Oil content (%)

Amtali (Bagmara colony) 38.47Melaghar (Phongbari) 37.07

E. Jatropha plantation in sloppy land in ICARfarm

In 2006,jatropha from seed was raised in sloppyland in ICAR farm and the growth characteristics

as recorded in December’07 are presented in Table8.

Table 8. Growth characteristics of jatropha insloppy land

Seed source Height Basal Collar No.of(m) diameter diameter branches

(cm) (cm)

Khowai 1.23 2.93 1.34 8.15(West Tripura)Udaipur 1.44 3.31 1.70 8.66(South Tripura)Dharmanagar 1.45 4.31 2.11 11.0(North Tripura)Damdamia 1.48 3.0 1.76 5(West Tripura)East Garo Hill 1.51 3.92 2.18 13.5Rajasthan 1.51 3.54 1.86 6.0

F.Jatropha plantation in villageIn a village, jatropha was planted in a

community land for demonstration in the monthof September’07 and the growth characteristics arepresented in Table 9.

Table 9. Growth charteristics of jatropha in avillage

Seed source Height Basal Collar No.of(m) diameter diameter branches

(cm) (cm)

Maharashtra 1.22 2.63 1.43 6.66Shantirbazar 0.56 3.26 1.06 1.66(Trijunction)Shantirbazar 0.44 2.93 0.90 0.66(Subhash colony)Julaibari 0.48 3.0 0.86 2.0(South Tripura)Baikhora 0.39 2.73 0.93 0.66(South Tripura)

FARMING SYSTEM RESEARCHPROJECT

FSR 1A number of crop combination was under trial

in FSR -1 where the cropping intensity could beraised to 300 % and the economics of croppingsequence as worked out below.


It is indicated that the crop sequence attempted inFSR -1 is maize –moong- cauliflower (1),sesamum-tomato (2), upland rice –cabbage (3),maize –cabbage(4), upland rice –broccoli-capsicum(5), maize –carrot (6), upland rice-mustard (7),moong –radish –french bean (8), moong –frenchbean –capsicum (9), sesamum –field pea (10),moong –mustard (11) and moong –field pea (12).The benefit-cost ratio is presented below (Fig.1).

Fig. 1. Benefit/cost ratio of crop sequence

It is thus indicated that maize –carrot could givethe maximum benefit/cost ratio of 3.06 followedby maize –cabbage ( 2.82) and moong –radish –french bean (2.70) etc.

Besides crops grown in the farming system,various fruit plants such as lemon, mango andbanana were planted and water harvesting structurewith duckery is also available.

FSR -1 is 1 hectare and out of which an area of3416 m2 is under various crops and the remainingarea is under forest tree species and fruit plants.The net economic return is observed to be aroundRs 0.51 lakh and out of the various interventions

made here , the benefit /cost ratio varies from 1.11to 5.67 .

Horticultural crops Area( m2) Productivity Cost of Gross return Net return Benefit/(t/ha) cultivation (Rs/unit area) (Rs/unit area) cost ratio

(Rs/unit area)

Baramasi lemon 200 - 127/- 434/- 307/- 3.42Assam lemon 100 - 330/- 845/- 515/- 2.56Mango 240 1.88 331/- 1006/- 675/- 3.04Banana 384 - 480/- 1650/- 1170/- 3.44Ridge /bottle gourd 300 - 1670/- 4250/- 2580/- 2.54Broom grass 108 - 400/- 850/- 450/- 2.13Fish from water 326 4.29 2100/- 11,900/- 9800/- 5.67harvesting structureDuckery 326 635 nos of 500/- 2083/- 1583/- 4.17

egg from 15nos of duck

FEED AND FODDER

Cultivated fodders: forage yield and nutritivevalue

Forage crops (Berseem: Trifolium alexandrinumand pearl millet/Bajra: Pennisetum typhoides) werestudied for their forage yield and nutritionalcharacteristics at Tripura Centre. Berseem(Muscavi) was sown in first week of November(rabi crop) and 5 cuts were obtained up to April.Bajra (var. AVKB-19) was grown in kharif seasonand sowing was done in June-July. The crop washarvested 65-70 days after sowing. The fresh forageyield was recorded to be 350-425 and 450-515 q/ha in berseem and bajra, respectively. Therespective DM content was 13.37 and 19.21%. Thenutritional parameters have been depicted in Table1.

Berseem (Muscavi)


It was observed that the forage yield of berseemwas much less than other regions particularlynorthern one which could be primarily due to acidicconditions of the soil in Tripura while the forageyield of bajra was at par.

Chemical evaluation of fodders consumed byBlack Bengal goats

Various fodders consumed by local goats (BlackBengal goat) of Tripura were collected andestimated for their nutrient composition in termsof proximate principles and cell wall constituents(CWC’s,). These included indigenous feedresources including tree/shrub leaves (A.heterophyllus, Ficus hispida, Gliricidia maculata,Gmelina arborea, L. leucocephala, Morus alba,Trema orientalis and Zizyphus mauritiana) and

agricultural weeds (Commelina benghlensis,Cyanodon dactylon, Eleusine indica, Paspalumconjugatum, Amaranthus spinosus, Mikaniacordata and Mimosa pudica). Cultivated fodderslike napier hybrid, signal grass and rice bean werealso evaluated. The DM content in tree leaves andweeds was 33.77±1.99 and 18.92±1.565,respectively. The mean values for CP, EE, CF, NFE,and total ash were found to be 15.81±1.67,2.66±0.28, 16.57±1.49, 55.07±0.89 and 9.90±1.56in case of tree leaves while the correspondingvalues for weeds were 14.17±1.62, 1.67±0.22,21.24±1.48, 51.33±1.00 and 11.59±0.33%. Withregard to CWC’s, the values averaged 46.97±1.87,27.43±0.38, 19.54±2.15, 16.18±1.23 and6.59±0.09% for NDF, ADF, hemicellulose,cellulose and ADL in tree leaves. In case of weeds,the respective values were observed to be59.85±4.95, 31.47±1.95, 28.28±3.84, 21.46±2.20and 5.52±0.63%. The balanced rations for goatswere formulated.

Nutritional strata of some underutilizedvegetables of Tripura

Underutilized vegetables are such vegetableswhich are consumed by local population of Tripuraparticularly by rural folk mainly tribals, however,their nutritional worth is not known and theirpotential as nutrient sources has not been realized.Several such vegetables (n=10) viz., Lagenariasiceraria (Laav vines), Centella asiatica(Thankuni), Oxalis corniculata (Amrul sak),

Bajra (AVKB-19)

Table 1. Nutritional characteristics of berseem and pearl millet

Parameter Berseem Bajra Parameter Berseem Bajra

Proximate principles (%) Major minerals (%)CP 18.01 8.52 Ca 1.96 0.55EE 2.15 1.76 P 0.42 0.27CF 17.16 25.01 Trace minerals (ppm)NFE 50.20 54.91 Fe 233.53 237.44Total ash 12.48 9.80 Cu 10.55 3.32

Zn 88.41 76.57CWC’s (%) Mn 53.25 59.94NDF 43.82 68.44 Co 0.24 0.18ADF 30.53 39.97 Digestibility (%)Hemicellulose 13.29 28.47 IVDMD 72.85 57.34Cellulose 19.20 28.54 IVOMD 74.32 58.59Lignin 8.34 7.22 ME (MJ/kg DM) 8.82 7.48


Chenopodium album (Bethua sak), Amaranthusspinosus (Kanta nutia), A. viridis (Jungli cholai),A caudatus (Daata plant), Boerrhavia diffusa(Punarnaba), Leucaena leucocephala (Subabool)and Brassica campestris (Lai patta) were evaluatedfor nutritional characteristics in terms of proximateprinciples and mineral composition. The dry mattercontent ranged from 10.65 to 22.25% averaging15.89±1.41%. The levels of CP, EE, CF, NFE andtotal ash were found to be 16.64±1.10, 2.54±0.24,15.89±1.41, 52.00±1.39 and 13.03±1.22%,respectively. Protein concentration ranged from10.87 to 23.33% while fibre level varied from9.96to 24.92. The average concentration (range inparenthesis) of Ca and P was observed to be0.99±0.19 (0.27-1.67) and 0.18±0.03 % (0.05-0.42), respectively while those of Fe, Cu, Zn, Mnand Co averaged 201.8±32.5 (62.1-346.1), 9.7±2.1(2.9-24.1), 67.6±19.5 (11.5-245.4), 89.9±16.4(13.5-161.2) and 0.3±0.04 (0.1-0.4) mg/kg drymatter, respectively.

Nutrient composition of different species ofmushroom

Eight species of mushroom (Calocybe indica,Pleurotus flabellatus, P. sajor caju, Volvariellavolvacea, P. florida, P. djamour, Macrolepiotaprocera and P. ostreatus) grown at Tripura Centrewere evaluated for proximate composition. TheDM content averaged 9.32% (7.50-13.43). Themean values (DM basis) for OM, CP, EE, CF, NFEand total ash were recorded to be 91.89, 27.07, 3.19,8.52, 53.11 and 8.11%, respectively across 8species. The protein content ranged from 17.27 (P.djamour) to 35.68 % (V. volvacea). The lowest EEconcentration was found in C. indica (2.78%) whileV. volvacea possessed the highest value (3.95%).Similarly, the differences existed among the specieswith regard to NFE contents which varied from36.40 (V. volvacea) to 65.31% (P. djamour). Themushroom species differed for total ash/inorganicmatter content as well (5.25-10.87%). It could beseen that the average fat level was much lower thaneggs or meats which could be helpful to obesepeople. On a comparative basis, protein contentwas higher than vegetables but lower than eggs/meat indicating that in terms of nutritional valuethey occupy intermediate position betweenvegetable and egg/meat proteins.

Status of soils, feeds/fodders and cattle withrespect to mineral elements

The concentration of available Ca (52.1-90.5ppm) and P (21.4-63.3 ppm) in majority of soilsamples (n=12) was below the critical limits whilethe levels of Fe (8.5-23.0 ppm), Cu (0.72-1.51ppm), Zn (2.5-3.8 ppm) and Mn (22.8-26.7 ppm)seemed to be adequate. Various feeds/fodders(n=15) consumed by cattle included agriculturalweeds (Commelina benghalensis, Cyanodon,Mikania cordata, Eleusine indica, Paspalumconjugatum, Alteranthera sessilis etc.), tree leaves(Artocarpus heterophyllus, Ficus hispida, Acaciamoniliformis, Trema orientalis, Gliricidiamaculate, Bambusa sp. etc.), paddy straw and/orrarely concentrate ingredients like rice bran/brokenwheat. Overall, they possessed Ca, Fe, Mn and Colevels well above the critical limits while majorityof them had low concentration of P, Cu and Zn.Blood serum of cattle (n=24) also showed lowerthan normal level of P (3.28-6.07 mg/dl), Cu (0.42-1.46 ppm) and Zn (0.48-1.66 ppm) in many caseswhile the concentration of Ca, Fe and Mn was inthe normal range.

Effect of supplementation of probiotics ongrowth and feed conversion ratio in crossbredpigs

Ten crossbred pigs (Hampshire x Khasi Local)of similar body weight (14.5 kg) and age (2.5-3.0months) were randomly distributed into 2 groupsof 5 animals each in a completely randomly blockdesign. All the animals were fed according to theirrequirements. The animals in group 1 (control)were not given any probiotics while animals ingroup 2 were supplemented with probiotics(Biobloom) at the rate of 75g/100 kg feed. Thefeeding experiment was continued for 135 days.Average daily gain (ADG) in body weight anddressing percentage were significantly (P<0.01)higher in supplemented group than the control one.ADG was found to be 288.8g and 366.6g in group1and 2, respectively while the corresponding valuesfor dressing percentage were 65.44 and 76.76 percent. Group 2 also showed better feed conversionratio compared to group1 (4.22 vs 5.23 kg per kggain). Average daily feed intake was, however, notaffected by probiotics supplementation and it wassimilar in both the groups (1.51 and 1.54 kg/d). It


could be seen that supplementation of probioticscould reduce the cost of production without anyextra feed.

Effect of replacement of maize with wild sotti(Curcuma zeodaria) rhizome on growth and feedefficiency in crossbred pigs

An experiment was conducted to study the effectof replacement of maize with wild sotti rhizome(chopped, dried and ground: chemical composition(DM basis): CP 10.18, EE 1.65, CF 5.88, NFE75.56 and total ash 6.73%) as energy source ongrowth and feed efficiency in crossbred pigs. Forthis, 12 crossbred pigs (Hampshire x Khasi Local)of similar body weight (about 30 kg) were randomlyinto 3 groups of 4 animals each in a randomizedblock design. The animals in group 1 (Control)were given normal diet (T1) while in other 2 groups,maize was replaced by wild sotti to the extent of25 and 50%, respectively (T2 and T3). The growthtrial was conducted for 75 days. The values foraverage daily gain (ADG) in body weight (383,366 and 356 g/d), feed intake (1.71, 1.68, and 1.66kg/d) and feed conversion ratio (4.47, 4.59 and 4.65kg feed/kg gain) were not significantly differentamong the groups. Thus, maize could be replacedby wild sotti rhizomes to the extent of 50% ingrowing pigs.

ANIMAL SCIENCES

DAIRY

Management of cattleA small herd of cattle was maintained at the

livestock farm. The animals were stall-fed. FromNovember to April, paddy straw was the mainroughage source and the animals were givensupplementary concentrate mixture and smallamounts of green fodders like maize, cowpea/ricebean, Chinese cabbage, oat, napier hybrid, paragrass etc. From May to September, the animalswere fed mainly on green fodders like perennialgrasses (Napier hybrid, congo signal, para grass,

thin napier etc.), annuals (maize, sorghum, cowpea,ricebeanetc.) and mixed grasses. The concentratemixture was also given in order to meet the animal’srequirements. Small quantities of fodder tree leavesmainly Leucaena, Gliricidia, Ficus hispida andArtocarpus heterophyllus were also fed.

Proper breeding, health, feeding andmanagemental aspects were taken care of. Theanimals were timely vaccinated against FMD, HSand BQ. Deworming schedule was followedproperly. Butox (deltamethrin) was used forcontrolling ectoparasites twice a year i.e., in March-April and July –September. The cow dung was usedfor making compost which was used for foddercultivation and also supplied to other Divisions.

PIGS

Management of crossbred pigsA total of 9 farrowings were obtained in

crossbred (Hampshire x Local) pigs maintained atthis Centre. The average gestation period was 113.6days. The average litter size was 6.76 and 5.42 atbirth and weaning, respectively. The body wt. atbirth and weaning was recorded to be 1.26 and 1.24kg and 9.77 and 9.44 kg for male and female piglets,respectively. Each piglet was injected with 1 mlImferon at 3, 7 and 14 days of age in order toprevent piglet anaemia. The adult pigs and pigletsafter 3 months of age were vaccinated againstSwine Fever. Most of the piglets after weaning weresold to the farmers for breeding purpose. Thepiglets were also supplied to SHG’s and Farmer’sclubs at nominal price. The excreta was used formaking compost.

GOATS

Development of a simple, sensitive enzymeimmunoassay for the determination of goatLuteinizing Hormone

A simple and highly sensitive enzymeimmunoassay (EIA) for the determination ofluteinizing hormone (LH) in goat plasma on 96-well microtiterplate using the second antibodycoating technique and biotin-streptavidin


peroxidase amplification system was developed.As the caprine LH and LH antisera are notavailable, biotin was coupled to ovine LH (NIDK-oLH, Bio, Lot # AFP 5551B, National HormonePeptide Program, Harbor-UCLA Medical Centre,Carson, CA, USA) and used to bridge betweenstreptavidin peroxidase and immobilized ovine LHbeta antisera (NIDDK-anti-oLHbeta-IC-1 A.S. Lot# AFPP 697071P, National Hormone PeptideProgram, Harbor-UCLA Medical Centre, Carson,CA, USA) in competitive assay. A two-dimensional titer determination test for theoptimum dilution of biotinylated oLH and theantiserum was carried out. The antibody titer of 1:100,00,000 and the biotinylated –oLH conjugatetiter of 1:4000 were found to be the most suitable.Ovine LH standards in various amount of plasma(20, 40 and 80 ml) were run in assay. The absolutebinding sensitivity of different concentrations ofoLH in 80 ml was similar to that observed in bufferstandards. Hence, all assays were conducted taking80 ml of unknown plasma samples and LHstandards ranging from 25 to 12800 pg/well/80 mlprepared in hormone free plasma. The sensitivityof EIA procedure was 25 pg/well LH, whichcorresponds to 0.31 ng/ ml plasma. A parallelismtest was carried out to compare the endogenousgoat plasma LH with ovine LH standards. A relativepercent binding curves for serially diluted goatplasma sample containing high level of endogenousLH and oLH standard were lying almost parallelto each other thereby confirming the actual LH

estimation in goat plasma. To validate the assaybiologically, two female cyclic goats werechallenged with 5mg intra muscular (i.m.) injectionof gonadotrophin releasing hormone (GnRH)(Receptal ® vet, Intervet Int. GmbH, Germany) andsubjected to serial blood samplings using indwell20G intra venous (i.v.) catheter Radiopaque(Jelco®, Medex Medical Ltd., Great Britain) inJugular vein with minimum pain at 15min intervalstarting 1h prior to GnRH injection till 8h post-injection and thereafter 1h interval for another 10h.The gradual increases in LH concentrations wererecorded post-GnRH administration, whichconfirms the biological validation of the EIAtechnique for determination of plasma LH incaprine species.

Generation of first-hand information onphenotypic characterization for variation inkidding size in Black Bengal goat

To characterize phenotypically for variation inkidding size in Black Bengal goats under NationalFund for Basic and Strategic Research inAgriculture Project funded by NAIP-PIU, ICAR,New Delhi, two districts, viz. West Tripura andSouth Tripura and then two blocks under eachdistrict were identified based on secondary dataon concentration of Black Bengal goats. Two-stagestratified random sample survey consisting ofvillage within Gram Panchayats (GP) as strata-1and animal within village as strata-2 has beenundertaken. Care was taken to select GPs and

Fig. 1. Standard Curve for an enzymeimmunoassay to determine plasma LH in goat

Fig. 2. LH profile in goat after GnRH (Receptal ®vet, Intervet Int. Germany) i.m. inj. of 5μμμμμg


villages located in isolation to minimize geneticlinkage among animals. Questionnaire and surveyformat consisting of animal’s identification,qualitative traits and quantitative traits of differentbody measurements apparently determiningkidding size were developed after testing it onselected samples. Observations were recorded atmonthly interval during pregnancy period and oneset of observation after kidding. Though themonthly data collection on pregnant goats indifferent villages is going on, a complete time-series data on 87 animals has been analyzed usingone-way ANOVA considering observed kiddingsize as the only source of variation for detectingany significant dependency of kidding size onquantitative phenotypic parameters. Meancomparison through one-way analysis of variancehas detected significant difference among somelinear body measurements in different months ofpregnancy among different groups. Days open waslikely found to have a crucial role in determiningkidding size. The incidence of twin birth was foundto be highest (58.2%) followed by single birth(31.9%), while the chance of triplet birth wasrecorded to have only 9.9%. The present analysishas been done using preliminary statistical toolsfor identifying the trend of the result. Completestatistical analysis will be done using appropriatetools when full data set will be available.

Transrectal ultrasonography for theinvestigation of reproductive organs in goats

The study of reproductive organs for exploitingfull reproductive potential in small ruminants like

goats is now an essential part of farm managementsystem. Due to structural anatomy of genital organsin goats to examine uterus and ovaries per rectum,there is a need of alternative method for routineexamination of reproductive organs in smallruminants. The techniques like laparotomy andlaparoscopy are available for examination ofreproductive organs. However, both laparotomyand laparoscopy are invasive surgical proceduresthat involve general anaesthesia or deep sedation.Thus, there are welfare implications and the normalappearance of the ovaries may be affected in long-term studies. Recently, Utra sonographic imagingtechnique has emerged as one of the most potentdiagnostic tool in domestic livestock species. Oneof the great advantages of ultasonography (USG)is that it is totally non-invasive and so it can beconfidently used for repeated examination of ananimal’s reproductive tract without impairing itsbreeding potential. Transrectal USG examinationin a standing position, using 5 MHz transducer withB-mode in goats has been standardized at ICARgoat farm, Lembucherra, Tripura. The principal ofUSG is that a sound wave travels in a pulse andwhen it is reflected back it becomes an echo andmakes a white image on the screen. The animalwas first restrained in a standing position withhuman assistance. The fecal pellets were removedfrom rectum digitally. The surface of transducerwas lubricated with Ultrasound jel (carboxymethylgel) and xylocane jel as local anesthetic material(optional) before its insertion into the rectum inorder to act as a coupling medium between thetransducer and rectal wall and reduce the irritation

Measurement of various physical parameters Recording of body weight of goat


or pain, respectively. The transducer was insertedin the rectum and manipulated by the externalcontrol of fingers and plams. The transducer wasgently introduced and then further advanced intothe rectum till non-echoic (dark) urinary bladderappeared on the screen. Due to completetransmission of sound wave through the fluid ofurinary bladder, i.e., the absence of any echo(anechoic), the image was appeared as black. Theurinary bladder was the landmark to locate theovaries. The vagina, cervix and then uterus werevisualized anterior to urinary bladder in thelongitudinal planes. The transducer was rotated 150

to 300 clockwise and counter clockwise to locatethe ovaries. The image of uterus, ovary wereappeared as slight white (hypoechoic), because ofsoft tissues. The evaluating the number of corporalutea (CL) in ovaries is under investigation andstandardization stage for studying the ovulation ratein goats.

Transrectal ultrasonography in she goat

Ultrasonography photo showing the urinarybladder (black), uterus, uterine horn and ovary

(white, pea-like structure)

Treatment camp-cum-distribution of goat feedat villages for augmenting production potential

Animal treatment camps at every month indifferent adopted villages under National Fund forBasic and Strategic Research in Agriculture Projectfunded by NAIP-PIU, ICAR, New Delhi wereorganized by Animal Reproduction Discipline ofthe Centre. A total of 859 animals covering goat,cattle and pigs were investigated and treated. Thegoat keepers were provided with goat feed andmineral mixture throughout the study period of sixmonths (pregnancy period) to avoid anycomplication during pregnancy and also for betterperformance of goats under field conditions.

Treatment camp Goat feed distribution

Assisted bottle feeding of milk reduces mortalityof kids in triplet/ quadruplet litter size

The objective of work is to reduce the mortalityof kids in litter size having more than two kidsduring the first month after kidding due to scarcityof milk. The feeding bottles along with milk wereprovided to 9 farm women in different villages afterthe report of triplet or quadruplet births. The kidswere fed milk artificially with bottle for one monthand found survivility of all kids at all farmer’shouse. The simple technology can save morenumber of kids at villages and thus confirm theproduction of more number of marketable goatsand uplift the household economy of the poor goatkeepers in the villages.

Farm women assisted bottle feeding in kids ofBlack Bengal goats


POULTRY

Evaluation of rural poultry germplasmDuring the period, a total of 2070 chicks of

Gramapriya strain were hatched. Out of 2070chicks, 980 Gramapriya chicks were distributed atday old stage to self help group of farmers ofJampuijala, Mohanpur and Melaghar villages onthe request of Department of Animal ResourceDevelopment, Govt. of Tripura and 1032Gramapriya chicks were distributed at 6-7 weeksof age to the farmers of Bishramganj, Urvabari,Baghma, Barabhaiya, Karaiyamura, Baghbasa andMirza villages at subsidized rate. The 255 day oldchicks of CARI Nirbhic were distributed to farmersof Bagan bazar, Teliamura Sub Division and 991CARI Nirbhic chicks were also distributed at 6weeks of age to the farmers of Sambhurampara,Ramsadhupara, Urvabari, Birchandermanu,Barabhaiya, Karaiyamura, Amtali, Jirinia, Westkhupilong and Baghma villages. The 144 chicksof CARI Shyama of 6 weeks of age were distributedto the farmers of Kobrapara village. The chickswere distributed for livelihood improvement ofpoor villagers.

Evaluation of performance of CARI NirbhicA total of 1151 eggs of CARI Nirbhic were set

for hatching in two hatches. The average percentfertility was estimated 80.36. The average percenthatchability on total egg set and fertile egg set wereobserved: 54.91 % and 68.32 %, respectively.

The mean body weights of CARI Nirbhic weremeasured at 2, 4, 6 and 8 weeks of age the farm.After 8 weeks of age the 50 % birds weredistributed to farmers. A total of 240 birds of CARINirbhic (12 birds to each of 20 farmers) weredistributed to farmers of Sambhurampara,Ramsadhupara and Urvabari villages. Then themean body weights were taken at biweekly intervalupto 20 weeks of age and at 40 weeks of age, inboth the sexes at farm and field levelsimultaneously. The mean body weights were notfound significantly different at farm and field level.The mean body weights were significantly higherin males than in females in all the age groups ofCARI Nirbhic. The mean body weights at all theages of CARI Nirbhic were lower than reported incase of Vanaraja, Giriraja and Gramapriya.

The cumulative feed consumption upto 6 wks.of age was 0.981 kg. / bird. The feed consumptionper day between 19-20 and 39-40 weeks of agewere: 99.0 and 160.22 ± 0.68 g./ bird at the farm.The feed consumption on all the ages was lower incomparison to other stocks evaluated at this centre.The lower feed consumption in CARI Nirbhic thanother stocks may be due to lower body weight ofthe bird. The age at sexual maturity was measured187.16 ± 0.35 and 198.04 ± 1.70 days, respectivelyat farm and field level. The age at sexual maturityof CARI Nirbhic is higher than all other stockevaluated at this centre except CARI Shyama. Theegg production upto 40 weeks of age was 37.32and 26.31 eggs, respectively at farm and field level.The egg production of CARI Nirbhic is lower thanGramapriya.

The percent mortality during brooding, growingand laying was observed: 12.34, 2.71 and 1.72 %,respectively. The percent mortality was lower thanreported by the RAU Bikaner and AAU, Anandcentre under NATP on small farm rural poultryproduction.

Farmers were not much satisfied about theperformance of CARI Nirbhic due to its lower bodyweight and egg production than Gramapriya.

Evaluation of performance of CARI ShyamaA total of 702 eggs of CARI Shyama were set

for hatching in two hatches. The average percentfertility was observed 79.49 %. The percenthatchability on total egg set and fertile egg set were49.86 % and 62.72 %, respectively.

The same procedure was followed forevaluation of CARI Shyama, as in case of CARINirbhic. The higher mean body weights wereobserved at farm level in comparison to field level.The mean body weights of CARI Shyama atdifferent ages were similar to CARI Nirbhic exceptat 20 and 40 weeks of age, where CARI Nirbhicshown significantly higher body weights. TheCARI Shyama shown lowest body weights thanall the stocks evaluated at this centre.

The cumulative feed consumption upto 6 weeksof age was estimated 0.969 kg. The feedconsumption per day between 19-20 and 39-40weeks of age were 97.0 and 158.50 ± 0.80 g./ birdand almost similar to CARI Nirbhic. The age atsexual maturity were: 193.00 ± 0.49 and 201.26 ±


1.87 days, respectively at farm and field level. Theage at sexual maturity is highest in CARI Shyamaas compared to all the stocks tested this centre. Theegg production upto 40 weeks of age was 29.76and 25.26 eggs, respectively at farm and field level.The egg production of CARI Shyama is lowest thanall other stock tested at this centre except KrishnaJ.

The percent mortality during brooding, growingand laying was observed 12.86, 2.95 and 1.34 %.The percent mortality was lower than reported bythe RAU Bikaner and GAU, Anand centre underNATP on small farm rural poultry production.

More over, this is also clarified that the farmerstotally dislike CARI Shyama bird due to its darkskin and meat colour as well as its lower bodyweights. Therefore most of farmers sold their birdsbefore laying.

Evaluation of performance of CARI colouredbroiler Sire and Dam lines

During the period, a total of 1646 and 1676 eggswere set for hatching for sire and dam lines,respectively. The average percent fertility wasestimated 70.60 and 66.17 %, respectively in sireand dam lines. The percent hatchability on totalegg set and fertile egg set were observed 61.36,59.37 % and 86.92, 89.72 %, respectively in sireand dam lines.

The mean body weights of CARI colouredbroiler sire and dam lines were measured at 2, 4, 5,6, 8 and 40 weeks of age in both the sexes at farm.The mean body weights at 5 weeks of age were:1.089 ± 0.007, 0.927 ± 0.01 and 1.002 ± 0.009 kg.,respectively in case of male, female and pooledmean in sire line and the corresponding bodyweights at 5 weeks of age in case of dam line were:989.20 ± 10.21, 847.31 ± 10.97 and 914.33 ± 9.06g., respectively. The mean body weights werehigher in males in comparison to females. The ageat sexual maturity was estimated 164.46 ± 1.30 and176.92 ± 1.09 days, respectively in sire and damlines. The egg production upto 40 weeks of agewas 22.46 and 26.26 eggs, respectively in sire anddam lines.

The percent mortality upto 6 weeks, from 7-20and 21-40 weeks of age were: 3.69, 0.50 and 2.16%, respectively in sire line and 8.07, 1.03 and 2.0%, respectively dam line. The percent mortality was

significantly lower in case of sire line than all theother stocks evaluated at this centre.

The purpose for establishing these parent broilerlines will be of crossing these lines with localindigenous Germplasm, to evolve new strain (s) ofpoultry, which would be suitable for rural poultryproduction.

Evaluation of Tripura local germplasmAbout 166 Birds of dark black colour have been

maintained at the farm. The eggs of this stock havebeen set for hatching for evaluation of this stock atthe farm. Thirty-six brown colour birds and 24spotted colour birds also maintained at the farm.Process for establishing brown and spotted flockshave been continued. The local Germplasm wouldbe used for crossing with improved broiler lines toevolve new strain of poultry, suitable for N.E.region.

Genetic improvement of growth and productiontraits of Japanese quail in agro-climaticconditions of Tripura.

The mean performance of body weights ofcoloured quail line at 3, 4 and 5 weeks of age were:107.92 ±1.32, 151.85±2.35 and 196.35±2.30 gms.,respectively and the corresponding body weightsin white quail line were: 93.23±1.35, 126.74±0.90and 163.87±0.93 gms., respectively. The weightgain in coloured quail line from 3-4, 4-5 and 3-5weeks of age were : 43.93±2.68, 44.50±3.18 and88.43±2.72 gms. respectively and thecorresponding weight gain in white quail line were:33.52±1.36, 37.13±1.15 and 70.65±1.67 gms.,respectively.

FISHERIES

Effect of addition of a self recruiting native fishon the fish Notopterus notopterus on in compositefish culture

Notopterus notopterus is a native minor fishwhich is capable for breeding in a confinedenvironment. This is an air breathing carnivorousfish mainly feeds on aquatic insects and smaller


Table 1. Total production parameters*comparing control and experimentalponds

Parameter Pond Mean + SE T value

Biomass Control 1.387 0.118 0.000$

Experiment 1.387 0.118Survival(%) Control 71.585 1.147 - 0.444$

Experiment 72.325 1.206Mean size at harvest Control 495.583 65.181 0.718$

(gm) Experiment 563.250 67.357Biomass harvested(Kg) Control 54.575 10.422 0.430$

Experiment 61.220 11.403Contribution by Control 20.000 3.715 0.000$

weight(%) Experiment 20.000 3.727

$ - Not significant (P>0.05)* Species and year wise pooled data from four experiments performedduring 2004-2008

Since this fishes are carnivorous in nature, thesurvival rates of carps were very important. Thesurvival rate did not differ statistically (P>0.05)between control and experimental groups.However, it was seen that there was significantdifference in the survival rate among species withsame pattern in control and experimental pondseven though the mean values of survival rates inexperimental pond showed slightly low values.

Mean size of each species differs significantly(P<0.01) both in terms of length and weight. Butmean size at harvest and their weight did not showany difference (P>0.05) between control andexperiment over different years of culture. Thisshows that N. notopterus did not inhibits norpromotes the growth performance of carp speciesin culture system and forms a neutral species incomposite fish culture.

Total biomass harvested was high inexperimental pond than control pond. Again,biomass harvested showed significant differenceamong different species with maximum harvestfrom catla and grass carp but did not differ (P>0.05)between different years of culture.

The culture of N. notopterus alongwith carpsin in the composite fish culture system will givefarmers a source of highly nutritious fish for theirown consumption without affecting the fishproduction and net profit out of his aquaculture. Inany season, notopterus fetched the highest pricewhen compared to the price of all carps in this

crustaceans. This fish has good consumer demandand reported to have some medicinal values. Thefish will grow maximum of 300-400g but alwaysfetch higher price than other commonly culturedfishes. This can be transported to long distance inlive condition and are comparatively hardy. It isalso observed that these fish breeds every year andwill take only one year to mature. Sexes can beeasily identified by its genital papilla. Females willbe much more swollen than males. They attach theireggs in hard substratum and guard their eggs. Ingeneral they have a better survival in pondecosystem.

Four fish ponds of similar size (0.08ha) wereused for the experiments. Fifteen fishes each werestocked and allowed to breed in the first monsoonitself in three experimental ponds and advancedfingerlings of Catla catla, Labeo rohita, Cirrhinuscirrosus, Ctenopharyngodon idella and Cyprinuscarpio were stocked in all ponds. Proper care wastaken for feeding, fertilization and management ofwater quality parameters. The carps were stockedand harvested annually and mola was harvestedthree times a year to avoid overcrowding and atfinal harvest about twenty mola were retained inthe pond for next year’s stocking. The major waterquality parameters, growth and production of carpswere recorded for four years period. There was nosignificant variation in the average values of waterquality parameters throughout the study. N.notopterus does not cause any significant impact(P>0.05) on the performance of any species testedin terms of growth, survival and production whichalso reflected in the over all production over theyears. The major production was from catla andgrass carp which did not change over the years bothin control and experimental ponds. Mola wereutilizing only the vacant niche in the food chain ofthe culture system. It did not compete with carpsfor food, thus leading to an additional gain of190kg/ha of valuable and nutritious fish.

Different species of fishes showed significantdifferences in biomass production in bothexperimental and control ponds (P<0.01) which didnot alter by the presence of N. notopterus. Eachfish species have its own food conversion ratio,growth and production rate which may be thereason for the significant difference in the biomassof each fish species.


region. It can be called as a ‘cash kanla’ like thereports of ‘cash carps/ cash mola’ from Bangladesh.

Parasitic diseases of fishes cultured in Tripurastate

The parasitic survey was done primarily on theIndian Major Carps, Catla catla (Catla), Labeorohita (Rohu), Cirrhinus cirrosus (Mrigal) and theChinese carps, Hypophthalamichthys molitrix(Silver carp), Ctenopharyngodon idella (GrassCarp)and Cyprinus carpio (Common Carp). Thespecimens analyzed were collected from the culturesystems of all four districts of Tripura.

Myxosporidinan and Trichidina infection wasvery common in fingerlings. Stocking density hasa significant role in the manifestion and spread ofthese parasites.Prevalence of Myxosporidian was21.7 and of Trichodina was 9.8. Monogeneaninfection was very common with a prevalence of50.8, and 11 species were recovered out of which2 are new to science. Digenean infection was verylow and was confined to smaller groups only(Prevalence 5.7). The parasites were identified asCentrocestus formosanus and Clinostomumcomplanatum. The parasiteas were evenlyrecovered from all the host species.Acanthocephalan parasitic infection was confinedto catla only. The parasite was identified asAcanthogyrus tripathi which was originallyreported from the same host from Mathura (India).Nematode and cestode infection was very rare. Fewplerocercoid larve were recovered from musclesof rohu and mrigal.

Copepod infections (Prevalence 42.5; MeanIntensity 3.7) were found in all the species. Twospecies of Ergasilus, Two species of Neoergasilus,one species each of Argulus, Lernae and Catlaphilawere obtained from the gills, scales and fins andskin of the fishes

Indian Major CarpsCatla catla (Catla): A total of 361 specimens

of Catla were surveyed out of which 310 werefound to be infected with various parasites. Argulus,Ergasilus, Neoergasilus Lernea, Catlaphila werethe common crustacean parasite in Catla.

Myxosporidian infection was mainly in fins andgills. Four species of Myxozozoans andmonogeneans also were identified infecting catla.

Labeo rohita (Rohu): About 442 specimensof Rohu were analyzed; 324 were found to beinfected with different parasites. Copepods werefound externally, mainly Argulus Ergasilus, andNeoergasilus. Five species of Myxozoan also werefound infecting rohu. Six species of monogeneanswere also found infecting Rohu.

Cirrhinus cirrosus (Mrigal): 436 numbers ofthis host sp. were examined and about 368specimens were observed infected with parasites.Among the copepods found externally, Argulus,Ergasilus and Neoergasilus were common. Fourspecies of monogeneans and four species ofMyxosporidians also were found infecting rohu.

Chinese CarpsCyprinus carpio (Common Carp):290

specimens were infected with different parasitesout of the 341 examined. Copepode parasites likeArgulus and Neoergasilus . were recorded fromthe fins. Four species of Myxozoans and one threespecies of monogeneans were recovered from C.carpio.

Hypophthalmichthys molitrix (Silver Carp):175 numbers of the host sp. was surveyed and 75numbers were found infected. Two species ofmonogenean and Myxosporidian, one species eachof Neoergasilus and Argulus were found infectingsilver carp.

Ctenopharyngodon idella (Grass Carp): 35fishes were found infected out of the 119 numbersexamined. One species of monogenean Dogieliuscatlaius, two species of Myxosporidians, onespecies of Argulus and Neoergasilus wererecovered from grass carp.

Utilization of cassava as fish feedCassava is popularly used as a binder in fish

feeds. Here experiments were conducted usingcommon carp fingerlings for two months to find

Monogenea Clinostomum(Dactylogyrus labei) releasing from cyst


out at what level it can be incorporated in fish feed.Experiments were conducted incorporating cassavaflour from 10% to 30% in the normal fish feed dietcontaining ground nut oil cake, rice bran, fish mealand soya meal. It was found the tapioca can beideally incorporated upto 20% level in a normalfish feed. However in highe concentration thepellets were more stable in water but it was veryhard and extended feeding time also was required.

In a second experiment feeding grass carp withtapioca leaves the three months results proved aslight retardation of growth if we feed the fisheswith Tapioca leaves alone. Average HCN level in

leaves was 310mg/kg. But in tissue level it couldnot be traced by titration method. The HCN wasdetermined by titrating with AgN03 after boilingthe sample in chloroform and reaction with 0.1NKOH. May be the spectrophotometry techniquewill give a clear confirmed report.Cassava peal dried and grounded was also tried infish feed at 5%, 10% , 15% and 20% level alongwith normal fish feed ingredients in tilapiaOreochromis mossambicus for a period 3 monthsin polythene troughs. It was found ideal upto5%level in fish feed. Both the growth and survivalwas affected in the higher incorporation of thetapioca peal.

Trichodina infection ongill

Trichodina in Dark field Trichodina live Trichodina silvernormal view nitrate staining


Research articles1. Datta ,M and Singh, N.P. 2007. Growth

characteristics of multipurpose tree species,crop productivity and soil properties inagroforestry systems under subtropicalhumid climate in India. Journal of ForestryResearch ( Springer Verlag publication), 18(4), 261-270.

2. Biswas, S., Chattopadhyay, K. and Singh,N.P. 2007. Evaluation against sheath blightdisease of maize under natural conditions.Indian Phytopath. 60 (3): 302-305.

3. Biswas, S. and Singh, N.P. 2007. Effect ofhost genotypes and cultural practices for themanagement of bacterial wilt in brinjal(Solanum melongena L). Indian Phytopath.60 (4): 438-441.

4. Biswas, S. and Singh, N.P. 2008. Influenceof host genotypes on the incidence of majordiseases of tomato during winter season inTripura. Indian J. Hort. 65(3): (in press).

5.Biswas, S. and Singh, N.P. 2008. IntegratedManagement of Wilt of Tomato Caused byRalstonia solanacearum. J. Mycol. Pl.Pathol., 38 (1) (in press)

6. Biswas, S. and Singh, N.P. 2008. Influenceof Climatic Conditions and CulturalPractices on the Development of FruitBodies of Pleurotus flabellatus in Tripura.Environment and Ecology. (in press)

7. Haldar, A. and Prakash, B. S., 2007. Effectof exogenous growth hormone-releasingfactor on growth hormone response, growthand feed conversion efficiency in buffaloheifers (Bubalus bubalis). The VeterinaryJournal. 174: 384-389.

8. Haldar, A. and Prakash, B. S., 2007. Effectof exogenous growth hormone-releasingfactor on blood metabolites and minerals inlate maturing buffalo heifers (Bubalusbubalis). Journal of Animal Physiology &Animal Nutrition. 91: 326- 332.

9. Datt Chander, Chhabra Aruna, Bujarbaruah,K.M., Dhiman, K.R. and Singh, N.P. 2007.

PUBLICATIONS

Nutritional evaluation of leaves of trees andshrubs as fodder for ruminants in Tripura.Indian J. Dairy Science, 60:184-190.

10.Datt Chander, Chhabra Aruna, Bujarbaruah,K.M., Singh, N. P. and Dhiman, K.R. 2007.Nutritional evaluation of weeds commonlyused as fodder for ruminants in Tripura.Indian J. Anim. Nutr. 24: 1-6.

11.Datt Chander, Chhabra Aruna, Singh, N.P.and Bujarbaruah, K.M. 2008. Nutritionalcharacteristics of horticultural crop residuesas ruminant feeds in Tripura. Indian J. Anim.Sci., 78: 312-316.

12.Datt Chander, Sankaran, M., Singh, N.P. andSanthosh, B. 2007. In vitro evaluation ofcultivars of tapioca and sweet potato tubersfor livestock. Indian J. Anim. Nutr. 24: 104-108.

13.Sankaran M., Singh, N.P., Nedunchezhiyan,M., Santhosh, B. and Datt Chander. 2008.Amorphophallus muelleri Blume (Araceae):An edible species of elephant foot yam intribal areas of Tripura. Aroideana, 31: 125-128.

14.Prakash, Jai, Singh, N.P, and Sankaran, M.2007. Response of mulching on in situ soilmoisture, growth, yield and economic returnof litchi under rainfed condition in Tripura.Indian Journal of Agriculture Sciences. 77,11: 56-58.

15.Prakash, Jai and Singh, S.P. 2007. Studieson mode of pollination, fruit set and fruitdrop in Jamun (Syzygium cumini Skeels).Environment and Ecology. 25S(4): 1151-1153

16.Prakash, Jai, Singh, N.P, and Sankaran,M.2008. Influence of slopes on fruiting, fruitquality and yield of Litchi chinensis Sonn.under rain fed condition of Tripura.Environment and Ecology. 26S(1): 215-217.

17.Ali, Md. Nasim, Chattopadhyay, K., Sarkar,H. K., Mandal, N. and Bhattacharyya, S.2007. Diversity among selected blackgramaccessions on the basis of RAPD and ISSR


markers. Indian Journal of Genetics andPlant Breeding 67(2): 171-172.

18.Chattopadhyay, K., Bhattacharya, S.,Mandal, N. and Sarkar, H. K. 2008. PCR-Based Characterization of Mung Bean(Vigna radiate) Genotypes From IndianSubcontinent In Intra- And Inter-SpecificLevel. Journal of Plant Biochemistry andBiotechnology 17(2): In press.

19.Biswas, Subrata, Chattopadhyay, K. andSingh, N. P. 2007. Evaluation against sheathblight disease of maize under naturalconditions. Indian Phytopathology 60(3):302-305.

20.Sankaran, M., Singh, N. P., Chattopadyay,K., Jai Prakash, and Das, S. P. (2008).Genetic divergencess .Indian Journal ofGenetics and Plant Breeding 68(1) : 1-3

21.Prakash Jai , Bhattacharyya, S.Chattopadhyay, K. Roy, S., Das, S. P. andSingh, N. P. 2008. PQM-1: A NewlyDeveloped Superior Clone of Pineapple forNortheastern India as evident throughphenotype, fruit quality and DNApolymorphism. Scientia Horticulturae(Under process)

Abstracts1. Singh, N.P., Datta, M., Sankaran, M.,

Santhosh, B. Chander Datt, Jai Prakash, K.Chattopadhyaya and Dhiman, K.R. 2008. Acomparative study of different FSR Modelsin Tripura: An overview. In Compendium:“National Seminar on Integrated FarmingSystems Relevant to NE region” held atCollege of Veterinary Sciences and A.H.,Central Agricultural University, Aizol-796014, Mizoram from Feb.7 to 8, 2008.p39.

2. Singh, N.P., Das Choudhuri, D. and Biswas,S. (2008). Crop calendar with the use ofmeteorological data in Tripura. InternationalSymposium on Agrometeorology and FoodSecurity, Central Research Institute forDryland Agriculture, Hyderabad, 18-21February, 2008. Abstract S7-O10, p162-163.

3. Biswas, S., Singh, N.P., Datta, M. and Singh,A.L. 2008. Major diseases of groundnutduring kharif crop season in Tripura.National Symposium on Plant DiseaseScenario in Organic Agriculture forecofriendly sustainability and 60th IPSMeeting, Regional Wheat Rust ResearchStation, Mahabaleshwar, 10-12 Jan., 2008.

4. Biswas, S. and Singh, N.P. 2008 Influenceof climatic conditions on the cultivation ofedible mushrooms. International Symposiumon Agrometeorology and Food Security,Central Research Institute for DrylandAgriculture, Hyderabad, 18-21 February,2008. Abstract S7-P38, p193.

5. Datt Chander, Chhabra A., Singh N.P. andBujarbaruah K.M. 2007. Chemicalcomposition, in vitro digestibility andmetabolisable energy values of agriculturalcrop residues found in Tripura. In Proc.:International Tropical Animal NutritionConference” held at NDRI, Karnal-132001,Haryana, India from Oct. 4 to 7, 2007.

6. Datt Chander, Sankaran M. and Singh N.P. and Santhosh B. 2007. Yield andnutritional characteristics of tubers ofdifferent cultivars of tapioca and sweetpotato. In Proc.: “International TropicalAnimal Nutrition Conference” held at NDRI,Karnal-132001, Haryana, India from Oct. 4to 7, 2007.

7. Datt Chander, Datta M., Bujarbaruah K.M.and Singh N. P. 2007. Macro and tracemineral status of agricultural crop residuesand concentrate feeds found in Tripura. InProc.: “International Tropical AnimalNutrition Conference” held at NDRI,Karnal-132001, Haryana, India from Oct. 4to 7, 2007.

8. Sankaran, M., Singh N.P., Santhosh, B., DattChander, Prakash Jai , Nedunchezhiyan, M.and Naskar, S.K. 2008. Tuber crops and theirpotential in integrated farming systems ofNE states. In Compendium: “NationalSeminar on Integrated Farming SystemsRelevant to NE region” held at College ofVeterinary Sciences and A.H., CentralAgricultural University, Aizol-796014,Mizoram from Feb.7 to 8, 2008. p64.


9. Prakash, Jai, Singh, N.P, and Sankaran, M.2007. Year round production technology ofpineapple in Tripura. Abstracts 60. 2ndIndian Horticulture Congress 18 –21 April.

10.Prakash, Jai, Das S.P. and Singh N. P. , 2007.Isolation of superior mutant pineapple.Abstracts 60. 2nd Indian HorticultureCongress 18 –21 April.

11.Chattopadhyay, K., Bhattacharyya, S.,Karmakar, S., Biswas, T., Das S. P. andSingh, N. P. 2007. Some grain qualityparameters and submergence tolerancelinked microsatellites in marker-assistedselection of rice. In: National Symposiumon Research Priorities and Strategies in RiceProduction System for Second GreenRevolution. CRRI, Cuttack, India, 20-22November, 2007.

12.Chattopadhyay, K., Sarkar, H. K., Mondal,N. and Bhattacharyya, S. 2007.Methods ofDiversity Analysis of Mungbean [VignaRadiata (L.) Wilczek] using Estimates Basedon Morpho-Metric and Molecular Data. InNational Legume Seminar at IIPR, Kanpur,2007.

Popular articles1. Singh N.P., Sankaran M., Santhosh B.and

Prakash, Jai, 2008. Mucana: a womdermedicinal plant Indian Horticulture 53(1),27-28.

2. Datt Chander, Singh, N.P. and Bujarbaruah,K.M. 2007. Pashu avum kukkut ahaar yaunke avyavon ki gunvatta ki janch ke liyeasaan tarike (Hindi). Kheti (accepted).

3. Datt Chander , Singh, N.P. and Bujarbaruah,K.M. 2007. Shukar paalan- vaigyanik tarikeapnayen (Hindi). Kheti. 60th Year (9): 24-28.

Book chapters1. Datta,M. 2007. Management of soil health

for sustainable organic food production innorth east India. p.205-217. In: Advances inOrganic farming Technology in India (eds)G.C. Munda, P.K.Ghosh, Anup Das, S.V.Ngachan and K.M. Bujarbaruah. ICARResearch Complex for NEH Region,Meghalaya.

2. Datta, M. and Singh, N.P. 2008. Performanceof some multipurpose tree species in Tripura.p.539-551.In:Exotics in Indian Forestry(eds) Sanjeev K. Chauhan , S.S.Gill, RajniChauhan and S.C. Sharma. AgrotechPublishing Academy, Udaipur

3. Biswas, S. and Singh, N.P. 2008. Influenceof environment in cultivating ediblemushroom.pp. 267-274 In: Climate changeand food security. (eds.) M. Datta, N.P. Singhand Er. D. Daschaudhuri, . New IndiaPublishing Agency, New Delhi, India.

4. M. Sankaran, Prakash Jai, Datta M. andSingh N.P. 2007. Climate and HorticulturalCrops, pp251-263 In : Climate and foodsecurity, M. Datta et al., (ed.) Published byNew India Publishing Agency, New Delhi

Book1. Datta, M.(ed) 2008. Climate Change and

Food Security, New India PublishingAgency, Pitam Pura, New Delhi.

Scientific/Technical Folders/Booklets/Leaflets1. Singh, N. P., Chakraborty, M. and

Chattopadhyay, K. 2008). Tripurar tilajamite unnata padhatite mesta chas(Improved cultivation techniques for Mestaunder tila land of Tripura). Publication no.38. ICAR Research Complex for NEHRegion, Tripura centre, Lembucherra,Tripura.

2. Ghosh, S.K., Chander Datt, Singh, N.P. andNgchan, S.V. 2008. Broiler RabbitProduction in Tripura. Publication No.-30.ICAR Research. Complex for NEH Region,Tripura Centre, Lembucherra-799210,Tripura (w), India.

Conference Proceedings1. Datta, M. and Singh, N.P. 2007. An appraisal

of agroforestry systems with reference to treebiomass, crop productivity and related soilproperties in north east India. 72nd AnnualConvention of Indian Society of SoilScience, Ranchi., pp.28.


2. Datta, M. and Singh, N.P. 2007. Riceproductivity : An approach to integratednutrient management systems, Rice andFood security workshop, Nagaland RiceFestival, pp.13-14.

3. Datta, M. and Singh, N.P. 2008. An appraisalof soil physico-chemical properties undervariable land use systems and climaticenvirons in North East India. InternationalSymposium on Agrometeorology and FoodSecurity, Hyderabad. S4-P7 : 78 -79.

Technology Bulletins/Manual1. Singh, N. P., Chattopadhyay, K. and Das, S.

P. 2008. Training Manual on JuteTechnology. Publication no. 40, ICARResearch Complex for NEH Region, Tripuracentre, pp. 1-77.

Technical bulletin :1. Sankaran M., Singh, N.P., Santhosh, B. and

Datt Chander, Prakash Jai and Ngachan S.V.2007. Production and Utilization of TuberCrops in Tripura. Technical Bulletin No. 37.52pp. ICAR Research Complex for NEHRegion, Tripura Centre, Lembucherra-799210, Tripura. India


BORO RICE DAY 2006-07Boro Rice Day 2006-07 was organized by ICAR

Research Complex for NEH Region, TripuraCentre at Bagma, South Tripura on 26th April, 2007as part of Front Line Demonstrations on boro rice.In total 337 FLDs were organized this year through6 Farmers Clubs in South Tripura. High yieldingrice varieties: Naveen, Pusa 44, Shanti, Birsamotietc were given for demonstrations along withimproved package of practices.

SEMINAR AND MEETING ON BLACKBENGAL GOATS

The first meeting of the National Fund Projectentitled ‘Endocrine Profiles and Characterizationof Candidate Genes Influencing Prolificacy inBlack Bengal Goat’ under the National Fund forBasic and Strategic Research in Agriculture, ICARand a seminar on ‘Revisit of Black Bengal Goat’on 27th and 28th April 2007, respectively wereorganized at ICAR, Tripura Centre. A total of 82delegates including Veterinary Officers fromAnimal Resource Development Department, Govt.of Tripura were participated in the seminar.

RICE DAY 2007The event was organized by ICAR Research

Complex for NEH Region, Tripura Centre on 5th

June 2007 at Bagma, South Tripura, to mark the

successful implementation of FLD on rice over last2 seasons in Tripura. Shri Manik Sarkar, Hon’bleChief Minister of Tripura graced the occasion asthe Chief Guest. Shri Gopal Ch. Das, Hon’bleMinister for Food & Civil Supplies, Tripura,graced the occasion as Guest of Honour. Smt.Maya Pal, Sabhadipati, Dakshin Tripura, waspresent as the special guest. Hon’ble Chief Ministeralong with other dignitaries visted the FLD riceplots and discussed with proud farmers.

DR. MANGALA RAI, SECRETARY, DARE &DIRECTOR GENERAL, ICAR

Dr. Mangala Rai, the Hon’ble Secretary, DARE& Director General, ICAR, visited ICAR ResearchComplex for NEH Region, Tripura Centre,Lembucherra on 23rd July 2007

AWARENESS PROGRAMME ONAQUACULTURE

Three days awareness level programme from13th to 15th November 2007 was organized by ICARResearch Complex for NEH Region, TripuraCentre, Lembucherra in collaboration withSchool of Agriculture, Indira Gandhi NationalOpen University, New Delhi for progressivefarmers and NGO leaders of different parts ofTripura. Fifty participants including eleven womenattended the programme.

IMPORTANT EVENTS


HEAD QUARTERSMEGHALAYA

AGRONOMYDr. G. C. Munda, Pr. ScientistDr. A. S. Panwar, Pr. ScientistDr. D. P. Patel, Sr. Scientist (Plant Physiology)Dr. Rajesh Kumar, Sr. ScientistDr. Anup Das, Sr. Scientist

WATER MANAGEMENTDr. P. K. Ghosh, Pr. ScientistDr. Ritesh Saha, Scientist

AGRICULTURAL EXTENSIONDr. Rajesh Kumar, Sr. Scientist

AGRICULTURAL ENGINEERINGDr. K. K. Satpathy, Pr. ScientistShri. M. B. Tamanhkar, Sr. ScientistDr. N. K. Lenka, Sr. ScientistDr. S. G. Ghadge, Sr. ScientsitDr. R. K. Singh, Sr. ScientistEr. Arvind Kumar, ScientistDr. T. D. Lama, ScientistDr. U. S. Saikia, Scientist

SOIL SCIENCEDr. Patiram, Pr. ScientistDr. Brajendra, Scientist

HORTICULTUREDr. B. C. Deka, Pr. ScientistDr. R. K. Yadav, Scientist(SS)Dr. Amit Nath, Scientist(SS)Dr. Satish Sanwal, ScientistDr. R.K. Patel, ScientistDr. Akath Singh, ScientistDr. Rajeev Kumar, Scientist

PLANT BREEDINGDr. A. Pattanyak, Pr. ScientistDr. Jibon Mitra, Sr. ScientistDr. S. Gupta, Sr. ScientistDr. (Mrs). Promila Devi, Sr. ScientistDr. (Mrs). Alpana Das, Sr. Scientist

PLANT PATHOLOGYDr. Satish Chandra, Pr. ScientistDr. Ram Dutta, Sr. ScientistDr. Pankaj Baiswar, Scientist

AGRICULTURAL ECONOMICS &STATISTICSDr. A.K. Tripathi, Sr. ScientistShri. Med Ram Verma, ScientistDr. S. Mandal, Scientist

AGROFORESTRYDr. Ramesh Singh, Sr. ScientistDr. A. K. Vishwakarma, Scientist

ENTOMOLOGYDr. N. S. Azad Thakur, Pr. ScientistDr. D. Kumar, Sr. ScientistDr. A. Kalaishekhar, ScientistDr. M. H. Kodandaram, ScientistShri. Kanchan Saikia, Scientist

ANIMAL PRODUCTIONDr. R. K. Bardoloi, Pr. ScientistDr. S. Naskar, Sr. ScientistDr. G. Kadirvel, Sr. ScientistDr. A. Kumaresan, ScientistDr. Rantu Basumatary, Scientist

ANIMAL NUTRITIONDr. J. J. Gupta, Pr. ScientistDr. Promod Singh, Sr. ScientistDr. P. Baswa Reddy, Scientist

LIST OF CONTRIBUTORS

Dr. S. V. Ngachan, Director


VETERINARY PUBLIC HEALTHDr. Ashok Kumar, Pr. ScientistDr. (Mrs).I. Shakuntala, Sr. Scientist

VETERINARY PARASITOLOGYDr. R. G. Laha, Sr. ScientistDr. Meena Das, Scientist

POULTRY SCIENCEDr. S. Doley, Sr. ScientistDr. Santosh Haunshi, Scientist

FISHERIESDr. K. Murmu, Scientist

CENTRES

ARUNACHAL PRADESHDr. R. Bhagawati, Joint DirectorDr. Magan Singh, Sr. Scientist (Agronomy)Dr. P. Suresh Kumar, Scientist (Horticulture)

MANIPURDr. N. Prakash, Joint Director,Dr. I. Meghachandra Singh, Sr. Scientist (SeedTechnology)Dr. M. Roychaudhuri, Sr. Scientist (Soil Science)Dr. B. N. Rao, Sr. Scientist (Horticulture)Dr. S. Roychaudhuri, Sr. Scientist (Soil Science)Dr. Pawan Kumar Sharma, Sr. Scientist (PlantPathology)Dr. Jogendra Singh, Sr. Scientist (Plant Breeding)Dr. V. P. Bhadana, Scientist (Plant Breeding)Dr. B. K. Bahera, Scientist (Fishery)Dr. B. B. Panda, Scientist (Agronomy)Dr. Subhra Saikat Roy, Scientist (Horticulture)

MIZORAMDr. K.A. Pathak, Joint DirectorShri T. Boopathi, Scientist (Entomology)Dr. B.K. Singh, Scientist (Veg. Sci.)Dr. Lalhruaipuii, Scientist (Vet. Microbiology)

NAGALANDDr. B.P. Bhatt, Joint DirectorDr. H.D. Karmakar, Scientist (Vet. Microbiology)Dr. S.S. Rathore, Scientist (Agronomy)Dr. Anjani Kumar Jha, Scientist (Veg Science)Dr. M. Karunakaran, Scientist (Animal Reprd.)Dr. B. Sahoo- Scientist

SIKKIMDr. H. Rahman, Joint DirectorDr. R.K. Avasthe, Sr. Scientist (Soil Science)Dr. Nazrul Haque, Sr. Scientist (Animal Nutrition)Dr. (Mrs) Saroj Toppo, Sr. Scientist (AnimalNutrition)Dr. Homeshwar Kalita, Sr. Scientist (Entomology)Dr. Suresh Kr. Dhup Singh, Sr. Scientist (LPM)Dr. Ramesh Chandra, Scientist (LPM)Sh. Matber Singh, Scientist (Agro-forestry)Dr. R. Karuppaiyan, Scientist (Plant Breeding)Dr. Kundan Kishore, Scientist (Horticulture)Dr. Laxman Chatlod, Scientist (Animal Health)Dr. K. Rameash, Scientist (Entomology)Dr. P.K. Panda, Scientist (Agronomy)Dr. Ashok Kumar, Scientist (Horticulture)Dr. Z.B. Dubal, Scientist (Animal Health)

TRIPURAProf. N. P. Singh, Joint DirectorDr. M. Datta, Principal Scientist (Soil Science)Dr. S. Biswas, Sr. Scientist (Plant Pathology)Dr. A. Haldar. Sr. Scientist (Animal Reproduction)Dr. S. Malik, Sr. Scientist (Poultry Science)Dr. S. P. Das, Scientist Senior Scale (PlantBreeding)Dr B. Santhosh, Scientist (Fishery)Dr. K. Chattopadhyaya, Scientist (Genetics)Dr. Jai Prakash, Scientist (Fruit Science)Dr. M. Sankaran, Scientist (Veg. Science)


bl o”kZ ds nkSjku ekSle lkekU; gh jgkA nks dsUnzksadks NksM+dj c”kkZ yxHkx lkekU; jghA ysEcqpsjk] f=iqjkdsUnz esa ;g lkekU; ls 53% vf/kd gqbZ vkSj mfe;e¼eq[;ky;½ esa lkekU; ls 8-1% de gqbZA

eq[;ky; esa pkoy lq/kkj dk;Zdze ds vUrxZr vkjlh ih ,y 1&115] oh ,y 30240 vkSj ,p ih vkj 2530fdLeksa dh ¼4-17&3-83 Vu izfr gsDVs;j½ mUur mijkÅWtsuksVkbiksa ds :Ik esa igpku dh xbZ vkSj vkj lh ih,y 1&126] vkj lh ih ,p 1&72 rFkk vkj lh ih ,p1&160 ¼nksuksa lqxfU/kr½ fdLesa dks fupyh Hkwfe ds mUur(5-2&5-7 Vu@gSÛ) thuksVkbi ds :Ik esa igpkuk x;kAtkjh dh xbZ nks ladj fdLeas ds vkj ,p&2¼ 6-43Vu@gSÛ ½ rFkk ih ,l Mh &3¼5-93 Vu@gSÛ½ ls HkhvPNk fu”iknu jgkA pkoy ds vkB lkS pkSrhl tuunzO;uewuksa dk fo’ks”khdj.k fd;k x;k rFkk 108 u;s ladyufd, ,, A v#.kkpy izns’k esa QVu (CykLV) jksx dsizfrjks/kh fdLeksa ds :Ik esa jk”Vªh; ikS/k’kkykvksa ls 194oa’kdzeksa vkSj 129 LFkkuh; tuunzO; uewuksa dh tkap dhxbZA ef.kiqj esa fofHkUu ifjiDork frfFk;ksa] yEckbZ vkSjQly dhs vU; fof’k”Vrkvksa dh n‘f”V ls vkxss lEc/kZuds fy, ,d lkS ,Q 7 oa’kdzeksa dk p;u fd;k x;kApkoy ds rhu ckyh@xqPNs okyk ,d cgqr lqUnjmRifjorhZ ¼eqVSUV½ dh igpku dh xbZ vkSj mls iztuugsrq iz;ksx esa yk;k x;kA ,e lh&34&7&21&15&58&49vkSj ,e lh &34&7&5&2&75&33&19 nks mUur oa’kdzeksaesa iÙkh vkSj xnZu VwVu jksx dh vR;f/kd izfrjksf/krkik;h xbZA ef.kiqj dsUnz ls ukfer vkj lh ,e&21 vkSjlh ,e&22 fdLeksa dks , oh Vh&1 esa izksUur fd;k x;kA,d lkS lkB tuunzO; uewuksa dk ladyu o ewY;kadufd;k x;kA vkj lh ,e&17] , vkj&4], vkj&12 dksmUur lqxfU/kr fdLekssa vkSj cf<+;k nkus okys thuksVkbiksads :Ik esa igpkuk x;kA ukxkySaM esa vkj lh ih,y&1&121] vkbZ bZ Vh 16313 vkSj vkj lh ,e&11

fdLeksa dks fupyh Hkwfe gsrq loksZÙke thuksVkbi ds :iesa rFkk vkj lh ih ,y 1&115 dks mijkÅWa Hkwfe gsrqloksZÙke thuksVkbi ds :i esa igpku dh xbZA flfDDeesa ‘kgljax&1 loksZÙke Qly nsus okyh fdLe ik;h xbZftlls tSfod fLFkfr ds vUrxZr 5-0 Vu@gSÛ mitizkIr gqbZA f=iqjk dh fLFkfr ds fy, Vh vkj lh&87&251rFkk Vh vkj lh 87&251&1 fdLeksa dh mUur fdLeksa ds:Ik esa igpku dh xbZA vkbZ bZ Vh 20496] vkbZ bZ Vh19837 vkSj vkbZ bZ Vh 20372 dks Hkh mUur ik;k x;kApkoy ds tuunzO; vkSj fdLeksa dk HkkSfrd] ikdh; oizlaLdj.kh; rFkk iks”kf.kd xq.koÙkk lECkU/kh fo’ys”k.kHkh fd, x;sA pkoy dh fdLeksa ds izdk’k fefrdlwPkhdj.k ls fofnr gqvk gS fd nsj ls RkS;kj gkus okyhfdLesa lh Mh Mh vkSj lh ,u ih ds izfr T;knklaosnu’khy gksrh gSaaA ,u&mi;ksx {kerk lEcU/kh v/;;u ls irk yxk fd pkoy dh [ksrh okyh igkM+h dsvuqlkj cgqr lh xkS.k ‘kk[kkvksa dks izca/ku dk;Zfof/k;ksals lq/kkjk tk ldrk gSA fofHkUu tSfod iks”kd rRoksa esa,Q okbZ ,e&20 Vu@gSÛ- +,stksyk nksgjh Qly iz.kkyhls ijh{k.k fdLe ‘kkgljax&1 esa 4-97 Vu@ gSÛ- dhlokZf/kd mit fjdkMZ dh xbZaA iwoZ&[kjhQ pkoy dsfy, ikS/k’kkyk O;oLFkk vkSj thuksVkbiksa dk ekudhdj.kfd;k x;kA iksfy Vuy $ [kqys esa ikS/k’kkyk LFkkfirdjus rFkk 45 ls 60 fnuksa esa jksikbZ djus dh fof/kloksZÙke ik;h xbZ rFkk buesa vkbZ vkj&64 lokZf/kdmit nsus okyh fdLe ik;h xbZA mUur pkoy vk/kkfjrQly vuqdzeksa ds :Ik esa vLFkkbZ vk/kkj ij cuh D;kfj;ksaesa pkoy $ VekVj rFkk LFkkbZ vk/kkj ij cuh D;kfj;ksaesa pkoy $ eVj $ QzSapchu dh Qly dh igpku dhxbZA pkoy&pkoy Qly vuqdze ds fy, vkbZvkj&64&‘kgljax&1 ds la;kstu dks loksZÙke la;kstuds :i esa le>k x;kA pkoy&eVj Qly iz.kkyh esaVsizgjksfl;k dh igpku tSfod iks”k.k ds loksZÙke lzksr

dk;Zdkjh lkjka’kdk;Zdkjh lkjka’kdk;Zdkjh lkjka’kdk;Zdkjh lkjka’kdk;Zdkjh lkjka’k


ds :Ik esa dh xbZA fupyh Hkwfe fLFkfr ds vUrxZr 5 fd-xzk ftad@gSÛ ds fglkc ls mi;ksx djus ij vkj lh&efuQkS&7 dh mit esa o`f) gqbZA blh izdkj Mh , ih$ ih ,l ,e ds mi;ksx ls bl fdLe dh mit esao`f) ik;h xbZA exj tc ftad dk iz;ksx fd;k x;k rksih ,l ,e dk izHkko de gqvkA

pkoy ds VwVu QQwan ds fu;a=.k esa VªkblkbDyktksydk 0-6xzk-@yh- ds fglkc ls iz;ksx lokZf/kd izHkkohik;k x;kA pkoy ds ruk Nsnd] iÙkh eksM+d vkSj ewy,sfQM dhVksa ds fy, jkbukSfDlij dk 0-4% th dkiz;ksx 3 xzkÛ ,- vkbZ-@gSÛ- ds fglkc ls vkSj jkbukSfDlik;j20 ,l lh dk iz;ksx 30feÛxzkÛ ,- vkbZ-@gSÛ ls djusij dkjxj ik;k x;kA mfe;e esa fupyh Hkwfe okyspkoy ds fy, vkj lh ,p bZ&lh&121 dk tSo dkcZfudlw=.k leqfpr ik;k x;kA

eDds ds nks thu iwy LFkkuh; tuunzO; ls cuk,x;s vkSj blh rjg vU; dbZ oa’kdzeksa dk irk yxk;kx;kA eq[; Qly ds ekSle esa eDds ds ruk NsnddhVksa ds 4&5 iwoZ oa’kdzeksa ds vk/kkj ij thooSKkfudv/;;u fd;k x;k vkSj mudh igpku dh xbZA eDdsaesa MksyksekbV ds la;kstu ls est isij fey dpjs¼20Vu@gSÛ-½ ds iz;ksx ls mRikndrk esa o`f) gqbZ gSaAflfDde esa 3 o”kksZa rd 20 lafeJksa dk ijh{k.k fd;kx;kA ,u , lh&6004 ls yxkrkj vPNh mit ¼4-62Vu@gSÛ-½ izkIr gqbZA ikap D;w ih ,e c’kadzeksa dk ewY;kadufd;k x;kA ,Q D;w ,p&57 dks lcls vf/kd mit nsusokyh ¼4-45 Vu@gSÛ) izfof”V ik;k x;kA fofHkUu tSfodiks”kd fefJr [kknksa esa] fefJr dEiksLV 2-5 Vu@gSÛ$uhe [kyh 0-5 Vu@gSÛ-$ofeZdEiksLV 2-5 Vu@gSÛ dsiz;ksx ls foosd ladq; eDdk&11 fdLe ls lokZf/kdmit feyhA f=iqjk ds fy, Vh vkj ,e &11¼4-46Vu@ gSÛ-½ ,d mUur eDdk thuksVkbi ik;k x;kA

fofHkUu nyguh Qlysa ftudk ijh{k.k mfe;e esafd;k x;k] buesa ls pkjs okyh jkblchu ¼vkj ch vkbZ&226xzkÛ@ikS/kk)] eVj ¼Vh vkj lh ih&8 vkSj ih&9½] elwj¼oh ,y 4&2-5 Vu@gSÛ ½ RkFkk jktek ¼dkeZy&2-6

Vu@gSÛ-½ dh mUur nkyksa ds :i esa igpku dh xbZAQyh Nsnd ohfoy dhV dh fofHkUu iztkfr;ksa dk v/;;u fd;k x;k] vkSj buls irk yxk fd buesa vUrfoZf’k”VLi)kZ gSA eVj ds ,sfQM dhV ds fu;a=.k ds fy, 0-5feÛfyÛ@yhVj dk iz;ksx dkjxj ik;k x;kA ef.kiqj dsfy, vjgj ds mUur thuksVkbiksa ds :i esa ;w ih ,,l&120 ¼3-1 Vu@gSÛ½ ih ,&134 (2-87 Vu@gSÛ ½rFkk vkbZ lh ih ,y &99034 ¼2-85 Vu@gSÛ ½A

lks;kchu ds mUur ca’kdzeksa esa ,e , ;w ,l &295]vkj lh ,l&1 rFkk ,u vkj lh&762-2Vu@gSÛ- dhigpku dh xbZA lks;kchu jrqvk jksx ds dkjxj izfrjks/kh ds :Ik esa lks;kchu ds 9 ca’kdzeksa dk irk yxk;kx;kA lks;kchu jrqvk jksx ds LQksVksa dks vo’kksf”krdjus esa vkbZ- jksft;e dks lcls vf/kd dkjxj ijthohik;k x;kA mfe;e ds fy, ewaxQyh ds vkbZ lh th oh00401 thuksVkbi dh igpku mUur ¼3-35 Vu@gSÛ ½thuksVkbi ds :Ik esa dh xbZA ukxkySaM dsUnz esa rksfj;ko ljlksa dh mUur fdLe ds :i esa lst&2 ¼2-1Vu@gSÛ dh igpku dh xbZ rFkk ih Vh 303¼1-1Vu@gSÛ½dks rksfj;k ds mUur thuksVkbi ds :i esa irk yxk;kx;kA f=iqjk dsUnz esa Vh vkj lh&Vh &1&5&1 dksukfer fd;k x;k vkSj bls rksfj;k&ljlksa ds vf[kyHkkjrh; lefUor vuqla/kku ifj;kstuk ds , oh Vh&1 esaizksUur fd;k x;kA f=iqjk dh fLFkfr;ksa ds vUrxZr vkbZoh Vh&rksfj;k Vh lh ,u& 07&11 ¼1-43 Vu@gSÛ ½ rFkk, oh Vh ihyh ljlksa okbZ ,l lh ,u&07&18 ¼1-61Vu@gSÛ½ dks mUur ik;k x;kA

ewaxQyh dh Qly esa dSfYl;e lYQsV ds lkFkQkSLQsV moZjdksa ds iz;ksx ls e`nk ,u-ih-dss- vkSj lYQjrRoksa ij egRoiw.kZ izHkko ns[kk x;kA ef.kiqj esa eawxQyhds chtksa dh cqokbZ ds le; 400xzk@10 fd-xzk- dsfglkc ls pwus dh xqfVdkvksa dk iz;ksx gyjs[kk esa pwus dsiz;ksx ls csgÙkj jgk tcfd lks;kchu esa gy pykrsle; jkbtksfc;e dk iz;ksx csgÙkj jgkA eawxQyh esa 2Vu@gSÛ ½ ds fglkc ls ofeZdEiksLV ds iz;ksx djuss lsns[kk x;k fd ;g tSfod moZjd dk loksZÙke lzksr gS]


exj Qly dVkbZ ls lEcfU/kr ifj.kke vtSfod ,u-ih-ds ds iz;ksx djus ls csgrj jgsA flfDde dh fLFkfr;ksads vUrxZr 5 Vu@gSÛ fefJr dEiksLV$1 Vu@gSÛ dsfglkc ls ofeZdEiksLV$ Vu@gSÛ ds fglkc ls uhe dh[kyh$1 Vu@gSÛ MkSyksekbV ds iz;ksx ls 0-94 Vu@gSÛmit izkIr gqbZA f=iqjk dh fLFkfr ds vUrxZr ljlksa dhQly esa vtSfod iks”kd ¼40%20%20 ,u-ih-ds½ ds iz;ksxdh vis{kk fVQzksfl;k dh ifÙk;ksa dh [kkn ¼10 Vu@gSÛ½ds iz;ksx ls mit esa 403% dh o`f)) ns[kh xbZA

xsagwW dk thuksVkbi oh ,y&804 mUur ¼2-28 Vu@gSÛ½ik;k x;kA XySfMvksyl dh ,d mi;qDr fdLe dhmUur fdLe ds :Ik esa igpku dh xbZ ftlds Likbddh vPNh yEckbZ gksrh gS] iq”id@Likbd Hkh cM+k gksrkgS vkSj iq”Ik rqqMk+bZ ds ckn Hkh ;g yEcs le; rd rktkcuk jgrk gSA

[kklh ukjaxh dks fofHkUu ewy o`Urksa ij dye cka/kdjfofHkUu HkkSfrd&jklk;fud xq.kksa dh n`f”V ls mldkewY;kadu fd;k x;kA [kklh ukjaxh ds lkFk vUr%Qlyds :Ik esa ewaxQyh dh Qly lcls vPNh ik;h xbZAv#.kkpy izns’k esa [kklh ukjaxh ds isM+ksa esa eqxhZ [kkndh rqyuk esa ,Q okbZ ,e vkSj lwvj ds ey dh [kknMkyus ls og T;knk jlhyk gksrk gS vkSj Vh ,l ,l Hkhvf/kd ik;k x;kA ikS/k jksi.k ds le; ikS/kksa dh nwjhj[kus lEcU/kh ijh{k.k esa ik;k x;k fd ikS/kksa dks 3X 3ds vUrj ls yxkus ij Qy dk Hkkj vf/kd jgk vkSj jlrRo Hkh vf/kd feykA lw{e izo/kZu ds vUrxZr v#.kkpyizns’k dsUnz esa [kklh ukjaxh ds nl o”kZ ls mxk, x,ikS/kksa esa ik;k x;k fd ikS/kksa dh yEckbZ cjkcj gksrh gSrFkk Qyksa dk vkdkj Hkh leku gksrk gS rFkk muesafdlh izdkj dk fodkj Hkh ugha vkrkA flfDde ds fy,fdoh Qy dh ,d mi;qDr gsokMZ fdLe ¼1-22 Vu@gSÛ½dh igpku dh xbZ ftlesa gLr ijkx.k djus ls vf/kdre Qy vk,A

f=iqjk esa vukUukl dh ‘ekSfjll’vkSj ‘ve`rk’ nksfdLeksa dk izorZu fd;k x;kA‘ekSfjll’ fdLe dsQyksa dk vkdkj vis{kkd`r dkQh cM+k Fkk vkSj ;g

tYnh rS;kj gksus okyh fdLe gSA fdUrq Qyksa dh xq.koÙkkesa ‘ve`rk’ csgÙkj ik;h xbZA gYdh l?kurk esa ik;kx;k fd blls iq”i.k o Qyu dh izfr’krrk izHkkforgksrh gSA LVªkcjh esa 30X 30 ls-eh- dh nwjh okys ikS/kksa esa

100% 60%120 ,u ih dk iz;ksx lokSZÙke ik;k x;kAvkM+w esa 30 vDrwcj dks 75% dVkbZ&NaVkbZ djus lsns[kk x;k fd bu isM+ksa ij Qyu 12 fnu igys gksusyxkA iihrs esa pw.kZd QQwan ds ,d izeq[k ijthohDySMksLiksfj;e DySMksLiksfjvksM~l dh igpku dh xbZAflfDde dsUnz esa LVªkcjh dh 16 fdLeksa esa ‘pUnyj’ dks[kqys vkSj iksfygkml nksuksa fLFkfr;ksa esa loksZÙke ik;kx;k exj iksfygkml ds vUrxZr mxk, x;s ikS/kksa esaQy xq.koÙkk csgÙkj ik;h xbZA flRkEcj esa yxk, x;sikS/kksa esa lspje iztkfr ls iyokj djus ls vf/kdremit feyhA de izpfyr Qyksa ds lq/kkj dk iz;klfd;k x;kA lksfgvksax esa thHk dye lokZf/kd lQyjghA eSfjdk dk Qy&otu 9-75 ls 15-25 xzke rdik;k x;kA

fofHkUu lfCt;ksa esa ewY;kadu lecU/kh ijh{k.kdjus ij ik;k x;k fd es?kk cSaxu&2 ¼41-0 Vu@gSÛ ½cSaxu dk ,d mUur thuksVkbi gSA xktj dh xq.koÙkklEc/kh fof’k”Vrkvksa ds ewY;kadu esa ,l Vh &14 dhloksZÙke thuksVkbi ds :Ik esa igpku dh xbZA mfe;eesa ,d izdk’k & vlaosnu’khy MkSfypkSl chu vkj lhMh ,y&10 ¼14&15 Vu@gSÛ ½ dh igpku dh xbZ tksvizSy& uoEcj dh cqvkbZ ds fy, mi;qDr gSA ef.kiqjdsUnz esa VekVj ds 25 cf<+;k fdLeksa dk ijh{k.k fd;kx;k rks blesa ik;k x;k fd ,e lh Vh vkj 7 ch dkQhmUur ¼41-7 Vu@gSÛ ½ gSaA fdUrq ef.kiqj esa p;u 9 ,vkSj p;u 7 loksZÙke thuksVkbi ik, x, rFkk buls 42-5 Vu@gSÛ rd dh mit feyhA ukxkySaM esa cSaxu dkp;u&1 tYnh rS;kj gksus okyh fdLe ik;h xbZ ftldsQy dh yEckbZ dkQh vPNh Fkh] gkykafd p;u 1]p;u&3 rFkk p;u&4 ls mit ¼20-5&21-7Vu@gSÛ ½yxHkx ,d leku jghA ‘kdjdUnh dh ‘xkSjh’ fdLedh bl {ks= dh loksZÙke fdLe ds :Ik esa igpku dh xbZ


ftldk xwnk lUrjh jax dk gksrk gSA flfDde ds fy,cU/k xksHkh dh cgkj ¼ 40 Vu@gSÛ ½ dks mi;qDr ik;kx;k ftlls vDrwcj esa ikS/ks yxkus ls lokZf/kd mitfeyhA flfDde ds fy, Qwy xksHkh dh ‘lqokfluh’ vkSjczksdksyh fdLe dh ‘,s’o;kZ’ fdLe Hkh mi;qDr ik;hxbZaaaA

mfe;e esa VekVj ds thuksVkbi chVh&1 ,y bZ1&2] es?kk VekVj&1] es?kk VekVj&2 rFkk cSaxu dkthuksVkbi vkj lh ,e ch ,y&3 dks cSfDVfj;y foYVjksx dk izfrjks/kh ik;k x;kA f=iqjk dsUnz esa VekVjthuksVkbi pÛ&1 esa cSfDVfj;y foYV vf/kd yxk vkSjlh ds oh Vh&17] vdkZ vkHkk esa de fn[kkbZ fn;kA vdkZvkHkk esa ireksM+k jksx dk ladze.k vis{kkd‘r de fn[kkbZfn;kA o”kkZ ds ekSle esa cSaxu thuksVkbi ‘flagukFk’ esafoYV jksx dk izHkko lcls de Fkk vkSj rhu eghus rdblesa izfrjksf/krk cuh jghA ‘khrdky esa ‘>wjh’ fdLejksx izHkko vkSj mit dh n‘f”V ls loksZÙke ik;h x;hAikbfjl czSfldk ds fofHkUu vUr% :iksa ds fy, uksokY;wjksuvkSj fLiukslSM nks u;h dkjxj dhVuk’kh nokvksa dhigpku dh xbZA fetksje esa 50% vtSfod mojZd$50%ofeZ deiksLV ds iz;ksx ls ca/kxksHkh dh mit ,oa xq.koRrkesa o`f) gqbZ gSA ukxkySaM dsUnz esa ca/kxksHkh vkSj VekVjdh mit o xq.koRrk ds fy, oehZdEiksLV ¼3-5 fd-xzke@eh-2½ dks tSfod mojZd ds loksZÙke lzksr ds :Ikesa igpkuk x;kA flfDde esa dksy Qlyksa ds izeq[kd‘Urdksa ds :Ik esa dVoweZ lssfeywij vkSj yky phfV;ksadh igpku dh xbZA

I;kt] thuksVkbi ,u&2&4&1 ds iz;ksx esa ns[kkx;k gS fd 75% ukbVªkstu$tSo mojZd ,stksfLifjyevkSj ,stksVkscSDVj ls mit esa lq/kkj gqvk gS vkSj usdQkSytYnh gh mRiUu gks x;kA ;g r; fd;k x;k fd vf/kd o”kkZ okys {ks=ksa es usdQkSy dh fLFkfr mRiUu djusdh n‘f”V ls ?kVh gqbZ ukbVªkstu dk iz;ksx ,d dk;Zuhfrds :Ik esa fd;k tk ldrk gSA

xcsZjk dh [ksrh esa ns[kk x;k fd blesa 50% Nk;ktky yxkuk 75% Nk;k tky ls csgÙkj gksrk gS vkSj

blesa 7-20 iq”Ik@ikS/kksa dk mRiknu gqvk gSA xcsZjk ds 9oa’kdzeksa dks pw.kZd QQwan dk izfrjks/kh ik;k x;k ftlesals vkjlh- th&3 esa lokZf/kd izfrjksf/krk feyhA es?kky;ls 27 fofHkUu taxyh iztkfr;ksa dk ladyu fd;k x;kvkSj mUgsa xeyksa esa yxk;k x;kA vnjd ds ueZewy jksxds fu;a=.k ds fy, tSo dkcZfud lw=.k th- ,Q- vkbZdks dkjxj ik;k x;kA

Qyksa vkSj elkyksa ds ckjs esa rqM+kbZ mijkar izca/kulaca/kh v/;;u fd, x,A pks&pks& VwVh QwVh rS;kjdjus ds fy, Lykbl dh 6 eh-eh- eksVkbZ vkSj ianzgfeuV okys OySaflax mipkj dks loksZÙke ik;k x;kA vkMwdk e/kqjl cukus ds fy, xwnk vkSj Vh- ,l RkRo dze’k%47-86% vkSj 32-0% lokZf/kd visf{kr ik;k x;kALVªkcsjh dh Qy rqM+kbZ ls igys 2% dSfYl;e DyksjkbMds mipkj ls blds Hkkj esa vkus okyh deh :dh gS vkSjQy [kjkc ugha gq, tcfd nks izfr’kr iksVsf’k;e lYQsVds fNM+dko ls Vh- ,l- ,l esa dqy ’kdZjk ,oa ,LdksfcZd,flM esa o`f) gqbZ gSA fNnz jfgr ,y-Mh- ih- ,y200xst esa dh xbZ iSfdzx ls 50% lkekU; fLFkfr dhrqyuk esa vkB fnu ds ckn Hkkj esa gksus okyh 0-97%deh :dh gSA

iz|kSfxdh fe’ku ds varxZr uhacw oxhZ; Qyksa] iS’kuQy] VekVj] QzSap chu] LVªkcsjh] [kqach Liku] dsyk rFkkgYnh ds cht ,oa ikS/k lkexzh dk mRiknu fd;k x;kvkSj mldh vkiwfrZ dh xbZA ef.kiqj ds fy, ‘dkosjh’fdLedks loksZÙke ik;k x;kA bl fdLe ds fy, 3X2 eh-dk varj fu/kkZfjr fd;k x;kA

vks;LVj [kqach ih- ,l- lh-&05 ¼ih-ltksj&dktw½vkSj dksM 01 ¼ih- ¶yksfjMk½ dh nks iztkfr;ksa dks mUurik;k x;kA f=iqjk dh fLFkfr esa [kqach dh rhu iztkfr;ksadks mi;qDr ik;k x;kA /kku ds Hkwls dks mM+n dhQfy;ksa ds fNyds esa feykdj cgqr vPNk ek?;e pkjkcuk;k x;kA /kku ds Hkwls esa [kqach mxkuk cgqr jkspdIkz;ksx gSA f=iqjk dh fLFkfr ds varxZr tc /kku ds Hkwlsds D;wc cukdj [ksrh dh xbZ rks 1&3 fnuksa esa mlesavPNh xqnxqnh [kqfEc;ka mx vk;ha tks m”.k dfVca/kh;LFkyksa ds fy, vlkekU; ckr gSA


[ksr esa fofHkUu d`Urduk’kh nokvksa ds iz;ksx esa ] cakllEcU/kh dsUnzksa esa ftad QkSLQkbM fofHkUu LFkyksa ij j[knsus ls lokZf/kd dkjxj iz;ksx jgk ftlesa 16-05&17-80% vkSlr mi;ksx jgkA

es?kky; esa fofHkUu ty lzksrksa ls ikuh dh xq.koÙkkdk fo’ys”k.k fd;k x;kA es?kky; ds vf/kdka’k tylzksrksadk ikuh vEyh; ik;k x;k ftlesa iksVsfl;e] lksfM;e]lYQj] dSssfY’k;e] eSfXuf’k;e] ukbVªkstu dh ek=k degS vkSj dkcksZusV rRo dk oxhZdj.k Hkh fd;k x;k rksdqN ugha feykA f=iqjk esa ikuh dk ih ,p Lrj 6-1&7-68jgk rFkk ukbVªsV lanw~”k.k vf/kd ik;k x;kA tydqaMvkSj ;FkkLFkku e‘nk ueh laj{k.k lEcU/kh izf’k{k.k fn;kx;kA

vEyh; e`nkvksa ds fy, e`nksa dh moZjrk ns[kus gsrqrhoz ijh{k.k fdV fodflr fd, x,] mudk izn’kZufd;k x;k ,oa forfjr fd, x,A e`nk fo’ys”k.k lEcU/kh e`nk xq.koÙkk dkMksZ dk izoZru fd;k x;kA f=iqjkdsUnz esa vc rd dqy 539 uewuksa dk ladyu fd;k x;kvkSj 132 dkMZ rS;kj fd, x,A nh?kkZof/kd [ksrh dsvUrxZr lsVSfj;k] daxksflXuy vkSj edwuk tSls ?kklksa lse`nk HkkSfrd fo’ks”krkvksa esa lq/kkj fd;k x;k ftlesa e`nkdVko 33% rd de gqvk vkSj dkcZu i`FkDdj.k esa lq/kkj vk;kA mijkÅWa pkoy] ljlksa ¼41%o`f)½ vkSj eVj¼36%o`f)½ ds fy, laj{k.k tqrkbZ mRd‘“V ik;h xbZA

d`f”k okfudh izk.kkyh esa 14 o”kksZa ds ikS/kjksi.k ds cknth- jkscqLVk dh vkSlr ÅWapkbZ 12-21 ehVj vkSj eksVkbZ12-98 lsa ehÛ gks xbZA th- jkscqLVk vuUukl dk mRiknu16-5 Vu@gSÛ- jgkA mfe;e esa vkS”k/kh; ikS/kkssa dk ckxyxk;k x;k ftlesa 35 iztfr;ksa ds ikS/ks gSaA

‘kksHkkdkjh eNyh ikyu vkSj tydqaM lEcU/kh v/;;u esa foÙkh; fofo/krk ns[kh xbZz ftlls irk yxk fdnksuksa fLFkfr;ksa esa dze’k% 1-31 rFkk 1-61 dk ykHk$ykxrdk cgqr vPNk vuqikr jgkA es?kky; ds lhekUr [ksrh{ks= esa pkoy dh mit c<+kus ds fy, pkoy dhHkye&1]Hkye&2 ‘kgljax&1] jathr fdLeksa dks mUurfdLeksa ds :Ik esa igpkuk x;kA ef.kiqj esa tytho

ikyu vk/kkfjr [ksrh iz.kkfy;ksa ds vkfFkZd ewY;kadu esaik;k x;kk fd blesa laLFkkxr _.k] vf/kd fuekZ.kykxr vkSj oSKkfud eNyh ikyu fof/k;ksa dh dehlcls cM+h leL;k,a gSaA

QkeZ e’khuks a esa de otu okyk ikoj fVyj]fiz&tfeZusVsM iSMh lhMj] gkFk ls pyk, tkus okyk /kkujksikbZ ;a= vkfn dk ijh{k.k fd;k x;kA igkM+h lh<+hnkj[ksrksa ds fy, de otuh ikoj fVyj dkQh dkjxj gSAdkyhfepZ dks lq[kkus okyk ,d ;a= fodflr fd;k x;ktks Mhty ls pyrk gSA 550&600- lsÛ -rkieku rdlq[kkuk lcls vPNk jgrk gSA fdlkuksa ds [ksrksa esa chtHkaMkj.k ds fy, pkjdksy ‘kksf”kr ,d chtnku dk fMtkbuHkh rS;kj fd;k x;kA

fNM+dko fof/k ls flapkbZ ds fy, lekurk esa fofo/krk ,oa blds vUrxZr vkus okys {ks= lEcU/kh v?;;ufd;k x;kA gkykafd NVs fLizadyj ds vUrxZr vkusokyk {ks= igys fLizadyj ls 55% de Fkk vkSj vfUrefLizadyj esa fudklh Hkh lcls de Fkh exj gj le;leku :i ls pyus esa vUrj ik;k x;kA tylaHkjfodkl dk;Zdze dk ewY;kadu djus ij ik;k x;k fdbl izkS|ksfxdh ds dkjxj izlkj ds fy, fdz;kUo;uokys dk;Zdze ds lkFk fyax vk/kkfjr izkS|ksfxfd;ksa dsla;kstu ls pyus okyk lgHkkxh fdz;kUo;u dk;ZdzemRd`“V fof/k gSA

laLFkku esa LFkkuh; lalk/kuksa ls larqfyr Ik’kq vkgkjrS;kj djus ds iz;kl tkjh gSaA okf”kZd Qyh pkjs esajkblchu vkj lh vkj ch&10] lks;kchu tSls ‘kkfey gSa]‘khrdkyhu okf”kZd pkjs esa tbZ vkSj ckjgeklh pkjs esaijkjh vkSj czwe tSls ?kklksa dks cf<+;k pkjk lzksrksa ds :Ikesa ik;k x;kA Ik’kqvksa vkgkj ds fy, ‘kdjdUnh dh‘ladj’ fdLe dh igpku dh xbZ ftlesa csgÙkj ‘kq”dinkFkZ Hkh gksrk gS] ikpd Hkh gksrk gS] vkSj ÅtkZ oizksVhu Hkh Hkjiwj ek=k esa feyrh gSA ‘kwdj ds cPpksa dsfy, pkoy dh Hkwlh ls rS;kj fd;s x;s vkgkj dkewY;kadu djus ij ik;k x;k fd LFkkuh; pkoy dhHkwlh cf<+;k ugha gksrh vkSj bldk iz;ksx 25% rd gh


fd;k tk ldrk gS ftlls FkksM+h& cgqr o`f) gks ldrhgSA vxfHkZ.kh vkSj nw/k u nsus okyh HksMksa ds fy, eDdsdk LVksoj & uSfi;j taxyh ?kkl lkbyst dh cf<+;klkbyst ds :Ik esa igpku dh xbZA bu HksM+ksa dks eDdsds usokjks vk/kkfjr vkgkj ls LisaV ekYV dh vkiwfrZ gkstkrh gS vkSj buds iks”k.k mi;ksx esa o`f) ik;h xbZAxk; ds fy, jkblchu vk/kkfjr vkgkj }kjk LisaV ekYVdh vkiwfrZ gksus ls nqX/k mRiknu esa ykHkdkjh izHkkofn[kkbZ fn;kA flfDde esa LFkkuh; pkjs ls feFksu mRiknuij v?;;u djus ls irk yxk fd ,sfEy’kks vkSj fdExwls ;Fkk& LFkku fLFkfr esa feFksu dh ek=k lcls de cuik;hA

tksuk&ckbafMax ijh{k.k fof/k ds iz;ksx ls rkts vkSjtes gq, ch;Z dk ewY;kadu djus ls irk yxk fd tesgq, ch;Z esa c)rk dh {kerk dkQh de ;kuh 0 ls 24,p rd gks xbZ rFkk LieZ e`R;rk ,oa ,sdzkslkse lesduesa ldkjkRed :Ik ls ikjLifjd lEcU/k fn[kkbZ fn;kAvkuqcaf’kd lewg] vk;q vkSj ekSle dh n`f”V ls Hkhe‘R;rk dk fof’k”V lg&lEcU/k ns[kk x;kA ejus dkizeq[k dkj.k ikpu rU= lEcU/kh fodkj FksA

y/kqLrjh; ‘kwdj&ikyu esa vYi fuos’k ‘kwdj mRiknuiz.kkyh dk fo’ys”k.k fd;k x;k rFkk fuos’k& ifj.kkeds izokg dk irk yxk;k x;kA ‘kwdj vkgkj vkSj ‘kwdjksads [kfut rRo lEcU/kh fjdkMZ ls irk yxk fd mPpLrjh; LikbySaFkl iztk- ¼vkgkj½ esa vf/kdka’k lw{e rRo,oa lw{e iks”kd rRoksa dk Lrj vf/kd FkkA rFkkfi vf/kdk’ka ‘kwdjksa esa dsfY’k;e] QkSLQksjl] lksfM;e] eSfXuf’k;erFkk iksVSf’k;e dh deh ik;h xbZA ;g Hkh ns[kus okyhckr gS fd 100% ‘kwdjksa esa ftad dh deh ik;h xbZAbuesa VsfLVdqyj vlkekU;rk,a] czqlsyksfll] Lokbu QhojtSlh chekfj;ka ns[kh xbZaA

vle dh igkM+h cdfj;ksa esa mRiknd vkSj iztUkulEcU/kh fdz;kvksa dk v?;;u fd;k x;kA ;g ns[kk x;k

fd cdfj;ksa dks czwe ?kkl lks;kchu ;k jkblchu dkvkgkj nsus ls muesa iks”kd rRoksa dh miyC/krk c<+ tkrhgSA cdjh ds IykTek ,y- ,p- fu/kkZj.k ds fy, ,d lk/kkj.k vkSj laosnu’khy ,satkbe bE;wuks ijh{k.k fof/k fodflrdh xbZA cdfj;ksa ds iztuu vaxksa ds ijh{k.k ds fy,,d vYVªk&lksuksxzkfQd fof/k Hkh fodflr dh xbZA

eqxhZikyu ds ekeys esa] fetksje esa 12 lIrkg rdLFkkuh; if{k;ksa dks ikyus ls fglkc yxk;k x;k fd30-35 #i;s@ i{kh dh ‘kq) vk; izkIr gqbZA czksbyjfpdu esa] ,e-¶ys dk ikuh esa ?kqyu’khy fgLlk 10fe-xzk-@fd-xzk ‘kjhj Hkkj nj ls bE;quksfLVeqysVj ds :Ikesa HkyhHkkafr mi;ksx esa yk;k x;kA ns’kh eqfxZ;ksa vkSjIk’kqvksa ds vkf.od tkfro`Ùk lEcU/kh v?;;u ls fofnrgqvk fd lkbVksdzksesc thu esa fofHkUu Lrjksa ij vilj.kgksrk gSA [kjxks’k ds U;wthySaM g~okbV o :lh fpafpykuLy ds [kjxks’k esa lokZf/kd ¼7%5%½ dzfed vilj.kfn[kkbZ fn;kA bl {ks= esa VdhZ if{k;ksa dk izorZu fd;kx;kA eqfxZ;ksa vkSj Ik’kqvksa dh dbZ chekfj;ksa ds vkf.odfunku fodflr fd, x, tSls&lSYek susyk Sfll]ekbdksVkSfDldksfll] DyksfLVªfM;e ifQazZtsal ladze.k]dkSfycSflykSfll vkfnA vkf.od rduhdksa ds iz;ksx lsIk’kqvksa vkSj eqxhZ lEcU/kh mRiknksa esa twuksfVd thoksa dhmifLFkfr dk irk yxk;k x;kA th vkbZ ijthoh;ladze.kksa ¼ gheksapl] vksblksQSxksLVksee vkSj C;wuksLVSee½dh ih ,y lh vkj vk/kkfjr igpku dk ekudhdj.kfd;k x;kA flfDde ls fy, x, Dyhfudy nw/k dsuewuksa esa LVSQkbykssdkSdl] LVsªIVksdkSdl vkSj bZ- izeq[kjksxtud ik;s x;sA

vaMksa dks Nhyus] fu”kspu vkSj lsus ds fy, 1-0 fe-yhoksok ,Q ,p@fd-xzk- ‘kjhj Hkkj dk batD’ku loksZÙkeik;k x;kA ySfcvks cSVk] vksoSfize vkSj vksoSVkbV esa vaMkasdk mRiknu c<+k;k x;kA vksoSVkbM dh vis{kk vksoSfizedks T;knk dkjxj ik;k x;kA

icar research complex for neh region umroi road, umiam ...pod-boring weevil indicated interspecific...

Documents