Proc. Nati. Acad. Sci. USAVol. 90, pp. 1556-1560, February 1993Biochemistry

5' sequences are important positive and negative determinants ofthe longevity of Chlamydomonas chloroplast gene transcripts

[RNA turnover/chloroplast transformation/rbcL gene/uidA (J-glucuonldase) reporter gene/chloroplast gene expression]

MARIA L. SALVADOR*, UWE KLEIN, AND LAWRENCE BOGORADtThe Biological Laboratories, Harvard University, 16 Divinity Avenue, Cambridge, MA 02138

Contributed by Lawrence Bogorad, November 12, 1992

ABSTRACT We have found that sequences in the 5' leaderof the Chlamydomonas chloroplast rbcL gene, when fused 5' toforeign genes, destabilize transcripts of these chimeric genes inthe chloroplast of transgenic Chlamydomonas but that 5' se-quences ofthe rbcL structural gene prevent this destabilization.Transcripts of the chloroplast rbcL gene are about equallyabundant at all times in Chlinydomonas reinhardij growing onan alternating 12-h light/12-h dark cycle. However, Chlamy-domonas chloroplast transformants, harboring chimeric genescontaining the same rbcL promoter with 63 or 92 bp of the rbcL5' leader sequence fused upstream of the Escherichia coli uidA(P-glucuronidase, GUS) gene, accumulated GUS transcriptsonly in the dark. Transcripts disappeared rapidly upon Mu-mination of the cells. The same phenomenon was exhibited bytranscripts of chimeric genes in which the GUS gene codingsequence was replaced by other unrelated genes. The precip-itous light-induced drop in GUS transcript abundance wasfound to be due to an "16-fold increase in the rate ofdegradation of GUS transcripts in light rather than to adecrease in the rate of transcription of the GUS gene. Tran-scripts of a chimeric rbcL-GUS construct in which the leadersequence of the rbcL gene was replaced by 103 bp of the leadersequence of the atpB gene were stable in illuminated cells. Thedestabilizing effect of the rbcL 5' leader sequence was reversedby adding 257 bp of the 5' coding region of the rbcL gene. Theresults show that chloroplast transcript levels in illuminatedChiamydomonas cells-and perhaps in other cases-can bedetermined, at least to some extent, by sequences and inter-actions of sequences transcribed from the 5' ends of genes.

The development of a microprojectile-based DNA deliverysystem (1) has made it possible to study features of Chlam-ydomonas chloroplast genes and their transcripts in trans-genic cells in vivo. Foreign DNA, when flanked by normallycontiguous Chlamydomonas chloroplast DNA sequences,becomes stably inserted into the chloroplast chromosome byhomologous recombination (2). Two different types of chlo-roplast gene promoters have been characterized in transgenicChlamydomonas carrying chimeric genes composed of mod-ified or unmodified promoter sequences linked to a reportersequence (3, 4). It has also been found that the promoters ofthe Chlamydomonas chloroplast atpB, atpA, and 16S rRNAgenes, when joined in transcriptional fusion with the Esch-erichia coli uidA (p8-glucuronidase, GUS) gene (5, 6), initiatetranscription correctly and drive transcription as effectivelyas they do for their endogenous genes (3, 4). In contrast, theGUS gene was transcribed from a DNA fragment containingthe Chlamydomonas chloroplast rbcL promoter at only about1% of the rate of the endogenous rbcL gene in cells undercontinuous illumination (3). We speculated that the rbcLpromoter functions poorly because of its incompatibility with

flanking sequences of the chimeric gene constructs and/or itsaltered location in the chloroplast chromosome of transfor-mants (3).To study the functioning of the rbcL promoter in more

detail, we constructed a number ofchimeric genes containingrbcL promoter fiagments of different sizes fused to the GUSreporter gene and introduced them into the Chlamydomonaschloroplast via microprojectile bombardment. We havefound that transcripts from these rbcL promoter-GUS genesaccumulate in Chlamydomonas chloroplast transformants torelatively high levels in darkness but are degraded veryrapidly upon illumination of the cells, although the rate oftranscription is not reduced immediately after illumination.In contrast, the pool of transcripts of the endogenous rbcLgene is not altered significantly upon illumination of dark-grown cells. This investigation was directed at understandingthe basis for differences in the longevity of transcripts ofchimeric rbcL-GUS and endogenous rbcL genes in vivo. Theexperiments described here show that the presence in therbcL-GUS mRNA of sequences transcribed from the 5'untranslated portion ofthe Chlamydomonas chloroplast rbcLgene destabilizes rbcL-GUS transcripts in light and that theinclusion of 5' rbcL coding sequences in the chimeric genecounteracts the destabilizing effect of the rbcL leader.

MATERIALS AND METHODSAlgal Cultures. Chlamydomonas reinhardtii nonphotosyn-

thetic mutant CC-373 (ac-uc-2-21), obtained from the Chla-mydomonas Genetics Center (Duke University, Durham,NC), and photosynthetic transformants of this strain weregrown as described (3, 4). Transformants were grown inalternating 12-h light/12-h dark cycles, with daily dilutions toabout 1.5 x 106 cells per ml at the beginning of the lightperiod.

Plasmids. Conventional cloning techniques were usedthroughout (7). Starting vectors for the chimeric gene con-structs used in this study were plasmids pCrc27 and pCrc39(3) containing rbcL (pCrc39) or atpB (pCrc27) promoterfragments fused 5' to the GUS structural gene.To create plasmid pMU14, a 2.2-kb Xba I restriction

fragment from a cDNA clone of the maize Lc gene (8) wascloned in reverse orientation into Xba I-digested pCrc39. Tocreate plasmid pAADA, a 388-bp Dde I (blunted)/Nla IVrestriction fragment from the 5' region of the rbcL gene,containing the rbcL promoter, was cloned into EcoRV/NcoI (blunted)-digested pUC-atpX-AAD (9). The rbcL promot-er-aadA-rbcL 3' end cassette was released with EcoRI/XbaI and cloned into EcoRI/Xba I-digested pCrc44 (3). PlasmidpCrc32 was constructed by cloning the blunted 401-bp Taq I

Abbreviation: GUS, jB-glucuronidase.*Present address: Departamento Bioquimica y Biologia Molecular,Universidad de Valencia, c) Dr. Moliner no. 50, Burjassot, Valencia46100, Spain.1To whom reprint requests should be addressed.

1556

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Dow

nloa

ded

by g

uest

on

Apr

il 4,

202

1

Proc. Natl. Acad. Sci. USA 90 (1993) 1557

fiagment from the Chlamydomonas chloroplast DNA EcoRI14 fragment, containing the 3' flanking sequences of thepsaBgene, in a forward orientation into the blunted Not I site ofpCrc27 adjacent to the 3' end of the GUS gene.

Plasmids pMU7, pMU9, pMU15, and pMU16, which differin the sequences upstream of the GUS structural gene, werederived from pCrc32. The 1059-bp Xho I/EcoRV restrictionfragment from the Chlamydomonas chloroplast DNA EcoRI14 fragment was cloned into Xho I/Sma I-digested pCrc32 tocreate plasmid pMU15. The 388-bp Dde I (blunted)/Nla IVrestriction fragment from EcoRI 14 was cloned into Xho I(blunted)/Sma I-digested pCrc32 to create plasmid pMU7.The 251-bp blunted Acc I/Sau3A restriction fragment fromEcoRI 14 was cloned into Xho I (blunted)/Sma I-digestedpCrc32 to create plasmid pMU9. To construct plasmidpMU16, the 116-bp Ase I (blunted)/Sma I restriction fragmentfrom pCrc32, containing a portion of the 5' untranslated leadersequence of the Chlamydomonas chloroplast atpB gene, wascloned in forward orientation into Cla I-digested bluntedpBluescript SK+ (Stratagene). The 290-bp Dde I (blunted)/Dra I restriction fragment from EcoRI 14, containing the rbcLpromoter, was cloned in forward orientation into the HincIIsite upstream of the atpB untranslated sequence in the above-mentioned pBluescript vector. The construct was removedwith Xho I/EcoRV and cloned into Xho I/Sma I-digestedpCrc32 to create plasmid pMU16. Constructs were verified bysequencing.

Chloroplast Transformation. All chimeric GUS genes werecloned into a Chlamydomonas chloroplast transformationvector, which promoted integration of the constructs intoChlamydomonas chloroplast DNA sequences adjacent to the3' end of the atpB gene (3, 4). Cells were subjected tomicroprojectile bombardment, and transformants were se-lected and verified according to published protocols (1, 2).DNA and RNA Isolation and Hybridization Analyses. DNA

and RNA isolations, DNA dot blots to screen for foreignDNA, and RNA gel (Northern) blots to determine the abun-dance of transcripts in transformants were done essentially asdescribed (3). Probes for the uidA (GUS) gene and theChlamydomonas chloroplast atpB and rbcL genes have beendescribed (3, 4). The 620-bp Dra III restriction fragment frompAADA and the 1.64-kb Xba I/Nco I restriction fragmentfrom pMU14 were used as probes for the aadA and Lc genes,respectively.

Rates of Transcription and Transcript Degradation. Thesewere determined as described (3, 10).

RESULTS

The Promoter Region of the Chlamydomonas ChloroplastrbcL Gene Confers Negative Light Regulation on the Expres-sion of Foreign Genes in Chloroplast Transformants. Thepromoter ofthe Chlamydomonas chloroplast rbcL gene (Fig.1), located -100 bp upstream of the translation start site (11),contains an octameric palindrome (TATAATAT), which isalso found in promoters of several other Chlamydomonaschloroplast genes and has been shown to be a functionalcomponent of the atpB gene (4).We reported previously (3) that a Chlamydomonas chlo-

roplast DNA fragment containing the rbcL gene promoterand flanking sequences (from position -649 to +63 relativeto the start site of transcription) supported only low rates oftranscription (as compared to the endogenous rbcL gene) ofthe bacterial uidA (GUS) reporter gene in chloroplast trans-formants in vivo. Also, only very small amounts of GUStranscripts accumulated in Chlamydomonas chloroplasttransformants harboring a chimeric rbcL promoter-GUSgene. These analyses were made in transformants grown incontinuous light. Because the rates of transcription of somechloroplast genes and the levels of some transcripts vary in

-50 .40 -.30 -iTAAATTTTGCTAG FTACM AIT1T A AITAATATITTAATG TAT-

10 00fI* * *$* *TAAAATTTTTCAACAATTT-TEAAAITA ATTT _ HASAAA 1 TAV3GATCCTiAA

70 so 90**** * *

AAGAAGITACAT TATT AIAA AT TILA`AAACAGAAA"TAAAGCAGGTGCTi

GATTCAAAGCCGGTGTAAAAGACTAC< Ii 1AAllTAC!ACACACC AVACGTA6-A200

* * * * *

AGAGATACTGIATATTTIAGC'TG-ATTK

1558 Biochemistry: Salvador et al.

1) i. 1)

*_ -OW - ./?|

D.-A1RK 1 i I'1

t/J[.ir lolt}- re (l .%I /v'S !-hL- '

-Loto-{.'(4( -0- t1)C ri

1,l -(H I, ByA.

1)

mm amMONo* IRclat ix Vtcccof Transcrilpioli

( __ }!

B

/ +\.6ti.

").%I.v;.is -;,eff{B

ifFI--

C,

4ec t.;; I 'mm~-

1)IfI::l I .. _

/ {)

E)\lIt- 7

D L

(; '.S

_ _u.US

pA.\l).\D a

p1lI t 4 ..

I UI3L' - _ (d;l

FIG. 2. Levels of transcripts from the endogenous rbcL gene (AUpper) and from chimeric genes containing rbcL (A-C) or atpB (D)promoter fragments in Chlamydomonas cells growing in a 12-hlight/12-h dark regime (light from 0 h-12 h, open bars; dark from 12h-24 h, filled bars). Total RNA was isolated from Chlamydomonaschloroplast transformants at the time points indicated below auto-radiograms and was analyzed by RNA gel blots (3). Structures of thechimeric gene constructs are shown schematically to the left of theautoradiograms. Numbers denote the positions of the bases at the 5'and 3' termini of the cloned DNA fragments relative to the start oftranscription in the endogenous rbcL and atpB genes. Probes usedfor hybridization are indicated on the right. The continuous filled barin A indicates that light/dark-grown cells were kept in continuousdarkness at a time when they normally are in light.

Transcripts from rbcL Promoter-GUS Genes Are Consid-erably Less Stable in Light Than in Darkness. The conspicu-ous drop in abundance of rbcL-GUS transcripts after theonset of light (Fig. 2) could be due to a decrease in the rateof transcription of the GUS gene, an increase in the rate ofdegradation of GUS transcripts, or both. We measured ratesof transcription of rbcL-GUS genes by in vivo labeling at twotime points in cultures of transformant MU7 maintained on12-h light/12-h dark cycles: close to the end ofthe dark period(11-h dark)-when GUS transcripts were very abundant-and shortly after the onset oflight (20-min light)-when levelsof GUS transcripts were decreasing. We found that GUStranscription from the rbcL promoter increased by about 35%at the beginning of the light period (Fig. 3) but that GUStranscripts were degraded about 16 times faster than in thedark (Fig. 4), as measured by in vivo pulse-labeling of newlysynthesized RNA (10, 14). This shows that the rapid declinein GUS transcript abundance in the beginning of the lightperiod is caused solely by a light-induced acceleration of thedegradation ofGUS transcripts and not by a decrease in therate of GUS gene transcription.The 5' Untranslated Leader Sequence of the Chlamydomonas

Chloroplast rbcL Gene Destabilizes GUS Transcripts in the

FIG. 3. Relative rates of transcription of a chimeric rbcL pro-moter-GUS gene (pMU7) and the endogenous rbcL gene at the endof the dark period (11-h dark) and in the beginning of the light period(20-min light) in light/dark-grown chloroplast transformantMU7 (seeFig. 2 for structure of construct). Rates of transcription weredetermined by in vivo labeling of RNA with [32P]orthophosphate asdescribed (3). The slots show the increases in specific radioactivityof rbcL-GUS and rbcL mRNAs after 10 min (10') and 20 min (20')of labeling. Autoradiograms were scanned with a laser scanningdensitometer, and relative rates oftranscription were calculated fromthe differences in densitometric values at the 20-min and 10-min timepoints (3). Rates at 11-h dark were set to 100%.

Light. The results presented above-which show that rbcL-GUS transcripts decay rapidly in illuminated cells-suggestthat RNA sequences are responsible for the rapid light-induced decline of rbcL-GUS RNA. Regions important forlight-induced instability of rbcL-GUS transcripts could befurther delineated by comparing the sequences of GUStranscripts that are not degraded rapidly in light (pCrc32, Fig.2D) with the sequences of GUS transcripts that show therapid decline (pMU7 and pMU9; Fig. 2B). The transcripts areidentical except for the 5' leader sequence upstream of theGUS coding region. It seemed likely that the 5' untranslatedleader sequence of the Chlamydomonas chloroplast rbcLgene destabilizes GUS transcripts-and probably other tran-scripts-in illuminated cells.To test this possibility, we constructed a chimeric rbcL

promoter-GUS gene (pMU16) in which the leader sequencefrom the rbcL gene (positions +1 to +63 in pMU7), contain-ing the presumed destabilizing sequence, was replaced by theleader sequence from the Chlamydomonas chloroplast atpBgene (from position -2 to + 103 relative to the start site of

DA'RK

.L)CdS

cltlB W O M

plUC( 18(I (). Z, i(;

L2(IGHT

H-lalf-lives

-thu _(JH .... S _

aip B

FIG. 4. Longevities of rbcL-GUS and atpB transcripts in dark-ness and in light in chloroplast transformant MU7. Light/dark-growncells were harvested at the end of the dark period (22-h dark), labeledfor 20 min with [32P]orthophosphate as described (10), and-afterwashing out unincorporated label-shaken for 1 h in the dark in a highphosphate medium. Samples were taken at the time points indicatedfrom cell suspensions kept in darkness or transferred to light. TotalRNA was isolated and hybridized to gene-specific probes (as shownto the left) previously immobilized on nylon membranes in a slot blotapparatus. Autoradiograms were scanned with a laser scanningdensitometer. Half-lives were calculated from semilogarithmic plotsofthe decrease in densities of the signals in the slots vs. time. pUC18DNA was used as a control for unspecific binding of RNAs.

A

Proc. Natl. Acad. Sci. USA 90 (1993)

('1i ; l.'' A ...('.

., i ( ."11 -. ":

_. {dIit1.1A

Dow

nloa

ded

by g

uest

on

Apr

il 4,

202

1

Proc. Natl. Acad. Sci. USA 90 (1993) 1559

transcription; see Materials and Methods for construction ofthe chimeric gene and Fig. 5 for sequences and borders ofDNA fragments in the construct). Transformants harboringthis construct (pMU16: rbcL promoter-atpB untranslatedregion-GUS) maintained dark levels of GUS transcripts incells in the light for at least 1 h (Fig. 5; compare with Fig. 2D),demonstrating that it is the presence of the 5' untranslatedleader sequence of the Chlamydomonas chloroplast rbcLgene that renders the transcript of the chimeric gene highlysusceptible to rapid degradation and, overall, that 5' regionsof genes are important for establishing the longevity oftranscripts in illuminated cells of the alga.

5' Sequences of the rbcL Structural Gene Prevent the Light-Induced Degradation of GUS Transcripts Caused by the rbcLUntranslated Region. Levels of transcripts from the endoge-nous Chlamydomonas chloroplast rbcL gene vary onlyslightly in light/dark cycles (Fig. 2A) although those tran-scripts contain the same leader sequence shown above todestabilize foreign genes in light. In view of the observationsdescribed above, it seemed likely that an RNA sequencetranscribed from elsewhere in the rbcL gene could counteractthe destabilizing effect of the rbcL leader sequence. To beginto identify the sequences in transcripts of the endogenousrbcL gene that might have the latter effect, we constructed achimeric rbcL promoter-GUS gene containing DNA se-quences from the 5' region of the Chlamydomonas chloro-plast rbcL gene plus an additional 252-bp of rbcL gene codingsequences in front of the GUS gene (pMU15; Fig. 5). Levelsof transcripts of this construct did not decrease in transfor-mants after 1 h in light (Fig. 5). Thus, sequences in the 252 bpat the 5' end of the rbcL structural gene neutralize thedestabilizing effect of the rbcL 5' leader sequence on GUStranscripts in illuminated cells. Sequences within this 252-bp

1)M 16- -- th-Mcl, 1w moi tr setquences .-

-290 -50 -40 -30 -20 10 -1TTAG. TAAATTTGCTAGIT:TTATTTTTA1 TITC I AAATAtAAAA1 T'T

r1 1o 2O 30 40* * * * *

gacggtatTAATATATATAGTTAAATGAAAAAACTAAAAAATAAGCGTTAGTGAATAalplB 5' UTR-

50 60 70 80 90 00ATACTTTITATATAAAAIT CTAT CTA TAT GTTT G AGcTTcC1T TTTAT AT AAATIT

( -I .Sgocggotc cccctoogct.tgatgtCGTCAGTCC Cr TATG

Ia t I|

4

'I)IB 1JTRI ~-_-,..pr..er (H +j II-7(P) ±3§-

3 LM.±L

pNIL:I6 ¢§ -U-'~ rs

t' N.S

FIG. 5. Levels of GUS transcripts at the end of the dark period(O h) and after 1 h of illumination in light/dark-grown Chlamydom-onas chloroplast transformants harboring the chimeric rbcL promot-er-GUS gene pMU15 or pMU16. Structures of the chimeric genesare shown schematically to the left of the autoradiograms. Thesequence of the rbcL promoter-atpB 5' untranslated region-GUSfusion, as determined by sequencing, is given above. Numbers at thesequence and at the schematic constructs relate to the start sites oftranscription in the endogenous rbcL and atpB genes. Vector poly-linker sequences between the cloned DNA fragments are shown insmall letters. UTR, untranslated region.

region are probably also responsible for stabilizing tran-scripts of the endogenous rbcL gene in illuminated cells.

DISCUSSION

We have found that the 63 nucleotides at the 5' end of theChlamydomonas rbcL gene transcript render chimeric RNAswith GUS, aadA, or Lc coding regions susceptible to rapiddegradation upon illumination of cells previously maintainedin darkness for 12 h. However, the rapid degradation iseliminated by the addition of 252 nt from the adjacent codingregion of the rbcL gene. Additional deletion and/or mutationanalyses are needed to locate specific elements within thesesequences that are important for regulating the degradation ofthe mRNA. Preliminary computer analyses of the folding ofthe 5' sequences of rbcL transcripts did not reveal structuralfeatures (like stem-loops or double-stranded structures thatmight be formed between nucleotides in the + 1 to +63 andthe +64 to +350 regions) that might be involved in making thetranscripts susceptible or resistant to rapid degradation.Some examples of developmentally and light-regulated

changes in transcript stabilities have been reported for greenphotosynthetic organisms: transcripts of the chloroplastpsbA gene were reported to be more than twice as stable inmature leaves as in young leaves of spinach (15). Light/dark-regulated changes in decay rates of mRNAs have been foundin Synechocystis (16) and potato (17). In Chlamydomonas,light appears to play an important role in regulation ofchloroplast RNA decay because it not only triggers the rapiddecline of several rbcL promoter-GUS transcripts (Fig. 2)but also enhances rates of degradation of several otherChlamydomonas chloroplast RNAs (ref. 10; compare alsolight and dark rates of degradation of atpB transcripts in Fig.4). We do not know how illumination acts to accelerate RNAdecay in light/dark-grown Chlamydomonas. In Synechocys-tis, it has been shown that photosynthetic electron transportis required for an increase in rates of decay of transcripts ofthe psbA gene (16). The present data suggest that mutationsin the 5' leader and the coding regions of a Chlamydomonaschloroplast gene could strongly influence the longevity of itstranscripts.

Control of mRNA stability can be important in posttran-scriptional regulation of gene expression (18), but the mo-lecular mechanisms governing the degradation ofmRNAs arelargely unknown. In Chlamydomonas, a number of nuclearmutants that fail to accumulate transcripts of one or more ofthe chloroplast genes psbB, psbC, psbD, atpA, and atpB,which encode polypeptides of photosystem II and the chlo-roplast ATPase complex (19-23), have been described. It isgenerally assumed that these mutants lack one or morespecific protein factor(s) required for stabilization of individ-ual chloroplast transcripts.

It has been speculated that binding sites for proteinsregulating RNA longevity are located in the 3' untranslatedregions ofchloroplast transcripts (24, 25). In most, but not all,cases these regions contain inverted repeat sequences capa-ble of forming stable stem-loop structures. Chloroplast pro-teins have been found to bind to and around these structuresin vitro (25-29), giving support to the notion that 3' untrans-lated sequences of chloroplast genes are involved in regula-tion of transcript stability. However, the rates of degradationof transcripts of chimeric GUS reporter genes were the samewhether or not the constructs were terminated by 3'-flankingsequences from the Chlamydomonas chloroplast rbcL orpsaB genes (30), indicating that 3' inverted repeat elements ofthese chloroplast genes function primarily as RNA process-ing or transcription termination sites in vivo rather than tostabilize transcripts. We did find, however, that the half-livesofGUS transcripts changed when sequences in the 5' regionof chimeric GUS gene constructs were altered (unpublished

Biochemistry: Salvador et al.

Dow

nloa

ded

by g

uest

on

Apr

il 4,

202

1

1560 Biochemistry: Salvador et al.

results), suggesting that 5' untranslated sequences can affectthe longevity ofchloroplast transcripts. The results presentedin this report not only support this conclusion but also showthat several factors can be involved in the regulation of atranscript's half-life.

The first two authors contributed equally to this work. We thankDr. D. Abarca and J.-F. Viret for critically reading the manuscript,Dr. S. Wessler for the Lc cDNA clone, Dr. M. Goldschmidt-Clermont for plasmid pUC-atpX-AAD, and Dr. J.-C. Woo forplasmid pAADA. U.K. received a grant from the Deutsche Fors-chungsgemeinschaft. M.L.S. was supported by a grant from Direc-cion General de Investigacion Cientifica y Tecnica, Spain. This workwas supported, in part, by a research grant from the U.S. Departmentof Agriculture-National Research Initiative Program of the Compet-itive Research Grants Office.

1. Boynton, J. E., Gillham, N. W., Harris, E. H., Hosler, J. P.,Johnson, A. M., Jones, A. R., Randolph-Anderson, B. L.,Robertson, D., Klein, T. M., Shark, K. B. & Sanford, J. C.(1988) Science 240, 1534-1538.

2. Blowers, A. D., Bogorad, L., Shark, K. B. & Sanford, J. C.(1989) Plant Cell 1, 123-132.

3. Blowers, A. D., Ellmore, G. S., Klein, U. & Bogorad, L.(1990) Plant Cell 2, 1059-1070.

4. Klein, U., De Camp, J. D. & Bogorad, L. (1992) Proc. Natl.Acad. Sci. USA 89, 3453-3457.

5. Jefferson, R. A., Burgess, S. M. & Hirsh, D. (1986) Proc. Natl.Acad. Sci. USA 83, 8447-8451.

6. Jefferson, R. A. (1987) Plant Mol. Biol. Rep. 5, 387-405.7. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989) Molecular

Cloning:A Laboratory Manual (Cold Spring Harbor Lab., ColdSpring Harbor, NY).

8. Ludwig, S. R., Habera, L. F., Dellaporta, S. L. & Wessler,S. R. (1989) Proc. Natl. Acad. Sci. USA 86, 7092-7096.

9. Goldschmidt-Clermont, M. (1991) Nucleic Acids Res. 19,4083-4089.

10. Salvador, M. L., Klein, U. & Bogorad, L. (1993) Plant J., inpress.

11. Dron, M., Rahire, M. & Rochaix, J.-D. (1982) J. Mol. Biol. 162,775-793.

12. Leu, S., White, D. & Michaels, A. (1990) Biochim. Biophys.Acta 1049, 311-317.

13. Hollingshead, S. & Vapnek, D. (1985) Plasmid 13, 17-30.14. Baker, E. J., Schloss, J. A. & Rosenbaum, J. L. (1984) J. Cell

Biol. 99, 2074-2081.15. Klaff, P. & Gruissem, W. (1991) Plant Cell 3, 517-529.16. Mohamed, A. & Jansson, C. (1991) Plant Mol. Biol. 16,

891-897.17. Fritz, C. C., Herget, T., Wolter, F. P., Scheli, J. & Schreier,

P. H. (1991) Proc. Natl. Acad. Sci. USA 88, 4458-4462.18. Atwater, J. A., Wisdom, R. & Verma, I. M. (1990) Annu. Rev.

Genet. 24, 519-541.19. Kuchka, M. R., Goldschmidt-Clermont, M., van Dillewijn, J.

& Rochaix, J.-D. (1989) Cell 58, 869-876.20. Rochaix, J.-D., Kuchka, M., Mayfield, S., Schirmer-Rahire,

M., Girard-Bascou, J. & Bennoun, P. (1989) EMBO J. 8,1013-1021.

21. Sieburth, L. E., Berry-Lowe, S. & Schmidt, G. W. (1991)Plant Cell 3, 175-189.

22. Drapier, D., Girard-Bascou, J. & Woliman, F.-A. (1992) PlantCell 4, 283-295.

23. Monod, C., Goldschmidt-Clermont, M. & Rochaix, J.-D. (1992)Mol. Gen. Genet. 231, 449-459.

24. Stem, D. B. & Gruissem, W. (1987) Cell 51, 1145-1157.25. Stem, D. B., Jones, H. & Gruissem, W. (1989) J. Biol. Chem.

264, 18742-18750.26. Nickelsen, J. & Link, G. (1989) Nucleic Acids Res. 17, 9637-

9648.27. Nickelsen, J. & Link, G. (1991) Mol. Gen. Genet. 228, 89-96.28. Schuster, G. & Gruissem, W. (1991) EMBO J. 10, 1493-1502.29. Hsu-Ching, C. & Stem, D. B. (1991) Mol. Cell. Biol. 11,

4380-4388.30. Blowers, A. D., Klein, U., Ellmore, G. S. & Bogorad, L.

(1993) Mol. Gen. Genet., in press.

Proc. Natl. Acad Sci. USA 90 (1993)

Dow

nloa

ded

by g

uest

on

Apr

il 4,

202

1