integration of paper-based nucleic acid testing methods ...€¦ · ipanema, online journal club 2,...

This project has received funding from the European Union’s Horizon 2020 research and innovation programme under the Marie Skłodowska-Curie grant agreement No 872662

Integration of PAper-based Nucleic acid testing mEthodsinto Microfluidic devices for improved biosensing Applications

DNA probes design and foodborne pathogen detection methods

Débora Albuquerque, Stefan Jarić, Ivana Podunavac, Kristina Živojević and Minja MladenovićINESC MN/BioSense Institute, Young Researchers

IPANEMA, Online Journal Club 2, April 30, 2020, Online video meeting

This project has received funding from the European Union’s

Horizon 2020 research and innovation programme under the

Marie Skłodowska-Curie grant agreement No 872662

Table of contents

DNA probes design

Electrochemical detection:

• Cyclic voltammetry

• Square-wave voltammetry

• Differential pulse voltammetry

• Impedimetric detection

Optical detection

• OLED method

• SPR method

• Colorimetry

• DNAzyme probe-based fluorescent detection




DNA ProbesWhat are they and why do we use them?

DNA probes are stretches of single-stranded DNA used to detect the presence of complementary nucleic acid sequences byhybridization. DNA probes are usually labelled (e.g. radioisotopes, epitopes, biotin or fluorophores) to enable their

detection.

o Excessive time o Expert personnelo Expensive equipmento Not suitable for in field diagnostics

Culture, plate count, isolation, and identification

by biochemical methods

o Can be expensiveo Show less sensitivity when

compared to DNA assayso High cross-reactivity overall

Immunoassays of pathogen-specific antigens

or antibodies

Detection of pathogen-specific DNA or RNA in specimens

o Extensive sample processing o Expensive laboratory-based

equipment o Easily inhibited by

contaminants

o High specificity: Detection of microorganisms down to strain level

o Fast (hours)o Less expensive then antibodieso Sensitiveo Detection using biosensors that are

portable and user-friendly

Nucleic acid amplification (e.g.

PCR)

DNA hybridization –DNA probes

What?

Why?

Where?

MedicineVeterinary

EnvironmentalFood

Sources: Mauk, M. G. et al. Biosensors 2018, 8:17.Vizzini, P. et al. AIMS Bioengineering 2017, 4:1.




ENA (European nucleotide site) (https://www.ebi.ac.uk/ena)

NCBI (National center for biotechnology Information) (http://www.ncbi.nlm.nih.gov/)

DDBJ (DNA Data bank of Japan) (http://www.ddbj.nig.ac.jp/)

DNA Probe Design

1. Knowing target sequence

ClustalW2 (http://www.clustal.org/clustal2/)

MAFFT (http://mafft.cbrc.jp/alignment/software/)

MUSCLE (http://www.drive5.com/muscle/downloads.htm)

T-Coffee (http://tcoffee.org/Projects/tcoffee/)

START by

2. Comparing target sequences among various microorganisms that show similarities. Alignment of DNA sequences present in data banks.

Data

Ban

ks

So

ftw

are

fo

r se

qu

en

ce

Ali

gn

men

t

Source: Vizzini, P. et al. AIMS Bioengineering 2017, 4:1.




DNA Probe Design

o Probe length

o Melting temperature• Oligonucleotide concentration• Salt concentration• GC content• Gibbs free energy

o Secondary Structures

o Homology and complexity scores

Parameters to consider when designing probes:




DNA Probe Design- Probe Length

Depending on their final application, an oligonucleotide probe can be short or long.

o Length: 20-25 bp or lesso Less costlyo Less specific than longer probeso Higher coupling efficiency during the synthesis of the

oligonucleotideso The shorter the probe, the more quickly it will anneal

to target DNA o Preferred for use in PCR

o Length: 50-70 bpo Highly specific (For each additional nucleotide, a

primer becomes four times more specific)o More probability for hairpin formations that can

reduce efficiency in hybridization to the target. o Preferred for use in microarrays

SHORT Probes LONG Probes

Sources: Dieffenbach, C. W. et al. Genome Res. 1993, 3Rahmann, S. Proceedings of the IEEE CBS’02 2002.




DNA Probe Design- Melting Temperature

The melting temperature of an oligonucleotide duplex (Tm) refers to the temperature at which the oligonucleotide is 50% annealed to its exact complement.

The Tm optimal range: 50 ºC to 70 ºC

Lower temperatures will allow hybridization of sequences with less than 100% homology and secondary structures Hybridization temperature

(or annealing temperature): Temperature 3-5ºC less then Tm. Corresponds to the temperature to aim for in experimental assays.

Sources://sfvideo.blob.core.windows.net/sitefinity/docs/default-source/technical-report/calculating-tm-for-oligo-duplexes.pdf?sfvrsn=46483407_4Ilie, L. et al. BMC Bioinformatics 2013, 14:69

Vizzini, P. et al. AIMS Bioengineering 2017, 4:1.

50% of the molecules are single-stranded 50% of the molecules are in the double-stranded form

Multiplexing

Higher temperatures will assure that onlycompletely homologous sequences hybridize.However, is less sensitive, yielding reduced signalintensities and thus a degraded signal-to-noiseratio

Melting temperatures of probes must be similar

At the melting temperature




DNA Probe Design- Oligo & Salt Concentration

The Tm of an oligonucleotide depends on various factors:

2. Salt concentration: Higher ionic concentrations of the solvent will increase Tm due to the stabilizing effects that cations have on DNA duplex formation.

• Magnesium cations (Mg2+): stabilize nucleic acidduplexes and facilitate their folding intosecondary and tertiary structures

• Potassium and sodium cations (K+, Na+): increase duplex stability.

Mg2+

1. Oligonucleotide concentration (Ct): High DNA concentrations favor duplex formation

Ct

K+, Na+

Tm

[Ions] Tm

[K+] [Na+] 20-1000 mM [Mg2+] ) 1.5-5 mM

Typical concentrations of salts used:

Sources:Owczarzy, O. et al. Biochemistry 2008, 47.https://ww2.chemistry.gatech.edu/~lw26/structure/molecular_interactions/mol_int.html




DNA Probe Design- GC Content

3. Oligonucleotide sequence: Generally, sequences with a higher fraction of GC base pairs have a higher Tm than do AT-rich sequences

GC regions are less specific: more prone to mis-pairing with other GC-rich regions

Typical GC content: 40-60 %

Base stacking interactions must also be considered, so the actual specific sequence must be known to accurately predict Tm

involves deviation from the perfect double helix form by tilting of

the backbone in 30º angle in horizontal plane. This happens to

stabilize DNA by overlapping base pairs. This arrangement

maximizes electrostatic complementarity interaction.

Sources:Boero, M. et al. The Oxford Handbook of Nanoscience and Technology 2010, 17.https://ww2.chemistry.gatech.edu/~lw26/structure/molecular_interactions/mol_int.html#PB5

Can’t have GC% too high → It’s a balance

Base stacking

GC% Tm

However




DNA Probe Design- Gibbs Free Energy

4. The Gibbs Free Energy (ΔG), is the energy required to break the bonds. This energy is a thermodynamic quantity which can be used as an indicator of whether a reaction is thermodynamically favorable or not.

where ΔH denotes enthalpy change and ΔS denotes entropy change

The more negative the ΔG value the more favorable is the reaction

Favorable

The Gibbs free energy decreases during hybridization, since an oligonucleotide duplex is more stable than the two single strands

The change in the Gibbs free energy [G(x; τ , σ )] when oligonucleotide x hybridizes to its Watson–Crick reverse complement atconstant temperature τ (in Kelvin) in a solution with a cation concentration of exp(σ) (in M), can be described by the followingequation:

ΔH° < 0ΔS° > 0ΔG < 0

Unfavorable

ΔH° > 0ΔS° < 0ΔG > 0

Source: Rahmann, S. et al. Bioinformatics 2004, 20.




DNA Probe Design- Tm Basic algorithm

Where:

Tm = melting temperature in °CA = number of adenosine nucleotides in the sequenceT = number of thymidine nucleotides in the sequenceC = number of cytidine nucleotides in the sequenceG = number of guanosine nucleotides in the sequence-7 = correction factor accounting for in solution (not necessary if in surface)

A method we use to calculate Tm is the Basic method (a modified Marmur Doty formula), which its use for oligonucleotides with short sequences lengths (14 bases or less).

Source:https://www.sigmaaldrich.com/technical-documents/articles/biology/oligos-melting-temp.html

This method assumes a probe concentration of 50 nM, a monovalent (Na+) ion concentration of 50 mM, and pH 7.0




DNA Probe Design- Tm NN algorithm

The primary method used to calculate Tm is the nearest neighbors (NN) method and its used for oligonucleotides with sequence lengths from 15 to 120 bases.

This method is considered to be the most accurate as it takes into account the effects of neighboring bases as contributed through base stacking. Unlike the other algorithm, the NN considers other thermodynamic parameters, including oligonucleotide, cation

concentrations and Gibbs free energy.One of the modified nearest neighbors formulas:

Where:Tm = melting temperature in °CΔH = enthalpy change in kcal mol-1 (accounts for the energy change during annealing / melting)A = constant of -0.0108 kcal K-1 ᐧ mol-1 (accounts for helix initiation during annealing / melting)ΔS = entropy change in kcal K-1 ᐧ mol-1 (accounts for energy unable to do work, i.e. disorder)R = gas constant of 0.00199 kcal K-1 ᐧ mol-1 (constant that scales energy to temperature)C = oligonucleotide concentration in M or mol L-1

-273.15 = conversion factor to change the expected temperature in Kelvins to °C[Na+] = Cation concentration in M or mol L-1 Source:

https://www.sigmaaldrich.com/technical-documents/articles/biology/oligos-melting-temp.html




DNA Probe Design - Tm NN algorithm

ΔS is reported inunits of kcal K-1 ᐧ

mol-1, ΔH reportedin kcal mol-1

There are a finite number of nearest-neighbor values for ΔH and ΔS which can be plugged directly into the NN formula

Source:https://www.sigmaaldrich.com/technical-documents/articles/biology/oligos-melting-temp.html




DNA Probe Design – Secondary Structure

Another biophysical criterion that is sometimes applied in the elimination of probes is the ability to form stable intramolecular structures (secondary structures) under the conditions of the experiment

Higher energy barrier to intermolecular hybridization

The intramolecular base pairsinvolved in secondary structurestabilize single-strand conformation

Slow hybridization kinetics

• Eliminating regions of self-complementarity• Designing shorter single-stranded probe and target molecules• Increasing the ‘incubation’ temperature

Ways to eliminate Secondary Structures:

Sources:Dong, F. et al. Nucleic Acids Research 2001, 29:15.Hendling, A. et al. Computational and Structural Biotechnology Journal 2019, 17.




DNA Probe DesignHomology and Complexity scores

Homology: when two sequences or structures share more similarity than would be expected by chance.

Sources: Pearson, W. R. Curr Protoc Bioinformatics 2013.https://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastDocs&DOC_TYPE=FAQ

Report the expected number of times the score would occur by chance — the evalue, E()-value, or expectation value — after 105-106 of searches. The E()-value is E(b)≤p(b)D, where D is the number of sequences in the database.

Complexity: Accounts for the presence (or not) of homopolymeric runs, short-period repeats, and subtler over representation of one or a few residues. A DNA with a low complexity region has all these repetitive sequences.The DUST program is used to mask or filter such regions in nucleic acid queries.

E()-value p(random match)




DNA Probe Design – How to do it?

Two different approaches:

Employ software that designs probes for specific genes

Manual design probes and check parameters using software

Sources:Vizzini, P. et al. AIMS Bioengineering, 4, 1, 2017.Vidic, J. et al. Sensors 2019, 19:1100.Ilie, L. et al. BMC Bioinformatics 2013, 14:69.




DNA Probe Design – Manual Design

1. Choose the region of the gene to target

2. When designing probe have in mind the parameters already discussed (probe length, GC content, melting temperature, secondary structures(to assure sensitivity) . Software: OligoCalc (http://biotools.nubic.northwestern.edu/OligoCalc.html)

3. Avoid sequences containing long stretches (more than four) of a single base.

4. In silico evaluation using specific software is highly recommended to assure specificity. The probe sequence should be compared with the sequence region or genome from which it was derived, as well against DNAs from various non-target microorganisms. Software: BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi) Picky (https://www.complexcomputation.org/download/Picky/)

Criteria to ensure non-cross-hybridization is referred to as Kane’s conditions:

(1) The overall complementarity with non-targets should be less than 75%. This means that the Hamming distance between the oligo and any non-target should be less than 75% of their length. (2) There should be no contiguous complementary region with non-targets of length 15 or more.

It is considered that a probe may show cross-hybridization with a non-target sequence when it does not satisfy condition (1) and (2).

Bacterial genomes This is due to the low GC content and common conserved repeats

!

Sources:Vizzini, P. et al. AIMS Bioengineering, 4, 1, 2017.Vidic, J. et al. Sensors 2019, 19:1100.Ilie, L. et al. BMC Bioinformatics 2013, 14:69.




DNA Probe Design- Software Approach

The aim of such programs is to make the task of designing specific, sensitive oligonucleotides easier and faster.

o Client/server Software - the user employs a small software client to send the data to a server, generally located in the laboratorywhich developed the design software. This laboratory is carrying out the calculation of the oligos and then is sending the results to thecustomer. Advantages: the final user does not need to have large local computing facilities at his disposal; software client is often veryeasy to install and to use over the Internet. Drawbacks: the database used to test the specificity of the probes must be present on theserver, which limits the possibilities; the calculation is dependent on the server availability; confidentiality of the data is not guaranteed.

Source:https://arxiv.org/ftp/arxiv/papers/0802/0802.3915.pdf

o Autonomous software- Advantages: the user completely controls the configuration of the parameters of the probe design; notdependent on a distant machine. Drawbacks: the applications are more difficult to install; requires a certain computing power; mayneed other software to function (like BLAST and Mfold)

o Sensitivity - Usually predicted through a measure of melting temperature, percentage GC content and sometimes measures of free energy and prediction of potential secondary structures.

o Specificity - Usually predicted by comparing a given oligonucleotide to sequences other than the target it is designed to hybridize to and testing for percent identity, contiguous regions of identical sequence and low complexity regions.

Two groups of software available (from a data-processing point of view):




DNA Probe Design- Software Approach

• Free Java client (data input and display of results) + Perl serverhosted by CBS (Center for Biological Sequence analysis,Denmark: http://www.cbs.dtu.dk/services/OligoWiz/

• Evaluated according to criteria: cross-hybridization, ΔTm, self-annealing, position and ‘low-complexity’. Each individualscore ranges from 0.0 (not suited) to 1.0 (well suited).

OligoWiz 2.0 (Nielsen et al., 2003) [Currently offline]

Client/server Software

Autonomous Software

• The software workflow runs on a Linux server (64 CPUs, 256GB RAM). http://oli2go.ait.ac.at/

• Evaluated according to criteria: cross-hybridization, Tm, probe hairpin, probe length.

Oli2go (Hendling et al., 2018) [PCR]

• The modular, open-source OligoMiner pipeline is written inPython using Biopython. https://github.com/beliveau-lab/OligoMiner

• Allows users to specify allowable ranges of probe length, GCcontent (GC%), and adjusted Tm calculated by using nearest-neighbor thermodynamics. Checks for specificity.

OligoMiner (Believeau et al., 2018)

• Perl program.http://pga.mgh.harvard.edu/oligopicker/

• The criteria considered are specificity(use of BLAST), Tm, position in thetranscript, probe length.

OligoPicker (Wang and Seed, 2003)

ProbeMaker (Stenberg et al., 2005)

• Free Java open-source software.http://probemaker.sourceforge.net/

• Designs sequences for probe-targethybridization based on Tm and lengthparameters. Checks for other used-definedparameters.




• DNA/RNA sequences with methylene bridge to connect 2’ oxygen and 4’ carbon of the ribose ring.

• Negatively charged• Synthesized like DNA/RNA• Easy to make LNA-DNA chimeras to enhance the hybridization specificity,

sensitivity and duplex stability • Soluble like DNA/RNA• The melting temperature of this probe is higher than normal probes• Low toxicity in animals• Their properties allow for discrimination of single point mutations and various

applications

• Artificial DNA sequence with backbone composed of repeating N-(2-aminoethyl)-glycine units (instead of ribose/deoxyribose) linked by peptide bonds.

• The bases are linked to the backbone by a methylene bridge (-CH2-) and a carbonyl group (-(C=O)-).

• Uncharged (binding PNA/DNA strands > DNA/DNA strands due to the lack of electrostatic repulsion)

• Synthesized like peptide• Easy to make PNA-peptide• Solubility varies with sequence• Low toxicity in animals• Backbone not recognized by polymerase (can’t be used in PCR)

Lo

cked

Nu

cle

ic

Acid

(LN

A)

Pep

tid

e N

ucle

ic

Acid

(P

NA

)

Alternative Probes

Sources:Braasch, D. A. et al. Cell Chemical Biology 2001, 8:1.Priya, N. G. et al. BMC Microbiology 2012, 12:81Vizzini, P. et al. AIMS Bioengineering 2017, 4:1.




DNA Probe Labeling and Biosensor Applications

Label PositionThe labelling molecules can be attached to one end (5’ or 3’) of theDNA probe, at both ends or be incorporated throughout the sequence.This can be accomplished by end-labelling, chemical labelling, and soon.

Probes can be used in couples (capture and detection) or singularly, based on the detection system used in the biosensor.

Secondary labels, tagged to nucleic acid, are recognized by detection systems with primary labels. Ex: biotin/streptavidin, antibodies

Nature of label • Detectability (target concentration at which signal/noise ratio just exceeds that of blanks)• Sensitivity• Radioactive or nonradioactive labels: safety, stability, detectability, sensitivity,• Ease of detection and equipment required• Primary label or secondary label

Primary labels yield a directly detectable signal. Ex: radioisotopes, enzymes and physicochemical reporters (fluorophors, luminophors) covalently attached to the nucleic acid.

Sources: Bhattacharya, S. et al. Advanced Functional Materials and Sensors 2019.Henderson, W. A. et al. Analytical Methods 2018, 45.Tijssen, P. Laboratory Techniques in Biochemistry and Molecular Biology 1993, 24:7Vizzini, P. et al. AIMS Bioengineering, 4, 1, 2017.




DNA Probe Labeling and Biosensor Applications: Chemiluminescence Sensor

Recognition probe-target complex: Avidin-HRP (horseradish-peroxidase) (1 hour)

Probe Length Target Region Label Modification

Capture:5’TGT TTGAGCGTCATTTCCTTCTCACTATTTAGTGGTTATGAGATTACACGAGG 3’

53 nt

B. bruxellensis was designed to target the ITS1–ITS2 regions (not

highly conserved)

Labelled at both ends with

digoxigenin

NH2 at 5’ for immobilization in optical fiber

sensor

Detection:5’ GGAGTGAGGGGATAATGATTTAAGGTTTCGGCC GTTATTATTTT 3’

45 ntB. bruxellensis was

designed to target the ITS1–ITS2 regions

Biotin at 3’ end -

Chemiluminescent Signal

Source: Cecchini, F. et al. Journal of Biotechnology 2012, 157.




DNA Probe Labeling and Biosensor Applications: Optical Biosensor

Probe (5’-3’) Length Target mutation Label Modification

ACGGACCGCACGGAG

15 nt Normal genome Free NH2 at 3’

ACGGACCACACGGAG

15 nt ACD Free NH2 at 3’

ACGGACCTCACGGAG

15 nt RBCD Free NH2 at 3’

CACGGACTGCACGGA

15 nt LCD Free NH2 at 3’

Source: Yoo, S. Y. et al. Anal Chem 2010, 82.

(6 h @RT)




Cyclic voltammetry (CV) - From basic theoretical aspect toward detection tool abilities

Electrochemistry

Physical chemistry aspectStudies the relationship between

electricity (physical) and identifiable chemical change (chemistry)

Chemical vs electrochemical reduction

Cyclic voltammetry

Analytical chemistry aspectStudies analytical techniques for the determination of parameters using

chemistry

Figures adopted from Elgrishi et al., J. Chem. Educ. 2018, 95, 197-206, https://doi.org/10.1021/acs.jchemed.7b00361

https://doi.org/10.1021/acs.jchemed.7b00361




Basic theory of CV

The cyclic voltammetry is a powerful tool to study the electrochemical behavior of a system by systematic study of current-voltage measurements of a given electrochemical cell.

Scanning of redox processes

Signal output -voltammogram

x axis – applied potential E [V]y axis – response, current signal i [A]Arrow - beginning and sweep direction of the "forward scan"v – scan rate [V/s], linear variation of potential with time

Experim

ental setu

p

Holes for degassing or

reagent addition

Teflon cap

Glass solution

reservoir

Electrolyte solution = solvent + supporting electrolyte

Counter electrode

Reference electrode

Working electrode






Electrolyte solution:Electron transfer from the electrode to the solution is compensated with ions migration to close the electrical circuit. Electrolyte – reduces solution's resistance.

Three modes of mass transport:1. Convection – mechanical forces (stirring, vibrations)2. Migrations – electric field3. Diffusion – concentration difference between two points within the EC

Working electrode:Carries out the electrochemical event. Potentiostat serves to control applied potential of the WE as a function of the RE. Composed of redox-inert material in the potential range of interest. Surface of the WE needs to be very well defined and clean.

Counter electrode:Completes the electrical circuit when redox event occurs at WE and current starts to flow. Larger surface avoids hindrance of kinetics of reactions at WE by the same event occuring at RE. Platinum, carbon-based.

Reference electrode:Well defined and stable equilibrium potential. Serves as a reference point from which the potential of WE is measured. Types: saturated calomel electrode (SCE), standard hydrogen electrode (SHE), and AgCl/Ag electrode.

Nernst equation:

Conditions:• One-electron reduction of Fc+ to Fc• E0 replaced by E0', activities of Ox and

Red analyte replaced by concentrations [Fc+] and [Fc] and n = 1

• Usually E0' ≈ E1/2

Chemically and electrochemically reversible process: peak-to-peak separation (ΔEp) equals to 57 mV at 25 °C and FWHM of the forward scan peak is 59 mV.Low barrier to electron transfer –immediate Nernstian equilibrium; high barrier to ET – slow reactions and larger ΔEp occurs.






CV as a tool for bacteria biofilm monitoring

Results data and figures are adopted from Kang et al., J. Ind. Eng. Chem 2012, 18, 800-807, https://doi.org/10.1016/j.jiec.2011.10.002

Outline:< Monitoring of initial bacterial adhesion and later biofilm maturation stage< Cyclic voltammerty used as a detection/monitoring tool< Pseudomonas aeruginosa, gram-negative aerobic bacteria used for study

Experimental intro:<Electrodes> WE – 2 mm diameter Pt disc, RE – Ag/AgCl, CE – Pt wire<Electrolyte> Bacteria adhesion – 0.1 mM PBS, Surface coverage monitoring – 0.01 mM K3[Fe(CN)6] + KNO3

<CV setup 1> Potential range: -0.6 - 1.2 V, scan rate: 250 mV/s<CV setup 2> Potential range: -0.1 - 0.5 V, scan rate: 250 mV/s (50, 100, 150, 200, 250 mV/s)<Tafel setup> Potential range: 0 – 1 V, scan rate: 5 mV/s

Early adhesion of bacteria (108 CFU/ml, in the absence of nutrients)

Initial CV conclusion:Pt + H2O -> PtOH + H+ + e-

PtOH -> PtO + H+ + e-

Current increases during bacteria adhesion in the range of 0.5 - 1.0 V and around 0.0 V with time.

https://doi.org/10.1016/j.jiec.2011.10.002




Tafel measurements CV current changes with the change of bacteria density (106, 107, and 108 CFU/ml)

Current decreases with the bacteria cell density –diminishment of effective surface area of the electrode.

CV measurement of biofilm maturation (108 CFU/ml with

nutrients supply)

CV current of biofilm-coated electrode is simmilar or lower than the current with bare electrode.Two reasons to current change:1. Current increase – enhanced electron transfer between WE and bacterial surface-associated molecules2. Current decrease – diminishment of area available for EC interaction due to surface-covering action

CV voltammogram changes due to amount

of adsorbed bacterial cells and degree of biofilm formation.






Surface cover calculation based on CV voltammogramsCV measurements in ferricyanide solution

– redox couples: ferricyanide and ferrocyanide.

Anodic and cathodic peak currents decreases with time (with biofilm surface-cover increase).Peak-to-peak separation increases with time – decrease of electrochemical reversibility due to diminishment of EC active surface area.

Calculations of surface coverage from CV voltammograms with the use of Randles-

Sevcik equation:

Diffusion coefficient calculated for bare electrode: 4.29 x 10-6 cm2/s.Differences between CV + RS eq. and fluorescence image analysis: sensitivity, CV measurement can detect EC reactions with all bacterial products (secreted proteins, carbohydrates and EPS), while CLSM sees only bacterial cells. Important fact: good correlation (r2 = 0.92) between CV CLSM surface coverage tendency.






Paper-based biosensor for detection of bacterial contamination in water

• An innovative, simple and low-cost, paper-based probefor detection of bacteria in water, fabricated by screenprinting carbon electrodes on to hydrophobic paper.

• The electrode surface was functionalised with carboxylgroups, prior to covalent immobilization of the lectinConcanavalin A (Con A), used as the biorecognitionelement.

• The system was then tested as an impedimetric sensorfor bacteria in water.

Saravanan Rengaraj, Álvaro Cruz-Izquierdo, Janet L. Scott, Mirella Di Lorenzo, Impedimetric paper-based biosensor for thedetection of bacterial contamination in water, Sensors and Actuators B, 265 (2018) 50–58,https://doi.org/10.1016/j.snb.2018.03.020

Functionalised screen-printed probe for bacterial detection

https://doi.org/10.1016/j.snb.2018.03.020

• The paper-based probe was fabricated by screen printing three layers of a carbon-based conductive ink ontoFabriano 5 HP paper.

• The final device consisted of a circular working electrode (6 mm diameter), with a geometric surface area of 0.286cm2, printed onto a paper strip 4 cm long and 1 cm wide.

• To cross-link the cellulose fibres, after screen printing the electrodes, the paper was submerged for 3 h in a solutionof 6% w/v glyoxal at room temperature (20 ± 3◦C), followed by a thermal treatment at 140◦C for 1 h.

• The success of each functionalization step was verified by cyclic voltammetry (CV) and electrochemical impedancespectroscopy (EIS).

Electrode surface modification

Saravanan Rengaraj, Álvaro Cruz-Izquierdo, Janet L. Scott, Mirella Di Lorenzo, Impedimetric paper-based biosensor for the detectionof bacterial contamination in water, Sensors and Actuators B, 265 (2018) 50–58, https://doi.org/10.1016/j.snb.2018.03.020

Oxidized by LSV at a scan rate of 5 mV/s,from 1.55 to 1.76 V vs. Ag/AgCl, in anaqueous electrolyte containing 2.5%K2Cr2O7and 10% HNO3

To activate the carboxylic groups, theelectrodes were incubated with 20 µL of1:1 EDC/NHS for 20 min at roomtemperature.

The electrodes were incubatedwith 10 µl of lectin (2 mg/ mL in0.1 M sodium acetate buffer, pH4.5) for 30 min

To prevent any non-specific adsorption,unreacted sites were blocked by exposing theelectrode surface to a 1 M ethanolaminehydrochloride solution for 20 min


Characterisation - PG and SPC electrodes

• Nyquist plot • Cyclic voltammograms


Rs - ohmic resistanceCdl - double layer capacitanceRct - electron-transfer resistance Zw - Warburg impedance

The Randlescircuit model

• CVs and impedance measurements were performed in phosphate buffer (0.1 M) in the presence of 5 mM ofFe(CN)6

3−/4−as redox probe

SPC (Screen Printed Carbon)electrode

SPC (Screen Printed Carbon)electrode

Pyrolytic graphite (PG)electrode

Pyrolytic graphite (PG)electrode


Results – PG electrodes


• It has been reported that Con A specifically binds with the mannose residues distributed on the surface of bacterialcells, such as E.coli and Bacillus sp. Lectin, however, might also interact with other types of bacteria in the sample,particularly if these present mannose residues on the surface of their cells.

103 CFU mL−1

104 CFU mL−1

105 CFU mL−1

Fresh synthetic wastewater – no bacteria Synthetic wastewater incubated overnight – no bacteria

The increase in the Rct is a result of the formation of

lectin-bacterial cell complexes on the electrode

surface.

frequency range of 1–100 kHz


https://www.sciencedirect.com/science/article/pii/S0039914009001337?via%3Dihub

Results – SPC electrodes


• Testing the use of the functionalised SPC electrodes for bacterial detection. a) Nyquist plots obtained with differentconcentration of bacterial cells. Impedance spectra were recorded at the formal redox potential Fe(CN)6

3−/4−in 0.1 M ofPBS (pH 7.4). b) Change in the charge transfer resistance, Rct, as a function of the bacterial concentration.

frequency range of 1–100 kHz

Estimated lower detection limit – 1.9*103 CFU/ml


Biosensors for Campylobacter spp. and Listeria monocytogenesdetection

Biosensors consist of a transduction element covered with a chemical or biological recognition layer whichinteracts with the target analyte

2 main signal – transducing mechanisms

• Electrochemical:

- Amperometric- Potentiometric- Impedimetric- Conductometric

• Optical:

- Colorimetric- Fluorimetric- SPR

• Affinity:

- Antibodies (Ab)- DNA probes- Aptamers

• Biocatalytic:

- Enzymes- Cells- Tissues

Biorecognition elements

https://www.expresshealthcare.in/news/purdue-university-develops-detection-technology-to-analyse-produce-for-foodborne-pathogens/401607/https://en.wikipedia.org/wiki/Listeria_monocytogeneshttps://en.wikipedia.org/wiki/Campylobacter

https://www.expresshealthcare.in/news/purdue-university-develops-detection-technology-to-analyse-produce-for-foodborne-pathogens/401607/

https://en.wikipedia.org/wiki/Listeria_monocytogenes

https://en.wikipedia.org/wiki/Campylobacter

• Campylobacter spp. amplicondetection• Gold working electrodefunctionalized with the DNA probeby a thiol - Au bond• Ferricyanide used as a redox probe• Unspecific signal avoided by using6-mercaptohexanol (MCH) as ablocking agent• The current signal decreases uponsequence hybridization

Square – Wave Voltammetry

Cyclic Voltammetry

Bare electrode

ssDNA+MCH

dsDNA

Campylobacter spp. detection based on SWV

https://en.wikipedia.org/wiki/Cyclic_voltammetry

Mirceski, V. and Gulaboski, R. Maced. J. Chem. Chem. Eng. 33 (1), 1–12 (2014)

Vizzini, P.; Braidot, M.; Vidic, J.; Manzano, M. Micromachines. 2019, 10, 500.

Morant Minana, M.C.; Elizalde, J. Biosens. Bioelectron. 2015, 70, 491–497.

https://en.wikipedia.org/wiki/Cyclic_voltammetry

dsDNA

ssDNA

• Listeria monocytogenes specific sequence detection by differentialpulse voltammetry (DPV)• Gold dendritic NPs deposited on the CILE electrode• Methylene blue (MB) as electrochemical indicator• The current signal decreases upon sequence hybridization due to theintercalation of MB into dsDNA

Listeria monocytogenes detection based on DPV

https://slideplayer.com/slide/6361282/

Sun, W.; Qi, X.; Zhang, Y.; Yang, H.; Gao, H.; Chen, Y.; Sun, Z. Electrochim. Acta 2012, 85, 145–151.

https://slideplayer.com/slide/6361282/

Excitation principle based on OLED for Campylobacter spp. detection

• Campylobacter spp. sequence detection• A miniaturized, highly-sensitive DNA biochipbased on a deep-blue organic light-emittingdiode (OLED)• Fluorescence detection of a specific biologicalprobe excited by OLED• Molecular design of the diode was optimizedto specifically excite a fluorophore-conjugatedDNA probe and tested using real meat• A small molecule-based OLED optimized toobtain a deep-blue (DB) colour emission with apeak wavelength of 434 nm (DB-OLED-Marcello) was used to excite the fluorescence ofthe commercial dye AlexaFluors 430 with theabsorption peak located at 434 nm and theemission peak located at 541 nm• a-NPD [N,Nʹ-diphenyl-N,Nʹ-bis(1-naphthylphenyl)-1,1ʹ-biphenyl-4,4ʹ-diamine]used as a light emitter• The fluorescence signal was acquired with ahigh sensitivity CCD camera

Vizzini, P.; Braidot, M.; Vidic, J.; Manzano, M. Micromachines. 2019, 10, 500. http://qxwujoey.tripod.com/oled.htm

https://en.wikipedia.org/wiki/OLED

OLED lighting panels

Manzano, M.; Cecchini, F.; Fontanot, M.; Iacumin, L.; Comi, G.; Melpignano, P. Biosens. Bioelectron. 2015, 66, 271–276.

http://qxwujoey.tripod.com/oled.htm

https://en.wikipedia.org/wiki/OLED

Campylobacter jejuni detection based on SPR

• Surface Plasmon Resonance (SPR) sensorplatform for C. jejuni detection• Direct, Sandwich and Sandwich assay withantibody-functionalized Au NPs• SPR sensor gold chips were firstfunctionalized withpolyclonal antibodies raised against C. jejuniusing covalent attachment• The LOD obtained in the sandwich assaywas better than that achieved usingcommercial enzyme-linked immunosorbentassay (ELISA)

Surface Plasmon Resonance Principle

Masdor, N.A.; Altintas, Z.; Tothill, I.E. Chemosensors 2017, 5, 16.https://www.aacc.org/publications/cln/articles/2019/may/the-role-of-surface-plasmon-resonance-in-clinical-laboratories

https://www.aacc.org/publications/cln/articles/2019/may/the-role-of-surface-plasmon-resonance-in-clinical-laboratories

Colorimetry

ENZYME – catalyzes the oxidation

CHROMOGENIC SUBSTRATE – characteristiccolor change in oxidized form

Pictures source: https://www.bio-rad.com/en-rs/applications-technologies/detection-methods?ID=LUSQ6KKG4

https://www.bio-rad.com/en-rs/applications-technologies/detection-methods?ID=LUSQ6KKG4



Colorimetry

Liu, Yushen, et al. Analytica chimica acta 1048 (2019): 154-160.

Zhang, Lisha, et al. Biosensors and Bioelectronics 86 (2016): 1-7.

TMBred

TMBox




Ali, M.M., Brown, C.L., Jahanshahi-Anbuhi, S. et al. A Printed Multicomponent Paper Sensor for Bacterial Detection. Sci Rep 7, 12335 (2017)

RNA-cleaving fluoregenic DNAzyme (RFD) – bacterial recognition and signal generation

Lysozyme – lysis of bacterial cells

Paper supstrate – nitrocellulose membrane backed with a thin plastic layer on one side Two-step printing –1. wax printing of microzones2. ink-jet printing of a DNAzyme-

loaded ink into the microzones

Pullulan/trehalose sugars –stabilization of printed bioactive molecules.

RNA-cleaving fluorogenic DNAzymes (RFDs)

• Single-stranded DNA sequences with catalytic activities, typically isolated from random-sequence synthetic DNA pools

FRQ – fluoregenic supstrateF – fluorophoreR – riboadenosine: CLEAVAGE SITEQ - quencher

RECOGNITION SEQUENCE SPECIFIC FOR E.coli

Ali, M.M., Brown, C.L., Jahanshahi-Anbuhi, S. et al. Sci Rep (2017)

Allosteric activation resulting in

a conformational change

Activated RFD catalyses the cleavage

of the fluorogenic substrate

https://www.nature.com/articles/s41598-017-12549-3

• prevent the denaturation of enzymes,degradation of labile small molecules, andhydrolysis of RNA species by auto-cleavageand RNase-induced degradation

PULLULAN TREHALOSE

Fluorescent image after the cleavage reaction of the DNAzyme after 7 days of storage.

RB – buffer alone; RB + TH – with trehalose; RB + PL – with pullulan; RB + TH + PL – with both


LYSOZYME – binds to the peptidoglycan moleculesof cell walls and hydrolyzes glycosidic bonds

Effect of lysozyme in the printed bio-ink on the fluorescence signal


DNAzyme probe performance

Performance of the DNAzyme in milk, apple juice and drinking water samples

Nuclease degradation test of printed paper sensor

• a limit of detection of 100 cells/mL

• variety of sample matrixes• without sample

enrichment• stable for at least 6

months when stored at ambient temperature






List of references:• Vizzini, P., Braidot, M., Vidic, J., & Manzano, M. (2019). Electrochemical and Optical Biosensors for the Detection of Campylobacter and Listeria: An Update

Look. Micromachines, 10(8), 500.

• Ali, M. M., Brown, C. L., Jahanshahi-Anbuhi, S., Kannan, B., Li, Y., Filipe, C. D., & Brennan, J. D. (2017). A printed multicomponent paper sensor for bacterial detection. Scientific reports, 7(1), 1-10.

• Kang, J., Kim, T., Tak, Y., Lee, J. H., & Yoon, J. (2012). Cyclic voltammetry for monitoring bacterial attachment and biofilm formation. Journal of Industrial and Engineering Chemistry, 18(2), 800-807.

• Rengaraj, S., Cruz-Izquierdo, Á., Scott, J. L., & Di Lorenzo, M. (2018). Impedimetric paper-based biosensor for the detection of bacterial contamination in water. Sensors and Actuators B: Chemical, 265, 50-58.

• Manzano, M., Cecchini, F., Fontanot, M., Iacumin, L., Comi, G., & Melpignano, P. (2015). OLED-based DNA biochip for Campylobacter spp. detection in poultry meat samples. Biosensors and bioelectronics, 66, 271-276.

• Sun, W., Qi, X., Zhang, Y., Yang, H., Gao, H., Chen, Y., & Sun, Z. (2012). Electrochemical DNA biosensor for the detection of Listeria monocytogenes with dendritic nanogold and electrochemical reduced graphene modified carbon ionic liquid electrode. Electrochimica acta, 85, 145-151.

• Masdor, N. A., Altintas, Z., & Tothill, I. E. (2017). Surface plasmon resonance immunosensor for the detection of Campylobacter jejuni. Chemosensors, 5(2), 16.

• Morant-Miñana, M. C., & Elizalde, J. (2015). Microscale electrodes integrated on COP for real sample Campylobacter spp. detection. Biosensors and Bioelectronics, 70, 491-497.

• Vidic, J., Vizzini, P., Manzano, M., Kavanaugh, D., Ramarao, N., Zivkovic, M., ... & Gadjanski, I. (2019). Point-of-need DNA testing for detection of foodborne pathogenic bacteria. Sensors, 19(5), 1100.

• Vizzini, P., Iacumin, L., Comi, G., & Manzano, M. (2016). Development and application of DNA molecular probes. AIMS Bioeng, 4, 113-132.

• Boero, M., & Tateno, M. (2010). Quantum-theoretical approaches to proteins and nucleic acids. In Oxford Handbook of Nanoscience and Technology.




• Cecchini, F., Manzano, M., Mandabi, Y., Perelman, E., & Marks, R. S. (2012). Chemiluminescent DNA optical fibre sensor for Brettanomyces bruxellensisdetection. Journal of biotechnology, 157(1), 25-30.

• Henderson, W. A., Xiang, L., Fourie, N. H., Abey, S. K., Ferguson, E. G., Diallo, A. F., ... & Kim, C. H. (2018). Simple lateral flow assays for microbial detection in stool. Analytical Methods, 10(45), 5358-5363.

• Hendling, M., & Barišić, I. (2019). In-silico design of DNA oligonucleotides: Challenges and approaches. Computational and structural biotechnology journal.

• Ilie, L., Mohamadi, H., Golding, G. B., & Smyth, W. F. (2013). BOND: basic oligonucleotide design. BMC bioinformatics, 14(1), 69.

• Owczarzy, R., Moreira, B. G., You, Y., Behlke, M. A., & Walder, J. A. (2008). Predicting stability of DNA duplexes in solutions containing magnesium and monovalent cations. Biochemistry, 47(19), 5336-5353.

• Pearson, W. R. (2013). Curr Protoc Bioinformatics.

• Priya, N. G., Pandey, N., & Rajagopal, R. (2012). LNA probes substantially improve the detection of bacterial endosymbionts in whole mount of insects by fluorescent in-situhybridization. BMC microbiology, 12(1), 81.

• Klau, G. W., Rahmann, S., Schliep, A., Vingron, M., & Reinert, K. (2004). Optimal robust non-unique probe selection using integer linearprogramming. Bioinformatics, 20(suppl_1), i186-i193.

• Liu, Y., Wang, J., Zhao, C., Guo, X., Song, X., Zhao, W., ... & Li, J. (2019). A multicolorimetric assay for rapid detection of Listeria monocytogenes based on the etching of gold nanorods. Analytica chimica acta, 1048, 154-160.

• Zhang, L., Huang, R., Liu, W., Liu, H., Zhou, X., & Xing, D. (2016). Rapid and visual detection of Listeria monocytogenes based on nanoparticle cluster catalyzedsignal amplification. Biosensors and Bioelectronics, 86, 1-7.

• Bhattacharya, S., Kumar, S., & Agarwal, A. K. (Eds.). (2019). Paper Microfluidics: Theory and Applications. Springer Nature.

List of references:




• Braasch, D. A., & Corey, D. R. (2001). Locked nucleic acid (LNA): fine-tuning the recognition of DNA and RNA. Chemistry & biology, 8(1), 1-7.

• Dieffenbach, C. W., Lowe, T. M., & Dveksler, G. S. (1993). General concepts for PCR primer design. PCR methods appl, 3(3), S30-S37.

• Dong, F., Allawi, H. T., Anderson, T., Neri, B. P., & Lyamichev, V. I. (2001). Secondary structure prediction and structure-specific sequence analysis of single-stranded DNA. Nucleic acids research, 29(15), 3248-3257.Mauk, M. G., Song, J., Liu, C., & Bau, H. H. (2018). Simple approaches to minimally-instrumented, microfluidic-based point-of-care nucleic acid amplification tests. Biosensors, 8(1), 17.

• Rahmann, S. (2002, August). Rapid large-scale oligonucleotide selection for microarrays. In Proceedings. IEEE Computer Society Bioinformatics Conference (pp. 54-63). IEEE.

• TIJSSEN, P. (1993). Labeling of probes and their detection. Laboratory techniques in biochemistry and molecular biology, 24, 269-374.

List of references:

This project has received funding from the European Union’s Horizon 2020 research and innovation programme under the Marie Skłodowska-Curie grant agreement No 872662

Integration of PAper-based Nucleic acid testing mEthodsinto Microfluidic devices for improved biosensing Applications

Thank you for your attention!

integration of paper-based nucleic acid testing methods ...€¦ · ipanema, online journal club 2,...

Documents