Altering metal selectivity of cobaltochelatase CbiXS from Methanosarcina barkeri by

a new structure-guided method of protein evolution introducing insertions and

deletions

Alexander Pisarchik

Corresponding author

Alexander Pisarchik

E-mail: pisarchik@yahoo.com

Phone: 1-650-307-4940

Keywords: Directed Evolution, CbiX, chelatase, metal selectivity, metal specificity,

isertions, deletions

Abstract.

Tetrapyrroles are a group of structurally related molecules that differ in the nature

of the centrally chelated metal ion. Although the mechanism of tetrapyrrole metalation is

generally understood, the mechanism of metal specificity and selectivity remains unclear.

It is also unknown how different chelatases evolve new metal preferences.

Here we characterize metal specificity and selectivity of CbiXS cobaltochelatase

from Methanosarcina barkeri, which is believed to be similar to the primordial

chelatases. Three areas of CbiX chelatase surrounding the main metal coordinating site

were mutated by a novel structure-guided method of in vitro evolution, which introduce

targeted substitutions, deletions and insertions. Mutants of the third alpha helix

demonstrated certain structural constraints characteristic to the p-helix, which are

important for channeling metal ions to the chelatase active site. Metal selectivity was

reversed in three CbiX variants harboring deletion of 2 amino acids in the third protein

loop. While wild type chelatase preferentially inserted Co2+, while these three mutants

inserted Fe2+. This data demostrates that introduction of insertions and deletions is a wery

a powerful way of protein evolution. Unfortunatly these type of mutations are mostly

ignored by protein engineers.

Introduction.

Many key biochemical processes such as oxygen transport, photosynthesis,

respiration, sulfur and nitrogen metabolism depend on metalated tetrapyrroles as protein

cofactors and prosthetic groups. Insertion of metals in tetrapyrroles is catalyzed by a

diverse group of enzymes called chelatases. Recently chelatases were divided in several

classes (1). Class I chelatases require three subunits for activity and utilize ATP, while

class II chelatases tend to exist as monomers or homodimers and do not require ATP.

Members of class II include protoporphyrin ferrochelatase, HemH, (2), sirohydrochlorin

ferrochelatase SirB (3,4) and sirohydrochlorin cobaltochelatases CbiK (5), CbiXL and

CbiXS (1). CbiXS are the smallest chelatases known with a single a/b domain (1). Other

class II chelatases (CbiK, CbiXL and HemH) have two such domains. These chelatases

are proposed to arise from CbiXS-type proteins by gene duplication {Yin, 2006 #43}. All

these features make CbiXS chelatases an attractive model for studying the evolution of

protein functions.

One protein function that is not completely understood is the mechanism of metal

selectivity, which leads to the preferential insertion of one particular metal ion into the

porphyrin ring. General mechanism of chelatase-mediate metal insertion has been

extensively studied (6,7,8). It involves distortion of the porphyrin ring and insertion of

the metal ion, which is coordinated by several residues (9). These metal coordinating

residues vary in different chelatase. In Hem H ferrochelatases ion is coordinated by

histidine and glutamate (His 183 and Glu264 from Bacillus subtilis) (10-14). In CbiK,

CbiX cobaltochelatases and SirB ferrochelatases metal is coordinated by two histidines

(4,5,15) Despite identical metal-coordinating residues, CbiK, CbiX and SirB chelatases

have different metal selectivity. All these chelatases can insert both cobalt and iron, but

CbiK and CbiX chelatases have higher selectivity for cobalt making Co-sirohydrochlorin,

while SirB chelatase prefers iron and produces Fe-sirohydrochlorin (siroheme) (16).

Thus, chelatase metal selectivity must be determined by other residues, not only those

directly involved in metal coordination. In this paper we tried to address this hypothesis

by applying point mutagenesis and in vitro evolution to CbiXS cobaltochelatase from

Methanosarcina barkeri. We mutated three regions of the CbiX protein surrounding the

metal-binding site by a novel method of directed evolution, capable of introducing point

mutations and gene rearrangements (deletions and duplications). We were able to

generate three mutant proteins with an altered metal selectivity. These enzymes

preferentially inserted Fe2+ even when they were incubated with a mixture of different

metals. Higher affinity for Fe2+ was achieved by an increase of Km for Co2+ or/and a

decrease of Km for Fe2+. All mutants with a shift in metal selectivity contained multiple

mutations in the third loop, which points to the importance of this region for metal

specificity and selectivity.

Results.

Siroheme, which is created by insertion of Fe2+ in sirohydrochlorin, is a prosthetic

group of sulfite reductase required for cysteine biosynthesis. Deletion of sirohydrochlorin

ferrochelatase leads to the cysteine auxotrophy; however CbiX chelatases can restore

cystein biosynthesis. These chelatases insert both Fe2+ and Co2+ in sirohydrochlorin and

have higher affinity for cobalt. If cobalt is present in the incubation media, it inhibits

bacteria’s growth by reducing formation of the siroheme. We used sirohydrochlorin

ferrochelatase deficient (DCysG) strain of E.coli to select functional CbiX mutants and

test their metal selectivity by growing them in the presence of cobalt.

Site-Directed mutagenesis.

Previously, metal selectivity of another sirohydrochlorin chelatase CbiK was

modulated by alanine mutations of two major metal coordinating histidines (His145 and

His207) (5). Similar mutations of the CbiX histidines His12 and His78 did not alter metal

selectivity. Mutation H12A completely abolished ferrochelatase activity resulting in a

clone that could not grow in M9 media. Replacement of the histidines with glutamic acid

(Table 1, mutants H12E and H78E), which makes metal coordinating center similar to the

HemH ferrochelatase (10-14) also failed to change metal selectivity.

Next, we tried an alanine scanning mutagenesis of the charged CbiX residues. We

substituted majority of charged residues (25 out of 32) with alanine and tested growth of

the mutants in minimal media (Table 1) and tested enzyme activity with cobalt in vitro

(data not shown). If we find a mutant with altered specificity towards just one metal ion,

it would point at this residue as a major contributor to the metal selectivity.

Unfortunately, we were not able to change metal selectivity by single mutations. Ferro-

and cobaltochelatase activities were changing in a concerted fashion. Mutants with the

decreased ferrochelatase activity and slower growth in M9 media (Table 1, mutants

S14A, F72A, H78A) also showed reduced in vitro activity with cobalt (data not shown).

The H12A mutant that couldn’t grow in the minimal media (Table 1, mutant H12A) also

did not show any chelatase activity with cobalt.

Structure-guided protein evolution

Because of our failure to modify CbiX metal selectivity by alanine mutagenesis,

we decided to try directed evolution. Unfortunately, none of the existing methods of

directed evolution gives sufficient control over nature and location of the introduced

mutations. Therefore, we designed our own method. Its main principle is to target

mutations to the most crucial protein regions, especially loops, which in contrast to the

secondary structures are known to be highly tolerant to various mutations and protein

rearrangements {Ladant, 1992 #46}{Pascarella, 1992 #47}. The details of the method are

described in the Materials and Methods section (Fig.2). Briefly, CbiX gene is split in two

segments. Every segment is amplified by PCR. Random in-frame deletions and

duplications are generated, when the left and the right half of the gene are ligated

together. Substitutions are introduced by degenerate nucleotides at the first codon

position. Degeneracy at the first codon position generates highly diverse libraries, which

also have small size. For example, randomizing 5 residues by this method gives a library

of about 1000 clones (45=1024), which is significantly lower then 3 million variants

produced by the (NNN)5 sequence (205=3,200,000).

We created three libraries of CbiX mutants each targeting a different region of

CbiX chelatase: loop 1, loop 3 and alpha helixes 3 and 4, surrounding histidines 12 and

78, which are the main metal-coordinating residues (Fig.1). Targeting mutations to these

regions gave us higher chances of success since residues located in the first of second

metal coordinating spheres are more likely to influence metal binding (25). Mutants were

named according to the mutated region. Abbreviation “L” means that mutations resided

in the loop area and “A” means that they were located in the helix region.

Targeted regions were mutated individually. Each library contained around 4000

clones (naïve library) and the ratio of functional clones was different for every region.

For example, library of loop 1 mutants produced around 100 clones growing in M9

media. Sequencing of the 7 clones revealed that only one clone was a real mutant (mutant

L1, Fig.3), while others contained wild type sequence. The library of loop 3 mutants

contained 25 clones growing in M9 and more then half of these clones were real mutants

(mutants L2-L18, Fig.3). A similar situation was observed for the library of alpha helices

3 and 4 (mutants A1-A8, Fig.3).

We also attempted to increase diversity of our library by combining mutations

from different clones. Three targeted areas were amplified from different libraries and

recombined by extension PCR. Around twenty clones from a naïve library of 2000 clones

were able to grow on M9 plates. Surprisingly, just two clones out of 10 sequenced clones

were real recombinants (L3A1 and L4A1). Both of them have an identical alpha helix

region coming from the A1 mutant (Fig.3).

Active Clones

Analysis of the clones that could grow in minimal media reveals several important

features related to the histidines directly involved in metal coordination. His12 is located

in the first loop of the CbiX chelatase. It is conserved in most known chelatases and

alanine mutation leads to a complete inactivation of the protein (Table 1). Interestingly,

the only mutant we have generated in this region (fig.3, mutant L1) did not have that

histidine. However, it had two arginines, meaning that His12 was not absolutely required

for protein activity but could be replaced by another charged residue (arginine) without

complete loss of function.

The opposite situation was observed for the alpha helix region, containing the

second invariant histidine (His78). This histidine appears more tolerant to mutations since

alanine mutation (Table 1, mutant H78A) has some residual activity, but all eight clones

harboring mutations in the helix region preserved this histidine.

Mutations located in the alpha helix region also showed some other interesting

features. For example, Lys81 was replaced ether by histidine or arginine meaning that the

positive charge at this position was important for protein function. Five out of 8 mutants

(Fig.3, mutants A1, A3-5, A7) also contained another positively charged residue located

approximately 2 aa downstream. Length of this region also appeared to have some

constraints with five out of eight mutants having the same number of amino acids as the

wild type protein (Fig.3, mutants A1-3, A5, A6) and only three mutants having one

residue deletion (Fig.3, mutants A4, A7, A8).

The third loop of the CbiX protein turned to be more tolerant to various

rearrangements. The shortest mutant had 4 aa deletion (Fig.3, mutant L7), while the

longest one was 6 aa longer than the wild type (Fig.3, mutant L4A1). Fifteen out of

seventeen mutants preserved serine Ser47 of the wild-type protein indicating that it is

important for the protein function (Fig.3, mutants L2-L14, L16, L18).

Mutants with altered metal selectivity

The clones able to grow on minimal plates were further grown in liquid M9 media

with cobalt chloride. Three clones harboring mutations in the third loop were able to

grow in this media meaning that they might have higher iron selectivity (Fig.3, mutants

L2, L3 and L4).

As mentioned earlier clones L3A1 and L4A1 were created by combining several

mutations from different regions: loop 3 and alpha helixes 3 and 4. To find out which of

the regions determine cobalt tolerance we tested every mutation individually. Mutants L3

and L4 showed a growth pattern similar to the parental clones L3A1 and L4A1 (Fig.3),

while L1 mutant did not show any tolerance to cobalt, which means that metal specificity

was determined by third loop of the CbiX protein (Fig.3, mutants L3, L4).

Analysis of the third loop of these proteins revealed several interesting features.

Clones L2 and L3 (or L3A1) had a very similar sequence of this region with almost

identical patterns of hydrophobic and hydrophilic residues. Both clones had a negatively

charged residue (glutamic or aspartic acid) located at the same position and a deletion of

two polar residues (asparagine and cysteine). Sequence of the L4A1 clone was

completely different. The third loop of this clone was the longest among all clones. It did

not have any negatively charged residues, but instead had a single positively charged

regidue (arginine).

Metal selectivity

As a next step, we checked the metal selectivity of the mutant proteins. We

purified proteins by metal affinity chromatography and checked which metal is

preferentially inserted (Fe2+ or Co2+) by measuring absorbance spectrum. The spectrum

of sirohydrochlorin has a maximum absorbance peak at 376 nm (23), if cobalt is inserted

the absorbance peak is at 414 nm (23) and if iron is inserted it is at 392 nm (24) (Fig.4).

When wild type CbiX protein was exposed to the mixture of Co2+ and Fe2+ (20

µM each) it inserted only cobalt (Fig.4). Most mutant proteins (like L5 and L6 in Fig.4)

also inserted cobalt preferentially (Fig.4). Only clones L2, L3A1, L3, L4A1 and l4 had

high iron selectivity. These clones showed some cobalt insertion, which was detected by

an increase of absorbance at 414 nm, but the major product had an absorbance maxima at

392 nm (Fig.4). Several other chelatases produced a spectrum with an absorbance peak at

392 nm and a broad shoulder at 414 nm that belong to Co-sirohydrochlorin (Fig.4, L10,

A1). These chelatases may not be very efficient in discriminating between different

metals, so affinity of these enzymes to Fe2+ may not be high enough to avoid inhibition

by cobalt.

Kinetics of metal insertion for the mutants with altered metal selectivity

Wild-type chelatase and the mutant proteins with altered metal selectivity were

purified and the kinetics of metal insertion was measured. Mutants L3 and L3A1 showed

a significant increase of Km for cobalt, while Km for iron remained unchanged (Table 2).

It means that increased iron selectivity is achieved by a lower cobalt binding. Quite

opposite effect was observed for L4 and L4A1 mutants: while Km for Fe2+ was lower

than in the wild type, Km for Co2+ remained unchanged (Table 2).

Mutant L2 showed an increase on Km for cobalt and a slight decrease of Km for

iron (Table 2). It was also the fastest growing clone in cobalt-containing media (Fig.3)

and the enhanced iron selectivity of this mutant could be explained by simultaneous

change of catalytic constants for both metals.

Discussion.

Despite the relatively well-studied mechanism of porphyrin metalation () the

nature of metal specificity and selectivity of chelatases remains largely unknown. Metal

selectivity is a result of interplay between the nature of metal, porphyrin substrate and the

enzyme itself. As evident from the order of the non-enzymatic porphyrin metalation:

Cu2+> Zn2+> Mn2+> Co2+> Fe2+> Ni2+> Cd2+> Mg2+ {Hambright, 1974 #171}, different

metals are inserted with different efficiencies. Shen and Ryde (18) showed that Mg2+ has

a lower affinity for porphyrin and stronger affinity for water, while Fe2+ is more likely to

form interactions with the porphyrin. The predicted structure of Fe-porphyrin complex

includes two water molecules and four interactions with porphyrin. For Mg2+ complex

formation of the first bond between metal and porphyrin is the most energy-demanding

step. (19). This high energy cost may also explain why Mg2+ chelatase consists of three

subunits and utilizes ATP (20), while class II chelatases inserting Co2+ and Fe2+ have one

subunit and don’t require ATP.

The nature of the porphyrin substrate is another part of the equation. It may

explain high energy requirements of another class I chelatase: aerobic cobaltochelatase.

This chelatase contain three subunits and require ATP hydrolysis (21). Its substrate

(hydrogenobyrinic acid a,c-diamide) has one of the carbons removed from the ring

through the process of ring contraction (21). The molecule may therefore be stiffer and

less tolerant to distortion by the chelatase.

Nature of the substrate may also explain different specificity of HemH

ferrochelatase towards Cu2+ and Zn2+ (22). Metalation of N-MeMP by Cu2+ was more

efficient than that by Zn2+. At the same time, Michaelis constant for metalation of

protoporphyrin IX by Zn2+ (17µM) is lower than for Cu2+ (170 µM) (22). Size of the hole

in the porphyrin ring was proposed to control metal specificity, which depended on the

type of porphyrin distortion by the chelatase.

The last but not least part of the metal selectivity enigma is the nature of the

chelatase itself. In studies of the chelatases, the most attention is usually paid to the main

metal-binding residues because they are easy to find and because they play the major role

in the porphyrin metalation. They may also have some effect on metal selectivity. For

example, metal specificity of CbiK was previously changed by alanine mutations of the

primary metal coordinating histidines (H145A and H207A). These mutants

complemented cysG deletion in the presence of cobalt, presumably due to the lower

specificity for cobalt (5). We created identical mutations in the CbiX chelatase (H12A

and H78A), but we did not see any changes in the metal selectivity. We also tried to

recreate the metal binding site of iron-specific chelatase (HemH ferrochelatase) (10-14)

by designing H12E and H78E mutations. These mutants did not tolerate cobalt better than

the wild type protein, meaning that replacement of the histidine by glutamate doesn’t lead

to a higher Fe2+ selectivity of CbiX chelatase. It also means that His12 and His78

residues are absolutely required for metal coordination, but the selectivity and specificity

are determined by other protein residues.

There is also a possibility that specificity-determining residues could be different

for different metals. For example, there is evidence that some chelatases have several

metal binding sites. HemH ferrochelatase inserts Fe2+, Zn2+ and Cu2+ into protoporphyrin

IX (35). These metals are coordinated by the invariant residues His183 and Glu264 (14).

Another site is located 7A from His183 and binds Mg2+, which has a stimulatory role

(14). In CbiK and CbiX chelatases ion and cobalt are assumed to bind to the same site

(16). To verify that we performed alanine scanning mutagenesis of the charged residues,

which are most likely to be involved in metal coordination. If chelatase selectivity is

determined by different metal-binding sites, mutating individual residues will change

metal specificity independently for each metal. If metals are bound to the same site,

mutations will change metal specificity in a concerted fashion. We found that none of our

alanine mutants could grow in the M9 media containing cobalt, which would be expected

for a mutant with high iron selectivity. Some mutants, especially those having mutations

close to the metal binding site (Table 1, mutants H12A, H78A, F43A, S14A), showed a

decrease of ferrochelatase activity, which was accompanied by lower cobaltochelatase

activity in vitro, supporting the assumption that Fe2+ and Co2+ bind to the same metal-

binding site.

Therefore protein metal selectivity is a feature that can not be easily changed by a

single amino acid mutation. Due to the indefinite number of possible amino acid

substitutions, rational protein engineering is not likely to find the right combination of

mutations needed to change metal selectivity. The best solution in this situation is to use

directed evolution. Unfortunately, none of the methods of directed evolution is perfect for

creating targeted synergistic mutations. Methods like ITCHY (26) SCRATCHY (27),

SHIPREC (28) and Nonhomologous Random recombination (NRR) (29,30) introduces

lots of frame-shift mutations, error-prone PCR is not targeted and do not genetare

insertions and deletions, gene shuffling tends to have a high background of the wild type

sequences (31). So we designed a novel method of Targeted Directed Evolution, which

was able to create highly diverse library by introducing deletions, insertions and

substitutions. This method is partially based on gene synthesis and gives a good control

over the nature of the introduced mutations, it does not generate stop codons and created

highly-diverse library of small size. The design of the library by this method is based on

the protein structure, which helps avoid meaningless mutations leading to the protein

misfolding and aggregation. It increases the meaningful libraty diversity and improves

protein expression. We used this method to target mutations to the three specific regions

of CbiX chelatase surrounding main metal coordinating residues (His12 and His78): loop

1, loop 3 and alpha helixes 3 and 4 (Fig.1).

Mutation of loop 1 generated a single clone, which had histidines His12 replaced

by arginine (Fig.1). Histidine His12 is one of two main metal coordinating residues and

occupies position equivalent to the His145 of CbiK cobaltochelatase (5) and His183 of

HemH ferrochelatase (10,11). This residue seemed indispensable for protein function

since H12A mutation leads to a complete protein inactivation (Table 1). But substitution

of histidine by arginine, as well as introducing other mutations in the third loop preserved

some residual enzymatic activity. This data demonstrates that even the most critical

residues can be replaced. The nature of the substitution could be one of the reasons, why

the mutant enzyme preserves some residual activity. Histidine and arginine are both

positively charged residues and therefore positive charge could be important for the

activity. But arginie substitution was not the only one. The whole loop sequence was

completely changed. Other mutation may have also modified metal affinity, but this

hypothesis still have to be verified.

Mutations in the helix region (Fig. A1-A) of CbiX demonstrated very interesting

features. The third helix of CbiX chelatase corresponds to the so-called p-helix of HemH.

p-helix residues were proposed to serve as a channel for the metal ions connecting the

interior of the active site to the protein exterior (34,14). p-helixes have 4.4 residues per

turn, implying that every fourth residue is in almost azimuthal position with respect to the

first, making a channel for the ions. p-helixes also have a characteristic amino acid

distribution with small amino acids (Ala, Gly and Pro) usually avoided in favor of

aromatic and large aliphatic amino acids (Ile, Leu, Tyr, Trp, Phe, His and Asn) and polar

residues (Asn, Glu, Thr and Ser) (34). The mutants of the alpha helixes 3 and 4 have

several features that could be explained only by p-helix structural constrains. All clones

have at least one positively charged residue preserved (Lys, His, Arg) corresponding to

the Lys81 of the wild type sequence (Fig.3). Five out of 8 mutants also contain another

positively charged residue. The distance between these charged residues is usually 2

amino acids, and the amino acid distribution is also similar to p-helixes. Involvement of

the p-helix in channeling metal ions to the active site was speculative so far. Our data

clearly shows that this protein region has severe structural constrains which are obviously

imposed by its important function. Since none of the mutants we have got changed metal

selectivity, this region may have no metal preferences.

Clones harboring mutations in the third loop of CbiX showed the most striking

results. Three mutants were able to tolerated cobalt much better than the wild type

chelatase. These clones were able to grow in the minimal media containing 0.1 mM

cobalt, which is 20 times more than the cobalt concentration used previously (16).

Mutants also showed reverted metal selectivity. When challenged with an equal amount

of Co2+ and Fe2+, they preferentially inserted iron, while wild type chelatase inserted

cobalt (Fig.4). The mutants can be split in two classes according to their sequence and

kinetic constants. Class I mutants (L2, L3A1) have a deletion of two polar residues

(asparagine and cysteine) at the N-terminal side of the loop. They preserve a negatively

charged residue (glutamic or aspartic acid). Both mutants achieve higher Fe2+ selectivity

by an increase of Km for cobalt (Table 2). The sequence of the Class II mutant (L4A1) is

completely different from clones L2 and L3. This mutant has the longest loop. It has

multiple polar residues and only one charged residue (arginine). This clone doesn’t show

any changes in affinity for cobalt. Instead it has a decrease of Km for Fe2+ (Table 2).

Thus the metal selectivity of CbiX chelatase was found to be determined by the

residues other then those directly involved in metal coordination. It was changed by

introducing multiple targeted mutations in a single protein loop pointing at high ability of

CbiXS chelatases to develop new properties. Such ability to develop new functions

(evolvability) was recently suggested as an important feature of natural evolution

{O'Loughlin T, 2006 #44}. Proteins that can easily change their properties were proposed

to play the major role in the response of the organisms to the rapidly changing

environment and its survival. Therefore, the best targets of the directed evolution

experiments are highly evolvable enzymes like archaeal CbiXS chelatases that can have

their properties changed by few strategically-located mutations.

Materials and Methods.

Chemicals and reagents. Porphobilinogen was purchased from Porphyrin Products

Inc.; restriction and modification enzymes were purchased from MBI Fermentas, Vent

DNA polymerase was purchased from New England Biolabs, Nickel-NTA resin and gel

filtration columns were from Amersham Biosciences, medium components from Fisher

Scientific and oligonucleotide primers were from Integrated DNA Technologies.

Bacterial strain, media and growth conditions. CysG deletion strain E. coli JM109

was created according to the method described by Datsenko and Wannert {Datsenko,

2000 #48} E. coli RP1 it was used for cloning, over-expression of proteins for metal

affinity chromatography and complementation experiments..

For complementation experiments, E. coli DcysG transformants were grown overnight

in LB supplemented with 100 µg/l of ampicillin at 37°C. 0.5 ml of the overnight culture

was pelleted and resuspended in M9 medium three times (NaCl 0.5 g/l, Na2HPO4 6 g/l,

KH2PO4 3g/l, NH4Cl 1 g/l, glucose 2 g/l, MgSO4 2mM, CaCl2 0.1 mM). Washed cells

were resuspended in 0.1 ml of M9 medium and inoculated in 4 ml of M9 medium

supplemented with 0.1 mg/l of ampicillin and 0.1 mM CoCl2. Tubes were shaken at 30oC.

Cloning, plasmid construction and cbiX protein purification.

Three enzymatic steps are required to complement CysG deletion in E. coli. Uro’gen

III has to be methylated to precorin-2, oxidized to sirohydrochlorin, which is used to

insert iron. Methylation can be catalyzed CysGa, which is a truncated variant of CysG

protein (C-terminal residues 203-457) {Fazzio, 1996 #49}. Precorrin-2 is oxidized to

sirohydrochlorin in E. coli spontaneously {Raux, 2003 #4} {Leech, 2002 #50}. The

metalation step is catalyzed by CbiX chelatase.

We used pUC-cysGa-L1 plasmid to create CbiX libraries. This plasmid contained a

cysGa and a multiple cloning site, which we used to insert CbiX variants. These two genes

were sufficient to complement CysG deficiency in E.coli. Truncated cysG variant cysGa

was amplified from genomic DNA of E. coli JM109 and cloned into pUCmod {Schmidt-

Dannert, 2000 #51}. The region downstream of the cysGa gene was then replaced with a

new multiple cloning site (SmaI, PstI, HindIII, XhoI, EcoRI, and NotI). CbiXS gene from

Methanosarcina barkeri (GeneBank accession #NZ_AAAR01001953) was synthesized

as a set of 45 bp long overlapping oligonucleotides and assembled together by

overlapping PCR

All chelatases were synthesized with a 6xHis tag attached to the C-terminal end of the

protein. CbiX proteins were purified by metal chelate affinity chromatography on

TALON resin (Amersham Biosciences) according to the manufacture’s protocol.

Library construction.

Three different regions of cbiX (loop 1, loop 3 and alpha helixes 3 and 4) were chosen

on the basis of their proximity to the metal-binding site. Residues His12 and His78 are

the main metal-coordinating residues (Fig.1).

Fig.2 gives an overview of the method with the third loop as an example. CbiX gene

was separated by PCR in two fragments. The first fragment of the gene was amplified by

a single forward primer and a set of reverse primers, which anneal to the region adjacent

to the targeted area. These primers contain an overhanging sequence with a varying

number of codons with one degenerate nucleotide and a restriction site. (Fig.2) The

second fragment of the gene was amplified using single reverse primer and a set of

forward primers designed similarly to the primers described above.

Amplification was done by Taq DNA polymerase (Promega) by heating at 95oC for 2.5

min followed by 30 cycles of denaturation at 94oC for 15 s, annealing at 55oC for 15 s

and extension at 72oC for 40 sec.

Amplifications were pooled together, purified by QIAGEN PCR purification kit and

digested with the appropriate restriction enzyme: NarI restriction site was introduced in

loop 1 mutant library, NheI in loop 3 mutants and Mph1103I in alpha helixes 3 and 4

mutants.

The products were ligated and amplified with flanking primers containing HindIII and

XhoI sites. PCR products were gel-purified, digested with HindIII, and XhoI and ligated

into pUC-cysGa-L1 (also cut with HindIII and XhoI). The resulting cbiXS library was

transformed into electrocompetent rcysG E. coli strain. Transformed cells were allowed

to recover in 1 ml of SOC medium at 37oC for 1.5 hours before being washed with M9

medium and plated on LB (naïve library) or M9 agar plates containing 100 µg/l

ampicillin (selected library).

Library of mutants with several mutated regions. Mutations located in the same

region were pooled together and amplified with the flanking primer and a primer located

between mutated regions. Amplification was done by Vent DNA polymerase (New

England Biolabs) by heating at 95oC for 2.5 min followed by 30 cycles of denaturation at

94oC for 15 s, annealing at 55oC for 15 s and extension at 72oC for 40 sec. PCR products

were resolved in 1% agarose gels and purified by QIAGEN Gel Extraction kit. Purified

DNA was mixed together and the full-length gene was amplified in one round of

extension PCR. Primers P2364 through P2367 were used to amplify fragments of the

gene for extention PCR. Primers P2364 (forward) GCACGTAAACATTCTGATGTG

and P2365 (reverse) CACATCAGAATGTTTACGTGC were located between loop 1 and

loop 3; and primers P2366 (forward) ACCAAAATTGCAGCAGTGCCA and P2367

(reverse) TGGCACTGCTGCAATTTTGGT were located between loop 3 and helix 3.

Sirohydrochlorin synthesis.

Sirochydrochlorin was generated as described in {Schubert, 2002 #18} by incubating

porphobilinogen with porphobilinogen deaminase (hemC), uroporphyrinogen III synthase

(hemD), uroporphyrinogen III methyltransferase (ylnD), and precorrin-2 dehydrogenase

(ylnF). YlnD and ylnF genes were cloned from B.subtilis. All genes were cloned in

pUCmod {Schmidt-Dannert, 2000 #51}. Cells were grown 24 hours at 30oC, spinned

down and suspended in the solution containing 50 mM Tris and 50 mM NaCl. Cell were

sonicated and the lysate was cleared by centrifugation at 12000 rpm in Beckman JA-17

rotor. This crude extract was used for sirochydrochlorin synthesis. Porphobilinogen

deaminase (hemC), uroporphyrinogen III synthase (hemD), uroporphyrinogen III

methyltransferase, and precorrin-2 dehydrogenase were incubated in 50 mM Tris-HCl

(pH 8.0) containing 10 mg of orphobilinogen, 0.375 µg/ml of S-adenosyl-L-methionine

and 0.25 µg/ml of NAD+.

Kinetic assays. Chelatase activity was measured by monitoring the disappearance of

sirohydrochlorin (lmax 376 nm) in the reaction volume of 1ml at 25°C by Ultrospec

3300pro spectrophotometer (Amersham Biosciences). Sirohydrochlorin (2.5 µM) was

added to the Tris-HCl buffer (50 mM pH 8) with and various concentrations of metals

(Co2+ or Fe2+; 0.1-20 µM) in anaerobic conditions. The reaction was started by addition

of 5 to 200µg of the purified CbiX proteins.

Metal competition Assays.

Mutant chelatases were purified by metal affinity chromatography and incubated with

the mixture of Co2+ and Fe2+ ions (20 µM each). Reaction mixture was identical to the

kinetic assays. The mix was incubated 5 min at 25 °C and the absorbance spectrum was

recorded by the Ultrospec 3300pro.

References

1. Brindley, A. A., Raux, E., Leech, H. K., Schubert, H. L., and Warren, M. J.

(2003) J Biol Chem 278(25), 22388-22395

2. Dailey, H. A., Dailey, T. A., Wu, C. K., Medlock, A. E., Wang, K. F., Rose, J. P.,

and Wang, B. C. (2000) Cell Mol Life Sci 57(13-14), 1909-1926

3. Raux, E., Leech, H. K., Beck, R., Schubert, H. L., Santander, P. J., Roessner, C.

A., Scott, A. I., Martens, J. H., Jahn, D., Thermes, C., Rambach, A., and Warren,

M. J. (2003) Biochem J 370(Pt 2), 505-516

4. Raux-Deery, E., Leech, H. K., Nakrieko, K. A., McLean, K. J., Munro, A. W.,

Heathcote, P., Rigby, S. E., Smith, A. G., and Warren, M. J. (2005) J Biol Chem

280(6), 4713-4721

5. Schubert, H. L., Raux, E., Wilson, K. S., and Warren, M. J. (1999) Biochemistry

38(33), 10660-10669

6. Romesberg, F. E., Santarsiero, B. D., Spiller, B., Yin, J., Barnes, D., Schultz, P.

G., and Stevens, R. C. (1998) Biochemistry 37(41), 14404-14409

7. Yin, J., Andryski, S. E., Beuscher, A. E. t., Stevens, R. C., and Schultz, P. G.

(2003) Proc Natl Acad Sci U S A 100(3), 856-861

8. Lecerof, D., Fodje, M., Hansson, A., Hansson, M., and Al-Karadaghi, S. (2000) J

Mol Biol 297(1), 221-232

9. Al-Karadaghi, S., Franco, R., Hansson, M., Shelnutt, J. A., Isaya, G., and Ferreira,

G. C. (2006) Trends Biochem Sci 31(3), 135-142

10. Kohno, H., Okuda, M., Furukawa, T., Tokunaga, R., and Taketani, S. (1994)

Biochim Biophys Acta 1209(1), 95-100

11. Gora, M., Grzybowska, E., Rytka, J., and Labbe-Bois, R. (1996) J Biol Chem

271(20), 11810-11816

12. Ferreira, G. C., Franco, R., Mangravita, A., and George, G. N. (2002)

Biochemistry 41(15), 4809-4818

13. Karlberg, T., Lecerof, D., Gora, M., Silvegren, G., Labbe-Bois, R., Hansson, M.,

and Al-Karadaghi, S. (2002) Biochemistry 41(46), 13499-13506

14. Lecerof, D., Fodje, M. N., Alvarez Leon, R., Olsson, U., Hansson, A.,

Sigfridsson, E., Ryde, U., Hansson, M., and Al-Karadaghi, S. (2003) J Biol Inorg

Chem 8(4), 452-458

15. Leech, H. K., Raux, E., McLean, K. J., Munro, A. W., Robinson, N. J., Borrelly,

G. P., Malten, M., Jahn, D., Rigby, S. E., Heathcote, P., and Warren, M. J. (2003)

J Biol Chem 278(43), 41900-41907

16. Raux, E., Thermes, C., Heathcote, P., Rambach, A., and Warren, M. J. (1997) J

Bacteriol 179(10), 3202-3212

17. Hambright, P., and Chock, P. B. (1974) J Am Chem Soc 96(10), 3123-3131

18. Shen, Y., and Ryde, U. (2004) J Inorg Biochem 98(5), 878-895

19. Shen, Y., and Ryde, U. (2005) Chemistry 11(5), 1549-1564

20. Walker, C. J., and Willows, R. D. (1997) Biochem J 327 ( Pt 2), 321-333

21. Heldt, D., Lawrence, A. D., Lindenmeyer, M., Deery, E., Heathcote, P., Rigby, S.

E., and Warren, M. J. (2005) Biochem Soc Trans 33(Pt 4), 815-819

22. Shipovskov, S., Karlberg, T., Fodje, M., Hansson, M. D., Ferreira, G. C.,

Hansson, M., Reimann, C. T., and Al-Karadaghi, S. (2005) J Mol Biol 352(5),

1081-1090

23. Schubert, H. L., Raux, E., Brindley, A. A., Leech, H. K., Wilson, K. S., Hill, C.

P., and Warren, M. J. (2002) Embo J 21(9), 2068-2075

24. Murphy, M. J., and Siegel, L. M. (1973) J Biol Chem 248(19), 6911-6919

25. Hellinga, H. W. (1996) Curr Opin Biotechnol 7(4), 437-441

26. Ostermeier, M., Shim, J. H., and Benkovic, S. J. (1999) Nat Biotechnol 17(12),

1205-1209

27. Lutz, S., Ostermeier, M., Moore, G. L., Maranas, C. D., and Benkovic, S. J.

(2001) Proc Natl Acad Sci U S A 98(20), 11248-11253

28. Sieber, V., Martinez, C. A., and Arnold, F. H. (2001) Nat Biotechnol 19(5), 456-

460

29. Bittker, J. A., Le, B. V., and Liu, D. R. (2002) Nat Biotechnol 20(10), 1024-1029

30. Bittker, J. A., Le, B. V., Liu, J. M., and Liu, D. R. (2004) Proc Natl Acad Sci U S

A 101(18), 7011-7016

31. Stemmer, W. P. (1994) Proc Natl Acad Sci U S A 91(22), 10747-10751

32. Chopra, S., and Ranganathan, A. (2003) Chem Biol 10(10), 917-926

33. Rao, A., Chopra, S., Ram, G., Gupta, A., and Ranganathan, A. (2005) J Biol

Chem 280(25), 23605-23614

34. Fodje, M. N., and Al-Karadaghi, S. (2002) Protein Eng 15(5), 353-358

35. Hansson, M., and Hederstedt, L. (1994) Eur J Biochem 220(1), 201-208

36. Datsenko, K. A., and Wanner, B. L. (2000) Proc Natl Acad Sci U S A 97(12),

6640-6645

Fig.1. Structure of the CbiX chelatase featuring the metal coordinating residues

(H12 and H78). Mutated regions are shown in red (loop 1, loop 3 and alpha helixes 3 and

4).

Fig.2. Scheme of the method. Two parts of the gene are amplified separately with

flanking primer and a set of degenerate primers. PCR products are digested with

appropriate restriction enzyme, ligated, re-amplified with the flanking primers and cloned

in the expression vector.

Mutant Loop 1 (NarI site)

Loop3 (NheI site)

Alpha helixes 3 and 4 (Mph1104I site)

Gro

wth

in

M9+

coba

lt

residue 11 22

residue 45 55

residue 77 88

WT G-HGSKLPYNKEV EN---SEP--T--LG--EA-I VHIT-KDIPR-IL-S - L1 RYRPQVPGT-K-V WT WT - L2 WT ----ASEP--S--LV--EA-K WT ++ L3A1 WT ----AS-L--T--L---DGVS MH-VAKDIPR-IL-S + L3 WT ----AS-L--T--L---DGVS WT + L4A1 WT –NC--SAPA-SICALTRGGVI MH-VAKDIPR-IL-S ± L4 WT –NC--SAPA-SICALTRGGVI WT ± L5 WT ----AS-L--S----R-DGAS WT - L6 WT ----ASGL--N----R-AAVI WT - L7 WT ----AS----------LAAAS WT - L8 WT -NC-ASGL--T----R-DGVI WT - L9 WT -NC-AS-L--SQ-----GAAI WT - L10 WT -NC-ASILA---------GAI WT - L11 WT -NC-ASKA--ST----LGGAI WT - L12 WT -NC-AS-L--T----R-GGAI WT - L13 WT -N--AS-L-------DAE--I WT - L14 WT -NC--SALGAS--------AT WT - L15 WT -NC--YALGAS--------VS WT - L16 WT -NC--SALGCY--------AS WT - L17 WT -NC--PALG--------CFAS WT - L18 WT NCCAASVL--T----RGEV-S WT - A1 WT WT MH-VAKDIPR-IL-S - A2 WT WT AHTT-KDIP--LIMH - A3 WT WT VHTNMH-VAR-VL-T - A4 WT WT AH-IMH-IAR-VLA- - A5 WT WT AH-IIR--MH-GFLS - A6 WT WT AHTIMH-IAC-ILA- - A7 WT WT AHII-R--MH-GFLS - A8 WT WT AHIM-H-IAC-ILA- -

Fig.3. Sequences of the mutants. Amino acids are color coded according to their

properties. Negatively charged residues are red, positively charged are blue, polar

residues are green and hydrophobic residues are black. WT corresponds to the wild type

sequence.

Fig.4. Absorption spectra of the metalated sirohydrochlorin produced by mutant

proteins incubated with a mixture of Co2+ and Fe2+ (blue line). Black, red and green lines

correspond to the sirohydrochlorin, cobalt-sirohydrochlorin and iron-sirohydrochlorin

(siroheme).

[First Authors Last Name] Page 33

[Insert Running title of <72 characters]

Tables. 1

Table 1 2

Complementation of DcysG deletion by cbiX point mutants 3

Mutations Growth in

M9 medium

Growth in M9 medium with 0.1mM CoCl2

H12A - - H12E ± - S14A ± - K15A +++ - Y18A +++ - K20A +++ - E21A +++ - D28A +++ - R32A +++ - K33A +++ - H34A +++ - D36A +++ - R40A +++ - F43A +++ - E48A +++ - E53A +++ - E56A +++ - K65A +++ - F72A ± - S75A +++ - H78A ± - H78E ± - K81A +++ - D82A +++ - R85A +++ - D90A +++ - E91A +++ - E98A +++ - D100A +++ - K102A +++ - D115A +++ - E116A +++ - 4

5

[First Authors Last Name] Page 34

[Insert Running title of <72 characters]

Table 2 1

Catalytic properties of cbiX mutants 2

Chelatase Cobalt Iron

Km [µM]

Vmax [nmol mg-1 min-1]

kkat [min-1]

Km [µM]

Vmax [nmol mg-1 min-1]

kkat [min-1]

Wild-type 0.66±0.17 159.71±46.48 2.38±0.69 0.85±0.28 11.05±4.14 0.18±0.06 L2 2.71±1.30 21.00±1.53 0.31±0.02 0.36±0.30 10.35±2.72 0.15±0.04 L3A1 2.32±0.29 32.84±3.32 0.48±0.05 0.84±0.12 4.75±1.04 0.07±0.02 L3 3.72±1.78 17.14±0.23 0.25±0.01 0.55±0.09 4.21±0.01 0.06±0.01 L4A1 0.56±0.05 12.20±3.06 0.18±0.04 0.15±0.11 17.45±8.37 0.26±0.12 L4 0.38±0.06 10.12±1.68 0.15±0.02 0.16±0.14 14.91±5.59 0.22±0.08 3