iobc / wprs · institut de botanique, biochimie rue emile argand 11 bp2 2007 neuchâtel switzerland...

IOBC / WPRS

Working group “Induced resistance in plants against insects and diseases”

Methods in research on induced resistance and tolerance

Proceedings of the meeting

at

Delémont (Switzerland)

2 - 4 November, 2004

Edited by: Annegret Schmitt, Brigitte Mauch-Mani

and Horst Bathon

IOBC wprs Bulletin Bulletin OILB srop Vol. 29 (8), 2006

The content of the contributions is in the responsibility of the authors The IOBC/WPRS Bulletin is published by the International Organization for Biological and Integrated Control of Noxious Animals and Plants, West Palearctic Regional Section (IOBC/WPRS) Le Bulletin OILB/SROP est publié par l‘Organisation Internationale de Lutte Biologique et Intégrée contre les Animaux et les Plantes Nuisibles, section Regionale Ouest Paléarctique (OILB/SROP) Copyright: IOBC/WPRS 2006 The Publication Commission of the IOBC/WPRS: Horst Bathon Federal Biological Research Center for Agriculture and Forestry (BBA) Institute for Biological Control Heinrichstr. 243 D-64287 Darmstadt (Germany) Tel +49 6151 407-225, Fax +49 6151 407-290 e-mail: [email protected]

Luc Tirry University of Gent Laboratory of Agrozoology Department of Crop Protection Coupure Links 653 B-9000 Gent (Belgium) Tel +32-9-2646152, Fax +32-9-2646239 e-mail: [email protected]

Address General Secretariat: Dr. Philippe C. Nicot INRA – Unité de Pathologie Végétale Domaine St Maurice - B.P. 94 F-84143 Monfavet Cedex France ISBN 92-9067-191-0 Web: http://www.iobc-wprs.org

Induced resistance in plants against insects and diseases IOBC/wprs Bull. 29(8), 2006

i

Preface The second meeting of the IOBC/wprs working group (WG) “Induced resistance in plants against insects and diseases” was held in Delémont, Switzerland, in 2004. It was organized as workshop with the title „Methods in research on induced resistance and tolerance“. One major focus was the exchange and discussion of methodological approaches, helping to understand the general and causal processes involved in induced defence reactions of plants against insects and plant pathogens.

Altogether, the workshop attracted 50 participants, of which 13 were students, from 10 European countries, and USA and Russia. As in the last meeting of the WG, the participating senior and younger scientist were originating from many different fields, and consisted e.g. of entomologists, plant pathologists, physiologists, molecular biologists and physicists, thus presenting different methodological approaches (physiological, molecular, applied, physical). During the two-day workshop, a total of 24 oral and 10 poster presentations were given. The sessions covered induced resistance / tolerance in different plant systems, including model systems such as Arabidopsis, and crops of more practical importance in horticulture and agriculture such as tomato, cucumber, grapevine, sugar beet, corn, wheat and even trees. Research aspects of induced resistance against fungal and bacterial plant pathogens and insects and results with different inducers such as chemicals, plant extracts, micro-organisms, and insects were presented. Results from investigations of tritrophic interactions between insect pests – induced plants – predators/parasitoids were adding even more complex insights into the relationships.

The meeting took place in the Centre St. François in Delémont, Switzerland, which offered besides good meeting facilities, nice and cheap accommodation, good and plenty food, and even a cellar bar ,which was used for get-togethers after the working day. The diverse and most interesting contributions from the participants together with the nice location and the smooth local organization by Dr. Brigitte Mauch-Mani (University of Neuchâtel, Institute of Botany, Neuchâtel, Switzerland) and her group led to a well appreciated and fruitful meeting. As for the last workshop, the event was fortunately supported by different sponsors, so that registration fees could be kept low.

Dr. Mauch-Mani established a homepage for the meeting, which has in the meantime become an integral part of our WG as information platform after and for announcements of further meetings. The homepage is kindly hosted under the University of Neuchâtel. The internet address is: http://www.unine.ch/bota/iobc

All information on the up-coming conferences will be available there. The meeting in Delémont gave space to a considerable amount of time for discussion

after the presentations and during the days and evenings. One major discussion point at Delémont concerned the question: What is working, what is not and why? In this respect it was discussed, why results on efficacy of inducers can often not be transferred from the greenhouse to the field, and possible reasons were seen in that the level of induction might already be reached by UV or other stressors so that further enhancement is not possible. Another reason could be that different stress pathways induced in the field, might hinder the induction of the pathway required.

ii

Overall, the workshop fostered the interdisciplinary exchange among the participants and led to very fruitful discussions within the group. The steering committee with Dr. Marcel Dicke, (Wageningen University, Department of Entomology, Wageningen, The Netherlands), Dr. Erkki Haukioja (University of Turku, Department of Biology, Turku, Finland), Dr. Brigitte Mauch-Mani (University of Neuchâtel, Institute of Botany, Neuchâtel, Switzerland), Dr. Annegret Schmitt (Federal Biological Research Centre for Agriculture and Forestry (BBA), Institute for Biological Control, Darmstadt, Germany) together with their liaison officer, Dr. Jürg Huber (BBA, Institute for Biological Control, Darmstadt, Germany) used the time in Delémont to arrange jointly with Dr. Nick Birch (Scottish Crop Research Institute, LEAF Innovation Centre, Invergowrie, Dundee, United Kingdom), convenor of the IOBC/wprs WG “Breeding for plant resistance to pests and diseases” the next meeting. The meeting will be a joint event of both IOBC/wprs WGs and is supposed to increase the exchange between WGs with related topics. Dr. Nikolaos Malathrakis (Technological Education Institute, School of Agriculture, Heraklio, Greece) kindly offered to act as local organiser for this event, which will take place in Heraklio in spring 2006. Also, Dr. Marcel Dicke, offered to act as local host together with Dr. Corné Pieterse (Utrecht University, Department of Biology, Utrecht, The Netherlands) for another joint meeting, together with the “PR-proteins Workshop”, a non-IOBC group, to be held in the Netherlands in spring 2007.

All colleagues and organisations who contributed to the success of our workshop through their efforts and input are highly thanked! Annegret Schmitt Convenor of the IOBC/wprs Working Group Induced Resistance in Plants against Insects and Diseases

iii

Financial support and donations

Andermatt Biocontrol AG, Grossdietwil, CH

CABI Bioscience Switzerland Centre, Delémont, CH

NCCR

National Centre of Competence in Research, Neuchâtel, CH


Contents Preface........................................................................................................................................ i Financial support and donations............................................................................................... iii Contents..................................................................................................................................... v List of Participants .................................................................................................................. vii Method to study the resistance induced by spraying epiphytic yeast against an insect

pest (Cydia pomonella L.) Aude Alaphilippe, Sylvie Derridj, Yigal Elad .................................................................. 1

Analysis of early events involved in signalling pathways leading to plant defense responses X. Daire, D. Wendehenne, A. Lebrun-Garcia, M. Bentéjac, A. Pugin ............................ 5

Apple tree resistance against an insect pest by an elicitor (ASM). Investigations by analyses of the leaf surface metabolites of the tree sites Sylvie Derridj, Alexis Borges .......................................................................................... 9

Investigating the ecology of inducible indirect defence by manipulating plant pheno-type and genotype Marcel Dicke, Maaike Bruinsma, Tibor Bukovinszky, Rieta Gols, Peter W. de Jong, Joop J.A. van Loon, Tjeerd A.L. Snoeren, Si-Jun Zheng ..................................... 15

Cell death or not cell death: two different mechanisms for chitosan and BTH antiviral activity Franco Faoro, Marcello Iriti ........................................................................................ 25

Elucidating the role and regulation of callose in BABA-induced resistance Victor Flors, Jurriaan Ton, Ronald van Doorn, Gabor Jakab, Brigitte Mauch-Mani ............................................................................................................................... 31

Methods to study the role of individual volatile organic compounds (VOCs) in indirect defenses of plants against herbivorous arthropods Matthias Held, Marco D’Alessandro, Ted C. J. Turlings .............................................. 37

Induced resistance to Fusarium head blight in winter wheat Ingerd Hofgaard, Åshild Ergon, Birgitte Henriksen, Hilde Kolstad, Helge Skinnes, Yalew Tarkegne, Anne Marte Tronsmo............................................................ 49

Reverse genetic methods in research on induced resistance of grapevine: development of a vector for shRNA production to induce gene silencing Gabor Jakab, Romain Dubresson, Michael Bel, Mollah Md. Hamiduzzaman, Brigitte Mauch-Mani, Jean-Marc Neuhaus ................................................................... 55

Combined transcript and metabolite analysis reveals genes involved in spider mite induced volatile formation in cucumber plants Iris F. Kappers, Per Mercke, Francel W.A. Verstappen, Oscar Vorst, Marcel Dicke, Harro J. Bouwmeester ........................................................................................ 61

vi

Induction of resistance against tomato powdery mildew (Leveillula taurica) by Acremonium alternatum A.-M. Kasselaki, M.W. Shaw, N.E. Malathrakis1, J. Haralambous .............................. 69

Induction of defence related enzymes and systemic resistance by the plant activator acibenzolar-S-methyl in sugar beet against Cercospora beticola Sacc. Simona Marinello, Pier Luigi Burzi, Claudio Cerato, Stefania Galletti, Roberta Roberti .............................................................................................................. 75

Control of phytopathogenic bacteria by chitosan Anna Maćkowiak-Sochacka, Henryk Pospieszny........................................................... 79

Induced resistance with extracts of Reynoutria sachalinensis: crucial steps behind the scene Annegret Schmitt ........................................................................................................... 85

Silicon as inducer of resistance in tomato against Ralstonia solanacearum Kerstin Wydra, Elie Dannon ......................................................................................... 91

vii

List of Participants Alaphilippe, Aude

Unité de Phytopharmacie et Médiateures Chimiques Route de St. Cyr 78026 Code France Tel.: 0033 13083 3154 Fax: 0033 13083 3119 e-mail: [email protected]

Allégre, Mathilde

INRA-Université de Bourgogne 17, Rue Sully 21065 Dijon CEDEX France e-mail: [email protected]

Bel, Michael Université de Neuchâtel Institut de Botanique, Biochimie Rue Emile Argand 11 BP2 2007 Neuchâtel Switzerland

Birch, Nick Scottish Crop Research Institute Invergowrie, Dundee DD2 5DA United Kingdom Tel: +44 (0)1382 562731 xt 2401 Fax: + 44 (0)1382 562426 (FAO Nick Birch) e-mail: [email protected]

Bodenhausen, Natacha

University of Lausanne Batiment de Biologie 1015 Lausanne Switzerland Tel.: 0041 21 692 4225 e-mail: [email protected]

Bruinsma, Maaike Wageningen University and Research Center Binnenhaven 7 6709 PD Wageningen The Netherlands Tel.: 0031 317 485434 e-mail: [email protected]

Burzi, Pier Luigi

Istituto Sperimentale Colture Industriali Via di Corticella 133 40129 Bologna Italy Tel.: 0039 051631 6837 Fax: 0039 051631 6856 e-mail: [email protected]

Christen, Danilo ETH Zürich Institute of Plant Science Universitätsstrasse 2 8092 Zürich Switzerland Tel.: ++41 (0)1-632-4836 Fax: ++41 (0)1-632-1572 e-mail: [email protected]

D´Alessandro, Marco Université de Neuchâtel Rue Emile Argand 11 2007 Neuchâtel Switzerland Tel.: 0041 32 718 3164 e-mail: [email protected]

Daire, Xavier INRA-Université de Bourgogne 17, Rue Sully 21065 Dijon CEDEX France Tel.: 0033 380 693 104 e-mail: [email protected]

viii

Derridj, Silvie Unité de Phytopharmacie et Médiateures Chimiques Route de St. Cyr 78026 Code France Tel.: 0033 13083 3164 Fax: 0033 13083 3119 e-mail: [email protected]

De Vos, Martin Utrecht University Phytopathology Sorbonnelaan 16 Utrecht 3584 CA The Netherlands Tel.: 0031 30253 6857 Fax: 0031 30251 8366 e-mail: [email protected]

Dicke, Marcel Wageningen University Laboratory of Entomology P.O. Box 8031 6700 EH Wageningen The Netherlands Tel.: 0031 317484311 Fax: 0031 317484821 e-mail: [email protected]

Dubresson, Romain Université de Neuchâtel Institut de Botanique, Biochimie Rue Emile Argand 11 BP2 2007 Neuchâtel Switzerland Tel.: 0041 32 718 2224 Fax: 0041 32 718 2201 e-mail: [email protected]

Faoro, Franco Universita di Milano CNR - Istituto Virologia Vegetale Via Celoria 2 20133 Milano Italy Tel.: 0039 02 5031 6786 Fax: 0031 020 525 7754 e-mail: [email protected]

Felton, Gary Penn State University Dept. of Entomology University Park PA 16802 USA Tel.: 001 814 863 7789 Fax: 001 814 865 3048 e-mail: [email protected]

Finck, Maria R. University of Kassel, Nordbahnhofstrasse 1a, 37213 Witzenhausen Germany Tel.: 0049 5542 981562 Fax: 0049 5542 981564 e-mail: [email protected]

Flors, Victor

University of Neuchâtel Rue Emile Argand 11 2007 Neuchâtel Switzerland Tel.: 0041 32718 2225 Fax: 0041 32718 2201 e-mail [email protected]

Haukioja, Erkki University of Turku Dept. of Biology 20014 Turku Finnland Tel.: 00358 2333 5778 Fax: 00358 2333 6550 e-mail: [email protected]

Heijari, Juha University of Kuopio P.O.Box 1627 70211 Kuopio Finland Tel.: 00358 1716 3199 Fax: 00358 1716 3230 e-mail: [email protected]

Held, Matthias University of Neuchâtel Rue Emile Argand 11 2007 Neuchâtel Switzerland Tel.: 0041 32 718 3161 e-mail: [email protected]

ix

Hofgaard, Ingerd S. Norvegian Crop Research Institute Hogskoleweien 7 1432 AS Norway Tel.: 0047 6494 9278 Fax: 0047 6494 9226 e-mail: [email protected]

Huber, Jürg Federal Biological Research Centre for Agriculture and Forestry (BBA) Institute for Biological Control Heinrichstr. 243 64287 Darmstadt Germany Tel.: 0049 6151 407220 Fax: 0049 6151 407290 e-mail: [email protected]

Iriti, Marcello

Universita di Milano Istituto Patologia Vegetale Via Celoria 2 20133 Milano Italy Tel.: 0039 02 5031 6786 Fax: 0031 020 525 7754 e-mail: [email protected]

Jakab, Gabor Université de Neuchâtel Institut de Botanique, Biochimie Rue Emile Argand 11 BP2 2007 Neuchâtel Switzerland Tel.: 0041 32 718 2225 Fax: 0041 32 718 2201 e-mail: [email protected]

Jourdie, Violaine University of Neuchâtel Rue Emile Argand 11 2007 Neuchâtel Switzerland Tel.: 0041 32 718 3043 e-mail: [email protected]

Kant, Merijn University of Amsterdam IBED Kruislaan 320 Amsterdam 1098 SM The Netherlands Tel.: 0031 20 525 7793 Fax: 0031 20 525 7754 e-mail: [email protected]

Kappers, Iris Wageningen University Department of Entomology p/a Plant Research International P.O. Box 16 6700 AA Wageningen The Netherlands Tel: 0031 317 475882 e-mail: [email protected]

Karavaev, Vladimir M.V. Monolosov Moscow State University Leninskie Gory 119992 Moscow Russia Tel.: 007 95 939 14 89 e-mail: [email protected]

Kravchuk, Jeanna Université de Neuchâtel Institut de Botanique, Biochimie Rue Emile Argand 11 BP2 2007 Neuchâtel Switzerland e-mail: [email protected]

Larmonier, Claire INRA-Université de Bourgogne 17, Rue Sully 21065 Dijon CEDEX France e-mail: [email protected]

Luthe, Dawn S. Mississipi State University Box 9650 Dept. of Biochemistry Mississipi, 39762 USA Tel.: 001 662 325 7733 Fax: 001 662 325 8664 e-mail: [email protected]

x

Lukkerhof, Ludo Wageningen University Department of Entomology p/a Plant Research Internaional P.O. Box 16 6700 AA Wageningen The Netherlands e-mail: [email protected]

Malathrakis, Nikolaos N.E. Technological University, Stavromenos PO Box 1939 Heraklio 71004 Greece Tel.: 0030 2810 379459 Fax: 030 2810 311388 e-mail: [email protected]

Marinello, Simona C.R.A. Istituto Sperimentale per le Colture Industriali V. di Corticella 133 40129 Bologna Italy Tel.: 0039 051 6316842 Fax: 0039051 6316856 e-mail: [email protected]

Mauch-Mani, Brigitte Université de Neuchâtel Institut de Botanique, Biochimie Rue Emile Argand 11 BP2 2007 Neuchâtel Switzerland Tel.: 0041 32 718 2205 Fax: 0041 32 718 2201 e-mail: [email protected]

Mollah, Hamiduzzaman M.D. Université de Neuchâtel Institut de Botanique, Biochimie Rue Emile Argand 11 BP2 2007 Neuchâtel Switzerland Tel.: 0041 32 718 2223 Fax: 0041 32 718 2201 e-mail: [email protected]

Pospieszny, Henryk Institute of Plant Protection Miczurina 20 Str. 60 318 Poznan Poland Tel.: 0048 6186 49094 Fax: 0048 6186 76301 e-mail: [email protected]

Schmitt, Annegret Federal Biological Research Centre for Agriculture and Forestry (BBA) Institute for Biological Control Heinrichstr. 243 D-64287 Darmstadt Germany Tel.: 0049 6151 407241 Fax: 0049 6151 407290 e-mail: [email protected]

Schweikert, Carmen Staatliches Weinbauinstitut Merzauerstrasse 119 79100 Freiburg im Breisgau Germany Tel.: 0049 761401 65891 Fax: 0049 7614016570 e-mail: [email protected]

Snoeren, Tjeerd, T.A.L Wageningen University and Research Center Binnenhaven 7 6709 PD Wageningen The Netherlands Tel.: 0031 317 485434 e-mail: [email protected]

Solntsev, Mikhail M.V. Monolosov Moscow State University Leninskie Gory 119992 Moscow Russia Tel.: 007 95 939 14 89 e-mail: [email protected]

xi

Tamm, Lucius FIBL, Crop Protection Division Ackerstrasse 5070 Frick Switzerland Tel.: 0041 62 8657 238 Fax: 0041 62 8657 273 e-mail: [email protected]

Thürig, Barbara FIBL Ackerstrasse 5070 Frick Switzerland Tel.: 0041 628657 298 Fax: 0041 628657 273 e-mail: [email protected]

Tomczyk, Anna Warsaw Agricultural University Dept. of Applied Entomology Nowoursynowska 166 02787 Warsaw Poland Tel.: 0048 228434942 Fax: 0048 228434942 e-mail: [email protected]

Ton, Jurriaan Utrecht University Section Phytopathology Faculty of Biology PO Box 800.84 3508 TB Utrecht The Netherlands Tel.: 0031 302536860 Fax: 0031 30251036 e-mail: [email protected]

Van Schie, Chris C.N. University of Amsterdam Kruislaan 318 Amsterdam 1098 SM The Netherlands Tel.: 0031 2052 57850 e-mail: [email protected]

Wydra, Kerstin K. University of Hannover Institute of Plant Diseases and Plant Protection Herrenhaeuser Str. 2 30419 Hannover Germany Tel.: 0049 51176 22643 Fax: 0049 51176 23015 e-mail: [email protected]

Zheng, Sijun S. Wageningen University Lab. of Entomology 6700 EH The Netherlands Tel.: 0031 317 482328 Fax: 0031 317 484821 e-mail: [email protected]


pp. 1 - 4

1

Method to study the resistance induced by spraying epiphytic yeast against an insect pest (Cydia pomonella L.) Aude Alaphilippe 1,2, Sylvie Derridj 1,2, Yigal Elad 1,3 1 SafeCrop Centre, Istituto Agrario San Michele all'Adige, Via Mach 1, 38010 San Michele

TN, ITALY [email protected] 2 INRA Unité de Phytopharmacie et médiateurs chimiques, Route de St Cyr, 78 026 Versailles

cedex FRANCE, Fax 00 33 + (0)1 30 83 31 19 3 Department of Plant Pathology, The Volcani Center, P.O.B. 6, Bet-Dagan, 50250 ISRAEL. Abstract : Primary metabolites (sugars) of the phylloplane stimulate the egg laying of the codling moth, Cydia pomonella. By modifying ratios and quantities of these metabolites we can decrease the number of eggs laid on the plants and could modify the development of pathogens. We thus spray apple trees with an epiphytic microorganism, which may modify the phylloplane composition by its metabolism and/or by inducing plant resistance mechanism, and as a consequence, modify the insect egg laying. We first screened epiphytic microorganisms able to survive on apple plant parts and to cover the whole foliage. Then we treated apple trees with one of the selected microorganisms (a yeast), and looked at the effect on egg laying. The preliminary results show that the egg repartition within trees is not changed by the presence of introduced microorganisms, but the egg number laid on trees is reduced up to 60% by the treatment. The first results of the phylloplane chemical analyses showed that the treatment changed the ratios within the sugar blend. Keywords: Cydia pomonella, apple tree, phylloplane, sugars, yeast. Introduction The codling moth, C. pomonella, which is the major insect-pest of apple trees, requires a high number of chemical applications. Over the past few years, it has developed resistance against chemicals, so it is a necessity to search for new alternative control strategies. Primary metabolites, soluble carbohydrates and sugar alcohols of the phylloplane are known to stimulate the egg laying (Lombarkia & Derridj, 2002). The ratios and quantities of these metabolites change according to the season and to the tree site. Four different sites: the fruit, the corymb leaves, the bourse shoot leaves and the distal leaves (all the other leaves), are originally distinguished by the insect for egg laying. The codling moth preference for egg laying may also vary with the season time. Here we plan to modify the composition of the plant surface in order to decrease the number of eggs laid by the codling moth. We thus sprayed an epiphytic yeast on apple trees. We first controlled the number of eggs laid and their distribution within the tree, and secondly looked at the phylloplane composition. Material and methods One and seven day after the treatment, on two treated and two non-treated trees at a time, gravid females were released and leaf surface washings were carried out in order to assure the decrease of eggs laid and the phylloplane composition modification by the yeast spraying.

2

Trees Apple trees from Golden Delicious Smoothee (2832 TR cg 10 M 106 scion VF) variety were 4 years old, 160 cm height, cultivated in containers in the open (Versailles, France). For the duration of the insect tests the trees were placed in the greenhouse. The effect of the yeast treatment was tested one and seven days after treatment. The treatments were carried out in the greenhouses, in order to avoid the dispersal of the microorganisms. Yeast treatment The yeast was grown on Potato Dextrose Agar media (Sigma) at room temperature. The treatment consisted of a solution made of distilled water supplemented with 0.01% of Tween 80 (Sigma) containing around 107 cells/ml of solution. This concentration was evaluated by optical density measured with a spectrophotometer at 450 nanometer. Trees were sprayed with c. 250 ml/tree at 5:00 pm solar time. Insects Mass rearing chrysalides from INRA, Le Magneraud, France, emerging in climatic room, were released on trees at one and seven days after the treatment. Each female was coupled with two males for 48 hours before the release. Forty females were released at 4:00 pm solar time per tree in screen cages in no choice conditions and this test was replicated four times for non-treated and treated plants. The duration of the insect-plant contact was 20 hours one day after treatment and 1 hour seven days after treatment. Counting of eggs on trees were made after the end of the release periods. Collect of plant surface metabolites and chemical analyses Fruits and leaves were sampled at three different sites (corymb, bourse shoot, distal). The samples (leaves and fruits) were collected at 5:00 pm solar time (just after insect release) on different trees than the ones used for the insect tests. Four leaves per site were sampled and four replicates for each site were chemically analysed. Two trees were sampled for each treatment.

The leaf washings were realised by using the method described by Fiala et al. (1990). The petiole, the calyx and stalk zones were covered with paraffin. The apple median part (about 300 cm2) was sprayed with 10 ml of ultra-pure water on each pole (calyx and stalk) in a rotation system in funnel form. Four leaves at a time, each side separately, were sprayed with 10 ml of ultra-pure water per 100 cm². Glucose, fructose, sucrose, quebrachitol, mannitol, sorbitol, myo-inositol were analysed. The samples were dissolved with pyridine and silylated with Bistrimetryl Silyl TriFluoro Acetamide before analyses by gas chromatography coupled to the flame ionisation detector, Delsi Nermag 200 apparatus. Results Incidence of the yeast-treatment on the C. pomonella egg quantities and distribution within the tree The distribution of eggs on the different tree sites within the tree was not changed by the yeast spraying. The majority of eggs were laid on the upper leaf side of the distal leaves. The lower quantity of eggs laid for the second release compared to the first one could be explained by the shorter time the insects were in presence of the trees. The quantity of eggs laid per tree was drastically reduced by the treatment on all the different tree sites and this for both release. One day after the treatment the egg numbers globally laid on the four trees decreased from 257 on the non treated trees down to 100 on the treated trees and seven days after treatment it decreased from 96 down to 45. Since none of the results were significant due to a high variability of the number of eggs laid, a second year of experiments is required to improve the results.

3

a) b)

Figure 1: Effect of the yeast treatment on C. pomonella egg laying in different apple tree sites.

Number of eggs laid per tree site (means ± standard error) one day after treatment (a) and seven days after treatment (b).

a) b)

Figure 2: Quantities (± s.e.) of metabolites on the upper side of the distal leaves one day after treatment(a) and seven days after treatment (b). Glucose (Glu), Fructose (Fru), Sucrose (Suc), Quebrachitol (Que), Mannitol (Man), Sorbitol (Sor) and Myo-inositol (Myo); (*) indicates significant differences of quantities between the control and treated trees according to student tests (p> 0,05).

Effect of the yeast-treatment on the phylloplane composition in soluble carbohydrates and sugar alcohols on the upper side of distal leaves (figures 2 & 3) On the upper side of the distal leaf surfaces one day after spraying the treatment increased the quantity of sacharose and sorbitol compared to the non treated trees (figure 2a).

0

100

200

300

400

500

600

glu fru suc que man sor myo

Qua

ntity

(µg/

cm²

controltreated

0

5

10

15

20

25

30

35

40

45

50

0

2

4

6

8

10

12

14

16

18

20

Corymb distal fruits Bours shootUN uP uN uP uN uP

Corymb distal fruits Bours shootUN uP uN uP uN uP

Mea

n of

egg

s lai

d

Control Treated

0

100

200

300

400

500

600

glu fru suc que man sor myo

*

*

*

*

*

4

Seven days after treatment (figure 2b), the phylloplane composition was strongly modified: the sugar levels decreased except for quebrachitol which increased. This change affected the ratios between soluble carbohydrates and sugar alcohols: within the blend of sugars, half of the composition was represented by soluble carbohydrates on the control leaves but only the third on the treated ones. Conclusion and discussion The yeast spraying drastically decreased one and seven days after treatment the quantity of eggs laid on trees, especially on the upper side of the distal leaves, on which the majority of eggs were laid. The treatment did not affect the egg distribution within the trees. As soon as one day after treatment we noticed that the quantities of sacharose and sorbitol were strongly increased. Seven days after treatment five upon the seven chosen primary metabolites were strongly reduced. These metabolites are egg-laying stimulant and the modification of their ratios or quantities could explain the reduction of eggs laid. We know that low levels of metabolites and ratio modifications can reduce the egg laying (Lombarkia, 2002; Derridj & Borges, 2006). Other chemical modifications, which could affect the insect by contact or before landing on the plant like volatile components may also be changed by this treatment.

In order to establish a correlation between the sugar composition of the phylloplane and the egg laying, we plan to study the egg laying of females on artificial substrates impregnated with the analysed metabolites reproducing the composition of the upper side of the distal leaves of treated and non treated plants in no choice condition. We also plan to evaluate other possible chemical modifications and we currently analyse, the free amino acids present in the phylloplane of treated and non treated plants. The yeast could modify the primary metabolite by its metabolism and catabolism activity, but could also induce defence mechanisms in the plant. Applications of dead yeasts on apple trees may help to identify this activity.

References Derridj, S. & Borges, A. 2006: Apple tree resitance against an insect pest induced by an

elicitor (ASM). Investigations by the analyses of the leaf surface metabolite on tree sites. – IOBC/wprs Bulletin 29(8): 9-13.

Fiala, V., Glad, C. Martin, M., Jolivet, E. & Derridj, S. 1990: Occurrence of soluble carbo-hydrates on the phylloplane of maize (Zea mays L.): variations in relation to leaf hetero-geneity and position on the plant. – New Phytol. 115: 609-615.

Lombarkia, N. & Derridj, S. 2002: Incidence of apple fruit and leaf surface metabolites on Cydia pomonella oviposition. – Entomologia Experimentalis et Applicata. 104: 79-87.


pp. 5 - 7

5

Analysis of early events involved in signalling pathways leading to plant defense responses X. Daire, D. Wendehenne, A. Lebrun-Garcia, M. Bentéjac, A. Pugin UMR INRA 1088 - CNRS 5184 -Université de Bourgogne, Plante-Microbe-Environnement, Dijon, France Abstract: Our work focused on characterisation of intracellular early events following elicitor treatment. Using tobacco and grapevine cell suspensions, we were able to monitor AOS and NO production, Ca influx and concentration variations and MAP kinases activation. These analyses allowed to establish in our models, the relationships between these events. They turned out to be useful to screen candidate elicitor compounds. Introduction Following pathogen recognition or elicitor treatment, signalisation events occurred, resulting in the expression of defense-related genes. We present here some of the methods currently used in our lab to characterise early events in order to decipher signalling pathways leading to defense responses. These methods used cell suspensions, a simplified system which greatly facilitates biochemical analysis and elicitor treatment. These analyses were first set up with the tobacco-cryptogein model (cryptogein is a proteinaceous elicitor secreted by the oomycete Phytophtora cryptogea), and then adapted to grapevine cell suspensions with other elicitors. Methods and results Changes in free cytosolic calcium concentration using aequorin-transformed cells Calcium influx and increase in free cytosolic calcium concentration have been reported to occur in response to various biotic and abiotic stresses. Here, cryptogein treatment triggers a typical biphasic and transient free-calcium elevation in tobacco cells (Lecourieux et al. 2002). Figure 1. Tobacco or grapevine cells expressed aequorine in the cytosol, a jelly-fish protein

which emits luminescence proportionally to Ca++ concentration. In these tobacco cells reconstituted aequorin reports basal [Ca++]cyt level of 150 to 250 nM. Cryptogein induces a characteristic biphasic [Ca++]cyt change during at least 2 hours.

0

0 , 2

0 , 4

0 , 6

0 , 8

1

1, 2

1, 4

1, 6

1, 8

2

0 5 10 15 2 0 2 5 3 0 3 5 4 0 4 5 5 0 5 5 6 0

T i me ( mi n)

C ry p t o g e i n 1 µM

C o n t r o l

6

Active oxygen species production (AOS) in grapevine (gamay) cells treated with oligogalacturonides (OG) AOS production is induced following wounding or biotic stress (Pugin et al., 1997, Wendehenne et al., 2002). AOS have antimicrobial effects and are involved in cell wall reinforcement and defense gene expression. Figure 2. H2O2 production following OG treatment was determined using chemiluminescence

of luminol. Chemiluminescence, measured with a luminometer, was integrated and expressed in nmol of H2O2 per gram fresh weight cells. For each value, values obtained in control cells were subtracted.

Figure 3. Time course activation of two MAP kinases in untreated (control) grapevine cells or

treated with T4BcPG1 (5 µg per gram FWC). Activation was analysed using in gel kinase assay with myelin basic protein as substrate, a MAP kinase preferential substrate (Lebrun et al. 1998).

Figure 4. NO measurement in cryptogein-treated tobacco cells. Cells were incubated for 2 hours with a NO-specific fluorophore (DAF-2DA), then treated with cryptogein. NO production was estimated by measuring fluorescence intensity.

49 kD

45 kD

30 60 5 15 30 45 60

Control TT44BBccPPGG11

0

10

20

30

40

50

0 10 20 30 40 50 60 70

Time (mn)

0

1

2

3

4

5

0 5 10 15 20 25 30 Time (min)

NO

(Rel

. Flu

o.)

7

Mitogen-activated protein kinases (MAPK) activation In plants, many MAPK modules participate to the transduction of stimuli, including elicitors. In this assay, grapevine cells were treated with the endopolygalacturonase I (T4BcPG1) purified from Botrytis culture filtrate, a potent elicitor (Poinssot et al. 2003). Intracellular nitric oxyde (NO) production NO, a gaseous free radical was shown to play an important role in defense, response, though not well elucidated. We showed that NO production can be induced by elicitor in tobacco, grapevine and Arabidopsis cells (Lamotte et al. 2004). Conclusion These biochemical assays allow us to gain insight in defense response signalling, a pharmacological approach was applied to establish the relationships between these events. We showed that the early events found in grapevine after endopolygalacturonase treatment, were quite similar to those in tobacco elicited by cryptogein. Nevertheless, the relationships between early responses are different in both plants. Beside fundamental studies, monitoring early defense responses provides a valuable tool to rapidly screen candidate elicitor compounds. References Lamotte, O., Gould, K.S., Lecourieux, D., Sequeira-Legrand, A., Lebrun-Garcia, A., Durner,

J., Pugin, A. & Wendehenne, D. 2004: Analysis of nitric oxide signalling functions in tobacco cells challenged by the elicitor cryptogein. – Plant physiol. 135: 516-529.

Lebrun-Garcia, A., Ouaked, F., Chiltz, A. & Pugin, A. 1998: Activation of MAPK homo-logues by elicitors in tobacco cells. – Plant J. 15: 773-781.

Lecourieux, D., Mazars, C., Pauly, N., Ranjeva, R. & Pugin, A. 2002: Analysis and effects of cytosolic free calcium increases in response to elicitors in Nicotiana plumbaginifolia cells. – Plant Cell 14: 2627-2641.

Poinssot, B., Vandelle, E., Bentéjac, M., Adrian, M., Levis, C., Brygoo, Y., Garin, J., Sicilia, F., Coutos-Thévenot, P., & Pugin, A. 2003: The endopolygalacturonase 1 from Botrytis cinerea activates grapevine defense reactions unrelated to its enzymatic activity. – Molecular plant. microbe interactions 16(6): 553-564.

Pugin, A., Frachisse, J-M., Tavernier, E., Bligny, R., Gout, E., Douce, R. & Guern, J. 1997: Early events induced by the elicitor cryptogein in tobacco cells: involvement of a plasma membrane NADPH oxidase and activation of glycolysis and pentose phosphate pathway. – Plant Cell 9: 2077-2091.

Wendehenne, D., Lamotte, O., Frachisse, J-M., Barbier-Brygoo, H. & Pugin, A. 2002: Nitrate efflux is an essential component of the cryptogein signalling pathway leading to defence responses and hypersensitive cell death in tobacco. – Plant Cell 14: 1937-1951.


pp. 9 - 13

9

Apple tree resistance against an insect pest by an elicitor (ASM). Investigations by analyses of the leaf surface metabolites of the tree sites Sylvie Derridj, Alexis Borges INRA Unité de Phytopharmacie et Médiateurs Chimiques, Route de St Cyr, 78046 Versailles Cedex, France, [email protected] Abstract: By using the inducer Acibenzolar-S-Methyl (ASM), which has been shown as an inducer of systemic resistance of apple trees against Erwinia amylovora, we induced an antixenosis resistance against the insect pest Cydia pomonella, particularly against egg laying which was reduced by 60 %. To understand the process we had to look at the primary metabolites which are present on the plant surface, known as egg laying stimulant. We had also to differentiate sites within apple tree and particularly the bourse shoot leaves. By these two ways we observed that the treatment induced a reduction of quantities of metabolites present on plant surfaces, soluble carbohydrates and sugar alcohols and changed also their ratios. A negative relationship between sucrose and sorbitol quantities was observed on the bourse shoot leaves. Experiments of egg laying in laboratory on artificial substrates reproducing the sugar compositions of the upper bourse shoot leaf surface we reproduced egg laying reduction by 50% with high level of sucrose and low of sorbitol. Key words: Cydia pomonella, apple tree, egg laying, systemic acquired resistance, plant surface, sugars. Introduction The use of systemic acquired resistance (SAR) as a component in an orchard ecologically based management is expected as a potential tool of control against the bacteria Erwinia amylovora. The aim of our study was to examine eventual resistance elicited by Acibenzolar-S-methyl (ASM) on Cydia pomonella egg laying which is the main insect pest on apple trees. We already demonstrated that acceptance of plant by this insect and its egg laying are influenced by plant metabolites which are present on the plant surface (Lombarkia & Derridj 2002). These metabolites coming from the photosynthesis present in the apoplast pass through the cuticle to the leaf surface (Stammitti et al 1995). SAR which modifies the plant metabolism (Fritig et al. 1994) and metabolite translocation throughout the plant (Treutter 2000) could also modify metabolite composition of the plant surface and consequently the insect behaviour. In the frame of this study we looked at the plant surface metabolite composition and at its relationships with insect egg laying. Material and methods Trees and ASM treatment Apple trees from Golden Delicious Smoothee (2832 TR cg 10 M 106 scion VF) variety were 3 years old, 190 cm height, cultivated in containers in the open (Versailles, France). ASM was sprayed on trees on the 3rd and 6th of June 2003 at the concentration of 100 mg per litter of the active product corresponding to 200 mg per litter of formulated product Bion® at the period of fruit size increase.

10

Insects and bio-tests Mass rearing insects (INRA of Le Magneraud in France) were released on trees between 11 to 19 days after the treatment. Forty females were released at 4h P.M. solar time per tree in screen cages in no choice conditions and this was replicated 4 times for non-treated and ASM treated plant. Counting of eggs on trees were made one hour after insect release in cages.

To test the role of plant surface metabolite blends on egg laying, experiments with artificial substrates were done with single females (10x4 replicates per each treatment) in no choice conditions. We used the bio-tests described by Lombarkia & Derridj 2002. Females tested had been laying eggs for two days before. Artificial substrates (white square nylon of 200 cm2 and 5 µm mesh size) were impregnated with 7 analysed metabolites (glucose, fructose, sucrose, quebrachitol, mannitol, sorbitol, myo-inositol) reproducing the composition of the upper leaf side of the bourse shoot of treated and non-treated plants. Concerning the compositions of the upper leaf side of the treated trees we tested 3 blends found: one with the mean values of each metabolites (mean ASM), two with the mean values except for sucrose and sorbitol: ASM l with low quantity of sucrose and high quantity of sorbitol and ASM 2 with low quantity of sorbitol and high quantity of sucrose.

Concentrations of the solutions in which the clothes were soaked were such as the nylon surface contained quantities similar to those of leaf surface 100-time diluted. After soaking, nylon clothes were dried under the hood at ambient temperature during about 30 min. Top, bottom, and wall of individual cages were lined with impregnated nylon cloth. Collect of plant surface metabolites and chemical analyses: Collects were carried out at 5h P.M. solar time (just after insect observations). The site chosen were the corymb leaves, the bourse shoot leaves and apples. We know already that C. pomonella generally prefer to lay eggs on the corymb leaves near the fruit. These leaves are known to have a similar physiological function as the first leaves of the bourse shoot (Suleman & Steiner 1994) which has about 13 leaves. To distinguish more easily corymb leaves from other leaves we chose the bourse shoot leaves at the 4th and 5th positions from the shoot bottom. Spurs with only one fruit were selected. One replicate consisted of 4 leaves sampled on two spurs. The bourse shoot, corymb leaves and fruit sampled were coming from the same spur. Four replicates per site were analysed chemically.

Collect of metabolites from the leaf surfaces used the method described by Fiala et al. 1990. Samples were silylated with pyridine and phenyl β–D glucopyranoside and bis-(trimethylsilyl)-trifluoroacetamide before analyses by gas chromatography coupled to the flame ionisation detector, Delsi Nermag 200 apparatus. We analysed glucose, fructose, sucrose, quebrachitol, mannitol, sorbitol, myo-inositol, Results Incidence of ASM treatment on the metabolite composition of apple tree surface of the different sites According to the apple tree site, the modifications of the surface composition were different and more or less variable. On corymb leaf surfaces the treatment induced a great variability on the under leaf side. It did not permit to show any significant modifications except for the

ng/cm² Glucose Fructose Sucrose Québrachitol Mannitol Sorbitol Myo-InositolNon treated 7,84 14,23 31,38 3,15 3,62 24,95 7,59mean ASM 3,13 8,95 7,39 1,99 1,96 31,71 2,74ASM 1 3,13 8,95 5,26 1,99 1,96 52,21 2,74ASM 2 3,13 8,95 10,10 1,99 1,96 5,90 2,74

11

sorbitol which increased after treatment (Fig. 1a). On the upper leaf side in spite of less variations there were no modifications due to treatment. No more effect of treatment was detected on the apple surfaces (fig. 1b). The main modifications due to the treatment were on the upper leaf side of the bourse shoot leaves on which less quantities of glucose, sucrose mannitol, myo-inositol were registered (Fig. 1c). On this site analyses amongst the replicates showed a negative correlation between sucrose and sorbitol quantities (Fig 1d).

Figure 1. Quantities of metabolites on the upper side of the corymb leaves (a), apple (b) and on the upper side of the bourse shoot leaves (c) by the ASM treatment vs. non treated. (d) negative correlation between sucrose and sorbitol quantities on the upper side of the bourse shoot leaves. * significant difference between treated and non treated plants for each metabolite p=0.05 Mann Whitney test.

Incidence of ASM treatment on egg laying Numbers of eggs per tree were dramatically reduced (60 %) by the treatment (Fig. 2). The distribution of eggs on the different sites within the tree was not changed by the treatment. The majority of eggs were laid on the upper leaf side of the bourse shoot leaves and apples. The main reduction was on the bourse shoot leaves (Fig. 2). Influence of leaf surface sugars of the bourse shoot leaves on egg laying No difference was observed on the female acceptance of the different substrates. When reproducing the primary metabolite blends found on the bourse shoot leaf surfaces on artificial substrate we reduced by 50% the eggs per female with the lowest quantity of sorbitol and the highest one in sucrose (Fig. 3).

0

10

20

30

40

50

60

Glu

cose

Fruc

tose

Sac

char

ose

Qué

brac

hito

l

Man

nito

l

Sor

bito

l

Myo

-Inos

itol

ng/c

m2 (m

eans

+/-

s.e.

)vvv

Nontreated

Treatedwith ASM

b)

0

10

20

30

40

50

60

Glu

cose

Fruc

tose

Sac

char

ose

Qué

brac

hito

l

Man

nito

l

Sor

bito

l

Myo

-Inos

itol

ng/c

m2 (m

eans

+/-

s.e.

)vvv

*

*

* *

c)

050

100150200250300350400450

Glu

cose

Fruc

tose

Sac

char

ose

Qué

brac

hito

l

Man

nito

l

Sor

bito

l

Myo

-Inos

itol

ng/c

m2 (m

eans

+/-

stan

dart

err

or)s

sss

y = -8,90x + 97,48R2 = 0,99

0

10

20

30

40

50

60

0 2 4 6 8 10 12

ng/cm2 of Sucrose

ng/c

m2 o

f Sor

bito

lsss

s

d)

a)

12

Figure 2. Reduction of C. pomonella eggs on treated trees by ASM treatment. * significant difference between treated and non treated sites p=0.05 Mann Whitney test.

Figure 3: Egg-laying on artificial substrates impregnated with blends of 7 metabolites found on the upper leaf side surface of the bourse shoots of ASM treated plants (mean ASM, ASM 1, ASM 2) vs. blend of non-treated plants. * significant difference with non treated p=0.05 Mann Whitney test.

Conclusion - discussion ASM treatment induced variability on the leaf surface composition in primary metabolites. A decrease of metabolites was well observed only on the bourse shoot leaves. This dramatically reduced C. pomonella egg numbers on this site on which the most of the eggs were laid within the tree. ASM could interfere in the translocation of sucrose and sorbitol between the source (growing shoot leaves) and sink constituted by reserve tissues of the fruit (Arnold & Schultz 2002). Consequently the modified composition of the apoplast can also modify the leaf surface composition. These two metabolites are egg-laying stimuli and the modification of their ratios can reduce egg laying.

We could reproduce on artificial substrates the egg laying reduction by high level of sucrose and low level of sorbitol. We know already that low levels of sorbitol can reduce the

0

5

10

15

20

1

Num

ber o

f egg

s pe

r fem

ales

ssss

whi

ch la

y eg

gs (m

eans

+/-

s.e.

)bbb

*

Non treated

mean ASM ASM 1 ASM 2

0102030405060708090

Eggs

per

tree

& p

er s

ite

(mea

ns +

/- st

anda

rt e

rror

)vvv

Distal leaves Bourse shoot leaves

Corymb leaves

*

*

Und

er s

ide

Und

er s

ide

Und

er s

ide

Upp

er s

ide

Upp

er s

ide

Upp

er s

ide

App

le

Bra

nch

All

site

s

Non treatedTreated with ASM

13

egg laying (Lombarkia & Derridj 2002), this does not exclude an eventual effect of egg laying reduction also by high levels of sucrose.

Other chemical modifications, which could act on the insect by contact or before landing on the plant like volatile components, could also be concerned in the effect of ASM. References Arnold, T.M. & Schultz, J.C. 2002: Induced sink strength as a prerequisite for induced tannin

biosynthesis in developing leaves of Populus. – Oecologia 130: 585-593. Fiala, V., Glad, C. Martin, M., Jolivet, E. & Derridj, S. 1990: Occurrence of soluble carbo-

hydrates on the phylloplane of maize (Zea mays L.): variations in relation to leaf hetero-geneity and position on the plant. – New Phytologist 115: 609-615.

Fritig, B., Heitz, T., Stinzi, A., Kauffmann, S., Pellegrini, L., Saindrenan, P., Geoffroy, P. & Legrand, M. 1994: Mécanismes moléculaires de défense des plantes vis à vis de micro-organismes pathogènes: détermination, signaux et régulation. – 10ème colloque sur les recherches fruitières. Angers 15 et 16 mars: 15-29.

Lombarkia, N. & Derridj, S. 2002 : Incidence of apple fruit and leaf surface metabolites on Cydia pomonella oviposition. – Entomologia Experimentalis et Applicata 104: 79-87.

Suleman, P. & Steiner, P.W. 1994: Relationship between sorbitol and solute potential in apple shoots relative to fire blight symptom development after infection by Erwinia amylovora. – Phytopathology 84 (10): 1244-1250.

Stammitti, L., Garrec, J.G. & Derridj, S. 1995: Permeability of isolated cuticles of Prunus laurocerasus to soluble carbohydrates. – Plant Physiology and Biochemistry 33 (3): 319-326.

Treutter, D. 2000: Induced resistance in plant pathology. Consequences for the quality of plant foodstuffs. – Journal of Applied Botany 74: 1-4.


pp. 15 - 23

15

Investigating the ecology of inducible indirect defence by manipulating plant phenotype and genotype Marcel Dicke, Maaike Bruinsma, Tibor Bukovinszky, Rieta Gols, Peter W. de Jong, Joop J.A. van Loon, Tjeerd A.L. Snoeren, Si-Jun Zheng Laboratory of Entomology, Wageningen University, P.O. Box 8031, NL-6700 EH Wageningen, The Netherlands, www.dpw.wau.nl/ento/english Abstract: A challenge for ecologists has been to understand how individual traits of organisms affect species interactions and community dynamics. Recent breakthroughs provide ecologists with delicate manipulative tools in which mechanistic knowledge of well-characterized genotypes and phenotypic plasticity can be exploited to study the effect of individual plant traits on interactions in ecosystems. Food webs are overlaid with infochemical webs that mediate direct and indirect interactions. It is increasingly clear that indirect interactions can have important effects on community dynamics. Infochemicals are interesting in this respect because they cannot be directly used in bodybuilding, yet the responses they elicit have important consequences for fitness, and thus for interactions in a community. Infochemicals from plants influence interactions with members of different trophic levels, such as carnivores and herbivores. The infochemical-phenotype of plants is plastic: infochemical emission is an active and specific process that is induced by herbivory. The infochemicals attract carnivores that affect the herbivore population. Additionally, the infochemicals also affect herbivore behaviour and characteristics of neighbouring competitor plants. Careful manipulation of the phenotypically plastic emission by plants provides unique opportunities to investigate the effect of the infochemicals on food-web interactions. This novel approach creates an essential link between molecular, chemical, behavioural and community ecology. Introduction A major challenge for biology in the 21st century is to integrate research approaches that address different levels of biological organisation: i.e. from subcellular processes all the way to community processes. A pressing issue in ecology is to understand how direct and indirect interactions among individual organisms influence food webs and community dynamics. This can now be addressed through a novel integration of approaches: from ecogenomics, through behavioural ecology to community ecology.

Chemical cues are a major source of information for very different organisms ranging from microorganisms to mammals (e.g. Dicke & Grostal 2001, Kats & Dill 1998, Roitberg & Isman 1992, Tollrian & Harvell 1999). Chemical information affects various behaviours that underlie population dynamics and food web interactions, including the selection of food, the selection of mates, competition and the avoidance of predators (e.g. Dicke & Vet 1999, Hilker et al. 2002, Kats & Dill 1998, Roitberg & Isman 1992, Sabelis et al. 1999, Turlings & Benrey 1998). Therefore, chemical information is an important factor influencing species interactions and most likely also community processes (Vet 1998). However, the study of chemical information conveyance has been mostly restricted to studies at the level of individual organisms and the identification of the chemicals that convey the information. The influence of chemical information on food web processes has received little attention (Hunter 2002, Van der Meijden & Klinkhamer 2000, Vet 1998), in contrast to effects of direct trophic interactions (Morin 1999). Yet, circumstantial evidence indicates that chemical information from phenotypically plastic plants can have important influences on food web dynamics through indirect effects that combine bottom-up and top-down effects (Dicke & Vet 1999,

16

Sabelis et al. 1999). Empirical support should come from manipulative experiments (manipulations of plant infochemical phenotype) that compare food web processes in the presence and absence of plant infochemicals. The ability to manipulate the infochemical phenotype of plants in specific and well-known ways is indispensable for this approach. Such experiments have recently come within reach. A plant’s infochemical phenotype can be either altered by manipulating the phenotype directly or by manipulating the genotype with subsequent effects on the phenotype (e.g., De Boer & Dicke 2004, Degenhardt et al. 2003, Kessler & Baldwin 2001, Van Poecke & Dicke 2002; Dicke et al. 2004, Kessler et al. 2004). Food webs Food webs describe the trophic relationships between sets of interacting species. The comprehensive analysis of a complete food web provides major problems because of the large number of species involved. Therefore, most food web analyses are restricted to a subset of strongly interacting species. The recently developed quantitative food web analysis has been successfully used to obtain detailed information on potential direct and indirect interactions that connect species in a community (Rott & Godfray 2000). Quantitative food web analysis includes quantitative and dynamic aspects of food webs and therefore provides insight into food web processes rather than a static representation of a food web. Moreover, it can also be used for comparative analyses. For instance, Omacini et al. (2001) compared an aphid-parasitoid web on Italian ryegrass that was either grown from endophyte-free or endophyte (Neotyphodium)-infected seed. They showed that presence of the endophyte affected relative aphid abundance and subsequently influenced food-web complexity. On endophyte-free plants, species complexity was higher through an increased number of trophic interactions per species, and the number of indirect links through shared natural enemies. Infochemical webs Every member of a food web produces infochemicals that can influence direct interactions between the producer of the cues and the organisms that respond to them. Moreover, an infochemical that is released into the environment can be exploited by any organism of the community to meet its own needs. As a result, infochemicals mediate ample indirect interactions as well (Dicke & Vet 1999, Hilker & Meiners 2002, Sabelis et al. 1999, Turlings & Benrey 1998). For instance, herbivore-induced plant volatiles may deter or attract herbivores, but they also indirectly affect carnivore-herbivore interactions through attraction of carnivores (predators and parasitoids). Differential responses by different carnivore species may mediate the degree to which they compete for the same resource or interact through intraguild predation. Carnivorous arthropods largely rely on herbivore-induced plant volatiles in locating herbivores or their microhabitat from a distance. Moreover, herbivore-induced plant volatiles can also affect herbivore-plant and carnivore-herbivore interactions on neighbouring plants through their effect on the neighbour’s phenotype (Dicke & Vet 1999, Sabelis et al. 1999). In summary, a food web is overlaid by a highly reticulate infochemical web (Dicke & Vet 1999, Shiojiri et al. 2001). This infochemical web is affected by, and affects, food-web interactions.

Infochemical emission by an organism not only changes its phenotype from e.g. an inconspicuous to an apparent one, but through its multiple effects on members of the community it can also change food web interactions and community composition (Vos et al. 2001). However, infochemically mediated interactions are usually exclusively investigated for isolated interactions within food webs to date.

17

Manipulation of plant phenotype and effects on interactions with community members It has been well established that herbivory or herbivore oviposition induces the emission of plant volatiles that attract carnivorous enemies of the herbivores (Hilker & Meiners 2002). This has been recorded for plant species in at least 13 families (Dicke & Vet 1999). The herbivore-induced plant volatiles are actively produced by the plants, which involves the induction of enzyme activity (Bouwmeester et al. 1999, Degenhardt & Gershenzon 2000, Pare & Tumlinson 1997, Van Poecke et al. 2001). This active process is mediated by signal-transduction in the plant, leading from the recognition of the herbivore (response to herbivore elicitors), via signal transduction pathways, to induced gene expression. The major signal-transduction pathway involved is the octadecanoid pathway through e.g. jasmonic acid (JA), and 12-oxophytodienoic acid (OPDA) (Hopke et al. 1994, Van Poecke & Dicke 2004). In addition, the salicylic acid (SA) pathway (Ozawa et al. 2000, Van Poecke & Dicke 2004) and the ethylene pathway (Horiuchi et al. 2001, Kahl et al. 2000) are also involved.

Furthermore, chemical analysis has shown that the major groups of induced volatiles comprise

(a) fatty acid derivatives (green leaf volatiles) such as (Z)-3-hexen-1-ol, (b) terpenoids such as 4,8-dimethyl-1,3(E),7-nonatriene and (c) phenolics such as methyl salicylate (for review see Dicke & Van Poecke 2002). The attraction of carnivores benefits the plants as was shown by e.g. the effects on seed

production (Fritzsche-Hoballah & Turlings 2001, Van Loon et al. 2000). The volatile blends that are emitted by herbivore-damaged plants are complex mixtures of up to 200 compounds and carnivores are sensitive to many, but not all of these compounds (Dicke et al. 1990, Smid et al. 2002, Turlings & Fritzsche 1999). The composition of the mixture can be important for carnivore response (De Moraes et al. 1998, Takabayashi & Dicke 1996). This complicates the analysis of the contribution of individual plant volatiles to carnivore attraction and thereby their contribution to plant fitness. However, recent developments have overcome this difficulty and allow exciting new experiments to be done through careful phenotypic manipulation. Manipulations of volatile emission The mechanistic knowledge on (a) the process of induction and (b) the identity of the emitted volatiles allows specific manipulation of the plant’s phenotype in terms of the volatile blends in several ways. (1) Effects of individual compounds added to intact plants. Individual components of the

volatile blend can be added to intact plants to investigate their effect on carnivore attraction. In this way one makes a simple – artificial – modification of the plant’s phenotype, i.e. the addition of a single odour component. Carnivores are usually attracted to mixtures of volatiles (Dicke et al. 1990, Turlings & Fritzsche 1999, Turlings et al. 1991), but still attraction to individual components is also recorded (Dicke et al. 1990, Kessler & Baldwin 2001). This method allows to establish the effect of individual characteristics (individual components) by themselves against a natural background of odours of undamaged plants in the laboratory and in the field.

(2) Comparison of complete blend, incomplete blends and supplemented incomplete blends. Investigating the role of individual components within a more complex blend is possible as well. Compounds from the signal-transduction pathways that underlie the induction process can be applied to a plant. Each of these compounds induces a specific subset of the total volatile blend (Koch et al. 1999). For instance, jasmonic acid (component of the octadecanoid pathway) induces a similar, though not identical, volatile blend in plants compared to herbivory. This has been demonstrated for several plant species, including

18

Brassicaceae (Dicke et al. 1999, Koch et al. 1999, Van Poecke 2002). The volatile blends emitted by partially induced plants were attractive to carnivores, although herbivore-infested plants were more attractive (Dicke et al. 1999, Van Poecke & Dicke 2004). With knowledge on the composition of the total blend induced by herbivory, and the composition of the elicitor-induced blend it is possible to add one or more compounds that are not induced by the elicitor while they are by herbivory. In this way one has an excellent tool to investigate the effect of individual plant characteristics on interactions with community members: one can compare the effect of the natural blend to that of the elicitor-induced blend as well as to the effect of the supplemented elicitor-induced blend (De Boer & Dicke 2004)

Manipulation of plant genotype and effects on interactions with community members Extensive knowledge exists on the ecology of induced plant volatiles related to brassicaceous plants (e.g. Agelopoulos & Keller 1994, Geervliet et al. 2000, Mattiacci et al. 1995, Shiojiri et al. 2001, Takabayashi & Dicke 1996). In recent years we have demonstrated that the brassicaceous plant Arabidopsis thaliana responds to herbivory in a similar way as other members of the plant family (Van Poecke & Dicke 2004).

In addition, Arabidopsis has as a major advantage that its use allows a novel, molecular genetic approach to the investigation of the ecology of herbivore-induced plant volatiles. The complete genome of Arabidopsis has been sequenced and there is an abundant supply of genotypes that are modified with respect to signal-transduction leading to induced responses (Mitchell-Olds 2001), including induced plant volatiles (Van Poecke & Dicke 2004). Genomic information in combination with knowledge on the identity of genes involved in induced volatile emission also allows to identify specific Arabidopsis lines from existing collections that have been derived from mutagenesis treatments. Such lines have a mutation in the specific gene of interest (e.g. Krysan et al. 1996). Moreover, Arabidopsis is easily transformed so that novel traits may be incorporated into the genome that may be investigated in an ecological context. Arabidopsis thaliana and its wild relatives have been recognized as a good model plant for ecological investigations (Mitchell-Olds 2001, Van Poecke & Dicke 2004). Advantages of a molecular genetic approach In the interaction of organisms with their environment, each individual expresses a complex phenotype that is subject to plasticity in response to the environment or in response to the individual’s phenology. In fact, the phenotype is not a static but a highly dynamic feature. The changes may occur over different levels of organisation (from the organelle to the organ) and over different temporal scales (from milliseconds to days or longer). Moreover, the phenotype is influenced by many genetic components. To investigate the contribution of individual traits, one should ideally manipulate that trait so as to affect its expression in the natural – though complex – way. The best way of doing this is to use mutants that are altered in the expression of the trait (Roda & Baldwin 2003, Van Poecke & Dicke 2004). In fact, comparing mutants with their relevant wildtype allows to analyse the effects of genetic variation in single traits. Genotypic variation and plant volatiles Signal transduction pathways: - Three major signal transduction pathways are known to be involved in the induction of plant volatiles: the octadecanoid, the salicylic acid and the ethylene pathways (Dicke & Van Poecke 2002 for review). Well-characterized genotypes that are altered in these signal transduction pathways are available for Arabidopsis (Pieterse & Van Loon 1999, Reymond et al. 2000, Walling 2000). These genotypes allow the analysis of the

19

involvement of the signal transduction pathways with a chirurgic kind of accuracy. A single gene has been modified and thus a single step in signal production or signal perception has been altered. These genotypes have been successfully used in the study of induced resistance against phytopathogenic microorganisms (Pieterse & Van Loon 1999, Walling 2000). Such well-characterized genotypes are now used to investigate the effect of single traits on interactions mediated by herbivore-induced plant volatiles (Van Poecke & Dicke 2002). As a result, it is possible to evaluate the new information in the context of induced responses to other environmental variation such as the attack by pathogens (e.g. Pieterse & Van Loon 1999).

Modification of volatile biosynthesis: - The volatile blend emitted by several brassica-caeous plants in response to herbivory has been well characterized (e.g. Geervliet et al. 1997, Mattiacci et al. 1995, Van Poecke et al. 2001). Genes that are involved in the production of these volatiles have been sequenced (e.g. Aharoni et al. 2000, Bohlmann et al. 1998, 2000). With this information mutant collections that have been obtained by ems-mutagenization or T-DNA insertion can be screened for specific genotypes that are altered (insertion, knock-out) in the gene of interest.

Novel volatiles: - Plants have evolved different kinds of herbivore-induced-volatile characteristics, ranging from producing novel compounds in response to herbivory to producing a blend that is similar to the blend emitted in response to mechanical damage (Dicke & Vet 1999). It has been postulated that novel compounds provide carnivores with more reliable information than compounds that are also induced by mere mechanical damage (Vet et al. 1998). Carnivorous arthropods are well known to learn to respond to herbivore-induced plant volatiles (Turlings et al. 1993). A parasitoid that has experienced a novel odour during a successful foraging bout learns to respond to the novel odour during subsequent foraging (Turlings et al. 1993). Employing Arabidopsis allows to investigate the effect of novel odours as well. Arabidopsis can easily be transformed and this may be done with genes such as terpene synthase genes (Chen et al. 2003, Dudareva & Pichersky 2000). Thus, the effect of certain volatiles can be investigated in a new background of volatiles. For instance, the insertion of a terpene synthase gene from strawberry, under the 35S promoter, into potato results in the constitutive emission of linalool by the transgenic potato plants. As a result the transgenic potato plants constitutively attract the predatory mite Phytoseiulus persimilis that is known to be attracted to linalool (Bouwmeester et al. 2003). Conclusion Ecologists have long recognized the importance of understanding mechanisms to further knowledge on the ecology of interactions between organisms. Inducible defences are characterized by large scale changes in gene expression. Knowledge of these changes can be exploited in different ways. It will allow ecologists to monitor how plants respond to different environmental stresses, both biotic and abiotic stress. Moreover, it will allow to investigate whether and how their responses to different stresses overlap or differ in qualitative/ quantitative aspects or in temporal and spatial aspects. Furthermore, it will enable ecologists to design manipulative experiments that can carefully address specific questions related to inducible defences. As a result, the large-scale reductionist investments in the study of mechanistic aspects of plant biology will provide important tools for ecologists to investigate functional aspects of the interactions of plants with their environment. At present these tools are available for a limited number of plant species, but most likely this number will increase rapidly.

Ecologists can use these new tools to address questions that could not be answered so easily until now. Some of these questions in the context of inducible defences are: (1) How

20

does gene-expression change in response to different biotic and abiotic stresses and how does this affect the plant phenotype and consequently the interactions within a food web context? (2) What is the effect of different combinations of biotic stresses, such as the simultaneous attack of different herbivorous arthropods, or the simultaneous attack of a pathogen and a herbivore? (3) How do different abiotic conditions affect the responses of plants to attackers? (4) How do plants respond to chemical information from neighbouring plants that are attacked by herbivores or pathogens.(5) What is the contribution of certain inducible defence characteristics to plant fitness?

By careful and precise manipulation of the emission of complex volatile blends by plants in response to herbivory, or herbivore oviposition, the effect of individual compounds can be established on interactions with community members. A final goal is to manipulate volatile blends under field conditions to investigate the effects of the plant characteristics on community processes (Dicke et al. 2004, Kessler & Baldwin 2001, Kessler et al. 2004). Combining studies on mechanisms with ecological studies on food-web interactions will thus provide important novel insights in the functioning of natural communities. References Agelopoulos, N.G. & M.A.Keller 1994. Plant-natural enemy association in the tritrophic

system, Cotesia rubecula-Pieris rapae-Brassicaceae (Crucifera): I. Sources of infochemicals. – J. Chem. Ecol. 20: 1725-1734.

Aharoni, A., L.C.P. Keizer, H.J. Bouwmeester, Z.K. Sun, M. Alvarez-Huerta, H.A. Verhoeven, J. Blaas, A.M.M.L. van Houwelingen, R.C.H. De Vos, H. van der Voet, R.C. Jansen, M. Guis, J. Mol, R.W. Davis, M. Schena, A.J. van Tunen & A.P. O'Connell 2000. Identification of the SAAT gene involved in strawberry flavor biogenesis by use of DNA microarrays. – Plant Cell 12: 647-661.

Bohlmann, J., G. MeyerGauen & R. Croteau 1998. Plant terpenoid synthases: Molecular biology and phylogenetic analysis. – Proc. Natl. Acad. Sci. USA 95: 4126-4133.

Bohlmann, J., D. Martin, N.J. Oldham & J. Gershenzon 2000. Terpenoid secondary metabolism in Arabidopsis thaliana: cDNA cloning, characterization and functional expression of a myrcene/ocimene synthase. – Archives of Biochemistry and Biophysics 375: 261-269.

Bouwmeester, H.J., F. Verstappen, M.A. Posthumus & M. Dicke 1999. Spider-mite induced (3S)-(E)-nerolidol synthase activity in cucumber and Lima bean. The first dedicated step in acyclic C11-homoterpene biosynthesis. – Plant Physiology 121: 173-180.

Bouwmeester, H.J., I.F. Kappers, F.W.A. Verstappen, A. Aharoni, L.L.P. Luckerhoff, J. Lücker, M.A. Jongsma & M. Dicke 2003. Exploring multi-trophic plant-herbivore interactions for new crop protection methods. – In: International Congress of Crop Science and Technology, Vol. 2, 10-12 November 2003, Glasgow, British Crop Protection Council, Alton, UK: 1123-1134.

Chen, F., D. Tholl, J.C. D'Auria, A. Farooq, E. Pichersky & J. Gershenzon 2003. Biosynthesis and emission of terpenoid volatiles from Arabidopsis flowers. – Plant Cell 15: 481-494.

De Boer, J.G. & M. Dicke 2004. The role of methyl salicylate in prey searching behavior of the predatory mite Phytoseiulus persimilis. – J. Chem. Ecol. 30: 255-271.

De Moraes, C.M., W.J. Lewis, P.W. Paré, H.T. Alborn & J.H. Tumlinson 1998. Herbivore-infested plants selectively attract parasitoids. – Nature 393: 570-573.

Degenhardt, J. & J. Gershenzon 2000. Demonstration and characterization of (E)-nerolidol synthase from maize: a herbivore-inducible terpene synthase participating in (3E)-4,8-dimethyl-1,3,7-nonatriene biosynthesis. – Planta 210: 815-822.

21

Degenhardt, J., J. Gershenzon, I.T. Baldwin & A. Kessler 2003. Attracting friends to feast on foes: engineering terpene emission to make crop plants more attractive to herbivore enemies. – Current Opinion in Biotechnology 14: 169-176.

Dicke, M. & L.E.M. Vet 1999. Plant-carnivore interactions: evolutionary and ecological consequences for plant, herbivore and carnivore. – In: H. Olff, V. K. Brown, and R.H. Drent, editors. Herbivores: Between Plants and Predators. Blackwell Science, Oxford, UK: 483-520.

Dicke, M. & P. Grostal 2001. Chemical detection of natural enemies by arthropods: an ecological perspective. – Annu. Rev. Ecol. Syst. 32: 1-23.

Dicke, M. & R.M.P. Van Poecke 2002. Signalling in plant-insect interactions: signal transduction in direct and indirect plant defence. – In: D. Scheel & C. Wasternack, editors. Plant Signal Transduction. Oxford University Press, Oxford: 289-316.

Dicke, M., J.J.A. van Loon & P.W. de Jong 2004. Ecogenomics benefits community ecology. – Science 305: 618-619.

Dicke, M., R. Gols, D. Ludeking & M.A. Posthumus 1999. Jasmonic acid and herbivory differentially induce carnivore-attracting plant volatiles in lima bean plants. – J. Chem. Ecol. 25: 1907-1922.

Dicke, M., T.A. Van Beek, M.A. Posthumus, N. Ben Dom, H. Van Bokhoven & A.E. De Groot 1990. Isolation and identification of volatile kairomone that affects acarine predator-prey interactions. Involvement of host plant in its production. – J. Chem. Ecol. 16: 381-396.

Dudareva, N. & E. Pichersky 2000. Biochemical and molecular genetic aspects of floral scents. – Plant Physiology 122: 627-633.

Fritzsche-Hoballah, M.E. & T.C.J. Turlings 2001. Experimental evidence that plants under caterpillar attack may benefit from attracting parasitoids. – Evolutionary Ecology Research 3: 553-565.

Geervliet, J.B. F., M.A. Posthumus, L.E.M. Vet & M. Dicke 1997. Comparative analysis of headspace volatiles from different caterpillar-infested and uninfested food plants of Pieris species. – J. Chem. Ecol. 23: 2935-2954.

Geervliet, J.B.F., M.S.W. Verdel, H. Snellen, J. Schaub, M. Dicke & L.E.M. Vet 2000. Coexistence and niche segregation by field populations of the parasitoids Cotesia glomerata and C. rubecula in the Netherlands: predicting field performance from laboratory data. – Oecologia 124: 55-63.

Hilker, M. & T. Meiners 2002. Induction of plant responses to oviposition and feeding by herbivorous arthropods: a comparison. – Entomol. Exp. Appl. 104: 181-192.

Hilker, M., O. Rohfritsch & T. Meiners 2002. The plant´s response towards insect egg depostion. – In: M. Hilker & T. Meiners, editors. Chemoecology of Insect Eggs and Egg Deposition. Blackwell Publishers, Berlin: 205-233.

Hopke, J., J. Donath, S. Blechert & W. Boland 1994. Herbivore-induced volatiles: the emission of acyclic homoterpenes from leaves of Phaseolus lunatus and Zea mays can be triggered by a ß-glucosidase and jasmonic acid. – Febs Letters 352: 146-150.

Horiuchi, J., G. Arimura, R. Ozawa, T. Shimoda, J. Takabayashi & T. Nishioka 2001. Exogenous ACC enhances volatiles production mediated by jasmonic acid in lima bean leaves. – Febs Letters 509: 332-336.

Hunter, M.D. 2002. A breath of fresh air: beyond laboratory studies of plant volatile-natural enemy interactions. – Agric. For. Entomol. 4: 81-86.

Kahl, J., D.H. Siemens, R.J. Aerts, R. Gäbler, F. Kühnemann, C.A. Preston & I.T. Baldwin 2000. Herbivore-induced ethylene suppresses a direct defense but not a putative indirect defense against an adapted herbivore. – Planta 210: 336-342.

22

Kats, L.B. & L.M. Dill 1998. The scent of death: Chemosensory assessment of predation risk by prey animals. – Ecoscience 5: 361-394.

Kessler, A. & I.T. Baldwin 2001. Defensive function of herbivore-induced plant volatile emissions in nature. – Science 291: 2141-2144.

Kessler, A., R. Halitschke & I.T. Baldwin 2004. Silencing the jasmonate cascade: Induced plant defenses and insect populations. – Science 305: 665-668.

Koch, T., T. Krumm, V. Jung, J. Engelberth & W. Boland 1999. Differential induction of plant volatile biosynthesis in the Lima bean by early and late intermediates of the octadecanoid signaling pathway. – Plant Physiology 121: 153-162.

Krysan, P.J., J.C. Young, F. Tax & M.R. Sussman 1996. Identification of transferred DNA insertions within Arabidopsis genes involved in signal transduction and ion transport. – Proc. Natl. Acad. Sci. USA 93: 8145-8150.

Mattiacci, L., M. Dicke & M.A. Posthumus 1995. beta-Glucosidase: an elicitor of herbivore-induced plant odor that attracts host-searching parasitic wasps. – Proc. Natl. Acad. Sci. USA 92:2036-2040.

Mitchell-Olds, T. 2001. Arabidopsis thaliana and its wild relatives: a model system for ecology and evolution. – Trends Ecol. Evol. 16: 693-700.

Morin, P.J. 1999. Community Ecology. – Blackwell Science, Oxford. Omacini, M., E.J. Chaneton, C.M. Ghersa & C.B. Muller 2001. Symbiotic fungal endophytes

control insect host-parasite interaction webs. – Nature 409: 78-81. Ozawa, R., G. Arimura, J. Takabayashi, T. Shimoda & T. Nishioka 2000. Involvement of

jasmonate- and salicylate-related signaling pathway for the production of specific herbivore-induced volatiles in plants. – Plant and Cell Physiology 41: 391-398.

Pare, P.W. & J.H. Tumlinson 1997. De novo biosynthesis of volatiles induced by insect herbivory in cotton plants. – Plant Physiology 114: 1161-1167.

Pieterse, C.M.J. & L.C.Van Loon 1999. Salicylic acid-independent plant defence pathways. – Trends in Plant Science 4: 52-58.

Reymond, P., H. Weber, M. Damond & E.E. Farmer 2000. Differential gene expression in response to mechanical wounding and insect feeding in Arabidopsis. – Plant Cell 12: 707-719.

Roda, A.L. & I.T. Baldwin 2003. Molecular technology reveals how the induced direct defenses of plants work. – Basic Appl. Ecol. 4: 15-26.

Roitberg, B.D. & M.B. Isman, editors 1992. Insect Chemical Ecology. An Evolutionary Approach. – Chapman & Hall, New York.

Rott, A.S. & H.C.J. Godfray 2000. The structure of a leafminer-parasitoid community. – Journal of Animal Ecology 69: 274-289.

Sabelis, M.W., M. van Baalen, F.M. Bakker, J. Bruin, B. Drukker, M. Egas, A.R.M. Janssen, I.K. Lesna, B. Pels, P. Van Rijn & P. Scutareanu 1999. The evolution of direct and indirect plant defence against herbivorous arthropods. – In: H. Olff, V.K. Brown & R.H. Drent, editors. Herbivores: Between plants and predators. Blackwell Science, Oxford: 109-166.

Shiojiri, K., J. Takabayashi, S. Yano & A. Takafuji 2001. Infochemically mediated tritrophic interaction webs on cabbage plants. – Population Ecology 43: 23-29.

Smid, H.M., J.J. A. van Loon, M.A. Posthumus & L.E.M. Vet 2002. GC-EAG-analysis of volatiles from Brussels sprouts plants damaged by two species of Pieris caterpillars: olfactory receptive range of a specialist and a generalist parasitoid wasp species. – Chemoecology 12: 169-176.

Takabayashi, J. & M. Dicke 1996. Plant-carnivore mutualism through herbivore-induced carnivore attractants. – Trends Pl. Sci. 1: 109-113.

23

Tollrian, R. & C.D. Harvell, editors 1999. The Ecology and Evolution of Inducible Defenses. – Princeton University Press, Princeton NJ.

Turlings, T.C.J. & B. Benrey 1998. Effects of plant metabolites on behavior and development of parasitic wasps. – Ecoscience 5: 321-333.

Turlings, T.C.J. & M.E. Fritzsche 1999. Attraction of parasitic wasps by caterpillar-damaged plants. – In: D.J. Chadwick & J. Goode, editors. Insect-Plant Interactions and Induced Plant Defence (Novartis Foundation Symposium 223). John Wiley & Sons, Chicester: 21-32.

Turlings, T.C.J., J.H. Tumlinson, R.R. Heath, A.T. Proveaux & R.E. Doolittle 1991. Isolation and identification of allelochemicals that attract the larval parasitoid, Cotesia marginiventris (Cresson), to the microhabitat of one of its hosts. – J. Chem. Ecol. 17: 2235-2251.

Turlings, T.C.J., F.L. Wäckers, L.E.M. Vet, W.J. Lewis & J.H. Tumlinson 1993. Learning of host-finding cues by hymenopterous parasitoids. – In: D.R. Papaj and A.C. Lewis, editors. Insect learning: ecological and evolutionary perspectives. Chapman & Hall, New York: 51-78.

Van der Meijden, E. & P.G.L. Klinkhamer 2000. Conflicting interests of plants and the natural enemies of herbivores. – Oikos 89: 202-208.

Van Loon, J.J.A., J.G. De Boer & M. Dicke 2000. Parasitoid-plant mutualism: parasitoid attack of herbivore increases plant reproduction. – Entomol. Exp. Appl. 97: 219-227.

Van Poecke, R.M.P. 2002. Indirect defence of Arabidopsis against herbivorous insects. Combining parasitoid behaviour and chemical analyses with a molecular genetic approach. – PhD thesis Wageningen University.

Van Poecke, R.M.P. & M. Dicke 2002. Induced parasitoid attraction by Arabidopsis thaliana: involvement of the octadecanoid and the salicylic acid pathway. – J. Exp. Bot. 53: 1793-1799.

Van Poecke, R.M.P. & M. Dicke 2004. Indirect defence of plants against herbivores: Using Arabidopsis thaliana as a model plant. – Plant Biology 6: 387-401.

Van Poecke, R.M.P., M.A. Posthumus & M. Dicke 2001. Herbivore-induced volatile production by Arabidopsis thaliana leads to attraction of the parasitoid Cotesia rubecula: Chemical, behavioral, and gene-expression analysis. – J. Chem. Ecol. 27: 1911-1928.

Vet, L.E.M. 1998. From chemical to population ecology: infochemical use in an evolutionary context. – J. Chem. Ecol. 25: 31-49.

Vet, L.E.M., A.G. de Jong, E. Franchi & D.R. Papaj 1998. The effect of complete versus incomplete information on odour discrimination in a parasitic wasp. – Animal Behaviour 55: 1271-1279.

Vos, M., S. Moreno Berrocal, F. Karamaouna, L. Hemerik & L.E.M. Vet 2001. Plant-mediated indirect effects and the persistence of parasitoid-herbivore communities. – Ecol. Lett. 4: 38-45.

Walling, L.L. 2000. The myriad plant responses to herbivores. – Journal of Plant Growth Regulation 19: 195-216.


pp. 25 - 29

25

Cell death or not cell death: two different mechanisms for chitosan and BTH antiviral activity Franco Faoro, Marcello Iriti CNR, Istituto di Virologia Vegetale, Sezione di Milano; Istituto di Patologia Vegetale, Università di Milano,Via Celoria 2, 20133 Milano, Italy Abstract: Two plant activators, benzothiadiazole (BTH) and chitosan, have been used in this study, comparing their efficacy and mechanisms of action in the Phaseolus vulgaris/tobacco necrosis necrovirus (TNV) system.

Both compounds induced local (LAR) and systemic acquired resistance (SAR) to TNV, though to a different extent. Furthermore, SAR was fully established after different induction times in the two systems, namely 7 days for BTH and 2-4 days for chitosan.

Histo-cytochemical investigations showed that BTH treatments raised H2O2 level homogeneously in the leaf tissues, without triggering cell death. In parallel, peroxidases activity, which regulates H2O2 homeostasis, was evenly enhanced as well, accounting for the high reduction in both size and number of lesions caused by TNV challenging inoculation. Instead, chitosan treatments induced numerous callose deposition sites, followed by a network of micro HR-like lesions formed by small groups of dead cells in the palisade mesophyll. DAB staining showed that micro-lesions are the consequence of localised H2O2 accumulation, and in turn, of localised micro-oxidative bursts. Thus, it is likely that chitosan-induced micro-lesions are responsible for the observed high local resistance, meanwhile generating signals for the induction of SAR. Key words: bean, benzothiadiazole, Bion, chitosan, H2O2, HR, PCD, SAR, TNV. Introduction Plant active response can be triggered with synthetic or natural compounds, namely “plant activators”, that, alike natural elicitors, up-regulate an array of plant defence genes and the onset of a broad spectrum, long lasting and systemic immunity, defined as systemic acquired resistance (SAR) (Kuć, 1982, Ryals et al., 1996). Hypersensitive response (HR), a peculiar form of programmed cell death (PCD), is involved at the onset of SAR, via NIM/NPR1 pathway (Heath, 1998). However, HR/PCD is neither necessary nor sufficient for SAR establishment, which, in turn can depend from reactive oxygen species (ROS) homeostasis, balancing them below a sub-lethal threshold (Levine et al., 1994).

Among plant activators, benzothiadiazole (BTH) and chitosan deserve particular attention, being also reported as antiviral compounds (Friedrich et al., 1996; Pospieszny et al., 1991). BTH, a salicylic acid functional analogue, induces phenylalanine ammonia-lyase (PAL), phytoalexin and pathogenesis related protein (PR) synthesis (Friedrich et al., 1996). Chitosan is a deacetylated chitin derivative whose antiviral activity strongly depends on both polymerisation (D.P.) and deacetylation (D.D.) degree (Chirkov, 2002).

We have previously demonstrated the efficacy of BTH in inducing resistance in bean to Uromyces appendiculatus (Iriti and Faoro, 2003) and of chitosan to tobacco bushy stunt tombusvirus (TBSV) (Faoro et al., 2001). In both cases the induced resistance was correlated with the accumulation of H2O2 in leaf tissues. We now show, using the pathosystem Phaseolus vulgaris/tobacco necrosis necrovirus (TNV), that different mechanisms underlay the antiviral properties of the two plant activators.

26

Material and methods Plant material and treatments Phaseolus vulgaris plants, cv. Borlotto Nano Lingua di Fuoco (BLF), were sown in 12 cm pots and grown in greenhouse at temp. 24±2°C, RH 60±5%, 16 h/8 h light/dark period. Ten-12 days after sowing, when the primary leaves were almost completely expanded, plants were sprayed with water solution of BTH [Benzo-(1,2,3)-thiadiazole-7-carbothioic acid S-methyl ester] (trade name Bion®, Syngenta, CH) at the concentration of 0.3 mM, prepared from a wettable formulation containing 50% (w/w) active ingredient (a.i.). Control plants were sprayed with water containing the wettable powder alone. A second treatment was carried out 2 days later to reduce SAR activation time (Iriti and Faoro, 2003). Chitosan treatments were carried out with the same timing. The compound was dissolved in 0.05% acetic acid at the concentration of 0.2% (Faoro et al., 2001) and the pH adjusted at 5.6. In this case, control plants were sprayed with 0.05% acetic acid. Both BTH and chitosan treatments were performed on primary leaves, meanwhile keeping secondary leaves covered with plastic bags, to avoid direct contact with the compounds. Virus inoculation A purified suspension of tobacco necrosis necrovirus (TNV), 500 ng/ml, was mechanically inoculated on both primary and first developed secondary leaves of bean plants, using a 600 mesh carborundum as an abrasive. Four groups (BTH-treated, chitosan- treated and respective controls) of 10 plants each, were tested in three repeated experiments. Inoculation was carried out either 2 or 5 days after the last treatment, and 4-5 days later, when the necrotic lesions were fully developed, each inoculated leaf was collected and immediately scanned at 300 Dpi. The digitalised images were then analysed with software from Data Translation, USA (Global lab), to measure the number and size of necrotic lesions. Evaluation of induced resistance The degree of local acquired resistance (LAR) has been evaluated considering the number of lesions per 102 cm2 of primary leaf, and is expressed as percentage reduction of lesions in comparison with untreated control. Systemic acquired resistance (SAR) has been evaluated in the same way, in inoculated secondary leaves. Histo-cytochemistry Leaf disks, 1 cm in diameter, were randomly punched with a cork-borer from primary leaf of either untreated and treated plants, and stained with Evans blue, to identify dead cell in the tissues. Other disks were infiltrated overnight with 1 mg·dm-3 3,3’-diaminobenzidine (DAB)-HCl, to detect H2O2 accumulation sites and peroxidase activity in vivo. The detailed protocols have been previously reported (Iriti and Faoro, 2003). Finally, some leaf disks were stained with aniline blue, to verify callose deposition (Eschrich and Currier, 1964), or with DAPI to identify collapsed nuclei (Thordal-Christensen et al., 1997). All samples were examined with an Olympus BX50 light microscope (Olympus, Japan), equipped with differential interference contrast (DIC) and epi-polarization filters. Results and discussion Resistance induction experiments showed that both BTH and chitosan are able to activate LAR and SAR to TNV in bean, though to different extent and after a different induction phase (IP) (Fig. 1). In particular, after a 4-day IP (Fig. 1a), chitosan proved to be more efficient than BTH in the induction of both LAR and SAR, with a reduction of the lesion number of 95,6% in the primary treated leaves, and of 95,2% in the secondary, untreated ones, in comparison with a reduction of 89,8% and 47,8%, respectively, in BTH treated

27

plants. Instead, after a 7-day IP, the induction of LAR was not significantly different using either chitosan or BTH (100% and 99,3% reduction in TNV lesions, respectively). However, after this longer IP, the level of SAR decreased in chitosan treated plants and increased in BTH treated ones (88,9% and 99,3% reduction in TNV lesions, respectively). Whatever the induction time and the resistance activator used, the lesion size was significantly reduced both in primary and secondary leaves.

Figure 1. Number of virus lesions per 102 cm2 (means±SE) of leaf tissues, when TNV was inoculated 2+2 (a) and 2+5 (b) days of induction phase (IP).

Histo-cytochemical investigations showed that BTH treatments raised H2O2 level homogeneously in the leaf tissues, without inducing cell death (Fig 2a,e). In parallel, peroxidases activity, which regulates H2O2 homeostasis, was evenly enhanced as well in the same tissues (not shown), accounting for the high reduction in both size and number of lesions caused by TNV challenging. Instead, chitosan treatments induced numerous callose deposition sites (Fig. 2c), followed by a network of micro HR-like lesions formed by small groups of dead cells in the palisade mesophyll (Fig 2b). These dead cells were mainly localized in the substomatal cavity (Fig. 2d), suggesting that chitosan enters the leaf through stomata and acts on nearby cells. DAB staining showed that micro-lesions are the consequence of localised H2O2 accumulation in the mesophyll cells (Fig. 2f), that is localised micro-oxidative bursts.

In conclusion, both compounds activate LAR and SAR, via an oxidative burst due to H2O2 accumulation. In BTH-treated tissues, H2O2 is uniformly localised on epidermal cell

Evaluation of induced resistance after 2+2 days of IP

0

10

20

30

40

50

Control BTH Chitosan100% -89,8% /-47,8% -95,6%/-95,2%

num

ber T

NV le

sion

s Primary leaves (LAR)Secondary untreated leaves (SAR)

a

Evaluation of induced resistance after 2+5 days of IP

020

406080

100

120140

Control BTH Chitosan100% -99,3% /-99,4% -100%/-88,9%

num

ber T

NV

lesi

ons Primary leaves (LAR)

Secondary untreated leaves (SAR)

b

28

wall at a sub-lethal level, without stimulating a cell death program, while in chitosan treated ones it accumulates in a few cells, causing them to die and generating micro-lesions. H2O2 acts, then, as a double edge sword for cell, balancing cell death and/or transducing external stimuli, but concerting, in any case, plant inducible defences. The fact that SAR induced by BTH, once established, remains higher than that induced by chitosan, is possibly due to the hormone-like nature of BTH itself, which mimics salicylic acid defence role, up-regulating the defence gene set. Instead, chitosan activity seems to be more tightly dependent from single elicitation of a few cells, thus involving a lower level of systemic signals. In this view, the high LAR level, induced by chitosan against TNV, is likely due to the enhanced peroxidase activity, already observed by other authors (Pospieszny and Giebel, 1996) and as a cause/consequence of the localised H2O2 accumulation in the mesophyll tissues (Bee et al., 2001).

Figure 2. Bean leaves treated with BTH (a,e) and chitosan (b,c,d,f) stained with Evans blue to assess cell death (a,b,d), aniline blue for callose (c) and DAB to localise H2O2 (e,f). Groups of dead cell are visible only in chitosan treated plants (b, arrows), in correspondence of callose deposition sites (c, arrow); dead cells are mainly those surrounding the substomatal cavities (d). H2O2 accumulation, due to BTH, occurs uniformly in the epidermal cell wall (e, arrow), while H2O2 induced by chitosan is localised in few mesophyll cells (f, arrow).

References Blee, K.A., Jupe, S.C., Richard, G., Zimmerlin, A., Davies, D.R. & Bolwell, G.P. 2001:

Molecular identification and expression of the peroxidase responsible for the oxidative burst in French bean (Phaseolus vulgaris L.) and related members of the gene family. – Plant Molecul. Biol. 47: 607-20.

29

Chirkov, S.N. 2002: The antiviral activity of chitosan (Review). – Appl. Biochem. Microbiol. 38: 1-8.

Eschrich, W. & Currier, H.B. 1964: Identification of callose by its diachrome and fluoro-chrome reactions. Stain technol. 39: 303-307.

Faoro, F., Sant, S., Iriti, M., Maffi, D. & Appiano, A. 2001:Chitosan-elicited resistance to plant viruses: a histochemical and cytochemical study. – In: Chitin Enzymology, ed Muzzarelli: 57-62.

Friedrich, L., Lawton, K., Ruess, W., Mesner, P., Speker, N., Gut Rella, M., Meier, B., Dincher, S., Staub, T., Uknes, S., Métraux, J.P., Kessmann, H. & Ryals, J. 1996: A benzothiadiazole derivative induces systemic acquired resistance in tobacco. – Plant J. 10: 61-70.

Heath, M.C. 1998: Apoptosis, programmed cell death and the hypersensitive response. – Eur. J. Plant Pathol. 104: 117-124.

Iriti, M. & Faoro, F. 2003: Benzothiadiazole (BTH) induces cell-death independent resistance in Phaseolus vulgaris against Uromyces appendiculatus. – J. Phytopathol. 151: 171-180.

Kuć, J. 1982: Induced immunity to plant disease. – Bioscience 32: 854-860. Levine, A., Tenhaken, R., Dixon, R.A. & Lamb, C. 1994: H2O2 from the oxidative burst

orchestrates the plant hypersensitive disease resistance response. – Cell 79: 583-593. Pospieszny, H. & Giebel, J. 1996: Peroxidase activity is related to the resistance against

viruses induced by chitosan. – In: Chitin Enzymology, Vol.II, ed. Muzzarelli: 379-383. Pospieszny, H., Chirkov, S. & Atabekov, J.G. 1991: Induction of antiviral resistance in plants

by chitosan. – Plant Sci. 79: 63-68. Ryals, J.A., Neuenschwander, U.H., Willits, M.G., Molina, A., Steiner, H.Y. & Hunt, M.

1996: Systemic acquired resistance. – Plant Cell 8: 1809-1819. Thordal-Christensen, H., Zhang, Z., Wei, Y. & Collinge, D.B. 1997: Subcellular localization

of H2O2 in plants. H2O2 accumulation in papillae and hypersensitive response during the barley-powdery mildew interaction. – Plant J. 11: 1187-1194.


pp. 31 - 35

31

Elucidating the role and regulation of callose in BABA-induced resistance Victor Flors 1,2, Jurriaan Ton 1,3, Ronald van Doorn 1, Gabor Jakab 1, Brigitte Mauch-Mani 1 1 Laboratory of Biochemistry, Institute of Botany, University of Neuchâtel, Rue Émile-Argand 11, Case Postale 2, 2007 Neuchâtel. Switzerland. 2Departamento de Ciencias Experimentales, Área de Fisiología Vegetal, Universitat Jaume I, Borriol s/n, 12071 Castellón. Spain. 3Section Phytopathology, Faculty of Biology, Utrecht University, PO Box 80084, 3508 TB Utrecht, The Netherlands Abstract: Priming plants for enhanced callose deposition has emerged lately as one of the major mechanisms of resistance against necrotrophic fungal pathogens. We have previously shown that the resistance inducer β-aminobutyric acid (BABA) primes for callose accumulation after pathogen attack and that this effect can be totally reversed through the application of the callose inhibitor 2-DDG. To further investigate the role of callose in resistance we have tested the callose deficient pmr4 (powdery mildew resistant-4) mutant. pmr4 does not show BABA-induced resistance (IR) against Plecto-sphaerella cucumerina. Additionally, our results demonstrate that pmr4 is resistant to Pseudomonas syringae and displays a constitutive expression of PR-1. Although it is known that BABA can prime for PR-1 expression this is not the case in pmr4 since here the SA pathway is constitutively activated and thus it has already a high PR-1 expression level. pmr4 is also impaired in BABA-IR against the necrotrophic fungus Alternaria brassicola due to the lack of callose accumulation upon infection or BABA treatment. In the case of the oomycete Hyaloperonospora parasitica pmr4 shows a resistant phenotype. Here, the lack of callose rescues the repression of the SA pathway. To elucidate the role of callose in BABA-IR against H. parasitica and its relation with the SA pathway we tested the double mutants pmr4-npr1 and pmr4-pad4 which are blocked in different steps of SA pathway. Both showed wild type phenotype against the oomycete and were also protected by BABA. In contrast, the double mutant pmr4-NahG was hypersusceptible to the H. parasitica and could not be protected by BABA. BABA-IR against H. parasitica is usually attributed to an activation of callose deposition, priming of the hypersensitive response and trailing necrosis. We observed that the double mutant pmr4-npr1 is still able to accumulate more pathogen-induced callose upon BABA treatment and also shows induced trailing necrosis as observed in the pmr4-pad4 mutant.

Based on our results we conclude that priming for callose deposition is essential for BABA-IR against A. brassicicola and is an important, but not the unique mechanism for BABA protection against H. parasitica since the induction of trailing necrosis can also contribute to stop the pathogen. Additionally, NPR1 and PAD4 seem not to be essential for trailing necrosis induction and the resulting resistance, while NahG and pmr4 mutations abolish BABA-IR against H. parasitica. Key words: BABA, pmr4, induced resistance, Alternaria brassicicola, callose. Introduction The non-protein amino acid β-aminobutyric acid (BABA) is a potent inducer of resistance against a wide range of biotic and abiotic stresses. Applied as a soil drench or foliar spray, BABA has been shown to protect against viruses, bacteria, oomycetes, fungi, nematodes and abiotic stresses (Sticher et. al. 1997; Zimmerli et. al. 2000, 2001; Cohen 2002). A common characteristic of the induced resistance phenomenon is that it is associated with an enhanced

32

capacity to express cellular defense responses, which are induced specifically upon attack by a pathogen. In Arabidopsis, the induced resistance by BABA is based on various mechanisms. Against P. syringae and B. cinerea, BABA-IR was found to correlate with and enhanced and earlier transcription of the SA-inducible PR-1 gene in wild-type plants, whereas NahG and npr1 plants failed to express BABA-IR (Zimmerli et. al. 2000, 2001).

BABA-IR against the necrotrophs Alternaria brassicicola and Plectosphaerella cucumerina seems to be controlled neither by the JA nor the SA signalling pathway. On the contrary, mutants impaired in ABA sensitivity or synthesis are blocked in BABA-IR against P. cucumerina as well as the mutant pmr4 defective in a pathogen induced callose synthase (At4g03550) (Nishimura et. al. 2003).

Additionally, callose deposition has been also shown to be important for defense against Hyaloperonospora parasitica. In this interaction BABA can prime for callose deposition around the site of pathogen penetration. Interestingly, pmr4 is more resistant to H. parasitica although this is probably due to a negative regulation of the SA signalling pathway by callose.

Here, we present our studies on the role and interaction between callose and the SA signalling pathway in BABA-IR against the necrotroph A. brassicicola, the bacterium P. syringae and the biotroph H. parasitica. Materials and methods Induced resistance bioassays Treatments with BABA were performed with 5-6 week-old Arabidopsis accession Columbia (Col-0) and the mutant pmr4 (Col-0 background) plants. Two days after treatment with water (control) or BABA (300 µM), plants were inoculated by dipping the leaves in a suspension of virulent P. syringae pv. tomato DC3000 (2.5x107 CFU mL-1). Disease was rated as described by Zimmerli et. al. (2000).

For A. brassicicola bioassays 5 week-old Col-0 and pmr4 plants were soil drenched with water or 150 µM BABA and inoculated two days after the treatment by applying 6-µl droplets containing 2x106 spores mL-1 of A. brassicicola pit-bull 3. Disease rating and stainings were performed as described by Ton & Mauch-Mani (2004).

H. parasitica bioassays were performed with three-week-old Col-0, pmr4, pmr4-NahG, pmr4-npr1 and pmr4-pad4 seedlings soil-drenched with water or 80 µM BABA. Two days after BABA induction, plants were challenge inoculated with H. parasitica strain NOCO by spraying 5 x 104 conidiospores per mL. Conidiospore production was scored 8 days after inoculation. For visualization of trailing necrosis, infected leaves were stained with lactophenol trypan-blue and examined microscopically 8 days after inoculation, as described by Koch & Slusarenko (1990). Quantification of callose deposition Infected leaves for callose quantification were destained overnight in 95% ethanol. Staining for callose and quantification were performed according to Ton and Mauch-Mani (2004). Results and discussion pmr4 is as resistant to Pst as Col-0 BABA-treated plants, probably due to a constitutive expression of the SA signalling pathway Application of BABA in Arabidopsis plants results in an induced resistance against the aggressive strain of Pst DC3000 (Zimmerli et. al. 2000). In this case a functional SA pathway is necessary to express BABA-IR. Surprisingly, the pmr4 mutation results in a gain-of-

33

function like phenotype showing resistance towards P. syringae (Fig 1). The lack of a functional callose synthase seems to leas to a recovery of the SA pathway from its repression by callose. In accordance with this hypothesis, PR-1 shows a constitutive expression in pmr4 that is not dependent on BABA treatment (data not shown).

1000

10000

100000

Col0 (H2O) Col0 BABA pmr4 H2O pmr4 BABA

Bact

eria

l gro

wth

log

(c.f.

u/m

g fw

)

a

b

b

b

Figure 1. Protective effect of BABA in Arabidopsis infected with Pst DC 3000 by dipping in

a bacterial cell suspension. Leaves of wild type (Col0) and mutant (pmr4) plants were analyzed for bacterial density 3 days after inoculation.

0

10000

20000

30000

40000

50000

60000

70000

80000

0 24 48 72 96 120 144

hours after inoculation

callo

se in

tens

ity (y

ello

w p

ixel

s/m

illio

n) Col-0 waterCol-0 BABApmr4.1 waterpmr4.1 BABA

0

10

20

30

40

50

60

70

48 72 96 120 144

time (hours)

% d

esea

sed

leav

es

pmr4 waterpmr4 BABACol-0 waterCol-0 BABA

a

b

c

c

b

aa

a

c

c

c

a

a

c

Figure 2. A) Quantification of BABA-induced resistance in Col-0 and pmr4 plants against A.

brassicicola. Percentage of diseased leaves was scored at different time points. B) Callose accumulation in water- and BABA-treated Col-0 and pmr4 upon infection with A. brassicicola.

pmr4 is impaired in BABA-IR against the necrotrophic fungus A. brassicicola due to the lack of callose accumulation upon infection or BABA treatment As shown previously BABA-IR against A. brassicicola is based on a primed accumulation of callose (Ton & Mauch-Mani, 2004). pmr4 displays a hypersensitive phenotype against

A B

34

Alternaria (Fig 2 A) and is impaired in BABA-IR due to the lack of callose accumulation (Fig 2 A and B). Interestingly, we obtained for the first time an aggressive strain of A. brassicicola virulent on Arabidopsis accession Columbia. Col-0 plants accumulated callose surrounding the fungal mycelium but this was not sufficient or at least too slow in order to efficiently stop the pathogen. As shown in Figure 2B, BABA induces an augmented accumulation of callose not only in the surrounding layer of cells in contact with pathogen mycelium but also in distal areas of the infected leave (Fig3). Additionally, BABA can also prime for augmented necrosis in cells close to the infection site (Fig 3), although is not well established whether necrosis or hypersensitive response can increase the resistance against necrotrophs.

Figure 3. Lactophenol-trypan blue staining and callose deposition 6 days after challenge inoculation. For callose visualization, leaves were stained with calcofluor-anilineblue and analyzed by epifluorescence microscopy (UV). White arrows show callose depositions.

pmr4 shows higher resistance to H. parasitica while the double mutants impaired in the SA signaling pathway show wild type phenotype Callose deposition is also an important mechanism for BABA-induced protection against H. parasitica but is not the unique one since the induction of trailing necrosis can also contribute to stop the pathogen (Zimmerli et. al. 2000).

pmr4 shows a resistant phenotype against H. parasitica (Fig 4). Paradoxically, this mutation confers resistance. However, when SA is blocked through the introduction of a second mutation such as NahG, pad4 or npr1, the resistance is reversed to wild type phenotype and the callose production is not restored (data not shown; Nishimura et al 2003). This indicates that the enhanced resistance of pmr4 is caused by a hyperactive SA response probably either due to the lack of callose or to the fact that callose synthase activity can rescue the repression of the SA pathway (Nishimura et. al. 2003). As Zimmerli et. al. (2000) described BABA-IR against H. parasitica is not SA-dependent and NahG plants can also be protected. Interestingly, the double mutant pmr4-NahG is impaired in BABA-IR (Fig 3)It cannot express enhanced callose accumulation (data not shown), trailing necrosis or the hyperactive SA pathway. On the other hand, pmr4-npr1 or pmr4-pad4 can be protected by BABA (Fig 3), therefore NPR1 and PAD4 seem not to be essential to express enhanced trailing necrosis. Surprisingly, some callose formation after BABA treatment has been

Col0 pmr4 Col0 pmr4

H20

BABA

35

observed in pmr4-npr1 (data not shown). BABA-IR in this double mutants is probably based on a combination between enhanced callose deposition and trailing necrosis which is not totally blocked in pmr4-npr1 or pmr4-pad4.

Figure 4. Colonization of BABA-treated leaves by H. parasitica at 8 days after challenge

inoculation. Leaves were stained with lactophenol/trypan-blue and analyzed by light microscopy

Acknowledgments This work was supported by the grants from the National Centre of Competence on Plant Survival in Natural Agricultural Ecosystems and by Swiss National Science Foundation grant no. 31-064024 to B. Mauch-Mani and the grant from the Agència Valenciana de Ciència i Tecnologia (Generalitat Valenciana) given to Victor Flors. References Ton, J. & Mauch-Mani, B. 2004: β-amino-butyric acid-induced resistance against necro-

trophic pathogens is based on ABA-dependent priming for callose. – Plant J. 38: 119-130. Zimmerli, L., Jakab, G., Métraux, J.-P. & Mauch-Mani, B. 2000: Potentiation of pathogen-

specific defense mechanisms in Arabidopsis by β-aminobutyric acid. – Proc. Natl. Acad. Sci. USA. 97: 12920-12925.

Zimmerli, L., Métraux, J.-P. & Mauch-Mani, B. 2001: β-aminobutyric acid-induced protection of Arabidopsis against the necrotrophic fungus Botrytis cinerea. – Plant Phys. 126: 517-523.

Nishimura, M.T., Stein, M., Hou, B.H., Vogel, J.P., Edwards, H. & Somerville, S.C. 2003: Loss of a callose synthase results in salicylic acid-dependent disease resistance. – Science 301: 969-972.

Cohen Y.R 2002: β-aminobutyric acid-induced resistance against plant pathogens. – Plant Dis. 86: 448-457

Sticher, L., Mauch-Mani, B. & Métraux J.-M. 1997: Systemic Acquired Resistance. – Annu. Rev. Phytopathol. 1997: 35:235-70.

Koch, E. & Slusarenko, A. 1990: Arabidopsis is susceptible to infection by a downy mildew fungus. – Plant Cell. 2: 437-445.

Col0 pmr4 pmr4-NahG pmr4-npr1 pmr4-pad4

H20

BABA


pp. 37 - 47

37

Methods to study the role of individual volatile organic compounds (VOCs) in indirect defenses of plants against herbivorous arthropods Matthias Held, Marco D’Alessandro, Ted C. J. Turlings University of Neuchâtel, Institute of Zoology, 2009 Neuchâtel, Switzerland Abstract: In response to an attack by herbivorous arthropods plants emit complex blends of VOCs that are highly attractive to natural enemies of these herbivores. Rapid progress in physiological and molecular aspects of such indirect defense mechanisms in plants provides detailed knowledge of the induction and release of plant VOCs. Understanding of the importance of individual VOCs within complex blends for attracting natural enemies is, however, still rudimentary. Using the tritrophic system: maize plants (Zea mays), lepidopteran larvae Spodoptera littoralis and the parasitoids Cotesia marginiventris and Microplitis rufiventris, we present methods that have allowed us to generate and modify herbivore-induced VOC blends of known composition (experimental approach). Such blends were compared and tested for attraction to the wasps in olfactometer studies. In addition we describe a statistical method based on linking odor profiles of different maize inbred lines with wasp behavior to evaluate the attractiveness of individual VOCs (explorative approach). The combination of these approaches provides new insights in the relevance of individual VOCs involved indirect defenses of plants against herbivorous arthropods. Key words: herbivore-induced plant volatiles, modification of odor blends, olfactometer, carbotrap, inhibitors, glyphosate, knockout mutants, terpene synthases, RDA, parasitoid, Cotesia marginiventris, Microplitis rufiventris, Spodoptera littoralis Introduction Plants respond to feeding damage of herbivorous arthropods by releasing large amounts of volatile organic compounds (VOCs) (for recent reviews: Arimura et al., 2005; Turlings & Wackers, 2004). These herbivore-induced VOCs are known to play a major role in the interaction between plants and arthropods and may act either directly, for example, by deterring oviposition by lepidopteran herbivores (De Moraes et al., 2001; Kessler & Baldwin, 2001) or indirectly, by attracting natural enemies of herbivores (Dicke & Sabelis, 1988; Turlings et al., 1990). In addition, there is growing evidence that VOCs are involved in chemical information transfer between plants (Arimura et al., 2000; Engelberth et al., 2004).

The chemical composition of herbivore-induced VOC blends is known for many plant-herbivore systems (Dicke, 1999; Pare & Tumlinson, 1999). Some VOCs are taxon-specific, such as the glucosinolate breakdown products in Brassica species (Mattiacci et al., 1995), whereas other VOCs appear to be common in many different plant families (Van Den Boom et al., 2004). These common compounds include “green leaf volatiles” (C6 aldehydes, alcohols and derivatives), cyclic and acyclic terpenes, phenolic compounds and nitrogenous compounds (Dicke et al., 1999; Pare & Tumlinson, 1999).

Research on the biosynthesis and release of herbivore-induced VOCs indicate that biotic factors, such as plant hormones (Thaler et al., 2002; Rojo et al., 2003; Schmelz et al., 2003), herbivore-derived elicitors (Mattiacci et al., 1995; Alborn et al., 1997; Merkx-Jacques & Bede, 2004), associated microorganisms (Cardoza et al., 2002; Rostàs et al., 2005) and abiotic factors, such as temperature and light (Takabayashi et al., 1994; Gouinguene & Turlings,

38

2002), UV-radiation (Johnson et al., 1999), O3 and CO2 concentration (Vuorinen et al., 2004; Vuorinen et al., 2004) interact and may all modify herbivore-induced volatile blends. In addition, there is great variability in the composition of herbivore-induced VOC blends among different plant genotypes within a plant species. For example, different maize varieties vary qualitatively and quantitatively in their VOC emission (Gouinguene et al., 2001; Degen et al., 2004). Thus, searching carnivores are faced with the difficult task to find their host and prey in highly complex volatile environments. Although studies showed that arthropods are indeed able to distinguish between highly similar volatile blends (e.g. (Takabayashi et al., 1995; De Moraes et al., 1998) the knowledge of how arthropods perceive, evaluate and respond to complex and variable mixtures of VOCs is still rudimentary (D'Alessandro & Turlings, 2006).

Classical studies investigating the role of different herbivore-induced VOCs in attracting natural enemies of the herbivores used a combination of behavioral assays, electrophysio-logical measurements and chemical analyses of volatile blends (Dicke et al., 1990; Whitman & Eller, 1990; Turlings et al., 1991; Du et al., 1998). However, enhanced sensitivity of VOC collection and analysis tools now reveals that in many tritrophic systems plant volatile blends are much more heterogeneous than previously expected. Indeed, plants are known to emit more than 30'000 divergent compounds, including alkanes, alkenes, alcohols, ketones, aldehydes, ethers, esters and carboxylic acids (Niinemets et al., 2004). One way of studying the importance of individual VOCs within a complex blend is to compare the attractiveness of volatile blends differing in only few known compounds. These blends can be obtained by using different chemical elicitors (Dicke et al., 1999; Turlings et al., 2000) or silencing genes involved in indirect defenses (van Poecke & Dicke, 2003; Kessler et al., 2004). Adding back missing VOCs to incomplete blends is a sound way to study the importance of individual compounds (De Boer & Dicke, 2004).

Here we will review methods used to study the importance of various compounds of Spodoptera-induced maize (Zea mays) volatile blends for the attraction of two species of parasitoids, Cotesia marginiventris and Microplitis rufiventris. We focus on “subtractive” approaches used to obtain blends differing in only few known VOCs and “additive” approaches to generate blends of known composition. Neither the methods nor the results are discussed in detail, as this research is still ongoing. We argue that only a combination of different approaches might lead to a full understanding of the role of VOCs in the interaction between plants and arthropods. Moreover, we stress that in the case of parasitoids it is important to test both naive females and females that had previous oviposition experiences, as during oviposition experiences parasitoids can learn VOCs by association and subsequently are attracted to VOCs that may be ignored by naïve wasps (Turlings et al., 1993; Vet et al., 1995).

Experimental approaches

Figure 1 summarizes approaches that can be used to produce or modify herbivore-induced VOC blends. Subtractive methods might be used to modify and eliminate some VOCs from a naturally herbivore-induced volatile blend. Such modification can be done by filtering out some VOCs of the full blend (volatome modification; volatome = sum of all released VOCs over a specific time), by applying inhibitors of enzymes involved in the VOC production (phenotype modification), or by knocking out or silencing genes coding for specific enzymes involved in the VOC production (genotype modification). The attractiveness of such modified blends can be tested in behavioral assays, and compared to the non-modified blend. Alternatively, additive methods might be used to generate blends of known composition or to

39

add specific VOCs to a known blend. For example synthetic VOCs can be applied on filter paper or on some other kind of VOC dispenser (volatome modification), specific VOCs might be induced after treatment of the plants with different elicitors (phenotype modification) or by transforming plants with constitutively expressed genes involved in the VOC biosynthesis (genotype modification).

Figure 1. Schematic representation of experimental approaches used to modify and generate

blends of herbivore-induced maize VOCs. To study the importance of individual compounds, such blends can be compared and tested for attractiveness to parasitoids in behavioural assays.

Examples of GC-FID and GC-MS chromatograms of blends that we obtained by using subtractive and additive methods are given in figure 2. Figure 2 A shows full and partially modified VOC blends of maize seedlings (Zea mays var. Delprim) infested with Spodoptera littoralis larvae. The altered blends were obtained by installing adsorbing filter tubes containing carbotrap-C (non-polar graphitized carbon adsorbent) in a 4-arm olfactometer between the odor source vessels and the arms of the olfactometer. VOCs were passed over these filters and the compounds that were breaking through were tested for chemical composition and attractiveness to Cotesia marginiventris females (D'Alessandro & Turlings, 2005). Depending on the amounts of carbotrap-C, such filters adsorbed most of the sesquiterpenoids and some other compounds (Figure 2 A). Interestingly, the blend filtered over 30 mg carbotrap-C was equally attractive to naive C. marginiventris females as the full

subtractive approach additive approach

genotype

phenotype

volatome

knocking out or silencing VOC genes

transforming plants with VOC genes

inhibiting VOC pathways

filtering out specific VOCs generating blends with synthetic compounds or fractions of VOCs

full herbivore-induced maize blend

inducing VOC pathways with elicitors

fraction of full blend fraction of full blend

40

Figure 2. Examples of GC-FID and GC-MS chromatograms of herbivore-induced maize volatile blends obtained by subtractive and additive methods. A) and B) Subtractive methods used to eliminate compounds from the full herbivore-induced maize blend. C) Additive method used to generate a blend containing VOCs commonly found in herbivore-induced maize blends.

volatome modification phenotype modification genotype modification

20

40

60

80

100

120

140

5 10 15 2020

40

60

80

100

120

140

20

40

60

80

100

120

140

GC

-FID

det

ecto

rsig

nal(

pA)

IS1

IS1

IS1

IS2

IS2

IS2

full blend

30 mg filter

150 mg filter

20

40

60

80

100

120

140

5 10 15 2020

40

60

80

100

120

140

20

40

60

80

100

120

140

GC

-FID

det

ecto

rsig

nal(

pA)

IS1

IS1

IS1

IS2

IS2

IS2

full blend

30 mg filter

150 mg filter

0

200000

400000

600000

800000

1000000

5 10 15 20

0

200000

400000

600000

800000

1000000

full blend

inhibited blend

GC

-MS

dete

ctor

sign

al(p

A)

IS1

IS1

IS2

IS2

Filtration of herbivore-induced maize blends over different amounts of carbotrap-C results in a reduction of various

terpenoids (1-4).

Incubation of maize seedlings in glyphosate solution and subsequent infestation with Spodoptera results in a blend with

strongly reduced amounts of shikimic acid derived VOCs (5 - 6).

Arabidopsis thaliana plants transformed with a TPS gene of maize plants produce 4 major maize-like sesquiterpenoids (7-10)

IS1

IS1

IS2

IS2

GC

-MS

dete

ctor

sign

al(p

A)

subtractive approach additive approach

A) B) C)

control Arabidopsis plant

TPS8 transformed Arabidopsis plant

0

50000

100000

150000

200000

250000

300000

350000

5 10 15 20

0

50000

100000

150000

200000

250000

300000

350000

2

3

4

2

34

1

1

2 3 41

5

5

6

6

9

7

810

40

41

herbivore-induced blend that contained much higher amounts of sesquiterpenes. However, if the wasps experienced the full herbivore-induced blend before, they significantly preferred the full blend over the modified one. The blend filtered over 150 mg carbotrap-C was less preferred by the wasps, but was still strong enough to attract the wasps if it was tested against clean air. The breakthrough of VOCs from an adsorbing bed depends on many factors, including vapor concentration, air flow and volume, bed geometry, flow rates and temperature (Harper, 2000; Dettmer & Engewald, 2002). By carefully adjusting these parameters and by selecting various adsorbing materials this technique offers the possibility to selectively adsorb different parts of the volatile blend.

An example for a modification of the phenotype of maize seedlings is given in figure 2 B. Here we incubated cut maize seedlings in a glyphosate solution. Glyphosate is interacting with the EPSP synthase (Schonbrunn et al., 2001) and after infesting glyphosate treated plants with Spodoptera larvae we obtained blends with strongly reduced amounts of shikimic acid derived VOCs compared to the water treated control plants (D’Alessandro et al., 2006). C. marginiventris females did not differentiate between the two blends, however, M. rufiventris significantly preferred the blend with reduced amounts of shikimic acid derived VOCs. Inhibitors of other VOC pathways could be used to reduce the amount of additional compounds of the induced blend. For example, the production of induced terpenes is known to be regulated by two pathways, the mevalonate-dependent (MVA pathway) and the mevalonate-independent (MEP pathway). Mono- and diterpenes are produced in the plastids via the MEP pathways, whereas sesquiterpenes and homoterpenes are produced in the cytosol via the MVA pathway (reviewed by: (Lichtenthaler, 1999; Pare & Tumlinson, 1999). Both pathways can be blocked with inhibitors, mevinolin and/or cerivastatin blocking the MVA pathway, fosmidomycin blocking the MEP pathway (Jux et al., 2001; Palazon et al., 2003).

Modification of the plants’ genotype offers another promising approach to obtain altered VOC blends. Only recently genes encoding for the enzymes producing VOCs in maize have been identified (Degenhardt & Gershenzon, 2000; Schnee et al., 2002; Köllner et al., 2004, 2004). Transposon insertion mutants of these terpene synthase (TPS) genes are available (e.g (Shen et al., 2000) and these knock-out mutants allow to test VOC blends that differ in only a few compounds from control blends. We tested a mutant that did not produce a homoterpene, but released higher amounts of its precursor. Surprisingly, in olfactometer assays the mutant was more attractive to naïve and experienced C. marginiventris wasps than the corresponding wildtype.

The simplest additive approach consists of testing the attractiveness of synthetic compounds or different extracts containing fractions of VOCs. In this way a blend of 11 major herbivore-induced VOCs of maize was shown in earlier studies to attract experienced C. marginiventris females (Turlings et al., 1991) and various fractions of this blend were isolated by preparative GC and tested for attractiveness (Turlings, 1999). However many compounds are not yet easily available and releasing them from any kind of dispenser might alter the natural release rate. Relative ratios of VOCs are important in the attraction of parasitoids (De Moraes et al., 1998). Still, synthetic compounds might be useful to add to a blend and to prove the importance of an individual compound in a complex mixture. In this way, we added back synthetic compounds to modified blends, in order to evaluate their relevance for attraction.

More complex blends and blends with compounds that are difficult to isolate or to synthesize can be obtained by using various elicitors inducing VOC biosynthesis. For example, incubation of maize seedlings in solutions of plant-derived elicitors (e.g. jasmonic acid), herbivore-derived elicitors (e.g. volicitin) or even pathogen-derived elicitors (e.g. coronatine) resulted in strong induction of VOCs commonly induced by herbivores (Turlings et al., 2002). Additionally, such blends might be obtained by constitutively expressing genes

42

-0.6 0.6

-0.4

0.6

Cotesia naive

Cotesia experienced wasp response

VOCs

axis 1 (EV = 0.248)

axis

2 (

EV

= 0

.066

)

1

2

3

4

5

involved in the VOC biosynthesis. Arabidopsis thaliana plants previously transformed with a gene encoding for a terpene synthase (TPS) were provided by J. Degenhardt and coworkers of the Max-Planck Institute for Chemical Ecology, Jena. Uninfested, transformed plants constitutively produced a blend of maize specific sesquiterpenes consisting of 4 main- and about 20 by-products. (Figure 2 C). This blend attracted C. marginiventris females after they experienced the same blend or a Spodoptera-induced maize blend that contained the same VOCs (Schneet et al., 2006).

Explorative approach

Natural herbivore-induced VOC blends do not only exhibit high interspecific but also intraspecific variability (Gouinguene et al., 2001; Degen et al., 2004; Van Den Boom et al., 2004). This variability comprises a bias for all experimental approaches. However, it can also be turned into an advantage by utilizing complexity and variability for explorative multivariate analyses of odor profiles.

Figure 3. RDA biplot based on the combined datasets of GC/MS analyses of VOC blends collected from maize plants and the corresponding choice of C. marginiventris wasps in a 6-arm olfactometer. Dotted vectors represent individual compounds (1-6 are sesquiterpenes) and solid vectors represent relative attractiveness for the wasps.

43

Multivariate statistics allows to analyze complex datasets and the techniques of direct gradient analyses (e.g. principal component analysis – PCA and correspondence analysis – CA) are commonly used to detect correlations and similarities within ecological datasets. Other methods of gradient analysis additionally allow combining datasets from different functional levels to detect patterns and correlations. Nevertheless, these direct methods including redundancy analysis (RDA) and canonical correspondence analysis (CCA) are not yet fully adopted by chemical ecologists.

We used RDA to link patterns of individual compounds released by 18 herbivore-induced maize inbred lines with the behavioral response of C. marginiventris wasps. Figure 3 depicts an RDA biplot based on VOC data from 106 maize plants and the corresponding wasp attraction. Each of the dotted vectors represents an individual compound; the 2 solid vectors represent the choice of naïve and experienced wasps, respectively. The longer a vector is the higher is the variance in the dataset it explains. The VOC distribution pattern shows that some compounds are closely correlated to each other, a fact, that could be explained by physiological linkages (e.g. between compounds sharing the same pathway). Comparisons of the VOC pattern with the wasp response vectors reveal that wasp attraction is positively correlated to some compounds in the blend (attractive function), but negatively correlated to others (repellent function). Furthermore, the RDA confirms a behavioral shift resulting from associative learning. Some compounds are more important for naïve wasps, whereas others are stronger correlated to the vector representing the response of experienced wasps.

The described multivariate approach allows exploring VOC datasets for compounds that may explain the attraction of parasitoids. However, given that physiological interactions may mask the attractiveness of particular VOCs within a complex blend, correlations should be interpreted with caution.

Conclusions

The complexity and variability of VOC blends emitted by herbivore-infested plants have been shown to complicate the identification of key compounds mediating tritrophic interactions. Modifying or generating herbivore-induced VOC blends of known composition are required to evaluate the role of specific VOCs. We used subtractive methods to selectively eliminate some VOCs from a blend and additive methods to add missing compounds or to generate blends of known composition. In addition, we explored the natural variation of odor blends emitted by maize inbred lines and simultaneously analyzed chemical profiles and the corresponding behavior of parasitoids. The combination of these methods together with behavioral assays suggest that some compounds have little or negative impact on the attraction of the parasitoids, while others are highly attractive. The attractiveness of various VOCs differed not only for the two wasp species, C. marginiventris and M. rufiventris, but also for wasps that previously experienced these compounds. For example, sesquiterpenes were only slightly attractive to naive C. marginiventris females. However, experienced females were strongly attracted to blends with high amounts of these compounds. This illustrates that the attractiveness of individual VOCs within a complex blend is strongly affected by the internal state of the animals. Thus, well-designed bioassays should not only provide a direct link between chemical profiles of the tested odor blends and wasp behavior, but also respect the internal state of the tested animals. We illustrated some approaches that provide information about the attractiveness of individual VOCs to parasitoids. This information may be useful to improve the efficiency of natural enemies of herbivorous arthropods for controlling pests, for example, by engineering plants that have enhanced VOC production capacity (Degenhardt et al., 2003). Finally, it should be emphasized that findings from precise laboratory studies should be confirmed in field experiments to provide the final

44

information about the importance of individual VOCs in indirect defenses of plants against arthropod herbivores. References Alborn, T, Turlings, T.C.J., Jones, T.H., Stenhagen, G., Loughrin, J.H. & Tumlinson, J.H.

1997: An elicitor of plant volatiles from beet armyworm oral secretion. – Science 276: 945-949.

Arimura, G., Kost, C. & Boland, W. (2005) Herbivore-induced, indirect plant defences. – Biochimica et Biophysica Acta – Molecular and Cell Biology of Lipids 1734: 91-111.

Arimura, G., Ozawa, R., Shimoda, T., Nishioka, T., Boland, W. & Takabyashi, J. 2000: Herbivory-induced volatiles elicit defence genes in lima bean leaves. – Nature 406: 512-515.

Cardoza, Y.J., Alborn, H.T. & Tumlinson, J.H. 2002: In vivo volatile emissions from peanut plants induced by simultaneous fungal infection and insect damage. – Journal of Chemical Ecology 28: 161-174.

D'Alessandro, M. & Turlings, T.C.J. 2005: In situ modification of herbivore-induced plant odors: A novel approach to study the attractiveness of volatile organic compounds to parasitic wasps. – Chemical Senses 30: 739-753.

D'Alessandro, M. & Turlings, T.C.J. 2006: Advances and challenges in the identification of volatiles that mediate interactions among plants and arthropods. – Analyst 131: 24-32.

D'Alessandro, M., Held, M., Triponez, Y. & Turlings, T.C.J. 2006: The role of indole and other shikimic acid derived plant volatiles in the attraction of two parasitic wasps. – Journal of Chemical Ecology, in press.

De Boer, J.G. & Dicke, M. 2004: The role of methyl salicylate in prey searching behavior of the predatory mite Phytoseiulus persimilis. – Journal of Chemical Ecology 30: 255-271.

De Moraes, C.M., Lewis, W.J., Pare, P.W., Alborn, H.T. & Tumlinson, J.H. 1998: Herbivore-infested plants selectively attract parasitoids. – Nature 393: 570-573.

De Moraes, C.M., Mescher, M.C. & Tumlinson, J.H. 2001: Caterpillar-induced nocturnal plant volatiles repel nonspecific females. – Nature 410: 577-580.

Degen, T., Dillmann, C., Marion-Poll, F. & Turlings, T.C.J. 2004: High genetic variability of herbivore-induced volatile emission within a broad range of maize inbred lines. – Plant Physiology 135: 1928-1938.

Degenhardt, J. & Gershenzon, J. 2000: Demonstration and characterization of (E)-nerolidol synthase from maize: a herbivore-inducible terpene synthase participating in (3E)-4,8-dimethyl-1,3,7-nonatriene biosynthesis. – Planta 210: 815-822.

Degenhardt, J., Gershenzon, J., Baldwin, I.T. & Kessler, A. 2003: Attracting friends to feast on foes: engineering terpene emission to make crop plants more attractive to herbivore enemies. – Current Opinion in Biotechnology 14: 169-176.

Dettmer, K. & Engewald, W. 2002: Adsorbent materials commonly used in air analysis for adsorptive enrichment and thermal desorption of volatile organic compounds. – Analytical and Bioanalytical Chemistry 373: 490-500.

Dicke, M. 1999: Evolution of induced indirect defense of plants. – In: R. Tollrian, C.D. Harvell, eds, The ecology and evolution of inducible defenses. Princeton University Press, Princeton, New Jersey: 62-88.

Dicke, M., Beek, van T.A., Posthumus, M.A., Ben Dom, N., Bokhoven, van H. & Groot, de A. 1990: Isolation and identification of volatile kairomone that affects acarine predator-prey interactions. Involvement of host plant in its production. – Journal of Chemical Ecology 16(2): 381-396.

45

Dicke, M., Gols, R., Ludeking, D. & Posthumus, M.A. 1999: Jasmonic acid and herbivory differentially induce carnivore- attracting plant volatiles in lima bean plants. – Journal of Chemical Ecology 25: 1907-1922.

Dicke, M. & Sabelis, M.W. 1988: How plants obtain predatory mites as bodyguards. – Netherlands Journal of Zoology 38: 148-165.

Du, Y.J., Poppy, G.M., Powell, W., Pickett, J.A., Wadhams, L.J. & Woodcock, C.M. 1998: Identification of semiochemicals released during aphid feeding that attract parasitoid Aphidius ervi. – Journal of Chemical Ecology 24: 1355-1368.

Engelberth, J., Alborn, H.T., Schmelz, E.A. & Tumlinson, J.H. 2004: Airborne signals prime plants against insect herbivore attack. – Proceedings of the National Academy of Sciences of the United States of America 101: 1781-1785.

Gouinguene, S., Degen, T. & Turlings, T.C.J. 2001: Variability in herbivore-induced odour emissions among maize cultivars and their wild ancestors (teosinte). – Chemoecology 11: 9-16.

Gouinguene, S.P. & Turlings, T.C.J. 2002: The effects of abiotic factors on induced volatile emissions in corn plants. – Plant Physiology 129: 1296-1307.

Harper, M. 2000: Sorbent trapping of volatile organic compounds from air. – Journal of Chromatography A 885: 129-151.

Johnson, C.B. & Kirby, J., Naxakis, G. & Pearson, S. 1999: Substantial UV-B-mediated induction of essential oils in sweet basil (Ocimum basilicum L.). – Phytochemistry 51: 507-510.

Jux, A., Gleixner, G. & Boland, W. 2001: Classification of terpenoids according to the methylerythritolphosphate or the mevalonate pathway with natural C-12/C-13 isotope ratios: Dynamic allocation of resources in induced plants. – Angewandte Chemie-International Edition 40: 2091-2093.

Kessler, A. & Baldwin, I.T. 2001: Defensive function of herbivore-induced plant volatile emissions in nature. – Science 291: 2141-2144.

Kessler, A., Halitschke, R. & Baldwin, I.T. 2004: Silencing the jasmonate cascade: Induced plant defenses and insect populations. – Science 305: 665-668.

Köllner, T.G., Schnee, C., Gershenzon, J. & Degenhardt, J. 2004: The sesquiterpene hydrocarbons of maize (Zea mays) form five groups with distinct developmental and organ-specific distribution. – Phytochemistry 65: 1895-1902.

Köllner, T.G., Schnee, C., Gershenzon, J. & Degenhardt, J. 2004: The variability of sesquiterpenes cultivars is controlled by allelic emitted from two Zea mays variation of two terpene synthase genes encoding stereoselective multiple product enzymes. – Plant Cell 16: 1115-1131.

Lichtenthaler, H.K. 1999: The 1-deoxy-D-xylulose-5-phosphate pathway of isoprenoid biosynthesis in plants. – Annual Review of Plant Physiology and Plant Molecular Biology 50: 47-65.

Mattiacci, L., Dicke, M. & Posthumus, M.A. 1995: Beta-Glucosidase – an elicitor of herbivore-induced plant odor that attracts host-searching parasitic wasps. – Proceedings of the National Academy of Sciences of the United States of America 92: 2036-2040.

Merkx-Jacques, M. & Bede, J.C. (2004) Caterpillar salivary enzymes: "eliciting" a response. – Phytoprotection 85: 33-37.

Niinemets, U., Loreto, F. & Reichstein, M. 2004: Physiological and physicochemical controls on foliar volatile organic compound emissions. – Trends in Plant Science 9: 180-186.

Palazon, J., Cusido, R.M., Bonfill, M., Morales, C. & Pinol, M.T. 2003: Inhibition of paclitaxel and baccatin III accumulation by mevinolin and fosmidomycin in suspension cultures of Taxus baccata. – Journal of Biotechnology 101: 157-163.

46

Pare, P.W. & Tumlinson, J.H. 1999: Plant volatiles as a defense against insect herbivores. – Plant Physiology 121: 325-331.

Rojo, E., Solano, R. & Sanchez-Serrano, J.J. 2003: Interactions between signaling compounds involved in plant defense. – Journal of Plant Growth Regulation 22: 82-98.

Schmelz, E.A., Engelberth, J., Alborn, H.T., O'Donnell, P., Sammons, M., Toshima, H. & Tumlinson, J.H. 2003: Simultaneous analysis of phytohormones, phytotoxins, and volatile organic compounds in plants. – Proceedings of the National Academy of Sciences of the United States of America 100: 10552-10557.

Schnee, C., Köllner, T.G., Gershenzon, J. & Degenhardt, J. 2002: The maize gene terpene synthase 1 encodes a sesquiterpene synthase catalyzing the formation of (E)-beta-farnesene, (E)- nerolidol, and (E,E)-farnesol after herbivore damage. – Plant Physiology 130: 2049-2060.

Schnee, C., Köllner, T.G., Held, M., Turlings, T.C.J., Gershenzon, J. & Degenhardt, J. 2006: A maize terpene synthase contributes to a volatile defense signal that attracts natural enemies of maize herbivores. – Proceedings of the National Academy of Sciences of the United States of America 103: 1129-1134.

Schonbrunn, E., Eschenburg, S., Shuttleworth, W.A., Schloss, J.V., Amrhein, N., Evans, J.N.S. & Kabsch, W. 2001: Interaction of the herbicide glyphosate with its target enzyme 5-enolpyvuvylshikimate 3-phosphate synthase in atomic detail. – Proceedings of the National Academy of Sciences of the United States of America 98: 1376-1380.

Shen, B.Z., Zheng, Z.W. & Dooner, H.K. 2000: A maize sesquiterpene cyclase gene induced by insect herbivory and volicitin: Characterization of wild-type and mutant alleles. – Proceedings of the National Academy of Sciences of the United States of America 97: 14807-14812.

Takabayashi, J., Dicke, M. & Posthumus, M.A. 1994: Volatile herbivore-induced terpenoids in plant-mite interactions: variation caused by biotic and abiotic factors. – Journal of Chemical Ecology 20(6): 1329-1354.

Takabayashi, J., Takahashi, S., Dicke, M. & Posthumus, M.A. 1995: Developmental stage of herbivore Pseudaletia separata affects production of herbivore-induced synomone by corn plants. – Journal of Chemical Ecology 21(3): 273-287.

Thaler, J.S., Karban, R., Ullman, D.E., Boege, K. & Bostock, R.M. 2002: Cross-talk between jasmonate and salicylate plant defense pathways: effects on several plant parasites. – Oecologia 131: 227-235.

Turlings, T.C.J., Alborn, H.T., Loughrin, J.H. & Tumlinson, J.H. 2000: Volicitin, an elicitor of maize volatiles in oral secretion of Spodoptera exigua: Isolation and bioactivity. – Journal of Chemical Ecology 26: 189-202.

Turlings, T.C.J., Gouinguene, S., Degen, T. & Fritzsche-Hoballah, M.E. 2002: The chemical ecology of plant-caterpillar-parasitoid interactions. – In: T. Teja, A.H. Bradford, eds, Multitrophic Level Interaction. Cambridge University Press, pp 148-173.

Turlings, T.C.J., Tumlinson, J.H., Heath, R.R., Proveaux, A.T. & Doolittle, R.E. 1991: Isolation and identification of allelochemicals that attract the larval parasitoid, Cotesia marginiventris (Cresson), to the microhabitat of one of its hosts. – Journal of Chemical Ecology 17: 2235-2251.

Turlings, T.C.J., Tumlinson, J.H. & Lewis, W.J. 1990: Exploitation of herbivore-induced plant odors by host-seeking parasitic wasps. – Science 250: 1251-1253.

Turlings, T.C.J. & Wackers, F. 2004: Recruitment of predators and parasitoids by herbivore-injured plants. – In: R.T. Cardé, J.G. Millar, eds, Advances in Insect Chemical Ecology. Cambridge University Press.

Turlings, T.C.J., Wäckers, F.L., Vet, L.E.M., Lewis, W.J. & Tumlinson, J.H. 1993: Learning of host-finding cues by hymenopterous parasitoids. – In: D.R. Papaj, A.C. Lewis, eds,

47

Insect learning. Ecological and evolutionary perspectives. Chapman & Hall, New York: 51-78.

Van Den Boom, C.E.M., Van Beek, T.A., Posthumus, M.A., De Groot, A. & Dicke, M. 2004: Qualitative and quantitative variation among volatile profiles induced by Tetranychus urticae feeding on plants from various families. – Journal of Chemical Ecology 30: 69-89.

van Poecke, R.M.P. & Dicke, M. 2003: Signal transduction downstream of salicylic and jasmonic acid in herbivory-induced parasitoid attraction by Arabidopsis is independent of JAR1 and NPR1. – Plant Cell and Environment 26: 1541-1548.

Vet, L.E.M., Lewis, W.J. & Carde, R.T. 1995: Parasitoid Foraging and Learning. – In: R.T. Carde, W.J. Bell, eds, Chemical ecology of insects. Chapman & Hall., New York: 65 -101.

Vuorinen, T., Nerg, A.M. & Holopainen, J.K. 2004: Ozone exposure triggers the emission of herbivore-induced plant volatiles, but does not disturb tritrophic signalling. – Environmental Pollution 131: 305-311.

Vuorinen, T., Nerg, A.M., Ibrahim, M.A., Reddy, G.V.P. & Holopainen, J.K. 2004: Emission of Plutella xylostella-induced compounds from cabbages grown at elevated CO2 and orientation behavior of the natural enemies. – Plant Physiology 135: 1984-1992

Whitman, D.W. & Eller, F.J. 1990: Parasitic wasps orient to green leaf volatiles. – Chemoecology 1: 69-76.


pp. 49 - 53

49

Induced resistance to Fusarium head blight in winter wheat 1Ingerd Hofgaard, 1,2 Åshild Ergon, 1Birgitte Henriksen, 1Hilde Kolstad, 2Helge Skinnes, 2Yalew Tarkegne, 1,2Anne Marte Tronsmo 1The Norwegian Crop Research Institute, Plant Protection Centre, Høgskoleveien 7, 1432 Ås, Norway. 2 Agricultural University of Norway, Institute of Plant and Environmental Sciences, P.O.Box 5003, 1432 Ås Abstract: Development of Fusarium head blight (FHB) was studied in winter wheat pre-treated with potential defence activators. Several chemicals were pre-screened for their capacity to reduce development of Microdochium nivale in a detached leaf assay. Selected compounds were further tested for their capacity to reduce Fusarium culmorum development in heads of winter wheat in greenhouse and field experiments. In the detached leaf assay, leaves from plants pre-treated with a foliar fertilizer displayed reduced disease development compared to untreated control. A significantly reduced disease development of FHB in plants pre-treated with the foliar fertilizer was also registered in the greenhouse and field experiments. In the field experiment, harvested grains from plants treated with the foliar fertilizer had up to 75% reduction in Fusarium infected seeds compared to grains from non-treated plants. Key words: Microdochium nivale, Fusarium culmorum, detached leaf assay, FHB, defence activator, foliar fertilizer, Resistim Introduction Fusarium head blight (FHB) is a widespread and destructive disease of cereals caused by a number of Fusarium species. Microdochium nivale is a part of the complex causing head blight symptoms in cereals. FHB can reduce grain quality due to the production of a range of toxic metabolites that have adverse effect on humans and livestock. Due to the lack of consistently effective control measures, FHB pose a significant threat to the yield and quality of small grained cereals (Pirgozliev et al. 2003).

All plants possess resistance mechanisms that can be induced upon pre-treatment with a variety of organisms and compounds (Tuzun 2001). It seems that induced resistance constitutes a mechanism through which the level of general resistance to pathogens is increased (van Loon 1997). Defence responses have been induced successfully in monocots by exogenous application of elicitors or defence activators including chitosans (Barber et al. 1989; Vander et al. 1998), β-aminobutyric acid (Oka & Cohen 2001) and salicylic acid or its functional analogues (Görlach et al. 1996; Morris et al. 1998; Schweizer et al. 1999; Bertini et al. 2003).

The aim of this work was to find a chemical defence activator capable of inducing resistance to Fusarium head blight in winter wheat. Several chemicals were pre-screened for their defence inducing capacity by using a detached leaf assay. Selected compounds were further tested for their capacity to reduce Fusarium culmorum development in heads of winter wheat in greenhouse and field experiments.

50

Materials and methods Detached leaf assay Winter wheat (cv. Bjørke) was grown in a greenhouse at 18/12°C day/night temperature and 16h additional light. After 2 weeks, the seedlings were sprayed with various compounds including plant and fungal extracts, chitosans, BION (syn. Actigard, Syngenta), β-aminobutyric acid, trehalose, and Resistim (a foliar fertilizer containing potassium, phosphorus and betaines, Mandops (UK) limited). A more complete description of the chemical compounds and concentrations used will be published (Hofgaard et al., manuscript in preparation). One week after treatment, 5cm segments from the mid-section of the second leaf were harvested and placed on 0.5% water agar containing 10mg l-1 kinetin. The leaf segments were inoculated the following day with a 10µl droplet of a M. nivale spore suspension adjusted to 1 X 106 conidia ml-1. The leaf segments were incubated at 10°C under 12h NUV and white light. Assessments of symptom appearance and sporulation were carried out daily under a compound microscope, as described by Browne & Cooke 2004. FHB, greenhouse studies Seeds of winter wheat were surface disinfected and placed onto wetted filter paper. After 10 weeks of vernalization at 2-4°C, the seeds were transplanted and further grown in a greenhouse at 15/10°C day/night temperature and 16h additional light. At heading, one week prior to flowering, the plants were sprayed with a liquid solution of BION, β-aminobutyric acid or the foliar fertilizer Resistim. At flowering, 6-10 heads in each pot were point inoculated with a 10µl droplet of a F. culmorum spore suspension (1 X 105 conidia ml-1). The inoculated heads were covered with plastic bags for 48h after inoculation. The plants were further grown at 20°C day (12h) and 15°C night (12h) and 18h additional light. Disease symptoms were scored as number of diseased spikelets per head, 11, 17 and 23 days after inoculation. There were 4 parallel pots in each treatment and the experiment was repeated twice. FHB, field experiment One week prior to flowering of winter wheat in the field experiment, the plants were sprayed with the potential defence activators (the same compounds as used in the greenhouse study). At flowering, all plants were spray inoculated with a spore suspension of F. culmorum at two different inoculum levels: 1 X 104 and 1 X 105 conidia ml-1 (0.1 L m-2). Disease symptoms were scored as percentage diseased spikelets per head, 14, 20 and 25 days after inoculation. Harvested grains from the different treatments were scored according to the percentage of Fusarium infected seeds by using a freezer blotter test (Limonard 1966). Results and discussion In the detached leaf assay, leaves from plants treated with the foliar fertilizer one week prior to M. nivale inoculation, displayed a significantly reduced disease development compared to the untreated control (Figure 1). A significantly reduced disease development after F. culmorum inoculation was also registered in heads from wheat plants pre-treated with the foliar fertilizer as compared to non-treated plants, both in the greenhouse (Figure 2) and field experiments (Figure 3). In the field experiment, harvested grains from plots treated with the foliar fertilizer had up to 75% reduction in number of Fusarium infected seeds compared to grains from non-treated control plots. A more complete description of the results will be published (Hofgaard et al., manuscript in preparation). No significant reduction of FHB was found in plants pre-treated with BION or β-aminobutyric acid (data not shown).

51

In our study, wheat plants were treated with a foliar fertilizer containing potassium, phosphorus and betaines. Potassium can both directly and indirectly reduce disease severity in plants (Palti 1981). Induced disease resistance in plants after foliar spraying with phosphates has been reported elsewhere (Reuveni et al. 1994). Glycinebetaines are accumulated in plants in response to high salinity, cold and drought, and exogenous application of betaines to plants has been shown to increase the tolerance to various stresses (Sakamoto & Murata 2000).

0

10

20

30

40

50

60

70

80

90

100

4 5 6 7 8 9Days after inoculation

% o

f lea

ves

disp

layi

ng s

poru

latio

n

Control

Fertilizer

Disease development on detached wheat leaves after M. nivale inoculation. Control: non-

treated plants. Fertilizer: plants pre-treated with a foliar fertilizer.

0

5

10

15

20

25

30

35

40

11 17 23Days after inoculation

% in

fect

ed s

pike

lets

per

hea

d

ControlFertilizer

FHB development in winter wheat after F. culmorum inoculation in the greenhouse study.

Control: non-treated plants. Fertilizer: plants pre-treated with a foliar fertilizer.

52

0

5

10

15

20

25

30

35

40

14 20 25Days after inoculation

% in

fect

ed s

pike

lets

per

hea

d

Control

Fertilizer

FHB development in winter wheat after F. culmorum inoculation in the field study. Control:

non-treated plants. Fertilizer: plants pre-treated with a foliar fertilizer.

In conclusion, we have shown that a foliar fertilizer treatment of winter wheat one week prior to flowering (and F. culmorum inoculation) can reduce development of FHB. The disease reduction in plants treated with the foliar fertilizer was also evident at harvest, as the level of Fusarium infected seeds from the fertilizer treated plants was reduced compared to seeds from non-treated plants. The screening of M. nivale resistance in detached wheat leaves was found to be a suitable method for pre-selecting putative chemical agents for FHB disease reduction. Further experiments will be accomplished to reveal why the foliar fertilizer treatment in our study reduced development of F. culmorum in heads of winter wheat. References Barber, M.S., Bertram, R.E. & Ride, J.P. 1989: Chitin oligosaccharides elicit lignification in

wounded wheat leaves. – Physiol. Mol. Plant Pathol. 34: 3-12. Bertini, L., Leonardi, L., Caporale, C., Tucci, M., Cascone, N., Di Berardino, I., Buonocore,

V. & Caruso, C. 2003: Pathogen-responsive wheat PR4 genes are induced by activators of systemic acquired resistance and wounding. – Plant Sci. 164: 1067-1078.

Browne, R.A. & Cooke, B.M. 2004: Development and evaluation of an in vitro detached leaf assay for pre-screening resistance to Fusarium head blight in wheat. – Eur. J. Plant Pathol. 110: 91-102.

Görlach, J., Volrath, S., Knauf-Beiter, G., Hengy, G., Beckhove, U., Kogel, K.H., Oosten-dorp, M., Staub, T., Ward, E., Kessmann, H. & Ryals, J.A. 1996: Benzothiadiazole, a novel class of inducers of systemic acquired resistance, activates gene expression and disease resistance in wheat. – The Plant Cell 8: 629-643.

Limonard, T. 1966: A modified blotter test for seed health. – Neth. J. Plant Path. 72: 319-321. Morris, S.W., Vernooij, B., Titatarn, S., Starrett, M., Thomas, S., Wiltse, C.C., Frederiksen,

R.A., Bhandhufalck, A., Hulbert, S. & Uknes, S. 1998: Induced resistance responses in maize. – Mol. Plant-Microb. Interact. 11: 643-658.

53

Oka, Y. & Cohen, Y. 2001: Induced resistance to cyst and root-knot nematodes in cereals by DL-B-amino-n-butyric acid. – Eur. J. Plant Pathol. 107: 219-227.

Palti,J. (1981): Cultural practices and infectous crop diseases. – Springer-Verlag, Berlin Heidelberg New York.

Pirgozliev, S.R., Edwards, S.G., Hare, M.C. & Jenkinson, P. 2003: Strategies for the control of Fusarium head blight in cereals. – Eur. J. Plant Pathol. 109: 731-742.

Reuveni, R., Agapov, V. & Reuveni, M. 1994: Folia spray of phosphates induces growth increase and systemic resistance to Puccinia sorghi in maize. – Plant Pathol. 43: 245-250.

Sakamoto, A. & Murata, N. 2000: Genetic engineering of glycinebetaine synthesis in plants: current status and implications for enhancement of stress tolerance. – J. Exp. Bot. 51: 81-88.

Schweizer, P., Schaffrath, U. & Dudler, R. 1999: Different patterns of host genes are induced in rice by Pseudomonas syringae, a biological inducer of resistance, and the chemical inducer benzothiadiazole (BTH). – Eur. J. Plant Pathol. 105: 659-665.

Tuzun, S. 2001: The relationship between pathogen-induced systemic resistance (ISR) and multigenic (horizontal) resistance in plants. – Eur. J. Plant Pathol. 107: 85-93.

van Loon, L.C. 1997: Induced resistance in plants and the role of pathogenesis-related proteins. – Eur. J. Plant Pathol. 103: 753-765.

Vander, P., Vårum, K.M., Domard, A., el Gueddari, E. & Moerschbacher, B.M. 1998: Com-parison of the ability of partially N-acetylated chitosans and oligosaccharides to elicit resistance reactions in wheat leaves. – Plant Physiol. 118: 1353-1359.


pp. 55 - 60

55

Reverse genetic methods in research on induced resistance of grapevine: development of a vector for shRNA production to induce gene silencing Gabor Jakab, Romain Dubresson, Michael Bel, Mollah Md. Hamiduzzaman, Brigitte Mauch-Mani, Jean-Marc Neuhaus University of Neuchâtel, Institute of Botany, Laboratory of Biochemistry, Emile-Argand 11, Case Postal 2, CH-2007 Neuchâtel, Switzerland Abstract: ß-aminobutyric acid (BABA), a non-protein amino acid is able to induce resistance in Arabidopsis plants through the priming of the salicylic acid (SA)- and abscisic acid (ABA)-dependent defence signalling pathways. BABA-induced resistance (BABA-IR) was also observed in grapevine against downy mildew. Treatments of the susceptible variety Chasselas with either benzothiadiazole (BTH, a SA analogue) or ABA, however, did not lead to protection while jasmonic acid (JA) treatment was able to induce resistance. Mutant screening to determine the importance of the different signalling pathways in BABA-IR was not feasible in grapevine, in contrast to Arabidopsis. Therefore we had to use alternative methods such as co-application of specific inhibitors together with BABA. This type of approach yielded results suggesting that callose deposition and other defence mechanisms depending on the phenylpropanoid and the lipoxygenase pathways all contributed to BABA-IR. Expression patterns of marker genes, on the other hand, indicated the priming of both the SA- and JA-signalling pathways in BABA-treated Chasselas plants. These results point to major differences in the expression of BABA-IR in Arabidopsis and grapevine. In order to determine the key components of BABA-IR specific for grapevine, we plan to use gene silencing techniques. While testing different techniques of siRNA production (transgenes encoding long hairpin-forming RNAs, dsRNA produced in E.coli), we opted for the development of a new system based on the U6 hairpin cloning system of Promega (siSTRIKE) and adapted for grapevine. For this purpose we cloned and sequenced a Vitis vinifera U6 promoter and used it to construct a new vector to produce short hairpin RNA (shRNA) in grapevine cells. Introduction The non-protein amino acid β-aminobutyric acid (BABA) is a potent inducer of resistance in plants against viruses, bacteria, oomycetes, fungi, nematodes and abiotic stresses (Zimmerli et. al., 2000; Jakab et al., 2001; Cohen, 2002). Characteristic for BABA-IR is the enhanced capacity to express different cellular defence responses, which are induced specifically upon attack by a pathogen. This phenomenon is called priming (Conrath et al., 2002). Using different signalling mutants of Arabidopsis, the involvement of various mechanisms has been revealed. Against P. syringae, BABA-IR was found to be dependent on functional salicylic acid (SA) signalling (Zimmerli et. al. 2000). Against the necrotrophs Alternaria brassicicola and Plectosphaerella cucumerina, however, resistance seemed to be controlled by neither the SA nor the jasmonate (JA) signalling pathway, while mutants impaired in abscisic acid (ABA) sensitivity or synthesis were blocked in BABA-IR against these necrotrophs (Ton & Mauch-Mani, 2004) as well as against the oomycete Hyaloperonospora parasitica (Ton et al., 2005). Additionally, callose deposition has been also shown to be important for defence in the latter interactions and BABA primed callose deposition around the site of pathogen penetration is ABA-dependent (Ton & Mauch-Mani, 2004; Ton et al., 2005).

56

BABA also protects grapevine against downy mildew (P. viticola) infection (Cohen et al., 2002). In our hands the protective effect of BABA was comparable to the effect of JA, while both SA and ABA were unable to induce resistance in grapevine against P. viticola. BABA-IR was strongly reduced by application of an inhibitor (ETYA) of the lipoxygenase pathway indicating that JA but not SA or ABA signalling is involved in BABA-induced protection of grapevine against downy mildew (Hamiduzzaman et al., unpublished results).

Because no signalling mutants of grapevine are available for further analysis of the observed differences in BABA-IR of Arabidopsis and grape, we decided to use gene silencing as another strategy. Gene silencing is a recently recognised mechanism which modifies gene expression in plants and other organisms and can be used to gain further insight into their function (Baulcombe, 2004). Double-stranded RNA (dsRNA) triggers different types of gene silencing that are collectively referred to as RNA silencing or RNA interference. dsRNA is processed into short RNA duplexes (small interfering RNA or siRNA) of characteristic size and structure which then guide RNA silencing by specific mechanisms. Several methods have been developed to produce and introduce dsRNA into cells. RNA viruses are widely used and so is Agrobacterium-mediated introduction of an inverted repeat of (part of) the gene under the control of a strong promoter (e.g. pHELLSGATE vectors). Alternatively, short hairpin RNAs (shRNAs) transcribed in vivo under the control of RNA polymerase III promoters can trigger the silencing of the corresponding gene. For the latter approach a U6 hairpin cloning system which can directly produce shRNA within animal cells has been developed (siSTRIKETM, Promega). Unfortunately, this system uses the human U6 promoter. Although in both metazoa and plants the U6 gene is transcribed by RNA polymerase III, the sequence and position of the regulatory elements are very different (Fig. 1, Waibel & Filipowicz, 1990). Therefore we isolated and cloned a U6 promoter from grapevine and constructed a vector system to produce shRNA in plants.

Figure 1. Structure and promoter elements of the U6 gene in metazoa (A) and plants (B). The

boxes represent the different promoter elements: DSE: distal sequence element; PSE: proximal sequence element (consensus seq.: STSRCCNTRNS); TATA: TATA-like element; USE: upstream sequence element (consensus seq.: RTCCCACATCG). The positions of the different elements are indicated above the boxes.

Materials and methods DNA extraction Total DNA was extracted from grapevine leaves according to Lodhi and coworkers (1994). Inverse PCR Total DNA (3 µg) was digested overnight in separate tubes with different restriction enzymes (BamHI, EcoRI, SalI, XhoI). After heat inactivation of the restriction enzyme, the volume was increased up to 200µL for overnight ligation with T4 DNA ligase. The ligated genomic DNA was then ethanol precipitated and resuspended in water. For PCR reaction an equal

DSE PSE TATA U6 TTTTTT

TTTTTTUSE TATA U6

-250 -50 -30

-60 -30

A

B

57

mixture of Taq and Pfu DNA polymerases were used with the following primers (5’out: 5’-CTTCTCTGTATCGTTCCAATTTTATCQQATGTCCCCGAAGG; 3’out: 5’-CTGCGCAA GGATGACACGCAYAAATCGAGAAATGGTCC) and the following program: 94°C 30sec; 68°C 10 min; 35 cycles. Cloning and sequencing of the PCR products: The PCR products were separated by agarose (1%) gel electrophoresis and the purified fragments were cloned into pGEM-T vector (Promega) according to the manual. Plasmids containing the expected fragments were purified using the Plasmid Miniprep kit (Qiagen) and sent to Microsynth (Balgach, Switzerland) for sequencing. Cloning of the promoter region: A 340 bp long fragment of the U6.2 promoter was reamplified with the primers U6pfw (5’- CTCTCAGCTCTCCCAACTTTTCTC) and U6prev (5’-ATGGTACCGAAGGGACAAGCTTTAATAGTGGAG) and cloned into the pGEM-T Easy vector (Promega). Using the EcoRI (from vector) and KpnI (introduced by the U6rev primer) sites the Vitis U6 promoter was recloned into a modified pUC18 plasmid in which the HindIII site had been previously refilled. Results and discussion Cloning the U6 promoter from grapevine The sequence of the U6 RNA is highly conserved among all the analysed organisms. Because the identity is almost 100%, we used the Arabidopsis sequence to design the primers for inverse PCR. The PCR reaction gave the same two bands (2kbp and 2.5kbp) in all four digestion-ligation reactions (Fig. 2A) suggesting the presence of at least three tandem copies of the U6 gene in the grapevine genome (Fig. 2B).

Figure 2. Result of the inverse PCR on the grapevine DNA. (A) Genomic DNA of grapevine

was digested with restriction enzymes as indicated on the top. The religated DNA was used in the following PCR reaction and the products were separated on agarose gel. M: 1 kb ladder. (B) Model of the genomic region of grapevine containing three copies of the U6 gene.

Both DNA fragments were isolated from the gel and cloned into pGEM-T Easy vector.

Sequence analysis confirmed that two intergenic regions of the U6 genes of grapevine had been cloned. The two promoter regions showed high homology and contained both USE and TATA-like elements similarly to U6 promoters from other plant species (Fig. 3). More than

U6 U6 U6

2.0 kbp 2.5 kbp

M

1Kbp

2Kbp3Kbp

Bam

HI

Eco

RI

Sal I

Xho

I

M

1Kbp

2Kbp3Kbp

Bam

HI

Eco

RI

Sal I

Xho

IA B

58

300 bp upstream of the coding region were highly homologous for the two Vitis U6 genes. Therefore this region was considered as the promoter region of the U6 gene and was used for further constructions (Fig. 3). Figure 3. Sequence alignment of the two U6 promoter regions of grapevine. Sequences

corresponding to the USE and TATA-like elements, respectively, are boxed. The primers used to obtain the promoter sequence for construction are shown under the VvU6.2 sequence. The HindIII restriction site immediately before the transcription start and the KpnI site in the U6prev primer are underlined.

Development of a vector system using the U6 promoter for siRNA production A 340 bp region of the U6.2 promoter was reamplified by PCR and cloned into pGEM-T Easy vector. The fragment was then moved into a modified pUC18 plasmid using the EcoRI site of pGEM-T Easy vector and the KpnI site introduced by the U6prev primer to obtain the pRDU6P1 vector. The U6 promoter in the pRDU6P1 vector is followed by a unique HindIII (at the transcription start site) and the remaining part of the original polylinker of pUC18 (Fig. 4). The HindIII site with any combination of the sites from the polylinker can be used to clone the shRNA constructs made by basepairing two oligonucleotides composed by 20-25 nucleotides long regions complementer to the targeted gene in inverted repeat form and linked by a loop sequence (AAGTACTCT) which allows the folding of the RNA into a hairpin (Fig. 4). To facilitate the finding of the clones containing the very short insert, a ScaI site

VvU6.1 CCCTCTCTATCCTAGGACACACTAAAGCAT-AATCATTTATTAGCTTCAACACCAAC--A VvU6.2 TTCCCTCTCAGCTCTCCCAACTTTTCTCATCAATTTTTTGGTTGCATAAATTTTCCCCAA * **** ** ** * *** *** *** * ** * ** * * U6pfw 5’-CTCTCAGCTCTCCCAACTTTTCTC VvU6.1 GTCTCACTGATTCATCTT--CGACTCTG--AAACCTAGACTAAATCAAAGTTCAACCCAA VvU6.2 ATTTTGACAATATGTTCTTCCAATTTTGTTGAGTAAAAAACCAAATAGAGTTGGATGTTT * * ** * * * * * ** * * * ** * **** * VvU6.1 ACCAATATCCCAAATCAAAGTTCAAAATATAAGTACAACTAAGAATTAAAGAAATAAACG

VvU6.2 TCCTTTGATT-GTCTATAAGATGAAAATATAAGTATAACAAACAAATGAAGAAGTAAAGA ** * * *** * ************ *** ** ** * ***** **** VvU6.1 AACAGAACGTATCCACGACCAAATAAAGAAACAAGAGAAGCAACCCTTACCTTAAGATTG VvU6.2 AGCAGAACATATCCACAACCAAATAAAGAAACAAGAAAAGTGACCCTCACTTTCAGGTTG * ****** ******* ******************* *** ***** ** ** ** *** VvU6.1 GGGACCCCCATGAACTCCATCAGGCGGTGCAGGTCATGTGAAACGACAACGTTTTGGGCA VvU6.2 TGGACCCACATAAA--------GGCAGTGCAGGTTGAGTGAAACGGCATCGTTTTGGGCA ****** *** ** *** ******** ******** ** *********** VvU6.1 TCCCATACCCAACATCCCCCATCACTTCTCTCATCCCACATCGAAACTTCACCAATAAAT VvU6.2 GCCGGGGGTC-----TTGACATCCCCATTCCCATCCCACATCGAAACTTTAAGACCAGAT ** * **** * ** ****************** * * * ** VvU6.1 TAGTGTCTTCATATTATCCAGCTCTCATACTGAAGTTTGTCTCTTCGGGGACATCCGATA VvU6.2 ATGTTTCCTCATATATTGAAACTCCACTATTAAAGCTTGTCCCTTCGGGGACATCCGATA ** ** ****** * * *** ** * *** ***** ****************** U6prev GAGGTGATAATTTCGAACAGGGAAGCCATGGTA-5’ VvU6.1 AAATTGGAACGATACAGAGAAGAATCGAATTCCCGCGGCCGCCATGGCGGCCGGGAGCAT VvU6.2 AAATTGGAACGATACAGAGAAGAATCGAATTCCCGCGGCCGCCA-GGCGGCCGGGAGC-- ******************************************** *************

59

(underlined) was introduced into the loop sequence. This way the positive clones give two fragments (930 bp and 1800 bp) after ScaI digestion while the empty vector gives only one (Fig. 4 inset).

Using an RNA polymerase III specific U6 promoter from grapevine we developed the vector pRDU6P1 which is suitable to produce shRNA in plant cells. To express the gene in plants, plasmid DNA can be delivered directly by particle bombardment. Alternatively, the U6 promoter + shDNA cassette of the pRDU6P1 vector can be transferred into a binary vector using the flanking EcoRI and one of the polylinker sites. Such a binary construct could be introduced into the leaves by agroinfiltration.

Figure 4. The pUC18 based pRDU6P1 vector exploiting the Vitis U6 promoter for shRNA

production. The unique HindIII and the polilinker sites (KpnI, BamHI, XbaI, SalI) are used to introduce the short fragment produced by hybridization of two oligonucleotides specific to the targeted gene. The inset: ScaI digestion of plasmid DNA of a negative (right) and two positive (middle) clones.

Acknowledgments This project was funded by the National Centre of Competence in Research (NCCR) Plant Survival, a research programme of the Swiss National Science Foundation. References Baulcombe, D.C. 2004: RNA silencing in plants. – Nature 431: 356-363. Cohen, Y.R. 2002: β-aminobutyric acid-induced resistance against plant pathogens. – Plant

Dis. 86: 448-457. Cohen, Y., Reuveni, M. & Baider, A. 2002: Local and systemic activity of BABA (β-amino-

butyric acid) against Plasmopara viticola in grapevines. – In: Advances in Downy Mil-dew Research (eds. Spencer-Phillips et al.). Kluwer Academic Publishers, Netherlands.

pRDU6P1 U6 promoter

Sca I Sca I

HindIII

KpnI BamHI XbaI SalI

EcoRI

sh

60

Jakab, G., Cottier, V., Toquin, V., Rigoli, G., Zimmerli, L., Metraux, J.P. & Mauch-Mani, B. 2001: Beta-aminobutyric acid-induced resistance in plants. – Eur. J. Plant Pathol. 107: 29-37.

Lodhi, M.A., Ye, G.N., Weeden, N.F. & Reisch, B.I. 1994: A simple and efficient method for DNA extraction from grapevine cultivars, Vitis species and Ampelopsis. – Plant Molecular Biology Reporter 12(1): 6-13.

Ton, J. & Mauch-Mani, B. 2004: β-amino-butyric acid-induced resistance against necro-trophic pathogens is based on ABA-dependent priming for callose. – Plant J. 38: 119-130.

Ton J, Jakab G, Toquin V, Iavicoli A, Flors V, Maeder MN, Métraux JP and Mauch-Mani B 2005: Dissecting the β-aminobutyric acid-induced priming phenomenon in Arabidopsis. – Plant Cell. In press.

Waibel, F. & Filipowicz, W. 1990: U6 snRNA genes of Arabidopsis are transcribed by RNA polymerase III but contain the same two upstream promoter elements as RNA polymerase II-transcribed U-snRNA genes. – Nucleic Acids Res. 18(12): 3451-3458.

Zimmerli, L., Jakab, G., Métraux, J.P. & Mauch-Mani, B. 2000: Potentiation of pathogen-specific defense mechanisms in Arabidopsis by β-aminobutyric acid. – Proc. Natl. Acad. Sci. USA. 97: 12920-12925.


pp. 61 - 67

61

Combined transcript and metabolite analysis reveals genes involved in spider mite induced volatile formation in cucumber plants Iris F. Kappers1,2, Per Mercke1, Francel W.A. Verstappen1, Oscar Vorst1, Marcel Dicke2, Harro J. Bouwmeester1 1 Plant Research International, P.O. Box 16, 6700 AA Wageningen, the Netherlands; 2 Laboratory of Entomology, Wageningen University, P.O. Box 8031, 6700 EH Wageningen,

The Netherlands Abstract: In response to feeding by herbivorous insects many plant species produce volatile compounds, particularly terpenoids, that are used by natural enemies of the herbivores to locate their prey. We are studying the factors that regulate this volatile production in cucumber (Cucumis sativus) leaves upon feeding by the two-spotted spider mite (Tetranychus urticae) and that are used as cues by the predatory mite Phytoseiulus persimilis. Cucumber shows a clear and specific induction of volatiles upon spider mite feeding or jasmonic acid spraying. Here we show how we use metabolomics and transcriptomics to isolate and characterize enzymes and genes involved in signaling and volatile production. Key words: cDNA micro-array, self-organizing map, metabolomics, transcriptomics, terpene synthase genes Introduction The many parameters that affect a plant’s response to herbivory suggest the involvement of a sophisticated defense system that optimizes response depending on the intruding organism. The impact of individual compounds in a volatile blend emitted by herbivore-infested plants on predator behavior is difficult to investigate. Nevertheless, single compounds have in a number of cases been shown to attract predators (Dicke et al., 1990; Kessler & Baldwin, 2001) and careful exploitation of differential induction of volatiles by herbivory and jasmonic acid has enabled to study the role of individual compounds within the total volatile blend emitted by the plant (De Boer & Dicke, 2004). However, the latter method may be used to investigate the role of some compounds but not of many others. The biosynthesis of most of the induced volatiles occurs de novo (Paré & Tumlinson, 1997) and involves the induction of enzyme activity (Bouwmeester et al. 1999; Degenhardt & Gershenzon, 2000). The cloning of genes that encode key enzymes regulating the biosynthesis of specific volatile compounds followed by the creation of transgenic plants with changed expression of these genes (over-expression or knock-outs), provides an exciting approach to elucidate the impact of the different volatiles in a blend and improve plant indirect defense (Bouwmeester et al., 2003).

Cucumber leaves (Cucumis sativus) have been demonstrated by several authors to produce a limited number of compounds upon spider mite infestation and the role of volatile production in predator attraction is well characterized (Takabayashi et al., 1994; Janssen et al., 1998; Agrawal et al., 2002). To identify cucumber genes of which the expression changes upon herbivory we decided to use an untargeted approach. Global gene expression techniques like cDNA microarrays have been developed to follow changes in the transcriptome. Here, we have used subtractive cDNA libraries (SSH) as a source for clone selection in the microarray preparation procedure, to increase the proportion of regulated target clones.

62

A next challenge in further refining the search for biosynthetic genes is to make a parallel analysis of transcript and metabolite profiles. Significant correlations between the metabolic contents and the expression of relevant genes have been demonstrated in a system using potato tubers (Urbanczyk-Wochniak et al., 2003). Here, we apply cDNA microarray analysis, in combination with a metabolomics approach to the study of spider mite induced gene expression in Cucumis sativus L. cv Corona with special focus on the induced volatiles that attract predators of the herbivores. Spider mite infestation and treatment with jasmonic acid induce a similar but not identical defense response. Therefore, these treatments were used in order to reveal transcriptional variation of genes involved in plant defense. Transcriptome (microarray analysis) and metabolome (volatile analysis) data were analyzed using correlation coefficients in combination with self organizing maps (SOM) in order to link genes to specific induced volatiles, emitted by cucumber leaves upon the different treatments. Material and methods Plant material and treatments Three-week old cucumber plants were infested with spider mites, sprayed with 1 mM jasmonic acid in water (0.01% Tween-20) or rubbed with carborundum powder for mechanical wounding. Volatile measurements and tissue samples for mRNA preparation were taken at 0, 6, 24, 48, 72, 96 and 168 h after treatment. Headspace analysis, extraction of mRNA and preparation of cDNA libraries Headspace trapping was used to analyse volatiles released from four leaf disks (∅ 6 cm) from each plant. The headspace was sampled for 3 hrs and analyzed using GC-MS as described previously (Bouwmeester et al., 1999). The rest of the leaf material was frozen in liquid nitrogen for mRNA extraction. To enrich for cDNA’s involved in indirect plant defence reactions two subtractive libraries (SSH) were made (up- and down-regulated; spider mite v. control) and cloned into pGEMT easy (Mercke et al., 2004). CDNA microarray and expression data analysis 713 random clones from the SSH+ and the SSH- were spotted on a cDNA microarray. The microarrays were hybridized using Cy3 and Cy5 labeled cDNA synthesized from the mRNA of the different time points. The transcriptome from each sample was compared to a common reference of a mixture of all mRNA samples (Mercke et al., 2004). 2Log-values for the amounts of volatiles were calculated and included in the dataset. Gene expression profiles and volatile production were analysed using Principle Component Analysis (PCA). The significance level for correlations was set at P≤0.005 (Mercke et al., 2004). Cloning and characterization of terpene synthases cDNAs with homology to GenBAnk sesquiterpene synthases found in clusters that also contained volatiles were used as a probe to screen a phage cDNA-library made of spider mite induced cucumber leaves. Full length cDNAs were cloned into expression vector pET23c. Functional protein expression and product identification were essentially carried out as descibed before (Mercke et al., 2004) using GC-MS (Bouwmeester et al., 1999). Results and discussion Induced and repressed responses A number of microarray cDNA fragments with a sequence most similar to a gene encoding a PR-1 protein (T08154) is strongly up-regulated by spider mite infestation and redundant in our SSH+ library. Comparing spider mite infested plants with non-infested plants, we found these cDNAs to be the most up-regulated genes along with lipoxygenase-gene derived

63

fragments (T10085). Inter-comparison of the transcriptome from several treatments makes it possible to segregate the lipoxygenase cDNA and the PR-1-like cDNAs. PR-1 cDNAs are among those later induced by jasmonic acid treatment compared to the lipoxygenase cDNAs. PR-1 proteins are generally associated with salicylic acid induced pathways. However, methyl jasmonate has been shown to induce PR-1 in tobacco (Xu et al., 1994) and also other SA-independent PR-1-inducing factors have been reported (Pieterse & van Loon, 1999). The most strongly down-regulated clones were mainly of housekeeping origin, especially cDNAs involved in photosynthesis.

It is known from earlier reports that jasmonic acid and spider mites induce different blends of predator-attracting volatiles in lima bean plants (Dicke et al., 1999) and this was now also shown to be the case for cucumber (Fig. 2). Jasmonic-acid sprayed plants produced larger quantities of volatiles but also a different blend. From our experiments we find that the ratio of terpenoids to (Z)-3-hexenyl acetate was significantly higher in the jasmonic acid-sprayed plants than in the spider mite infested plants at seven days after infestation. It should be noted that the jasmonic acid-sprayed plants are not mechanically damaged, whereas the spider mite infested plants are being mechanically damaged continuously by the herbivores. The differences between the jasmonic acid and spider mite treatments in volatile formation are likely caused by the stimulation of a broader spectrum of signal transduction pathways by the herbivore (Ozawa et al., 2000, Horiuchi et al., 2001, Dicke et al., 2003). Data analysis When ranking the clones based on how well their expression pattern over all the treatments correlates with the emission rates of specific volatiles we obtained a list of several cDNA clones with significant correlation values. Based on their expression pattern, volatile data and cDNAs are clustered into 24 groups in a SOM (Fig. 1A). Candidate genes for a role in the biosynthesis of volatiles were selected from this SOM and the Pearson correlation coefficients used to rank genes. For example, there are two different cDNA fragments corresponding to the cDNA of (E,E)-α-farnesene synthase on the chip “5G8” and “8D11”. These two cDNA fragments have the highest correlation with the volatile emission data of (E,E)-α-farnesene and also form a separate cluster with (E,E)-α-farnesene (Fig. 1B). The SOM in Fig. 1A also allocates peroxidase-like fragments to the same group as 4,8-dimethyl-1,3(E),7-nonatriene. cDNAs involved in volatile biosynthesis We cloned the (E,E)-α-farnesene synthase (accession number: AY640154) supported by the observation that the product (E,E)-α-farnesene correlated well with two cDNA fragments over all the treatments The result demonstrates the applicability of combining metabolic profiling and global gene-expression techniques. (E,E)-α-farnesene has been reported before to be a component in the herbivory-induced volatiles from Cucumis sativus (Takabayashi et al. 1994, Bouwmeester et al., 2003) and is known to attract carnivorous arthropods (Scutarenu et al., 1997). (E,E)-α-farnesene and its synthase had a different induction pattern compared to the other induced volatiles and enzymes (Fig. 2B). It is tempting to speculate that the (E,E)-α-farnesene synthase needs a higher threshold of intracellular jasmonic acid to be activated than the other terpene synthases, resulting for example from direct jasmonic acid spraying or very intense spider mite feeding.

We have also cloned, expressed and identified another sesquiterpene synthase, i.e. (E)-ß-caryophyllene synthase (accession number: AY640155). (E)-ß-caryophyllene was never detected as an induced volatile in cucumber and, to our knowledge, has not been reported from cucumber in the literature. In many other plant species (E)-ß-caryophyllene is an important constituent of the induced volatile blend (Bouwmeester et al., 2003, Van den Boom et al., 2004). The absence of (E)-ß-caryophyllene in the volatile blend of induced cucumber could perhaps be due to a low or localized expression. We are currently investigating if the

64

cloned (E)-ß-caryophyllene synthase has a role in the herbivore-induced defense system in cucumber. Figure 1. (A) Self-organizing-map with 24 components reflecting the gene expression and

volatile formation patterns. Each circle/pie represents a cluster of genes with similar expression pattern. The larger the circle the more clones in this particular group with a similar expression pattern. Intracircular color codes: Spider mite and early jasmonic-acid induced genes (waves), spider mite and late jasmonic-acid induced genes (dotted), (Z)-3-hexenyl acetate (1, white), (E)-ß-ocimene (2, hatched), 4,8-dimethyl-1,3(E),7-nonatriene (3, grey), (E,E)-α-farnesene (4, black).

4,8-Dimethyl-1,3(E),7-nonatriene, a terpenoid that attracts the predator Phytoseiulus persimilis of the spider mite T. urticae (Dicke et al., 1990) clustered into group D3 (Fig. 4). This C11-hydrocarbon is biosynthesized from the terpenoid precursor 3S-(E)-nerolidol by a sequence of oxidative degrading steps (Donath & Boland, 1994. 1995; Bouwmeester et al., 1999; Degenhardt & Gershenzon 2000). In this, or neighboring groups, we did not find any cDNAs likely to be involved in the biosynthesis of 3S-(E)-nerolidol (i.e. a sesquiterpene synthase). However, group D3 contains four cDNA fragments (3B8, 6B1, 5E2 and 6C12) with homology to cucumber acidic peroxidase T10444. Peroxidases have shown to be involved in a wide range of oxidizing reactions and are consequently interesting candidates for a role in the oxidation of 3S-(E)-nerolidol to 4,8-dimethyl-1,3(E),7-nonatriene. A possible

A 1 2 3 4 5 6

A

B

C

D1

2

3

4

B c0 m6

m24

m48

j6 j24

j48

j72

s24

s48

s72

s96

s168

c6

(E,E )-α-FarneseneFarnesene synthase fragment (5 G 8)Farnesene synthase fragment (8 D 11)Unknown (3 E 2)Pectin acetylesterase (4 E 11)

A 1 2 3 4 5 6

A

B

C

D

1 2 3 4 5 6

A

B

C

D1

2

3

4

B c0 m6

m24

m48

j6 j24

j48

j72

s24

s48

s72

s96

s168

c6


B c0 m6

m24

m48

j6 j24

j48

j72

s24

s48

s72

s96

s168

c6


65

role for cytochrome P450s in the conversion of nerolidol to 4,8-dimethyl-1,3(E),7-nonatriene has also been suggested (Donath & Boland, 1994, 1995), but we did not detect any cytochrome P450s in group D3.

Interestingly, the additional N-terminal coding sequence (44 aa) of (E,E)-α-farnesene synthase has a pI of 8.7, relative to the overall pI of 5.2, which is a common feature of plastid targeting sequences and also according to the iPSORT program (Bannai et al., 2002) the enzyme will be targeted to the chloroplast. Moreover, the (E,E)-α-farnesene synthase catalyzes the formation of (E)-ß-ocimene from GDP at about equal efficiency as the formation of (E,E)-α-farnesene from FDP (data not shown) and the correlation of the expression pattern of the farnesene cDNA fragments to the volatile (E)-ß-ocimene is high and significant (Fig. 5D). Thus, this could theoretically imply a dual role for this enzyme, with the targeting signal enabling the pre-enzyme to enter the plastids that in Arabidopsis have been shown to contain GDP as well as some FDP (Aharoni et al., 2003) and subsequently form both (E)-ß-ocimene and (E,E)-α-farnesene. The reported presence of FDP in Arabidopsis plastids (Aharoni et al., 2003), the plastid targeting signal, the dual product formation in vitro and the correlations between expression and metabolite formation makes the production of (E)-ß-ocimene and/or (E,E)-α-farnesene by one enzyme a serious option.

In conclusion, the approach to combine global gene expression analysis with metabolite analysis has resulted in the discovery of cucumber genes involved in induced volatile emission and indirect defense. Apparently, in a regulated system, such as the induced indirect defense system we have used here, enzyme activities involved are partly proportional to the presence of the corresponding transcripts and the correlation between volatile emission and gene expression patterns can then be used to select interesting genes. This approach has good potential for identifying more genes involved in induced plant defense or other metabolic pathways in the future. Figure 2. Volatile profile over time emitted from four leaf disks after spraying with 1 mM jas-

monic acid (A) and after spider mite infestation (B) In (B) the right Y-axis represents data for (Z)-3-hexenyl acetate. Error bars indicate standard error of three replicates.

(Z)-3-Hexenyl acetate

(E)-β-Ocimene

4,8-Dimethyl-1,3(E),7-nonatriene

(E,E)-α-Farnesene

0.2

0.6

1.0

0 24 48 72 96 168

2.0

6.0

10.0B

Dete

ctor

resp

onse

(x 1

06 )

2

6

10

0 6 24 48 72

A

Time after induction [h]

(Z)-3-Hexenyl acetate

(E)-β-Ocimene

4,8-Dimethyl-1,3(E),7-nonatriene

(E,E)-α-Farnesene

0.2

0.6

1.0

0.2

0.6

1.0

0 24 48 72 96 168

2.0

6.0

10.0B

Dete

ctor

resp

onse

(x 1

06 )

2

6

10

0 6 24 48 72

A

Time after induction [h]

66

Acknowledgements This work was supported by Marie Curie Individual fellowship (MCFI-2000-01234) (to PM), the Dutch Technology Foundation (STW project WPB.5479) (to IFK) and the Dutch Ministry of Agriculture, Nature Management and Fisheries (DWK 333) (to FWAV and HJB). This paper was previously published as a complete version in Plant Physiol 135: 2012-2024. References Agrawal, A.A., Janssen, A., Bruin, J., Posthumus, M.A. & Sabelis, M.W. 2002: An ecological

cost of plant defence: attractiveness of bitter cucumber plants to natural enemies of herbivores. – Ecol. Lett. 5: 377-385.

Aharoni, A., Giri, A.P., Deuerlein, S., Griepink, F., de Kogel, W.J., Verstappen, F.W.A., Verhoeven, H.A., Jongsmaa, M.A., Schwab, W. & Bouwmeester, H.J. 2003: Terpenoid metabolism in wild-type and transgenic Arabidopsis plants. – Plant Cell 15: 2866-2884.

Bannai, H., Tamada, Y., Maruyama, O., Nakai, K. & Miyano, S. 2002: Extensive feature detection of N-terminal protein sorting signals. – Bioinformatics 18: 298-305.

Bouwmeester, H.J., Verstappen, F.W., Posthumus, M.A. & Dicke, M. 1999: Spider mite-induced (3S)-(E)-nerolidol synthase activity in cucumber and lima bean. The first dedicated step in acyclic C11-homoterpene biosynthesis. – Plant Physiol. 121: 173-180.

Bouwmeester, H.J., Kappers, I.F., Verstappen, F.W., Aharoni, A., Luckerhoff, L.L.P., Lücker, J., Jongsma, M. & Dicke, M. 2003: Exploring multi-trophic plant-herbivore interactions for new crop protection methods. – In: J. Pickett, ed., Proceedings of the International Congress Crop Science and Technology, Glasgow, Vol. 2, 10-12 November 2003. British Crop Protection Council, Farnham, UK: 1123-1134.

De Boer, J.G. & Dicke, M. 2004: Prey searching behavior of the predatory mite Phytoseiulus persimilis: the role of methyl salicylate. – J. Chem. Ecol. 30: 255-271.

Degenhardt, J. & Gershenzon, J. 2000: Demonstration and characterization of (E)-nerolidol synthase from maize: a herbivore-inducible terpene synthase participating in (3E)-4,8-dimethyl-1,3,7-nonatriene biosynthesis. – Planta 210: 815-822.

Dicke, M., van Beek, T.A., Posthumus, M.A., Ben Dom, N., van Bokhoven, H. & de Groot, A.E. 1990: Isolation and identification of volatile kairomone that affects acarine predator prey interactions. Involvement of host plant in its production. – J. Chem. Ecol. 16: 381-396.

Dicke, M., van Poecke, R.M.P. & de Boer, J.G. 2003: Inducible indirect defence of plants: from mechanisms to ecological functions. – Basic Appl. Ecol. 4: 27-42

Dicke, M., Gols, R., Ludeking, D. & Posthumus, M.A. 1999: Jasmonic acid and herbivory differentially induce carnivore-attracting plant volatiles in Lima bean plants. – J. Chem. Ecol. 25: 1907-1922.

Donath, J. & Boland, W. 1994: Biosynthesis of acyclic homoterpenes in higher-plants paral-lels steroid-hormone metabolism. – J. Plant Physiol. 143: 473-478.

Donath, J. & Boland, W. 1995: Biosynthesis of acyclic homoterpenes: enzyme selectivity and absolute configuration of the nerolidol precursor. – Phytochem. 39: 785-790.

Horiuchi, J., Arimura, G., Ozawa, R., Shimoda, T., Takabayashi, J. & Nishioka, T. 2001: Exogenous ACC enhances volatiles production mediated by jasmonic acid in lima bean leaves. – FEBS Lett. 509: 332-336.

Janssen, A., Pallini, A., Venzon, M. & Sabelis, M.W. 1998: Behaviour and indirect inter-actions in food webs of plant-inhabiting arthropods. – Exp. Appl. Acarology 22: 497-521.

67

Kessler, A. & Baldwin, I.T. 2001: Defensive function of herbivore-induced plant volatile emissions in nature. – Science 291: 2141-2144.

Mercke, P., Kappers, I.F., Verstappen, F.W.A., Vorst, O., Dicke, M. & Bouwmeester, H.J. 2000: Combined transcript and metabolite analysis reveals genes involved in spider mite induced volatile formation in cucumber plants. – Plant Physiol. 135: 2012-2024.

Ozawa, R., Arimura, G., Takabayashi, J., Shimoda, T. & Nishioka, T. 2000: Involvement of jasmonate- and salicylate-related signaling pathways for the production of specific herbivore-induced volatiles in plants. – Plant Cell Physiol. 41: 391-398.

Paré, P.W. & Tumlinson, J.H. 1997: De novo biosynthesis of volatiles induced by insect herbivory in cotton plants. – Plant Physiol. 114: 1161-1167.

Pieterse, C.M.J. & van Loon, L.C. 1999: Salicylic acid-independent plant defence pathways. – Trends Plant Sci 4: 52-58.

Scutarenu, P., Drukker, B., Bruin, J., Posthumus, M.A. & Sabelis, M.W. 1997: Volatiles from Psylla-infested pear trees and their possible involvement in attraction of anthocorid predators. – J. Chem. Ecol. 23: 2241-2260.

Takabayashi, J., Dicke, M., Takahashi, S., Posthumus, M.A. & van Beek, T.A. 1994: Leaf age affects composition of herbivore-induced synomones and attraction of predatory mites. – J. Chem. Ecol. 20: 373-386.

Urbanczyk-Wochniak, E., Luedemann, A., Kopka, J., Selbig, J., Roessner-Tunali, U., Willmitzer, L. & Fernie, A.R. 2003: Parallel analysis of transcript and metabolic profiles: a new approach in systems biology. – Embo 4: 1-5.

Van den Boom, C.E.M., van Beek, T.A., Posthumus, M.A., de Groot, A. & Dicke, M. 2004: Qualitative and quantitative variation among volatile profiles induced by Tetranychus urticae feeding on plants from various families. – J. Chem. Ecol. 30: 69-89.

Xu, Y., Chang, P.F.L., Liu, D., Narasimhan, M.L., Raghothama, K.G., Hasegawa, P.M. & Bressan, R.A. 1994: Plant defense genes are synergistically induced by ethylene and methyl jasmonate. – Plant Cell 6: 1077-1085.


pp. 69 - 73

69

Induction of resistance against tomato powdery mildew (Leveillula taurica) by Acremonium alternatum A-M. Kasselaki1,2, M. W. Shaw2,4, N. E. Malathrakis1, J. Haralambous3

1 STEG, Laboratory of biological control of plant diseases, TEI-Crete, Stavromenos 71 004, Heraklio, Crete, Greece, Email [email protected]

2 School of Plant Sciences, The University of Reading, Whitenights, Reading RG6 6AS, UK. 3 Hellenic Centre for Marine Research, P.O.Box 712, 19013 Anavissos, Attika, Greece 4 To whom correspondence should be addressed. Abstract: Acremonium alternatum reduced powdery mildew infection by Leveillula taurica on tomato leaves and on cucumber cotyledons when spores were applied alive or killed. The effect was systemic, protecting untreated leaves above the treated ones and depended on temperature and leaf age.

Key words: Leveillula taurica, Acremonium alternatum, biocontrol, induced resistance, organic, tomato

Introduction Powdery mildew caused by Leveillula taurica is a serious disease of tomato in the Mediterranean (Palti, 1988), the U.S and Canada (Guzman-Plazola, 1997; Cerkauskas et al., 2000). The threat that resistance to fungicides used will evolve, led to an interest in studying potential biocontrol agents, including hyperparasites. In Crete, the hyperparasite Acremonium alternatum was isolated and identified from the thallus of Podosphaera xanthii (=Sphaerotheca fuliginea), on cucumber (Malathrakis, 1985) and gave promising results against this pathogen on cucumber in practice (Malathrakis & Klironomou, 1992).

The aim of our experiments was to test A. alternatum as a biocontrol agent against L. taurica on tomato. In practice many putative fungal antagonists of powdery mildews are thought to act by induction of resistance rather than parasitism or antibiosis (Belanger & Labbe, 2002). To separate hyperparasitic effects from induced resistance effects, we applied A. alternatum dead as well as alive. Systemicity of induced resistance by A. alternatum was also investigated. Materials and methods Preparation of media Detached cucumber cotyledons were maintained in Petri dishes with 20 ml of a medium containing 15 g/L agar with 0.1 g/L citric acid, 0.1g/L L-ascorbic acid, 1 mg/L indole-3-butyric acid and 40 mg/L kanamycin filter sterilized and added to the molten agar before dispensing. Potato Dextrose Agar (PDA, Sigma-Aldrich) was prepared with 10 mg/L Kanamycin A monosulfate added when warm. Host plants – Acremonium alternatum Tomato seeds (F1 hybrid ‘Manthos’ GC 785, Thiram treated, S&G Netherlands) and cucumber seeds ‘Knossos’(Crete) were sown in peat (Kronos; Proviron, Netherlands) and grown in a controlled environment chamber (Conviron, Canada) at 25 °C and 12hL / 12hD.

70

A freeze-dried culture of A. alternatum supplied by ATCC was used as primary stock. Subcultures from this onto PDA incubated for 10 d at 25 oC and then stored at 5 oC were used as secondary stock cultures. Conidial suspensions were prepared with sterile distilled water, and adjusted to 106 spores/ml. Spores were killed by: a) Autoclave: 100mL were autoclaved at 121 oC for 15 minutes, and b) UV radiation: 100mL were placed in a transparent open plastic container under UV radiation in a laminar flow cabinet (Elmed B72, Greece) for 30 minutes. Effect of A. alternatum on L. taurica on cucumber cotyledons Cotyledons were collected 7days after sowing, submerged in 0.48 % sodium hypochlorite solution for two minutes, washed twice for 2 min in sterile deionised water and blotted dry. They were then immersed for one minute in sterile deionised water or one of the following suspensions of A. alternatum conidia: alive, autoclaved, or UV killed. They were blotted dry and placed on cotyledon agar at 21°C and 12hL/12hD (1 cotyledon/dish), with 5 replicates. The next day, each cotyledon was inoculated in 5 evenly spaced places with L. taurica conidia from cotyledons infected 15 days earlier, using an entomological needle. The number of conidiophores per spot was recorded 9 and 12 days, after inoculation. Data were log trans-formed for analysis to produce homogenous variances. Cultural techniques in growth chamber experiments Experiments were conducted in two C.E. chambers (Conviron EF7, Canada (125x60x110 cm). The light source was overhead and comprised 4 pairs of 60W fluorescent lamps and 4 60W incandescent bulbs. Seedlings were transplanted at the 3 - 5 true leaf stage into plastic pots (10x12 cm) with peat substrate on plastic saucers for watering. They were trained on 1m high plastic sticks and tap watered daily. Plants were inoculated with a 104spores/ml suspension of L. taurica. Inoculum was obtained from newly infected leaves on heavily infected tomato plants in the greenhouse. Effect of temperature One of the chambers was set at 27°C and the other was set at 19°C. Photoperiod in both was 12hL/12hD. Small electric fans were placed on the bottom of the chamber every ten days, at three different spots among the plants, for 20 minutes each time, in order to ensure spreading of inoculum and infection of the upper leaves. Disease severity was assessed visually on leaves 1-8. In a preliminary experiment of 9 weeks (data not presented) twelve plants in each chamber were artificially inoculated with L. taurica. In the main experiment of 10 weeks fourteen tomato plants were placed in each chamber. Every 7 days, half the plants in each chamber were sprayed with autoclaved A. alternatum spore suspension and half with water. Data were logit transformed and regressed on time to estimate ‘T50’ (time needed for disease to reach 50%) and ‘epidemic rate’. A univariate factorial ANOVA was then applied. Systemicity Both chambers were set at 25°C and 12hL/12hD photoperiod. Tomato plants were placed in the chamber in three rows of five. A total of five treatments were applied, each to one plant in a row. The treatments were the factorial combinations of A. alternatum suspensions applied to run-off 7 and 2 days before artificial inoculation with L. taurica to either the 1st leaf or the 1st and the 3rd leaves, plus water sprayed plants as a control. Number of disease lesions and percentage of infected area, estimated visually, were recorded on leaves 1-4, 17 days after inoculation. The variate ‘size’ (severity / number of lesions) was calculated and log trans-formed for analysis. The number of lesions was analysed untransformed following prelimi-nary tests. Treatments were compared using the following orthogonal comparison contrasts in ANOVA: a) All A. alternatum treatments compared to water, b) All day 7 A. alternatum treatments compared to day 2, c) Treatment of leaf 1 compared to treatment of leaves 1+3 and d) Interaction between ‘day of treatment’ and ‘leaves treated’.

71

Results Effect of A. alternatum on L. taurica on cucumber cotyledons A. alternatum suspensions, alive or killed, reduced the number of conidiophores after 9 days by 97% on average, and by 80% at 12 days (Fig.1). Figure 1: Average number, log-transformed, of Leveillula taurica conidiophores at 9 and 12 d

after application of Acremonium alternatum alive or killed suspensions on cucumber cotyledons. Error bars represent 2 SEM

Effect of temperature The interaction of ‘temperature’and ‘treatment’ was significant at P<0.05 on all leaves. Autoclave killed A. alternatum prolonged T50 by 50% or more at 27° C but not at 19° C (Fig. 2A&B). Epidemic rate was consistently reduced by about 30% at 27°C but not at 19°C (Fig. 2C&D). However, the effect was not significant at P < 0.05 on leaves 3 and 4. Systemicity Up to 85% fewer L. taurica lesions appeared on leaves of plants sprayed with autoclaved A. alternatum spores in the most favourable treatments (P <0.001, Fig. 3A). The effect was similar on all leaves. Application 7 days before inoculation gave a slightly larger effect than application 2 days before inoculation (P< 0.05). The treatments reduced the number of lesions as much on leaves not directly treated as on those directly treated. Size of L. taurica lesions was approximately halved on leaves 1 and 2 sprayed with killed A. alternatum spores (Fig 3B). On leaf 1, treatment of both leaves 1 and 3 at 7d before inoculation was particularly effective, giving an 80% reduction, but on leaf 2 the effect did not depend on time of application or number of treated leaves. The treatment had little if any effect on leaves 3 and 4. Discussion A. alternatum treatment of tomato plants or cucumber cotyledons had a substantial and significant effect on L. taurica infection. On cucumber cotyledons, conidiophore appearance

0

2

4

6

alive autocl. uv water

A. alternatum treatment

ln(C

onid

ioph

ores

/inf

ectio

n po

int)

9 days

12 days

72

was delayed and numbers were greatly reduced by live or killed conidia leading to the conclusion that A. alternatum induces resistance to the plants. Experiments in controlled conditions showed that the resistance was induced much more effectively at 27°C than 19°C. It is unlikely that this was an artefact due to stress, since a 6°C temperature shock is fairly small. The interaction could therfore be a direct effect of temperature on the mechanism of resistance, or could reflect the way temperature affects the pathogen. It is plausible that interactions between plant defence mechanisms and temperature should occur, since Guzman-Pazola (1997) noted that while high (>25°C) temperatures favour infection and formation of new lesions of L. taurica on tomato, lower temperatures (<20°C) favour expansion of already existing lesions.

Figure 2: Distribution of T50 (time needed for disease to reach 50%) at 27°C (A) and 19°C (B), and epidemic rate at 27°C (C) and 19°C (D), on leaves 1-8 of tomato plants inoculated with Leveillula taurica, sprayed with either water or autoclave killed Acremonium alternatum spores, and maintained in a CE chamber.

The systemicity experiment showed that effects and probably intrinsic susceptibility varied substantially between leaves. On the older leaves 1 and 2, the main reduction was in L. taurica lesion expansion (size), while on the younger leaves 3 and 4, lesion numbers were significantly reduced but lesion expansion was hardly affected.

In conclusion, A. alternatum provided moderate control of infection by L. taurica, as an inducer of resistance. The effect was systemic and very effective under some circumstances, but varied with leaf age, time of application, and temperature.

27oC A

T50

(d)

250

200

150

100

50

0

19oC B

Leaf

87654321

Rat

e (d

-1)

0.40

0.35

0.30

0.25

0.20

0.15

0.10

0.0500.00

27oC C

Leaf

87654321

Treatment

A. a aut.

Water

19oC D

27oC A

T50

(d)

250

200

150

100

50

0

19oC B

Leaf

87654321

Rat

e (d

-1)

0.40

0.35

0.30

0.25

0.20

0.15

0.10

0.0500.00

27oC C

27oC A

T50

(d)

250

200

150

100

50

0

19oC B

Leaf

87654321

Rat

e (d

-1)

0.40

0.35

0.30

0.25

0.20

0.15

0.10

0.0500.00

27oC C

Leaf

87654321

Rat

e (d

-1)

0.40

0.35

0.30

0.25

0.20

0.15

0.10

0.0500.00

27oC C

Leaf

87654321

Treatment

A. a aut.

Water

19oC D

Leaf

87654321

Treatment

A. a aut.

Water

19oC D

73

Figure 3: Mean number of lesions (A) and mean size of lesion (B) of Leveillula taurica on

tomato leaves (1-4), for different treatments of Acremonium alternatum autoclaved: D2(D7) L1+3 (application 2(7) days before inoculation on leaves 1 &3) and D2(D7)L1 (application 2(7) days before inoculation on leaf 1).

Acknowledgements We thank the School of Agriculture in the Technological Educational Institute (TEI), Crete, Greece for facilities for the experiments. References Belanger, R.R. & Labbe, C. 2002: Control of powdery mildews without chemicals:

prophylactic and biological alternatives for horticultural crops. – In: Belanger, R.R., Bushnell, W.R., Dik, A.J. & Carver, T.L.W., eds. The Powdery Mildews. A Comprehensive Treatise, St. Paul, Minnesota: APS Press: 256-267.

Cerkauskas, R.F., Leopold, L. & Ferguson, G. 2000: Control of powdery mildew in green-house cucumbers, peppers, and tomatoes. (Abstract). Phytopathology 90: S12.

Guzman-Plazola, R.A. 1997: Development of a spray forecast model for tomato powdery mildew (Leveillula taurica) (Lev.) Arn. – Davis, California.: University of California, PhD thesis.

Heil, M. 2001: The ecological concept of costs of induced systemic resistance (ISR). – European Journal of Plant Pathology 107: 147-51.

Malathrakis, N.E. 1985: The fungus Acremonium alternatum Linc: Fr., a hyperparasite of the cucurbits powdery mildew pathogen Sphaerotheca fuliginea. – Zeitschrift für Pflanzen-krankheiten und Pflanzenschutz 92: 509-15.

Palti, J., 1988: The Leveillula mildews. – Botanical Review 54: 423-535. Malathrakis, N.E. & Klironomou, E.J. 1992: Effectiveness of Acremonium alternatum and

Glycerol against cucumber powdery mildew (Sphaerotheca fuliginea). – In: Tjamos, E.C., Papavizas, G.C. & Cook, R.J., eds. Biological control of plant diseases. NATO ASI Series 230: 443-6.

Assessment 2

0

50

100

150

200

0 1 2 3 4Leaf number

Lesi

ons

D7L1,3 D2L1,3 D2L1D7L1 Control

A Assessment 2

0.00.10.20.30.40.50.60.70.80.9

0 1 2 3 4Leaf number

Siz

e of

lesi

on

D7L1,3 D2L1,3 D2L1D7L1 Control

B


pp. 75 - 78

75

Induction of defence related enzymes and systemic resistance by the plant activator acibenzolar-S-methyl in sugar beet against Cercospora beticola Sacc. Simona Marinello1, Pier Luigi Burzi1, Claudio Cerato1, Stefania Galletti1, Roberta Roberti2 1 Istituto Sperimentale per le Colture Industriali, Bologna, Italia. 2 Dipartimento di Protezione e Valorizzazione Agroalimentare, Alma Mater Studiorum, Università di Bologna, Italia

Abstract: The involvement of systemic acquired resistance in Cercospora leaf spot control by the application of acibenzolar-S-methyl (ASM) was studied under greenhouse and field conditions.

Nine plants of the sugar beet Monodoro cultivar, partially resistant to Cercospora beticola, were treated with ASM (Bion, Novartis) in the greenhouse and inoculated with the pathogen (T+I) four days later. Untreated – non-inoculated (C), treated – non-inoculated (T) and untreated – inoculated (I) groups of plants served as controls. Leaf samples of 300 mg per plant were collected 2, 4, 7 and 10 days after inoculation in order to analyse the induction of PR proteins peroxidase and chitinase after IEF in 3-5 pH range.

One peroxidase isoform (pI 4.7) was induced on days 7 and 10 in T+I and T plants, while it was absent in I and C plants. Three chitinase isoforms showed the highest enzymatic activity in T+I and T plants, reaching a peak 7 days after the inoculation.

In the open field, the same cv. was used, under a natural pressure of pathogen inoculum, comparing repeated ASM treatments with fungicide applications and untreated control.

The disease incidence of ASM treated plots was significantly lower than the control and not different from fungicide treated plots, showing the effectiveness of ASM treatments in Cercospora leaf spot control and in inducing plant resistance to the pathogen. Key words: Sugar beet, Cercospora leaf spot, SAR, acibenzolar-S-methyl, PR proteins. Introduction Cercospora leaf spot disease, caused by Cercospora beticola Sacc., is one of the most important wide spread fungal diseases affecting Beta species and it is present in most areas with a warm humid climate.

Systemic acquired resistance (SAR) is a plant defence state observed upon infection, conferring a protection against a large range of pathogens. This phenomenon is associated with the accumulation of salicylic acid and pathogenesis related (PR) proteins. Exogenous application of chemicals or biological control agents is effective in inducing resistance (Faize et al., 2004).

A potent SAR activator is acibenzolar-S-methyl (ASM), which does not have antimicrobial proprieties but instead increases crop resistance to diseases by activating the SAR signal transduction pathway in several plant species (Baysal et al., 2003).

In this study the plant resistance activator acibenzolar-S-methyl (Bion, Novartis) was tested by leaf treatment for its ability to protect sugar beet plants from Cercospora leaf spot and to induce PR protein such as chitinases (PR 3) and peroxidases (PR 9).

76

Materials and methods Greenhouse experiment and PR activity assays Nine sugar beet plants at the six leaf stage of the Monodoro cultivar, partially resistant to C. beticola, were treated with a suspension of ASM formulate wettable powder (50% of active ingredient) at a concentration of 60 mg L-1 in distilled water. The treatment was applied on one leaf per plant until run-off. Four days after the treatment an aqueous suspension (1x105 C. beticola conidia ml-1) was sprayed on the non-treated leaves of the same plants (T+I).

Untreated – non-inoculated (C), treated – non-inoculated (T) and untreated - inoculated (I) groups of plants served as controls. Two, 4, 7 and 10 days after inoculation, non-treated leaves were excised and plant proteins were extracted.

Peroxidase activity was determined after IEF on polyacrylamide gel within a pH range 3-5, incubated with 0.46% guaiacol and 13 mM H2O2 at room temperature. Chitinase activity was detected using an overlay gel containing 0.04% (w/v) glycol chitin as substrate after IEF (pH range 3-5). Bands were detected by staining with Calcofluor white M2R and visualized under UV (365 nm) exposure (Caruso et al., 1999). Field experiment The field study was conducted in 2004 at Rovigo province, in northern Italy, under natural C. beticola inoculum, on Monodoro cv., in a randomised block design with 6 replicates and 9 m2 plots. ASM suspension was sprayed at 15 day-intervals at the concentration of 60 mg L-1 (1 L per plot, 5 applications starting at 12 leaf stage). ASM treatments were compared to a water treated control and to conventional chemical control (3% cyproconazole and 9% fentin acetate, ALTO BS Syngenta), 2 kg ha-1, 2 treatments starting at 12 leaf stage.

Disease incidence was evaluated on August 18th by KWS scale-based score (0-9). Data were submitted to variance analysis; means were separated by L.S.D. test at P≤ 0.05 significant level (Statgraphics Plus 5.1). Results and discussion The analysis of systemically produced peroxidases showed that two isoforms (pI 4.7 and pI 4.4) were induced on day 7 and were still present on day 10 in T+I and T plants, while they were almost absent in I and C plants (Fig. 1, 2).

Figure 1. Peroxidase activity in sugar beet leaves after treatment with ASM and inoculation with

C. beticola (T+I) at 2, 4, 7 and 10 days after inoculation; untreated – non-inoculated = C, treated – non-inoculated = T; untreated – inoculated = I. For peroxidase activity crude proteins (30 µg per lane) from non-treated leaves were subjected to polyacrylamide gel by IEF. Arrows indicate the two isoforms induced by ASM treatment.

pI 4.7

pI 4.4

I C T T+I I C T T+I I C T T+I I C T T+I

d2 d4 d7 d10

77

Figure 2. Densitometric analysis of peroxidase isoforms with pI 4.4 (A) and pI 4.7 (B) performed

by Quantity One software (Bio-rad).

Several chitinase isoenzymes ranging from pI 3 and 5 in all samples were present (Fig. 3). Three isoforms, pI 3.6, 3.4 and 3.3, were affected by ASM treatment and C. beticola inoculum. They showed an increased activity in I plants two days after inoculation with respect to C plants followed by a decrease in the basal level. On the contrary, in T and T+I plants the three isoforms showed an increase starting from day 4 after inoculation, the level being maintained until day 10 (Fig. 3, 4).

Figure 3. Chitinase activity in sugar beet leaves after treatment with ASM and inoculation with

C. beticola (T+I) at 2, 4, 7 and 10 days after inoculation; untreated – non-inoculated = C, treated – non-inoculated = T; untreated - inoculated = I. Chitinase activity was detected after IEF (40 µg per lane) using an overlay gel containing 0.04% glycol chitin. Arrows indicate the three isoforms induced by ASM treatment.

Figure 4. Densitometric analysis of the three chitinase isoforms performed by Quantity One

software (Bio-rad).

I C T T+I I C T T+I I C T T+I I C T T+I

d2 d4 d7 d10

pI 3.6

pI 3.4

pI 3.3

Intensity x mm2 (103)

pI 3.6

0

500 1.000

1.500

2.000

2 4 7 10

pI 3.4

2 4 7 10days after inoculation

pI 3.3

2 4 7 10

ICTT+I

A

0

500

1.000

1.500


0

200

400

600


ICTT+I

Intensity x mm2 (103) ICTT+I

B

78

The effect of the different treatments on disease incidence, evaluated under greenhouse (data not shown) and field conditions, showed that repeated ASM treatments protected sugar beet leaves from Cercospora leaf spot in a way not different from the fungicide (Tab. 1). Table 1. Disease incidence after the different treatments in field trial on August18th evaluated by

KWS scale (0 = 0% of leaf necrotic area, 9 = 100% of leaf necrotic area).

Our results seem to indicate that the treatments with ASM upon challenge of C. beticola inoculation enhanced the systemic production of PR proteins (PR 3 and PR 9) in sugar beet upgrading the plant defence response in open field. References Baysal, O., Soylu, E.M. & Soylu, S. 2003: Induction of defence-related enzymes and resistance

by the plat activator acibenzolar-S-methyl in tomato seedling against bacterial canker caused by Clavibacter michiganensis ssp. michiganensis. – Plant Pathol. 52: 747-753.

Caruso, C., Chilosi, G., Caporale, C., Leonardi, L., Bertini, L., Magro, P. & Buonocore, V. 1999: Induction of pathogenesis-related proteins in germinating wheat seeds infected with Fusarium culmorum. – Plant Science 140: 87-97.

Faize, M., Faize, L., Koike, N., Ishizaka, M. & Ishii, H. 2004: Acibenzolar-S-methyl induced resistance to Japanese pear scab is associated with potentiation of multiple defence responses. – Phytopathol. 94(6): 604-612.

Treatments KWS score Cyproconazole + fentin acetate 2.67 a ASM 2.50 a Untreated 5.33 b


pp. 79 - 84

79

Control of phytopathogenic bacteria by chitosan Anna Maćkowiak-Sochacka, Henryk Pospieszny Institute of Plant Protection ul. Miczurina 20, 60-318 Poznań, Poland. Abstract: Conventional chemical and biological methods of plant protection are not sufficient in control of bacterial diseases thus, induction of plant defense mechanisms is a potential method to reduce phytopathogenic bacteria.

Chitosan, a natural copolymer of glucosamine and deacetylglucosamine shows wide biological activity and is biodegradable, biocompatibile and safe for environment. The aim of this work was to assess the effects of chitosan on the growth of pathogenic bacteria in vitro and on bacterial plant diseases. Antibacterial activity of chitosan derivatives was manifested dually: by the inhibition of the growth of bacteria in vitro and by the inhibition of bacterial infection.

Only cationic polymers of chitosan inhibited of the growth of bacteria, and cationic chitosan derivatives induced resistance of plant to bacterial infection. Efficacy of chitosan depended mainly on type of chitosan derivative as well as bacteria and plant species. Chitosan acted against bacterial diseases of plants more preventively than therapeutically. Key words: Phytopathogenic bacteria, chitosan, induced plant resistance. Introduction Control of phytopathogenic bacteria is mostly based on preventive treatment, because conventional chemical and biological methods of plant protection are not sufficient in this case. Induced resistance initiated as response to pathogen attack is a potential method for plant protection against bacterial diseases. Mechanisms of induced resistance (Hammerschmidt, 1999) occur in plant also as consequence of treatment with synthetic or natural inducers such as chitosan (Joubert et al., 1998; Ryan, 1998).

Chitosan, a natural copolymer of glucosamine and deacetylglucosamine naturally occurs only in the selected species of fungi. Usually chitosan is obtained by deacetylation of chitin crustaceans (Domard, 1993). Chitosan shows very wide biological activity and is biodegradable, biocompatibile and safe for environment. Biological activity of chitosan appears among others as the consequence of synthesis of phytoalexins and chitinase and proteinase inhibitors, changes in structure of plant cells, lignification of cell walls and apposition of callose following increase of the level of phenolic substances ( Barber et al., 1989). Chitosan causes also increase of peroxidase as well as H2O2 level (Maćkowiak & Pospieszny, 2000) and the inhibition of stomatal aperture by inducing the evolution of reactive oxygen species from guard cells in plant (Lee et al., 1999). Chitosan induces resistance in plants against such patogens as fungi (Benhamou & Theriault, 1993; El Ghaouth et al., 1994), viruses (Pospieszny et al., 1991) and viriods (Pospieszny, 1997). In the case of fungal pathogens chitosan induces not only resistance reactions but also is fungicidal against several fungi (Allan & Hadwiger, 1979)

The aim of this work was to evaluate the effects of chitosan on the growth of pathogenic bacteria in vitro and on bacterial plant diseases.

80

Materials and methods Bacteria The phytopathogenic bacterial strains used in experiments were: Agrobacterium tumefaciens L-1, Clavibacter michiganensis ssp. michgathe nenensis T-5, Clavibacter michiganensis ssp. insidiosus L-1, Erwinia amylovora L-3, Erwinia carotovora ssp. carotovora Z-55, Pseudomonas syringae pv. tomato Pseudomonas savastanoi pv. phaseolicola BPR 560, Pseudomonas syringae pv. lachrymans BPR 559, Xanthomonas axonopodis pv. phaseoli F-1 and Xanthomonas hortorum pv. pelargonii E-5. Chitosans Experiments were carried out using solutions of high and low molecular weight chitosan salts, chitosan oligomers, anionic chitosan modifications as well as water / microcrystalline chitosan suspensions. In vitro experiments An effect of chitosans on the bacterial growth was assessed by Minimum Inhibitory Concentration test (MIC). Drops of substances at the different concentrations were applied onto the surface of agarose plates containing the culture of bacterium in Nutrient Dextrose medium. The MIC values were defined as the lowest concentrations of chitosan that inhibited the growth of bacteria after overnight incubation at 26°C. Induction of plant resistance For determination of the induction of resistance of plants to bacterial infection by chitosan derivatives the following experimental models were used: (1) tomato – bacterial speck of tomato (Pseudomonas syringae pv. tomato), (2) geranium – bacterial blight, wilt, leaf spot of pelargonium (Xanthomonas hortorum pv. pelargonii) and (3) cucumber – angular leaf spot (Pseudomonas syringae pv. lachrymans). Plants were sprayed with chitosan or its derivavitves and 24-48 hrs later inoculated with bacteria. Effect of chitosan derivatives on the bacterial infections was calculated as a percentage of the reduction of local lesions produced by bacteria on the chitosan treated leaves in comparison to control (untreated). All experiments were made in 4 repetitions and the results analyzed statistically (Tukey’s Test, α= 0.05) Table 1. Effect of different chitosan derivatives on bacterial growth in vitro

MIC [%] Chitosan derivatives Cmm Cmi Xhp Xahp Psph Pst Ea Ecc At

Chitosan acetate 0.01 0.01 0.25 0.1 0.25 0.1 0.25 0.25 0.25 Microcrystalline chitosan

(0.5) (0.5) (0.5) (0.5) (0.5) (0.5) (0.5) (0.5) (0.5)

Chitosan oligomers (1.0) (1.0) (1.0) (1.0) (1.0) (1.0) (1.0) (1.0) (1.0)Sulphochitosan (1.5) (1.5) (1.5) (1.5) (1.5) (1.5) (1.5) (1.5) (1.5)Carboxymethylchitosan (1.5) (1.5) (1.5) (1.5) (1.5) (1.5) (1.5) (1.5) (1.5)

Clavibacter michiganensis ssp. michganenensis (Cmm), Clavibacter michiganensis ssp. insidiosus (Cmi), Xanthomonas hortorum pv. pelargonii (Xhp), Xanthomonas axonopodis pv. phaseoli (Xaph), Pseudomonas savastanoi pv. phaseolicola (Psph), Pseudomonas syringae pv. tomato (Pst), Erwinia amylovora (Ea), Erwinia carotovora ssp. carotovora (Ecc), Agrobacterium tumefaciens (At). The parenthesis indicate, that the substance was inactive even at highest examined concentration.

81

Results and discussion As shown in Table 1, only cationic chitosan i.e. chitosan acetate, inhibited directly growth of all bacterial strains. No inhibition of growth of bacteria was observed with anionic chitosan derivatives (sulphochitosan, carboxymethylchitosan), chitosan oligomers and microcrystalline chitosan. The sensitivity of bacteria to chitosan varied: Gram positive bacteria (Clavibacter michiganensis ssp. michiganensis, Clavibacter michiganensis ssp. insidiosum) are more sensitive that Gram negative ones (Erwinia carotovora ssp. carotovora, Erwinia amylovora). Correlation between molecular weight or degree of deacetylation of chitosan and its antibacterial activity was not found in this study.

Figure 1. Efficacy of different chitosan derivatives in reduction of bacterial speck of tomato. Plants were sprayed with 0.1% solution or suspension of chitosan derivavtive 48 h before inoculation with bacteria Pseudomonas syringae pv. tomato

Our in planta investigations showed, that cationic chitosan derivatives were effective in the inhibition of symptoms of bacterial speck of tomato caused by P. syringae pv. tomato. (Fig. 1). Interestingly, microcrystalline chitosan and chitosan oligomers which did not inhibit growth of P. syringae pv. tomato in vitro, inhibited the bacterial infection. These results suggest, that the inhibition of bacterial infection by chitosan has been rather due to the induction of the resistance of plants than its direct antibacterial action. In this case chitosan did not act as a curative but as preventive agent – the treatment made five hours after inoculation with P. syringae pv. tomato did not cause any reduction of bacterial speck of tomato symptoms. The best results were observed, when the plants were treated with chitosan solution 24- 48 h before inoculation.

Chitosan efficacy was dependent on its molecular weight and degree of deacetylation. The most efficient were chitosans of molecular weight ranging from 70 to 150 kD. Both, increase or decrease of chitosan molecular weight reduced its efficacy (Fig. 2).

1.02 c1.61 c

64.50 b64.87 b71.22 a

0

10

20

30

40

50

60

70

80

Chitosan acetate Microcrystallinechitosan

Chitosan oligomers Carboxymethylchitosan Sulphochitosan

Eff

icac

y [%

]

82

Figure 2. Effect of molecular weight of chitosan on its efficacy in reduction of symptoms

bacterial speck of tomato. Plants were sprayed with 0.1% solution of chitosan acetate 48 h before inoculation with bacteria Pseudomonas syringae pv. tomato.

The most efficient substance in reduction of bacterial speck of tomato was chitosan acetate of deacetylation degree 80%. The increase or decrease of deacetylation degree caused significant limitation of chitosan efficacy (Fig. 3).

Figure 3. Effect of degree of deacetylation of chitosan on reduction of bacterial speck of tomato.

Plants were sprayed with 0.1% solution of chitosan acetate 48 hrs before inoculation with bacteria Pseudomonas syringae pv. tomato.

In comparison to experiments with bacterial speck of tomato, treatment of pelargonium and cucumber plants with chitosan acetate caused relatively low reduction of bacterial blight, wilt, leaf spot of pelargonium (Xanthomonas hortorum pv. pelargonii) and angular leaf spot of cucumber (Pseudomonas syringae pv. lachrymans) (Fig.4).

Results presented above allows for the conclusion that the antibacterial activity of chitosan derivatives were manifested dually: by the inhibition of the growth of bacteria in vitro and by the inhibition of bacterial infection. The protection of plants to bacteria by chitosan was not the result of its direct bacteriostatic nor bactericide activity, because

62.44 c

82.67 a

58.78 d

78.02 b

0

20

40

60

80

100

60.4 73.4 80.0 97.0

Degree of deacetylation [%]

Eff

icac

y[%

]

62.12 c

85.29 a82.86 a74.78 b

0

20

40

60

80

100

25 70 150 500Molecular weight [ kD]

Eff

icac

y[%

]

83

reduction of disease symptoms occurred on treated and untreated parts of plants, besides, microcrystalline chitosan and chitin oligomers which did not inhibit growth of P. syringae pv. tomato in vitro, inhibited the bacterial infection.

Figure 4. Reduction of angular leaf spot of cucumber (Pseudomonas syringae pv. lachrymans) and bacterial wilt of pelargonium (Xanthomonas hortorum pv.pelargonii) and bacterial speck of tomato (Pseudomonas syringae pv. tomato) by chitosan acetate. Plants were sprayed with 0.1% solution of chitosan acetate 48 h before inoculation with bacteria.

Efficacy of chitosan in stimulation of plant defense mechanisms depended mainly on type of derivative as well as bacteria and plant species. Besides, chitosan acted against bacterial diseases of plants more preventively than therapeutically. Each factor influencing chitosan activity should be thoroughly examined and taken into consideration before its application in plant protection. References Allan, C.R. & Hadwiger, L.A. 1979: The fungicidal effect of chitosan on fungi of varying cell

composition. – Exp. Mycology 3: 285-287. Barber, M.S., Bertram, R.E. & Ride, J.P. 1989: Chitin oligosaccharides elicit lignification in

wounded plant leaves. – Physiol. Mol. Plant Pathol. 34: 3-12. Benhamou, N. & Theriault, G. 1993: Treatment with chitosan enhances resistance of tomato

plants to the crown and rot pathogen Fusarium oxysporum f. sp. radici-lycopersici. – Physiol. Mol. Plant Pathol. 41: 33-52.

Domard, A. 1993: Physiochemical characterization of glucosamine and N-acetylglucosamine oligomers. – Chitin Enzymology, Eur. Chitin Soc. Ancona: 99-102.

El Ghaouth, A., Arul, J., Grenier, J., Benhamou, N., Asselin, A. & Bulanger, R. 1994: Effect of chitosan on cucumber plants: suppression of Pythium aphanidermatum and induction of defence reactions. – Phytopathology 84: 313-320.

Hammerschmidt, R. 1999: Induced disease resistance: how do induced plants stop pathogen? – Physiol. Mol. Plant Pathol. 55: 77-84.

Joubert, J.M. et al. 1998: A 1,3-β-Glucan, specific to a marine alga, stimulates plant defense reaction and induces broad range resistance against pathogens. – Proceed. Brighton Crop Protec. Conf. Pest and Diseases: 441-448.

71.221 a

31.49 c

54.13 b

0

20

40

60

80

Pelargonium Cucumber Tomato

Eff

icac

y (%

)

84

Lee et al. 1999: Oligalacturonic acid and chitosan reduce stomatal aperture by inducing the evolution of reactive oxygen species from guard cells of tomato and Commelina communis. – Plant Physiol. 121(1): 147-152.

Maćkowiak, A. & Pospieszny, H. 2000: The effect of chitosan on peroxidase activity in different plant species. – Monograph of Polish Chitin Society. vol. 6: 145-149.

Pospieszny, H. 1997: Antiviroid activity of chitosan. – Crop Protect. 16: 105-106. Pospieszny, H., Chirkov, S.N. & Atabekov, J.G. 1991: Induction of antiviral resistance in

plants by chitosan. – Plant Sci. 79: 64-68. Ryan, C.A. 1998: Oligosaccharides as recognition signals for the expression of defensive

genes in plants. – Biochemistry 27: 8879-8883.


pp. 85 - 90

85

Induced resistance with extracts of Reynoutria sachalinensis: crucial steps behind the scene Annegret Schmitt BBA, Institute for Biological Control, Heinrichstr. 243, 64287 Darmstadt, Germany Abstract: Plant extracts of Reynoutria sachalinensis are inducing resistance and tolerance in a variety of crops. Extract application leads to effective disease control of powdery mildew fungi on e.g. cucumber, tomato or grape vine as well as against e.g. Botrytis cinerea on young ornamental or vegetable plants.

The induction by R. sachalinensis is characterised by a variety of processes following treatment with the extract and the pathogen, of which some could be identified as crucial steps with respect to the disease control properties. In non-infected cucumber leaf discs, treatment with the extract resulted in the development of reactive oxygen species. Six hours after treatment, levels of hydrogen peroxide were increased from 3 µM in water treated leaf discs to 22 µM in extract treated. When in addition to the treatment with R. sachalinensis Plantacur E (formulated vitamin E preparation) was infiltrated into leaves, the level of hydrogen peroxide reached 11 µM, while Plantacur E applied alone did not induce any increase in H2O2. Plantacur E treatment of plants before the extract application reduced the efficacy of R. sachalinensis, indicating that the development of reactive oxygen species plays a major role in this induction process. In barley coleoptiles treated with R. sachalinensis extract, increased papilla formation was identified at the penetration sites of Blumeria graminis f.sp. hordei together with the accumulation of hydrogen peroxide in the papillae.

Enhanced activities of enzymes belonging to the phenolic pathway, which are involved in the production of phytoalexins, were qualitatively and quantitatively determined in cucumber plants infested with S. fusca and treated with R. sachalinensis extract. Treatment of conidia of S. fusca with these phytoalexins resulted in a significant decrease in germination. C-glycosyl flavonoid phytoalexins were proven to be responsible for collapse of S. fusca colonies. Possibly, these are also responsible for the vacuolisation of powdery mildew haustoria in cucumber leaves treated with R. sachalinensis extract.

The results show that different crucial steps can be linked to the disease control properties involved in resistance induced by R. sachalinensis extract. Important plant responses occur directly after extract treatment (priming), as well as at a later stage, i.e. after pathogen attack. Key words: hydrogen peroxide, plant extract, powdery mildew, cucumber, barley Introduction The giant knotweed, Reynoutria sachalinensis (suggested to be re-named Fallopia sacha-linensis) is commecially used for production of a resistance-inducing plant extract (Milsana®). The inducing ability of this extract leads to effective disease control in a variety of crops, mono- and dicotyledones, against different plant pathogens. Under greenhouse conditions, regular application of the extract in cucumber, tomato, pepper, begonia, potted herbs and barley resulted in efficacies up to 100% with respect to the different powdery mildew fungi (Herger & Klingauf, 1990; Dik & van der Staay, 1995; Moch et al., 2000; Konstantinidou-Doltsinis et al., 2001; Konstantinidou-Doltsinis et al., 2006; Ernst, pers. communication). Highly effective control of Botrytis cinerea was achieved when young tomato and pepper plants and young ornamentals were treated with the extract (Schmitt et al., 1996). However, in

86

the case of B. cinerea, induction was only effective in young but not in mature tomato plants (unpublished). Moderate effectiveness under greenhouse conditions was found e.g. after inducing treatment of begonia or cucumber flowers against B. cinerea, of carnation and bean against rust fungi (Herger, 1991). Moderate effectiveness was reported against grey mould in grape berries (Schmitt et al., 2002), and cultivar-dependend efficacy was reported in roses against powdery mildew fungi (von Amsberg & Watanabe, 2002). No induced resistance was found against downy mildew fungi.

Trials under field conditions proved the high effectiveness of this inducing plant extract with respect to powdery mildews in cucumber, grape vine and strawberry and grey mould in strawberry (Schmitt et al., 2002; von Amsberg & Watanabe, 2002; Ernst personal communi-cation). Interestingly, increases in yield of cucumber by more than 20 % were not only found when powdery mildew disease was successfully reduced by 80 – 100 %, but also when the efficacy was substantially lower (Konstantinidou-Doltsinis & Schmitt, 1998; Konstantinidou-Doltsinis et al., 2001), indicating that induced tolerance towards the pathogen is another important factor.

The main challenge when talking about induced resistance, however, is the identification of the causal plant responses, crucial for the ability of the treated plant to restrict or eliminate the plant pathogen. In order to elucidate these, trials in cucumber and barley were undertaken and results are presented in the following. Results and discussion Involvement of hydrogen peroxide Cucumber For investigations, staining with diaminobenzidine (DAB) was applied, which visualizes the development of hydrogen peroxide (H2O2). Müller et al. (1998) showed that incubation of cucumber leaf discs in 1% R. sachalinensis plant extract led to brown spots on the extract-treated leaves after staining with DAB. In the water incubated controls no spots occurred. This oxidative burst was quantified by photometrical measurement of external H2O2. Again, 6 hours after incubation in the extract (and at no earlier time) treated cucumber leaves produced a seven-fold higher concentration of H2O2 (22 µM) than the control discs (3 µM).

Infiltration of leaf discs with the radical scavenger α-tocopherole (“Plantacur E”, a formulated vitamin E preparation which facilitates the penetration of the active compound into the leaf) prior to extract treatment led to a reduction of H2O2 by 50 % compared to extract treatment alone. Infiltration of the radical scavenger alone showed no difference in the level of measured H2O2 compared to the water control.

Based on the findings that hydrogen peroxide is accumulated in cucumber after treatment with R. sachalinensis extract, and that application of a radical scavenger reduced this level significantly, the potential role of H2O2 in the overall induction process was investigated. The first 2 true leaves of young potted cucumber plants were externally sprayed with H2O2 (100, 1000, 2000 mM) and 1 day later inoculated with a suspension of S. fusca conidia. The time interval was chosen to avoid direct fungitoxic effects on the pathogen and at the same time to assure that the active principle was still present. Phytotoxicity was observed at a concentration of 2000 mM. Concentrations above 100 mM resulted in a significant decrease of disease severity, i.e. in a significant efficacy against the pathogen. The efficacy after 1000 mM treatment was, however appr. 50 % lower than after treatment with a 1 % R. sachalinensis extract. This was probably due to the fact that H2O2 could not diffuse into the leaf to the necessary extent, thus not reaching appropriate levels inside the plant tissue.

Since these results already proved the significant decrease of H2O2 in cucumber leaf discs treated with a radical scavenger prior to treatment with the resistance inducer, the next step

87

was the investigation of effects of Plantacur E on the efficacy of R. sachalinensis extract in potted cucumber plants. Spray treatment of the first 2 true leaves with the radical scavenger prior to extract application enhanced disease severity by 13 % compared to that after 1 % R. sachalinensis extract application. The adverse effects on the efficacy of the resistance inducer were much better visible when 0.1 % R. sachalinensis extract was used: disease severity was reduced by 66 % compared to that after 0.1 % extract application. This can be attributed to the assumption that the levels of H2O2 produced internally were much higher than those measured externally via the photometer, and that the amounts of α-tocopherole that reached the site of action inside the tissue were not sufficient to scavenge the reactive oxygen completely (Müller, 2002).

The levels of H2O2 produced in the leaf tissue after application of R. sachalinensis extract (without subsequent inoculation), however, did not lead to visible hypersensitive reactions (HR). Measurements of peroxidases (POD) showed, that 7 hours after extract application, i.e. within 1 hour after the oxidative burst, the enzyme activity was raised drastically while in water treated plants, the level remained the same throughout the observation time. This implies that POD is engaged in the degradation of H2O2 produced during the oxidative burst (Müller et al., 2000).

In induced and inoculated cucumber plants, HR of attacked cells due to H2O2 accumulation and the percentage of effective H2O2 containing papillae were significantly increased (Müller, 2002).

From the results gained it can be concluded that H2O2 levels reach subliminal levels in the plant tissue within a few hours after application of the extract, so that the molecule possibly plays a role in signal transduction. After pathogen attack, however, H2O2 appears to play also a significant role in the defence of induced plants against S. fusca. External measurement of H2O2 in barley leaves did not give conclusive results. However, formation of effective papillae in general, and those containing H2O2 increased after treatment with Reynoutria-extract significantly over the rates in control plants (Moch et al., 2000), while HR at the infection sites was not significantly different during the observation time of 72 hours. Since measurements started only 24 hours after inoculation, it remains to be clarified if treatment with Reynoutria-extract not only increased the H2O2-production, but also accelerated it.

Involvement of phytoalexins Cucumber Compounds with fungicidal effects are found in many plant species as reaction of a plant to pathogen attack. In cucumber, however, phytoalexins have not been reported for a long time. Daayf et al. (1995) were the first to identify phytoalexins in cucumber. From greenhouse-grown cucumber they extracted leaves of the following variants: a) non-infected, untreated (C), b) non-infected, Milsana® treated (M), c) infected, untreated (I), d) infected, Milsana®-treated (IM). Crude cucumber leaf extracts of these variants were subjected to thin layer chromatography, and plates were sprayed with Cladosporium cucumerinum in order to determine zones of growth inhibition. The aglycone fractions of cucumber leaf extracts from all variant but the control showed a rapid and strong accumulation of fungitoxic phenolic substances. However, only in infected and Milsana®-treated samples (IM) a unique and strongly fungitoxic spot occurred. The fungitoxicity was corroborated against conidia of S. fusca, where again only fraction IM showed a significantly lower germination rate compared to all other variants. The responsible compound was identified as p-methyl coumaric acid (Daayf et al., 1997), the first phytoalexin identified in cucumber.

Schneider & Ullrich (1994) reported that phenylalaninammonialyase (PAL) and poly-phenoloxidase (POX) activities were significantly enhanced after induction with R.

88

sachalinensis, while after inoculation with S. fusca three days later, the level of enzyme activity was remaining low. In contrast, in water-treated cucumber plants the activity of PAL and POX was raised only after inoculation.

The results indicate that the level of intermediate metabolites / precursors of phytoalexins are significantly raised after induction with the extract, so that the fungitoxic molecules are available timely and in large amounts upon pathogen attack.

Lately, phytochemical analysis and fluorescence microscopy observations revealed the production of autofluorescent C-glycosyl flavonoid phytoalexins within the epidermal tissues of cucumber plants undergoing fungal ingress (McNally et al., 2003). Phytoalexin production was triggered by the combination of treatment with Milsana® after inoculation. In the hours that preceded the collapse of conidial chains, phytoalexins accumulated inside the haustorial complexes of the pathogen within the epidermal cells of disease-resistant plants. Fofona et al. (2005) reported that down regulation of a key enzyme of the flavonoid pathway resulted in nearly complete suppression of induced resistance, and microscopy confirmed the develop-ment of healthy fungal haustoria within these plants. The earlier observations by Herger (1991), which showed strong vacuolisation, i.e. degradation of haustoria in R. sachalinensis treated cucumber leaves, can thus now possibly be attributed to the activity of these flavonoid phytoalexins.

Overall, the timely synthesis of C-glycosyl flavonoid phytoalexins at precise subcellular locations can be seen as an important defence reaction used by cucumber to create incom-patible interactions with powdery mildew.

Crucial steps before and after infection For the resistance inducing extract of R. sachalinensis, different crucial steps can be linked to the disease control properties induced by the extract, in cucumber and in barley (table 1). Important plant responses directly after extract treatment and before infection have been reported as priming reactions (Conrath et al., 2002), while others only occur after extract application and infection have taken place.

Table 1. Induced crucial effects after treatment with R. sachalinensis extracts for control of

powdery mildew of cucumber (C) and barley (B)

Induced effects with R. sachalinensis extracts

before infection after infection reactive oxygen species (C / B?) reactive oxygen species (C / B) papilla formation (C / B) enzymes of the phenolic pathway (C) enzymes of the phenolic pathway (C) phytoalexins (germination of conidia,

vacuolisation of haustoria) (C) A major priming reaction for R. sachalinensis is the development of reactive oxygen

species, especially H2O2 as well as enzymes of the phenolic pathway in cucumber. Phyto-alexins, namely p-methyl coumaric acid and C-glycosyl flavonoids are important for induced reactions after pathogen attack. In barley, the role of H2O2 before infection could not yet been clarified. At a later stage, i.e. after pathogen attack, however, H2O2 plays a significant role in

89

effective pathogen defence when accumulating in papillae or leading to HR in infected epidermal cells of cucumber and barley. References Conrath, U., Pieterse, C.M.J. & Mauch-Mani, B. 2002: Priming in plant – pathogen

interactions. – Trends in Plant Science, 7(5): 210-216. Daayf, F., Schmitt, A. & Belanger, R.R. 1995: The effects of plant extracts of Reynoutria

sachalinensis on powdery mildew development and leaf physiology of long English cucumber. – Plant Disease, 79: 577-580.

Daayf, F., Schmitt, A. & Belanger, R.R. 1997: Evidence of phytoalexins in cucumber leaves infected with powdery mildew following treatment with leaf extracts of Reynoutria sachalinensis. – Plant Physiology, 113: 719-727.

Dik, A.J. & Van der Staay, M. 1995: The effect of Milsana on cucumber powdery mildew under Dutch conditions. – Med. Fac. Landbouww. Rijksuniv. Gent 59 (3a): 1027-1034.

Fofana, B., Benhamou, N., McNally, D.J., Labbé, C., Séguin, A. & Bélanger, R.R. 2005: Suppression of Induced Resistance in Cucumber Through Disruption of the Flavonoid Pathway. – Phytopathology 95(1): 114-123.

Herger, G. 1991: Die Wirkung von Auszügen aus dem Sachalin-Staudenknöterich, Reynoutria sachalinensis (F.Schmidt) Nakai, gegen Pilzkrankheiten, insbesondere Echte Mehltaupilze. – PhD thesis, Technical University Darmstadt, Germany.

Herger, G. & Klingauf, F, 1990: Control of powdery mildew fungi with extracts of the giant knotweed, Reynutria sachalinensis (Polygonaceae). – Med. Fac. Landbouww. Rijksuniv. Gent 55: 1007-1014.

Konstantinidou-Doltsinis, S., Markellou, E., Fanouraki, M. N., Kasselaki, A-M., Koumaki, C. M., Schmitt, A., Liopa-Tsakalidis, A. & Malathrakis, N.E. 2006: Efficacy of Milsana®, a formulated plant extract from Reynoutria sachalinensis, against powdery mildew of tomato (Leveillula taurica) (Lév.) Arn.. – Biocontrol, accepted.

Konstantinidou-Doltsinis, S. & Schmitt, A. 1998: Impact of treatment with plant extracts from Reynoutria sachalinensis (F.Schmidt) Nakai on disease severity of powdery mildew and yield in cucumber under Greek conditions. – Crop Protection 17(8): 649-656.

Konstantinidou-Doltsinis, S., Tzempelikou, K., Petsikos-Panayotarou, N., Markellou, E., Kalamarakis, A., Ernst, A., Dik, A. & Schmitt, A. 2001: Efficacy of a new liquid formulation from Fallopia sachalinensis (Friedrich Schmidt Petrop.) Ronse Decraene as inducer of resistance against powdery mildew in cucumber and grape vine. – IOBC/wprs Bulletin 24 (3): 221-224.

McNally, D.J., Wurms, K.V., Labbé, C. & Bélanger, R.R. 2003: Synthesis of C-glycosyl flavonoid phytoalexins as a site-specific response to fungal penetration in cucumber. – Physiol. Mol. Plant. Patho. 63 (3): 293-303.

Moch, K., Müller, S., Rothe, G. M. & Schmitt, A. 2000: Abwehrreaktionen in Gerste gegen Blumeria graminis f.sp. hordei durch verschiedene Resistenzinduktoren. – Mitt. Biol. Bundesanst. Land- und Forstwirtsch. Berlin-Dahlem 376: 391-392.

Müller, S. 2002: Resistenzinduktion und Pathogenabwehr durch Reynoutria sachalinensis-Extrakt und Physcion: Signalkette im Vergleich zu systemischen Induktoren und Beziehungen zur Hypersensitiven Reaktion. – PhD thesis, Rheinische Friedrich-Wilhelms-Universität, Bonn, Germany.

Müller, S., Schmitt, A., Huber, J. & Ullrich, W. 1998: Die Bedeutung von Wasserstoffperoxid in der Signalkette von Reynoutria sachalinensis. – Mitt. Biol. Bundesanst. Land- und Forstwirtsch. Berlin-Dahlem, 357: 149-150.

90

Müller, S., Huber, J., Ullrich, W. & Schmitt, A. 2000: Beteiligung verschiedener Wasserstoffperoxid-metabolisierender Enzyme bei der Resistenzinduktion durch Reynoutira sachalinensis im System Gurke / Echter Gurkenmehltau. – Mitt. Biol. Bundesanst. Land- und Forstwirtsch. Berlin-Dahlem, 376: 411-412.

Schmitt, A., Eisemann, S., Strathmann, S., Emslie, K.A. & Seddon, B. 1996: Wirkungsweise von Extrakten aus dem Sachalin-Staudenknöterich, Reynoutria sachalinensis, gegenüber dem Erreger des Grauschimmels, Botrytis cinerea. – Mitt. Biol. Bundesanst. Land- und Forstwirtsch. Berlin-Dahlem 321: 421.

Schmitt, A., Kunz, S., Nandi, S., Seddon, B. & Ernst, A. 2002: Use of Reynoutria sachalinensis plant extracts, clay preparations and Brevibacillus brevis against fungal diseases of grape berries. – In: 10th International conference on cultivation technique and phytopathological problems in organic fruit-growing and viticulture; presentations at the meeting from 04. to 07.02.2002 in Weinsberg, Germany. Fördergemeinschaft Ökologischer Obstbau e.V. (FÖKO) an der Staatlichen Lehr- und Versuchsanstalt für Wein- und Obstbau (LVWO) Weinsberg (Ed.), Germany: 146-151.

Schneider, S. & Ullrich, W.R. 1994: Differential induction of resistance and enhanced enzyme activities in cucumber and tobacco caused by treatment with various abiotic and biotic inducers. – Physiol. Mol. Plant. Pathol. 45: 291-304.

Von Amsberg, H. & Watanabe, S. 2002: Does Milsana® bioprotectant induce resistance in greenhouse as well as in field-grown plants? IOBC/wprs Bulletin 25 (6): 193-196.


pp. 91 - 96

91

Silicon as inducer of resistance in tomato against Ralstonia solanacearum Kerstin Wydra, Elie Dannon Institute of Plant Diseases and Plant Protection, University of Hannover, Herrenhäuser Str. 2, 30419 Hannover; [email protected] Abstract: Bacterial wilt is widely distributed in tropical, subtropical and some temperate regions of the world. Control of the causal agent, Ralstonia solanacearum, is difficult and host plant resistance breakdown was frequently observed. Therefore, only integrated control combining resistance and cultural and biological measures seems promising. Silicon amendment significantly reduced bacterial wilt incidence for tomato genotypes L390 (susceptible) by 26.8% and King Kong2 (moderately resistant) by 56.1% compared to non-treated plants grown in hydroponic culture. However, wilt incidence in silicon-treated plants of genotype L390 reached 100% at 13 days post inoculation, while in genotype King Kong2, final plant death was reduced by 20%. Bacterial numbers were significantly lower in silicon-treated compared to non-treated plants in King Kong2 at 2 dpi in midstems and in all organs at 5 dpi, and in Hawaii 7998 (resistant) in all organs at 2 dpi. Increased tolerance was observed in genotypes L390 and King Kong2 with silicon treatment. Silicon accumulated in roots. Negative correlations between root silicon content and bacterial numbers of midstems in genotypes Hawaii 7998 and King Kong2 suggested an induced resistance. Indications for an influence of host genotype and silicon treatment on the phenotypic conversion of R. solanacearum strain To-udk2-sb from fluidal to non-fluidal colonies in planta were observed. This is the first report on the effect of silicon on a bacterial disease and in a silicon-non-accumulator plant. Key words: integrated control, induced resistance, tolerance, phenotypic conversion, Pseudomonas solanacearum Introduction Bacterial wilt caused by Ralstonia solanacearum (Smith) Yabuuchi et al. affects over 200 crop and weed species and is widely distributed in tropical, subtropical and some temperate regions of the world. The disease ranks as one of the most important if not the most important disease of bacterial origin in the world (Kelman 1998), causing sometimes total losses in tomato crops (Ram-Kishun & Kishun 1987). The bacterium invades the plant vascular tissues through wounded roots or natural openings, and progresses through intercellular spaces into the xylem. Colonization of stems results in browning of the xylem, foliar epinasty and lethal generalized wilt (Buddenhagen & Kelman 1964). Control of this disease is difficult and discourages planting of tomato, potato and tobacco in productive, but infested soils (Kelman, 1998). Breeding for resistance in tomato has generally resulted in good levels of site-specific resistance. However, breakdown of resistance has frequently been reported in tomato cultivars grown away from the original breeding areas (Grimault & Prior, 1993; Wang et al., 1998). Therefore, only integrated control combining host plant resistance and cultural and biological measures seems promising.

R. solanacearum is a highly diverse and adaptive bacterium, that differs in host range, geographical distribution, pathogenicity, epidemiological interactions and physiological properties (Buddenhagen et al. 1962, Genin & Boucher 2002). The high variability of the pathogen in phenotypic and genetic features is expressed in response to varying environ-

92

mental conditions. Ralstonia solanacearum shows a spontaneous shift from the mucoid (fluidal) to the non-mucoid type under certain growth conditions (Kelman & Hruschka 1973), whereby bacteria become avirulent. Only recently the involvement of the host plant in the reversion of the PC phenomenon has been shown with a susceptible genotype (Poussier et al. 2003). A possible interaction between host genotype and phenotypic conversion has not been described, nor is the direct or indirect effect of silicon treatment on the state of the pathogen known.

Application of silicon has been shown to enhance plant tolerance to environmental stresses reinforce cell walls and increase plant resistance against fungal pathogens (Samuels et al. 1994, Datnoff et al. 2001, Fawe et al. 2001) and insects (Epstein 2001) in silicon-accumulator plants such as rice or cucumber. Besides a possible role of silicon in formation of a mechanical barrier, induced resistance was suggested to be involved (Stumpf & Heath 1985, Menzies et al. 1991, Cherif et al. 1992). The effect of silicon on bacterial diseases and on pathogens in non-accumulator plants remains so far unknown.

Therefore, the role of silicon in increasing resistance of tomato to bacterial wilt and the possible influence of silicon and host genotype on the phenotypic conversion of the pathogen were investigated. Material and methods Plant materials and inoculation Tomato genotypes L390 (susceptible to R. solanacearum), King Kong2 (moderately resistant) and Hawaii 7998 (resistant) were grown in hydroponic culture (Dannon & Wydra 2004) with 30 °C / 26 °C day / night temperature, 80% RH and light for 12 hours per day. Twenty milliliter monosilicic acid [1.4 mM Si(OH)4] were added to 5 L of nutrient solution; monosilicic acid was obtained after exchange of potassium silicate solution K2SiO2 with cation exchangers (Dannon & Wydra 2004). The hydroponic solution was aerated and changed at the day of inoculation with the highly virulent R. solanacearum strain To-udk2-sb from Thai origin belonging to race 1 biovar 3 (Leykun 2003) at a final inoculum concentration of approximately 107 CFU/ml. Experimental design Four treatments were arranged in a completely randomised block design: (i) plants with silicon, inoculated with R. solanacearum (Rs +Si), (ii) plants without silicon, inoculated with R. solanacearum (Rs -Si), (iii) plants with silicon, without R. solanacearum inoculation (-Rs +Si, control) and (iv) plants without silicon, without R. solanacearum inoculation (-Rs -Si, control), with 16 plants per genotype and treatment. Leaves, stems and roots of four plants were randomly selected per treatment and sampling date at two and five days post inoculation (dpi) for bacterial and silicon quantification (Dannon & Wydra 2004). Experiments were repeated three times. Quantification of disease Disease severity was evaluated in five classes, wilt incidence was calculated as the percentage of dead plants (class 5) at the evaluation date out of the total number of plants in the treatment. For bacterial quantification, bacterial colonies from plant macerates were counted after 48 hours incubation at 30°C. Fluidal (> 1 mm diameter) and non-fluidal (< 1 mm diameter) colony types were differentiated (Dannon & Wydra 2004). Silicon quantification Total silicon content of leaves, stems and roots was determined for organs of the same plants which were used for bacterial quantification at two and five days post inoculation (Dannon & Wydra 2004).

93

Results and discussion Symptom development Disease severity and wilt incidence (AUDPC) of silicon-treated plants were significantly lower compared to non-treated plants of the susceptible genotype L390 with 16.1 and 26.8%, respectively, and the moderately resistant King Kong2 with 41.3 and 56.2%, respectively (data not shown).

In genotype L390 disease severity and wilt incidence were retarded in ‘Si+’ plants (Fig. 1). In genotype King Kong2, plant death did not occur until 12 dpi in silicon-treated plants compared to 6 dpi in non-silicon treated plants. At the end of the trials, 46% of plants had survived in silicon treatments and 33% in treatments without silicon. Silicon may have increased the effect of resistance factors present in genotype King Kong2, while in genotype L390, which lacks effective resistance factors, disease development could only be delayed. Quantification of bacteria Significantly lower bacterial numbers were found in silicon-treated midstems, and in all organs of genotype King Kong2 at 2dpi and 5dpi, respectively (data not shown). In genotype Hawaii 7998, significantly lower bacterial numbers were observed in all organs of silicon-treated plants compared to non-treated plants at 2dpi. Also Yamazaki (2001) and Leykun (2003) reported high latent infection in stems of the resistant genotypes Hawaii 7998 and Hawaii 7996.

Figure 1: Bacterial wilt incidence development in silicon-treated and non-treated plants inoculated with R. solanacearum in tomato genotypes L390 (susceptible), King Kong2 (moderately resistant) and Hawaii 7998 (resistant) -Si = plants without silicon supply, +Si = plants supplied with silicon. No further changes occurred after 16 dpi. Data are means of three repeated trials ± SE.

Plotting wilt incidence against bacterial numbers at 5 dpi, the effect of silicon application on the reduction of bacterial numbers in genotype King Kong2 is demonstrated, whereas a disease reducing effect occurred in both genotypes L390 and King Kong2 (Fig. 2). In treatments without silicon, bacterial numbers in all organs of genotype King Kong2 were equal to L390 or higher, although symptom development was significantly reduced. These observations point at a mechanism of tolerance in King Kong2, which increased after silicon treatment, when disease severity was further reduced, and of an induced tolerance in genotype

0

20

40

60

80

100

0 2 4 6 8 10 12 14 16Days post inoculation

L390-Si

L390+Si

King Kong2-Si

King Kong2+Si

Hawaii 7998-Si

Hawaii 7998+Si

B

94

L390, where silicon-treated plants showed less symptoms with similar bacterial numbers compared to non-treated plants.

A decrease of bacterial density in midstems compared to the collar was also reported by Prior et al. (1994), with a significant correlation between the bacterial population at midstem level and the degree of resistance (Grimault et al. 1994), and these authors localized resistance mechanisms in the midstem. Relation between bacterial numbers and silicon content Silicon amendment reduced bacterial numbers in the moderately resistant genotype King Kong2 in midstems (2 dpi) and in all organs (5 dpi), and in the resistant genotype Hawaii 7998 in all organs (2 dpi) (data not shown). Regression analysis revealed significant direct effects of silicon in roots on the bacterial population in roots of genotypes Hawaii 7998 (2 dpi) and King Kong2 (5 dpi), and of silicon in leaves on bacterial numbers in leaves for the three genotypes (2 dpi), suggesting a direct influence of silicon on colonization of these organs. Silicon in roots explained 18 – 37% of the variation of bacterial populations in midstems, indicating that silicon induced resistance to the pathogen in midstems, where mechanisms of resistance were found to be located in tomato (Prior et al. 1994).

0

200

400

600

800

1000

0 2 4 6 8Bacterial numbers in mid-stems [log10 CFU/g stem]

L390+Si

L390-Si

King Kong2+Si

Hawaii+Si Hawaii-Si

King Kong2-Si

0

200

400

600

800

1000

0 2 4 6 8Bacterial numbers in mid-stems [log10 CFU/g stem]

L390+Si

L390-Si

King Kong2+Si

Hawaii+Si Hawaii-Si

King Kong2-Si

Figure 2: Distance between the three tomato genotypes L390 (susceptible), King Kong2

(moderately resistant) and Hawaii 7998 (resistant) with regard to the AUDPC based on wilt incidence and bacterial numbers in the midstems at 5 dpi Data are from means of the AUDPC based on wilt incidence (see Table 1) and of bacterial numbers in the midstems at 5 dpi. Wilt incidence = percentage of dead plants (class 5) in a treatment at an evaluation date.

Bacterial colony types The phenotypic conversion of R. solanacearum from fluidal to non-fluidal colonies was frequently reported in stored cultures (Pradhanang et al. 2000, Schell 2000), but reasons for the transformation are unknown. Non-fluidal colonies, present in low percentage in the inoculum suspension, were increased in isolations from genotype L390 (2 dpi) (data not shown). Interactions with genotypes of different resistance were to date not investigated. Our results indicate an influence of the plant, comparing the percentage of non-fluidal cells in planta in the susceptible genotype with the cells in nutrient solution. But, we observed

95

significantly higher numbers of non-fluidal cells in stems of untreated plants of the susceptible genotype, compared to the nutrient solution and to King Kong2 and Hawaii7998 at 2 dpi, while bacterial numbers in stems were similar across genotypes. After silicon treatment, the number of non-fluidal cells was reduced in the susceptible genotype and increased in the resistant genotype at 2 dpi.

Thus, plant factors might have an influence on the loss of the ability to produce high quantities of extracellular polysaccharides. The non-fluidal type was observed to be still virulent, and inoculation of fluidal and non-fluidal types each in a susceptible tomato plant resulted in both types after re-isolation. Also Poussier et al. (2003) described a host plant -dependent phenotypic conversion of R. solanacearum from non-pathogenic forms in a susceptible tomato genotype.

Resistance of tomato against R. solanacearum was enhanced by silicon treatment. Therefore, silicon is suggested to be involved in induced resistance and increased tolerance, interacting with resistance factors of the plants, with an indirect effect on bacterial growth and the physiological status of the bacteria. Acknowledgements We thank Dr. W. Horst and G. Heine, Institute of Plant Nutrition, University of Hannover, for support in silicon analysis. References Buddenhagen, I. & Kelman, A. 1964: Biological and Physiological aspects of bacterial wilt

caused by Pseudomonas solanacearum. – Ann. Rev. Phytopathol. 2: 203-30. Buddenhagen, I., Sequeira, L. & Kelman, A. 1962: Designation of races in Pseudomonas

solanacearum. – Phytopathol. 52: 726. Chérif, M., Benhamou, N. & Bélanger, R.R. 1992: Ultrastructural and cytochemical studies of

fungal development and host relations in cucumber plants infected by Pythium ultimum. – Physiol. Mol. Plant Pathol. 39: 353-75.

Dannon, E.A. & Wydra, K. 2004: Interaction between silicon amendment, bacterial wilt development and phenotype of Ralstonia solanacearum in tomato genotypes. – Phys. Mol. Plant Pathol. (in press)

Datnoff, L.E., Seebold, K.W. & Correa, V.F.J. 2001: The use of silicon for integrated disease management: reducing fungicide applications and enhancing host plant resistance. – In: Silicon in agriculture, eds. Datnoff LE, Snyder GH, Korndörfer GH, Elsevier Science, The Netherlands: 171-83.

Epstein, E. 2001: Silicon in plants: Facts vs concepts. – In: Silicon in agriculture, eds. Datnoff LE, Snyder GH, Korndörfer GH, Elsevier Science, The Netherlands: 1-15.

Fawe, A., Menzies, J.G., Chérif, M. & Bélanger, R.R. 2001: Silicon and disease resistance in dicotyledons. – In: Silicon in agriculture, eds. Datnoff LE, Snyder GH, Korndörfer GH, Elsevier Science, The Netherlands: 159-69.

Genin, S. & Boucher, C. 2002: Ralstonia solanaceraum: secrets of a major pathogen unveiled by analysis of its genome. – Mol. Plant Pathol. 3: 111-18.

Grimault, V., Anais, G. & Prior, P. 1994: Distribution of Pseudomonas solanacearum in the stem tissues of tomato plants with different levels of resistance to bacterial wilt. – Plant Pathol. 43: 663-68.

Grimault, V. & Prior, P. 1993: Bacterial wilt resistance in tomato associated with tolerance of vascular tissues to Pseudomonas solanacearum. – Plant Pathol. 42: 589-94.

96

Kelman, A. 1998: One hundred and one years of research on bacterial wilt. – In: 2nd International Bacterial Wilt Symposium. 22-27 June, 1997, Guadeloupe. Book of Abstracts 1998: 10.

Kelman, A. & Hruschka, J. 1973: The role of motility and aerotaxis in the selective increase of avirulent bacteria in still broth culture of Pseudomonas solanacearum. – J. Gen. Microbiol. 76: 177-88.

Leykun, Z. 2003: Latent infection of ‘resistant’ tomato genotypes with Ralstonia solanacearum and the viable but non-cuturable state of the pathogen in tomato tissue. – MSc thesis. University of Hannover, Germany.

Menzies, J.G., Ehret, D.L., Glass, A.D.M., Helmer, T., Koch, C. & Seywerd, F. 1991: Effects of soluble silicon on the parasitic fitness of Sphaerotheca fuliginea on Cucumis sativus. – Phytopathol. 81: 84-88.

Poussier, S., Thoquet, P., Trigalet-Demery, D., Matthieu, A. & Trigalet, A. 2003: Host plant –dependent phenotypic conversion of Ralstonia solanacearum from non-pathogenic forms via alteration in the phcA gene. – Mol. Microbiol. 49: 991-1003.

Pradhanang, P.M., Elphinstone, J.G. & Fox, R.T.V. 2000: Sensitive detection of Ralstonia solanacearum in soil: a comparison of different detection techniques. – Plant Pathol. 49: 414-22.

Prior, P., Grimault, V. & Schmit, J. 1994: Resistance to bacterial wilt (Pseudomonas solanacearum) in tomato: Present status and prospects. – In: Bacterial wilt: The disease and its causative agent Pseudomonas solanacearum, Hayward A.C. and Hartman G.L. eds., International Centre for Agriculture and Bioscience (CAB), Wallingford, United Kingdom: 209-234.

Ram-Kishun, S. & Kishun, R. 1987: Loss in yield of tomato due to bacterial wilt caused by Pseudomonas solanacearum. – Indian Phytopathol. 40: 152-55.

Samuels, A.L., Glass, A.D.M., Menzies, J.G. & Ehret, D.L. 1994: Silicon in cell walls and papillae of Cucumus sativus during infection by Sphaerotheca fuliginea. – Physiol. Mol. Plant Pathol. 44: 237-42.

Schell, M.A. 2000: Control of virulence and pathogenicity genes of Ralstonia solanacearum by an elaborate sensory network. – Ann. Rev. Phytopathol. 38: 263-92.

Stumpf, M. A. & Heath, M.C. 1985: Cytological studies of the interactions between the cowpea rust fungus and silicon-depleted French bean plants. – Physiol. Plant Pathol. 27: 369-85.

Wang, J.-F., Hanson, P. & Barnes, J.A. Worldwide evaluation of an international set of resistance sources to bacterial wilt in tomato. – In: Bacterial wilt disease. Molecular and ecological aspects, Prior, P., Allen, C. & Elphinstone, J. eds., Second International Bacterial Wilt Symposium, Gossier, Guadeloupe, France. 22-27 June 1997, Springer Verlag, Germany: 269-279.

Yamazaki, H. 2001: Relation between resistance to bacterial wilt and calcium nutrition in tomato seedlings. – Jap. Agricult. Res. Quart.: 163-69.

iobc / wprs · institut de botanique, biochimie rue emile argand 11 bp2 2007 neuchâtel switzerland...

Documents