ll3

Origina] Paper Plant Bio.technology. 20 (2), 11 3- 119 (2003)

ldentiflcation of Regulatory Elements Involved in EXpression

of a Rice Endopeptidase Gene Repl in Embryos

Keita SUTOHi,Hideki KAT02, Daisuke YAMAUCHll,~** and Takao MlNAMIKAWA{

~Department ofBiological Sciences. I'okyo Metropolitan University, Minami-ohsawa 1 1, Ilachioji-shi,Jt)kyo 192 0397, .Japan

IWinter Stress I.aboratory, National Agricultual Research Center fur Hokkaido Region (NARCH). NARO,Ilitsujigaoka I, I~)yohira

-ku. Sapporo 062 -- 8555. Japan

P,'esent address."sDepartment of Ltfe Science, I/imeji /nstitute of I'echnology, Sh.osha 2167, /Iimeji --shi,

Hyogo 671 - 2201 Japan*Corresponding author Email address: dyamauch@sci.himeji-tech.ac.jp

Received 21 August 2002; aceepted 5December 2002

Abstract

A gene f0.r a cysteine endopeptidase REP 1, Repl, is expressed in both the embryo and aleuronelayers in germinating rice seeds. The expression of Re.pl was not rcpressed in the embryo byexogenously applied uniconazole, a gibberellin (GA) biosynthesis~ inhibitor, even thot~gh GA inducibleexpression of the gene o.ccurred in the aleurone layers. Serialiy truncated Repl promoters fused to the ~glucuronidase (GUS) reporter gene were employed to identify the cis regulatory e]ernents involved in

the embryo specific expression. The deletion of the region from 500 to 432 decreased the GUSactivity significant]y. Linkerscan mutation analysis. was carried out to determine the sequencesinvolved in the expression of Repl in embryos, which showed that the region from - 500 to 432contained at least two positive regu]atory elements.

Key words: embryo, endopeptidase, gibberellin, promoter analysis, rice.

Abbreviations

ABA, abscisic acid; CaMV, cauliflower mosaicvirus; EDTA, ethylenediaminetetraacetic acidj GA,gibb~erellin; GARE, GA-respons~e element; GUS, ~glucuronidase; Luc, Iuciferase.

Introduction

Cereal grains such as rice, barley and wheat, store

most of their reserves, those are principal]y starch

and proteins, in endosperms surrounded by aleuronelayers where hydrolases are synthesized (Bewleyand Black, 1994). During s.eed germination andearly seedling growth, the storage protein in the

endosperm is digested by endopeptidascs secreted

from the aleurone layers and is mobilized to supply

amino acids that support the growth of the embryo.The synthesis of the endopeptidascs in aleuronelayers is induced by gibberellin (GA) and thisinduction is antagonized by abscisic acid (ABA).Expression of the gene for a barley cysteine endope-petidase EP B. EP131, in aleurone layers has beeninduced by GA (Koehler and Ho, 1990). Analysis of

the El)131 promoter indicated that the GA-responseelement (GARE), TAACA(}/A, conserved in cercalGAinducible genes was required for the GA in-ducible expression (Cerc6s et al.

,1999).

We previously purified a cysteine endopeptidaseREP-1 (rice endopeptidase - 1) from rice seedlings(Kato and Minamikawa, 1996). The enzymaticcharacterization of REP- I revealed that this en-zyme mainly plays a role in the degradation of thestorage protein glutelin, which accounts for about800/r, of the total protein in rice seeds. A CDNAclone for REP 1, named pRP60, was isolated andits sequence indicated that REP-1 belonged to apapain-like cysteine proteinase (Kato and Mina-mikawa, 1996). We isolated a clone for the REP- 1gene, Repl, pgRP60, and its nucleotide sequenceshowed that the gene is intron- Iess (Kato et al.,

1999). We also isolated a CDNA clone encodinganother papainlike cysteine proteinase namedpRP80 and isolated a clone for the correspondinggene, RepA (Shintani et al., 1995; Kato et al.,19~99). Northern blot analysis showed that mRNASfor both Repl and RepA were undetectable in drys.eeds, but their levels increased sharply upon imbi-

l1･i-

bition (Shintani et al., 1997). When the aleuronelayer was incubated without hormone, mRNAs forthe two proteinases were maintained at a low level.

H.owever, the levels of the two mRNA in this tissuewcre increased by the addition of GA3, and the

effect was elimiuated by the addition of ABA. GAsynthesized in the embryo is secreted to the aleu-

ronc layers and induces hydrolase gene expression

(Kaneko et al., 2002). The RepA mRNA Ievel inseedlings was reduced by exogenously npplieduniconazole, a GA biosynthesis inhibitor, but thisinhibitor had a weak effect on the repression ofRepl expres.sion. We presumed that GA was notrequired for the expression of Repl in ric.e embryos.

It is known that GA induces a -amylase e.xprcs-sion in the aleurone layeis of cereal seeds (Bewley

and Black, 1994), but Umemura et al. (1998) foundthat a amylase expression in rice embryos wasrcgulated by sugar starvation: the expression of

RAm)'3D in the embryos was repressed by exoge-nously applied sugar. Using a transient expression

system with particle bombardment to analyze the

sugnr scnsing mechanism of the RAmy3D promoteractivity. Toyofuku et al. (1_998) identified the pr0=moter elements required for sugarinduced repres-sion of the RAmy3D in rice embrycs, a:nd thesesequences are different from GARE. These reportsindicate that the regulation of (z amylase expres-sion is different in embryos and aleurone layers.

In the present study, we used uniconazole, atriazole type growth retardant which inhibits thebiovynthesis of GAS at the conversion of ent-kau-rc.ne to entkaurenoic acid (Izumi et al., 1985), to

show that GA was not required for Repl expressionin rice embryos. The promoter rcgion of Repl wasanalyzed with a transient assay systern to identify

the cis- regulatory elements in the ernbryos. Ourresults from the deletion and linker-scan analyses

showed that the region from -500 to 432 wasrequired for the high-level expression of Re'pl and

included at least two positive regulatory elements.

Materials and Methods

l)lant materials

Rice seeds (Oryza sativa L. cv. Nipponbare) wcrekindly gifted to us by Dr. Seiichiro Kiyota (NationalInstitute of Agrobiological Resources, Tsukuba,Japan). The rice seeds were husked and surface

sterilized by treatment with lo/o Antiformin includ-

ing O.050/r' Tween 80 for 60 min followed by thor-ough washing with sterile water. The seeds wereallowed to germinate at 27 'C in darkness for 5daysin the presence or the absence of 50 /!M unicon-azole. For the preparation of rice embryos, the rice

seeds were germinated in liquid medium (Mura-shige and Skoog medium with 3(~;/(; sucrose and 2.2

mg l~ 2,4_dichlorophenoxyacetic acid) as de-scribed by Umemura et al. (199S.). After incubationfor seven days, the embryos were dissected from the

endosperrns, and transferred to the same liquid

medium as described above.

Isolation of total RNA and Northern blot anal_ysisTotai RNA was prepared as described by Karrer

et al. (1991). The glyoxylated RNAS Were separatedby electrophoresis on a I.40/~ agarose gel and wereblotted onto a Hybond- N nylon membrane (Amcr-sham Biosciences). A CDNA clone for Repl,pRP60, was used as the probe for Repl. To probe aamylase mRNA, the partial cDNA clone for rice aamylase corrcsponding to the rcgion from +_~49 to+1268 of RAmylA CDNA was cloned as. describedpreviously (Karrer et al., 1991). 32P Iabeling of

cDNA fragments was conducted with a randomprimer DNA Iabeling kit (Takara Shuzo). Hybrid-ization was performed in a plastic bag filled with50a/r, formamide and 5x SSPE (1.x SSPE: 0.5 MNaC1, 10 mM NaHP04, ImM EDTA, pH 7.4) for16 hat 42 'C..

Construction of reporter plasmids

The truncate.d fragments of the Repl promoter

were amplified by polymerasc chain reaction (PCR)and two mutations for creatlng IlindIII and .S'pel

sites were simultaneously generated at the 5' andthe 3' ends of the fragments, respectively. Theamplified fragments were cloned to pCR 2.1 vector(Invitrogen) to confirm the sequences, and then cutfrom the plasmids with Ilindlll and Spel, re in-

serted into the fi- glucuronidase (GUS) vector,

pB1221 (Jefferson et al., 1987), in the replacementof the cauliflower mosaic virus (CaMV) 35S RNApromoter to construct RX- 184, RX- 367, RX432,RX-500, RX-568 and RX8O8. Several point-mutated constructions were generated from RX500 by PCR-based oligonucleotide directed muta-genesis (Picard et al., 1994) with 6bp pointmutations. and 9-bp intervals. The amplified frag-

ments were inserted into thc pB1221 vector asdescribed above, Nucleotide s.equences of the am-plified fragments were confirmed with an automatic

DNA sequencer (Prism model 310, PE AppliedBiosystems).

Delivery of DNA coated gold particles into riceembryos

Gold particles (1 /!m in diameter; Tokuriki Hon-ten) were conjugated with DNA at 7 /!g mg~~(DNA per particles) by ethanol precipitation. The

luciferase (Luc) reporter plasmid pAHC1~8 (Chris-

tensen and Quail, 'i996) was always introduced intothe rice embryos as an internal control. Fifty

micrograrns of the gold particles were bombardedinto fivc embryos at a hclium gas pressure cf 4kgfcm~ with a biolistic device (IDERA GIE-Ill.Tanaka). The dis.tance between target tissue and thenozzie of the gun was fixed at 4cm. After bombard-ment, five embryos were incubated in 5ml ofshooting buffer (20 mM sodium succinate pH 5.5,2O mM CaCl~ and 10 f!g ml--~ chloramphenicol) ina petri dish with shaking for 20 h at room temper-at~~re. Ten embryos were then homogenized using amortar and a pestle in 200 f~1 of the cxtractionbuffer containing 10O. mM KP04, 2mM 1,4--dithio-threitol, 2mM EDTA and _5(~/(; glycerol (pH 7.8).The. homogenate was centrifuged at 12,000g for 30min at 4'C and the supernatant was retained f.ormeasurelY}ent of the activities of GUS and Luc. Inthe Luc assay, 20 /1 1of each extract was reactedwith a cornmercial kit (Pica Gene, Toyo Ink). Thepeak light intensity was measured using a luminom-eter (NU 600, Nichion). In the GUS assay, 50 /fl ofeach extract was reacted with 4- methylumbelliferyl

p D -- glucuronide as a substrate according toKosugi et al. (1990). The GUS activity was mea-sured in a spectrofluorophotometer (RF5000, Shi-madzu). The relative GUS activity was normalizedagainst the Luc activity.

Results and Discussion

Repl expression in rice embryoThe expressicn ofRe'pl in the aleurone layers was

induced by GA (Shintani et al., 1997). Uniconazolewas exogenously applied to rice seedlings. How-ever, unicona2z:ole did not effect the levels of Repl

mRNA in the seedlings (Fig. l). The expression of.Repl was found in rice embryos and its level wasnot affected by exogenously applied uniconazole.Previously, RAmylA, a rice a -amylasc gene, wasshown to be expressed in embryos (Itoh et al.,1995). Therefore, we examined the eff.ect of exoge-nously applied uniconazole on the expression of

RAmylA in rice emhryos and found that it did notcompletely suppress the RAmylA expression inseedlings and had only a weak effect on the repres-sion ofRAlrylA expression in the embryo (Fig. l).

GA--induced a -amylase gene expression in thealeurone layers of barley sceds has been shown tobe unaffected by the presence of sugar, whereas

exogenously applied sugars did effect effect a "amylase gene expression in embryos (Perata et al.,

1997). Exogenously applicd uniconazole decreasedthe endogenous GA Ievel in the cmbryos and re-

Fig. 1

Rep1

RAmylA

rRNA

Uni.

Seedling

- +

Embryo

~Si

- +

115

Effccts o~fa GA biosynthesis inhibito.r, unicon-azole, on the gene expression of proteinase

(Repl) and a arnylase (RAmylA). Total RNA(10 /lg per lane) was ana]yzed by 1~1~orthernblo.tting with cDNAs fo.r Repl and RAmylA asprobes. Seedlings (Seedling) or embryos (Em-bryo) were incubatcd in the presence (+) or the

absence () of 50 f!M uniconazole (Uni.). Forthe detection of rRNA, the gel was stained withO~.04 (7r) methylene blue in O.5 M sodium acetatebuffer at pH 5.2.

duced RAmylA mRNA to 300/(; (Loreti et al., 2000).In rice embryos, uniconazole decreased the

RAmylA mRNA Ievel slightly but did not affect theRepl mRNA Ievel (Fig. l). This result suggests thatGA is not required for the expression of Repl in theembryo, and that the meehanisms of expression arediffe.rent in embryos and aleurone layers. Ho et al.(2000) isolated the gene for OsEP3A correspondingto Repl and this promoter region fused to the GUSreporter gene was introduced into rice suspension--cultured cells. The promoter activity of Repl wasincreased by nitrogen starvation.

We examined the effect of nitrogen on Replexpression with a transient assay sy~.tem described

below. The reportcr construct RX-500, includingRepl promoter fused to the GUS gene codingregion, was introduced into rice embryos which

were incubated in medium with or without a nitro-

gen resource, but the presence or absence of nitro-

gen in the medium did not affect Repl promoteractivity (data not shown). The factors involved in

Repl expression in rice embryo remain to be de-fined.

Deletion analysis of the Re'pl PromoterTo delineatc the regiou involved in Repl expres-

sion, we constructed six reporter plasmids derivedfrom pB1221 in the replacement of CaMV 35S RNApromoter with the truncated Re'/;1 Promoter. Whenthe Repl promoter was truncated to --808 or -568,

ll6

pB1221

,,

H X GUS

,, ,II

-808RX-808

RX-568*568

･500RX-500

RX-432*432

.367RX-367

Fig. 2

h-LI RX-184.1 93

O O.1 0.2 O.3 0.4

Relative activity (GUS/LUC)

Deletion analysis of the Repl promoter region. Reporter constructs carry a serics of

truncated promoter regions of RepJ. After bombardment, the rice embryos~ were incubated

for 24 h. Then the enzymatic activities were measured as described in the "Materials and

Methods section". The restriction enzyme recognition sites of HindIII and Xbal areindicated by H and X in pB1221, respectively. Arrows indicate directions of thetranscription of Repl. Relative activity was calculated by dividing the GUS to Luc ratiofrom each construct by the GUS to Luc ratio obtained from pB1221. The results shown aremeans and staadard errors from four independent hombardments.

o.5

GUS activities remained at low levels (Fig. 2).However, the Repl promoter truncated to - 500allowed fivefold higher GUS activity comparedwith those from the above two constructs. Further

deletion of the Repl promoter reduced the GUSactivity. These results suggest that the negative and

positive regulatory elements are located in the

region from - 568 to 500 and from 500 and 432,respectively.

Shintani et al. (1997) showed that GA and ABAregulate the expression of Repl in aleurone layers.

Recently, we found that two GARES that exist in theregion downstream 184 of the Repl promoter wereinvolved in GAinducible expression in the aleu-

rone layers (unpublished data). Thus, it is possible

that the regulation of Repl expression differs in

ernbryos and aleurone layers in germinating rice

seeds.

ldentlfication of the positive regulatory element bylin.ker scan mu.tation

To identify the cisregulatory elements in theregion from 500 to -- 432, point mutations weregenerated from RX-500 as descrlbed in Fig. 3A.

When RX-500lm- Iand RX--50Olm-2 were bom-barded, the GUS activities were reduced signifi-cantly compared with the original plasmid RX-500(Fig. 3B). However, the GUS activity of RX- 500lm3was equal to that of the original construct. These

results indicate that the sequence from 492 to

476 contributes to Repl expression in the embry-

os~.Furthermore, the point mutations in RX 500lw!

4, RX- 500lm5and RX _~00lm -- 6showed reducedGUS activities, whereas the point mutation in RX-500lm7 did not have any effects cn the GUSexpression. This indicates that the sequence from

465 to -442 is also involved in Repl expression.

The fluctuating profile of GUS reporter gene ex-pression as shown in Fig. 3B indicates that theregion from -432 to _500 contains at leas.t twopositive regulatory elements

.

We searched for a putative transcription factorbinding sequence using the Signal Scan program(Higo et a/., 1999) in the Repl promoter regionfrom 500 to 432. As shown in Fig. 4, the regionfrom -500 to -432 contains a Myb binding site,

CGGTTC (Urao et al. , 1993); the core sequence oflow - temperature - responsive element, CCGAC

117

A *500 -432~X See AAOA~*X:rr/~eCC(~A*rCAA~eeA~eTATC+AACAACTCeeT(~e~Crr(..rrGCeeCTCT(~CCTCATC~C:AACCA

RX*SOelm"I ･ ･ ･ ･ ･ ･ cTceAe･ ･ ･ -Xhel

RX-Seehn-2 ･ ･ ･ * * ･ * cTce~e･ ･ * -Xhoi

~X-~Q~~m-3 ･ ･ ･ ･ ･ ･ ･ ･C'~eeAe･ ･ ･ -Xhe~

RX*SOe~m~ ･ ･ ･ ･ ･ ･ ･ ･ ･CTceAG･ ･ ･ -~kc ~

RX-SQQ~m-5 ･ ･ ･ * ･ ･ ･ * C?cGA~･ ･ * -i~*he~

RX-SOe~sT~-6 ･ * ･ * ･ * ･ ･CTCOAe･ ･ ･ ･ -~~T

~X*S~0~ln*?+ ･ ･ ･ ･ ･ * ･ ･CTeeAeXkc~

-500 *432

Ropl promoieF~2

GUS

BRX-5CO

RX*500lm-1

RX*500im-2

RX*500lm*3

RX*500im*4

RX*500im*5

RX-500lm*6

RX-500lm-7

Fig. 3

c.4Relative activity (GUS/LUC)

*500 -432 +32

Repl promoter GUSl.inker-scan analysis of~ the region from 5OO to - 432 of Repl promoter. (A) The

nucleotide sequence of the wild type Repl is shown in the top lanc (RX 500) and thesuccessive point mutation sequences are shown in the lanes beiow (RX500lm- 1. toRX500lrn7, rcspectively). Mutated wc]eotide sequences are underlined. Dots representunaltered nucleotides. A sehematic diagram of the forefather construct, RX- 50O, is shownat the bottom of the constructs. (B) Modeks of linker mutated constructs are shown on the

left. A schematic diagram of the forefather cons.truct. RX 500, is s.hown at the bottom ofthe constructs. A boxed X indicates the point of mutation. Relative activity was calculatedby dividing the GUS to Luc ratio from each construct by the GUS to Luc ratl0. obtainedfrom pB1221. The results shown are means and standard errors fr{~.m three or moreindependent hombardrnents~

.

*,(+~_,r~16=

r~1 r-,AAGAGCTAGCCGATCAACCGACGTATCAACAACTC

-432

GGTGGTCTCTGCGGCTCTGCCTCATCGCAACCAIm-6 lm-7Im*5Im-4

The putative rcgulatory e]ements in the Repl

promoter region fr0.m 5O.O to 432. Under-lining indicates the point mutation sequences of

the constructs used for the linker scan analysis.

The following sequences are indicated by num-bers in blankets: 1, Myb binding site; 2, Iowtemperature~esponse elomerrt; 3, CGACG ele-ment; 4, GATA box; 5, RAVI binding site; and6, bZIP binding site.

118

(Baker et al., 1994); a CGACG element (Hwang etal.

,1998.); a GATA box (Lam and Chua, 1989); and

a RAVI binding site. CAACA (Kagaya et al.,1999). Moreover, we also found a GACGTA se-quence to which the bZIP transcription factor bound(Williams et al., 1992). These sequences are located

betweeu 495 to --469. We could not find anyreported cis--regulatory elements in the region from46_~ to -- 442 involved in Repl gene expression.

The sequence between the point mutation sites of

RX 500lm l. and RX-- 500lm -2 contains four pu-tative regulatory elements. The low -temperature-responsi.ve element is excluded in this report, be-

cause we. focused on the embryospecific expres-s.'ion of Repl. The CGACG element is involved insugar - starvation induction of the rice (~ - amylase

gene. RAm)'3D, in emhryos (Hwang et al., 1998).However, this element may not be involved in Replexpression in the embryos, because sugarstar-vation did not induce Repl expression (HO et al.

,

2000). A Myb transcription factor, GAMyb, isknown to be involved in the GA-inducible expres-sion of genes for a --amylase and proteinase in

aleurone layer cells (Gubler et al., 1995). But the

GARE TAACAC'J interacting with GAMyb, is. dif-ferent from the Myb binding sequence in the regionfrom 500 to 432 in the Repl promoter. Because

Myb transcription factors are encoded by a multi-gene family (Suzuki et al., 1997), Repl expressionin embryos may be regulated by Myb transcriptionfactors differently from GAMyb. The sequeneeGACGTA, recognized by bZIP transcription factors(Williams et al,, 199.2), is found in the promoters of

the genes for cysteine proteinases from leguminousplants (Akasofu et al., 1990; Ogushi et al., 1992).

But these promoters are not well characterized,

although the two genes have been shown to beexpressed in the embryos of germinating seeds

(Yamauchi et al., 1992; Tanaka et al., 1993). It is

possible that the GACGTA motif is involved in theexpression of proteinases iu the embryos of germi-nating sceds.

Acknowledgements

We than.k Dr. Seiichiro Kiyota, National Instituteof Agrobiological Seiences for his gift of rice seeds

and Dr. Peter H. Quail for his gift of the plasmid

pAHC18. We are also grateful to Sumitomo Chem-ical Co., Takarazuka, for providing uniconazole.

References

Aku~ofu, n., Yamauchi, D., Minamikawa, 1'., 19.90. Nucleo-tide sequenee of the gene for sulihydryl- endopeptidase

(sll - EP) from Vigna munga. Nucleic Acids Res., 18:

IS92

Baker, S. S., Wilhelr~, K. S., Thomashow, M. F., 1994. The

5'region of Arabidopsis thaliana corl5a ha~ cis--

acting elements that confer cold-,drought- and ABA -

tegulated gene expression. Plant Mol. Biol., 24: 701-

71 3.

Bewley, J. D., Bkack, M., i994. Seeds: physiofogy of

deveiopment and ge~n~inariou. Prenum Press, New Yorkand I_ondor~.

Cercds, M., G6n~ez-Caden~s, A., Ho, T.-H. D, 1999.

Hormonal regulation of ~1 cysteine proteinase gene, EPB1, in barley aleurone layers: cis- and trans-acting

elements involved in the co ordinated gene expressionregulated by gibbcrellins ~~~d abscisic acid. Pla~t J., 19:

107 118.Christensen, A. H., Qu P. H., 1996_ Ubiquitin pron~ote~--

based vectors for high Ievei expression of sc]ectableand/or screenable marker ge~ies in monocotyledo~ousplants. Transgenic Res,, 5: 21.3 -- 218.

GJuble~, F., Kalla, R., Roberts, J. K.. Jacobsen. J. V., 1995.

Gibberellintegulated expression of a myb gene inbarley aieurone cells: evide~cc for Myb tr~nsactivationof a high --pl a amylase gene promoter. Plant Cell, 7:

1879-- 1891.Higo, K., Ugawa, Y., Iwamoto, M., Kore~laga, T., 1999.

Plant cis acting regulatory DNA elements (PI~.ACE)database: 1999. Nucieic Acids Res., 27: 297- 300.

Ho, S. L.. Tong, W. F.. Yu, S. M., 2000. Multiple ~loderegulation of a cysteine proteirrase gene expression in

rice. Plant Physiol., 122: 57 -- 6.6.

Hwang, Y. S., Karrer, F.. E., 'I'homas. B. R., Chen, L.,

Rodriguez. R. L. P., 1998. 'I'hree cis elements tequiredfor rice a - amylase Amy3D exprcssion during sugarslarvation. Plant Mol. Biol., 36: 331 341..

ltoh, K., Yamaguchi, J., Huang, N., Rodriguez, R. L.,

Akazawa, T., Shimamoto..K., i(,.95. Deveiopme~~tal and

horn~onal regulation of rice a -arnyiase (RA;rylA)gusA f~sion genes in tra~Isgenic rice seeds. Plant

Physiol., 107: 25 - 31.

lzumi, K.. Kamiya, Y., Sakurai, A., Oshio, H.. Takahashi,

N., 1985. Studies of sites of action of a new plantgrowth ~etardant (E) - ~- (4 - Chlorophenyl) - 4,4 - di-nlethl -2 (1,2,4 triazol- yl)-- I-- penten 3 ol in a celifree system froin Cuc~~rbit(~ maxim~. Plant Cell

Physioi., 26: 821 827.

Jefferson, R. A., Kavanagh, T. A., Bevan, M. W., 1987.

GUS fusions: ~glucuro~idase as ~ sensitive andversaiile gene fusio~ marker in higher plants. EMBO J.,6: 3901 3･07.

Kagaya, Y., Ohmiya. K,, Hattori, T,, 1999. RAV1, a novel

DNAbinding protei~, binds~' to bipartite recognition

sequence through two distinct DNAbinding doznainsl~niquely fouDd in highe~ piants. Nucleic Acids Res., 27:

470-- 478.

Kaneko, M., Itoh, H., Ueguchi--Tanaka, M.. Ashikari, M,,

Matsuoka, M., 2002. The a - a~nylase inducticn inendosperm during rice. seed gcrmination is caused bygibberellin synthesized in epitheliunl;. Plant Physiol.,

128: 1264 1.270.Kaf~er, E. E,. Litts, J, C., Rodrigue.2:, R. l.., 1991. Differ-

119

ential expression of a - arrlylase genes in gerrDinatingrice and barley seeds. Plant Mol. Biol., 16: 797 805.

Kato, H., Mina~nikawa. T., 1996. Identification and charac-

terization of a rice cysteine endopeptidase that digests

gluielin. r･iur. J. Biochern., 239: 310 316.Kaio* H., Shintani, A., Minamikawa, T., 1999. The structure

a~d orga~ization of two cysteine endopeptidase genesfrorn rice. Plant Cell Physiol., 40: 462 467.

Koehler, S. M., Ho, T.H. D., 1990. Hor~nonal regulation,processing, and secretion of cysteine proteina~.es in

barley aieurone layers. Pla~t Cell, 2: 769 783.Kosugi, S.. Ohashi, Y., Nakajima, K., A~ai, K,, 1990. An

improved assay for ~ glucurinidase in transforreedcells: methanol alrnos& completely suppresses a putative

endogenous P glucuronidase activity. Plant Sci., 70:~33 - 140.

l.am, E., Chu~, N.H., 19g9. ASF- 2: a factor that binds tothe cauiiflower mosaic virus 35S promotcr and aconserved GATA motif in_ Cab promoters. Plant C~ll, 1:i147 -- 1156.

I.ore~i. E_, Ma:tsukura, C., ('Jubler. F., Alpi. A., Yamaguchi,J., Pcrat~1, P., 2000. Gi~cose repression of a arnylasein b.-irley e~~bryos is independe~t of CJAMYB tr~nscrip-tion. Plant Mol. Biol., 44: 85 90.

Ogushi, Y., Tan',tka, T., Yamauchi, D., Min T.,

1992. Nucleotide sequence of a ger!ef.or an endopep-

tidase (l~･.P-- C1) fr0~l~ Phaseoll~s v~~lgaris. Plant Mol.

Biol., 19i 705 7O6.Petata, P., Matsuoka, C,, Vernieri, P., Yamaguchi, J., 1997.

Su_gar fepression of a gibberelli~-dependent signaiing

pathway in barley embryos. Pl~nt Cell, 9: 2197-- 2208.

Picard, V., Ersdal-Badju, E., I_u, A., Bock, S. C., 1994. A~apid and ef.ficie~t onetube PCR based mutagenesistechnique using Pfu DNA polymerase. Nucieic AcidsRes., 22: 2587-- 2591.

Shi~tani, A.. Kato. H.. Miuan~ikawa, T., 1997. Hormonalrcgulation of expressiou of two cystei~e endopeptidase

genes in rice seedlings. Pla~lt Cell Physiol., 38: 1242124S.

Shintar~i, A., Yarnauchi, D., Minamikawa, T., 1995. Nucieo-tide sequence of C.DNA for a putative cysteine proteasefrom rice seeds. Piant Physiol., l.07: 1025.

Suzuki, A., Suznki, T., Tanabe, F., Toki, S., Washida, H.,

Wu, C. Y., Takaiwa, F., 1997. Cloning and expressionof five myb-related genes fro~n ric-e seed. Gene. 198:

393 398.

Tanaka, T.. Minamikawa, T., Yamauchi, D., Ogushi, Y.,

1993. Expression of an F.ndopeptidase (EPC1) inPhaseolas vulgaris plants. P.Iant Physicl., 101: 421428.

Toyofuku, K., Umemura, T., Yumaguchi, J., i998. P~omoterelements required fo~ sugar r~pression of the RAmy3Dgene for a amylase iri rice, Fk']BS l.ert., 428: 275280.

Umemura, T., Perata, P., Futsuha~a. Y.,Yamaguchi, J., 19.98_

Sugar sensing and a a~nylase gene repression in riceembryos. Piant~, 204: 420 428.

Urao, T., Yamaguchi-Shinozakl, K., Urao, S., Shinozaki,

K., 1993, An Arabidopsis myh homolog is indueed bydehydration stress and its gene produci binds to the

conserved MYB recognitio;~ seque~~ce. Plant Cell, 5:1529 1539.

Williarns, M. E., Foste~, R., Ch~a, N. H., 199^2. Sequencesffanking the hexal~~eric G -- box core CACGTG affectthe specificity of protein bindi~rg. Piant Cell, 4: 485-496.

Yarnauchi, D., Akasofu, H., Mina~~)ikawa, 'I'., 1992. Cys-

teine endopeptidase from Vigna n7u.ngo: gene structure

and expresssior!. Plant Cell Phy~, iol., 28: 789 797.