journal of research in biology volume 3 issue 8
DESCRIPTION
TRANSCRIPT
Aim and Scope
Journal of Research in Biology is an international scientific journal committed to the development and spread of research in Biological sciences. It accepts research articles with affiliation to biological science from all around the globe and
publishes them in the journal. The submitted articles are peer-reviewed by experts in the field and editorial board members. Make
the most of your research by publishing articles in Journal of Research in Biology.
Journal of Research in Biology works as a portal for biological scientific research publication. It works to promote the use of biological sciences knowledge in the world public policy, and to develop and advance science policy that serves the needs of
scientific research and education communities, particularly the biological sciences.
The journal has been uniquely positioned to help members of the scientific community; become effective advocates
for their science and to be better known for the public that relate to or impact the biological sciences.
Call for Papers
Journal of Research in Biology seeks Research Articles, Short Communications and Mini reviews. The Journal will accept
and review submissions in English from any author, in any global locality. A body of international peers will review all submissions with potential author revisions as recommended by reviewers, with the intent to achieve published papers that:
Relate to the field of Biology
Represent new, previously unpublished work
Advance the state of knowledge of the field
Conform to a high standard of presentation.
Disclaimer: Journal of Research in Biology is not responsible for the content of individual manuscripts. Manuscripts available in this journal were peer reviewed. Manuscripts accepted in the issues conform to the editorial policies. But more details regarding the nature of their research, conflicts in their workplace, plagiarisms, stealing of others property, manipulation of data, illegal formulation of a paper from other allied papers etc., were all not known to us. Any details, queries regarding the manuscripts should be only dealt with the authors and not with the publisher. The concept of peer review can only limit the plagiarism to a small extent where as it is the work of the public and the individuals to identify and stop the illegal formulation of new articles from the other. The publisher invites all details regarding the plagiarism of an article published in the journal provided with the original data and supplementary files for confirmation. On identifying plagiarism issues in an article, the article published will be removed from the journal website and further on the citation of the same will be debarred. Provided the author of the manuscript will be prohibited to publish his/her other studies in our journal or throughout the journals under our portal.
List of Editors of Editors in the Journal of Research in Biology
Managing and Executive Editor:
Abiya Chelliah [Molecular Biology]
Publisher, Journal of Research in Biology.
Editorial Board Members:
Ciccarese [Molecular Biology] Universita di Bari, Italy.
Sathishkumar [Plant Biotechnologist]
Bharathiar University.
SUGANTHY [Entomologist]
TNAU, Coimbatore.
Elanchezhyan [Agriculture, Entomology]
TNAU, Tirunelveli.
Syed Mohsen Hosseini [Forestry & Ecology]
Tarbiat Modares University (TMU), Iran.
Dr. Ramesh. C. K [Plant Tissue Culture] Sahyadri Science College, Karnataka.
Kamal Prasad Acharya [Conservation Biology]
Norwegian University of Science and Technology (NTNU), Norway.
Dr. Ajay Singh [Zoology]
Gorakhpur University, Gorakhpur
Dr. T. P. Mall [Ethnobotany and Plant pathoilogy]
Kisan PG College, BAHRAICH
Ramesh Chandra [Hydrobiology, Zoology]
S.S.(P.G.)College, Shahjahanpur, India.
Adarsh Pandey [Mycology and Plant Pathology]
SS P.G.College, Shahjahanpur, India
Hanan El-Sayed Mohamed Abd El-All Osman [Plant Ecology]
Al-Azhar university, Egypt
Ganga suresh [Microbiology]
Sri Ram Nallamani Yadava College of Arts & Sciences, Tenkasi, India.
T.P. Mall [Ethnobotany, Plant pathology]
Kisan PG College,BAHRAICH, India.
Mirza Hasanuzzaman [Agronomy, Weeds, Plant]
Sher-e-Bangla Agricultural University, Bangladesh
Mukesh Kumar Chaubey [Immunology, Zoology]
Mahatma Gandhi Post Graduate College, Gorakhpur, India.
N.K. Patel [Plant physiology & Ethno Botany]
Sheth M.N.Science College, Patan, India.
Kumudben Babulal Patel [Bird, Ecology]
Gujarat, India.
CHANDRAMOHAN [Biochemist]
College of Applied Medical Sciences, King Saud University.
B.C. Behera [Natural product and their Bioprospecting]
Agharkar Research Institute, Pune, INDIA.
Kuvalekar Aniket Arun [Biotechnology]
Lecturer, Pune.
Mohd. Kamil Usmani [Entomology, Insect taxonomy]
Aligarh Muslim university, Aligarh, india.
Dr. Lachhman Das Singla [Veterinary Parasitology]
Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana, India.
Vaclav Vetvicka [Immunomodulators and Breast Cancer]
University of Louisville, Kentucky.
José F. González-Maya [Conservation Biology]
Laboratorio de ecología y conservación de fauna Silvestre,
Instituto de Ecología, UNAM, México.
Dr. Afreenish Hassan [Microbiology]
Department of Pathology, Army Medical College, Rawalpindi, Pakistan.
Gurjit Singh [Soil Science]
Krishi Vigyan Kendra, Amritsar, Punjab, India.
Dr. Marcela Pagano [Mycology]
Universidade Federal de São João del-Rei, Brazil.
Dr.Amit Baran Sharangi [Horticulture]
BCKV (Agri University), West Bengal, INDIA.
Dr. Bhargava [Melittopalynology]
School of Chemical & Biotechnology, Sastra University, Tamilnadu, INDIA.
Dr. Sri Lakshmi Sunitha Merla [Plant Biotechnology]
Jawaharlal Technological University, Hyderabad.
Dr. Mrs. Kaiser Jamil [Biotechnology]
Bhagwan Mahavir Medical Research Centre, Hyderabad, India.
Ahmed Mohammed El Naim [Agronomy]
University of Kordofan, Elobeid-SUDAN.
Dr. Zohair Rahemo [Parasitology]
University of Mosul, Mosul,Iraq.
Dr. Birendra Kumar [Breeding and Genetic improvement]
Central Institute of Medicinal and Aromatic Plants, Lucknow, India.
Dr. Sanjay M. Dave [Ornithology and Ecology]
Hem. North Gujarat University, Patan.
Dr. Nand Lal [Micropropagation Technology Development]
C.S.J.M. University, India.
Fábio M. da Costa [Biotechnology: Integrated pest control, genetics]
Federal University of Rondônia, Brazil.
Marcel Avramiuc [Biologist]
Stefan cel Mare University of Suceava, Romania.
Dr. Meera Srivastava [Hematology , Entomology] Govt. Dungar College, Bikaner.
P. Gurusaravanan [Plant Biology ,Plant Biotechnology and Plant Science]
School of Life Sciences, Bharathidasan University, India.
Dr. Mrs Kavita Sharma [Botany]
Arts and commerce girl’s college Raipur (C.G.), India.
Suwattana Pruksasri [Enzyme technology, Biochemical Engineering]
Silpakorn University, Thailand.
Dr.Vishwas Balasaheb Sakhare [Reservoir Fisheries]
Yogeshwari Mahavidyalaya, Ambajogai, India.
Dr. Pankaj Sah [Environmental Science, Plant Ecology]
Higher College of Technology (HCT), Al-Khuwair.
Dr. Erkan Kalipci [Environmental Engineering]
Selcuk University, Turkey.
Dr Gajendra Pandurang Jagtap [Plant Pathology]
College of Agriculture, India.
Dr. Arun M. Chilke [Biochemistry, Enzymology, Histochemistry]
Shree Shivaji Arts, Commerce & Science College, India.
Dr. AC. Tangavelou [Biodiversity, Plant Taxonomy]
Bio-Science Research Foundation, India.
Nasroallah Moradi Kor [Animal Science]
Razi University of Agricultural Sciences and Natural Resources, Iran
T. Badal Singh [plant tissue culture]
Panjab University, India
Dr. Kalyan Chakraborti [Agriculture, Pomology, horticulture]
AICRP on Sub-Tropical Fruits, Bidhan Chandra Krishi Viswavidyalaya,
Kalyani, Nadia, West Bengal, India.
Dr. Monanjali Bandyopadhyay [Farmlore, Traditional and indigenous
practices, Ethno botany]
V. C., Vidyasagar University, Midnapore.
M.Sugumaran [Phytochemistry]
Adhiparasakthi College of Pharmacy, Melmaruvathur, Kancheepuram District.
Prashanth N S [Public health, Medicine]
Institute of Public Health, Bangalore.
Tariq Aftab
Department of Botany, Aligarh Muslim University, Aligarh, India.
Manzoor Ahmad Shah
Department of Botany, University of Kashmir, Srinagar, India.
Syampungani Stephen
School of Natural Resources, Copperbelt University, Kitwe, Zambia.
Iheanyi Omezuruike OKONKO
Department of Biochemistry & Microbiology, Lead City University,
Ibadan, Nigeria.
Sharangouda Patil
Toxicology Laboratory, Bioenergetics & Environmental Sciences Division,
National Institue of Animal Nutrition
and Physiology (NIANP, ICAR), Adugodi, Bangalore.
Jayapal
Nandyal, Kurnool, Andrapradesh, India.
T.S. Pathan [Aquatic toxicology and Fish biology]
Department of Zoology, Kalikadevi Senior College, Shirur, India.
Aparna Sarkar [Physiology and biochemistry] Amity Institute of Physiotherapy, Amity campus, Noida, INDIA.
Dr. Amit Bandyopadhyay [Sports & Exercise Physiology]
Department of Physiology, University of Calcutta, Kolkata, INDIA .
Maruthi [Plant Biotechnology]
Dept of Biotechnology, SDM College (Autonomous),
Ujire Dakshina Kannada, India.
Veeranna [Biotechnology]
Dept of Biotechnology, SDM College (Autonomous),
Ujire Dakshina Kannada, India.
RAVI [Biotechnology & Bioinformatics]
Department of Botany, Government Arts College, Coimbatore, India.
Sadanand Mallappa Yamakanamardi [Zoology]
Department of Zoology, University of Mysore, Mysore, India.
Anoop Das [Ornithologist]
Research Department of Zoology, MES Mampad College, Kerala, India.
Dr. Satish Ambadas Bhalerao [Environmental Botany]
Wilson College, Mumbai
Rafael Gomez Kosky [Plant Biotechnology]
Instituto de Biotecnología de las Plantas, Universidad Central de Las Villas
Eudriano Costa [Aquatic Bioecology]
IOUSP - Instituto Oceanográfico da Universidade de São Paulo, Brasil
M. Bubesh Guptha [Wildlife Biologist] Wildlife Management Circle (WLMC), India
Rajib Roychowdhury [Plant science]
Centre for biotechnology visva-bharati, India.
Dr. S.M.Gopinath [Environmental Biotechnology]
Acharya Institute of Technology, Bangalore.
Dr. U.S. Mahadeva Rao [Bio Chemistry]
Universiti Sultan Zainal Abidin, Malaysia.
Hérida Regina Nunes Salgado [Pharmacist]
Unesp - Universidade Estadual Paulista, Brazil
Mandava Venkata Basaveswara Rao [Chemistry]
Krishna University, India.
Dr. Mostafa Mohamed Rady [Agricultural Sciences]
Fayoum University, Egypt.
Dr. Hazim Jabbar Shah Ali [Poultry Science]
College of Agriculture, University of Baghdad , Iraq.
Danial Kahrizi [Plant Biotechnology, Plant Breeding,Genetics]
Agronomy and Plant Breeding Dept., Razi University, Iran
Dr. Houhun LI [Systematics of Microlepidoptera, Zoogeography, Coevolution,
Forest protection]
College of Life Sciences, Nankai University, China.
María de la Concepción García Aguilar [Biology] Center for Scientific Research and Higher Education of Ensenada, B. C., Mexico
Fernando Reboredo [Archaeobotany, Forestry, Ecophysiology]
New University of Lisbon, Caparica, Portugal
Dr. Pritam Chattopadhyay [Agricultural Biotech, Food Biotech, Plant Biotech]
Visva-Bharati (a Central University), India
Dr. Preetham Elumalai [Biochemistry and Immunology] Institute for
Immunology Uniklinikum, Regensburg, Germany
Dr. Mrs. Sreeja Lakshmi PV [Biochemistry and Cell Biology] University of Regensburg, Germany
Dr. Alma Rus [Experimental Biology]
University of jaén, Spain.
Dr. Milan S. Stanković [Biology, Plant Science]
University of Kragujevac, Serbia.
Dr. Manoranjan chakraborty [Mycology and plant pathology]
Bishnupur ramananda college, India.
Table of Contents (Volume 3 - Issue 8)
Serial No Accession No Title of the article Page No
1 RA0396 Cyclin D1 Gene Polymorphism in Egyptian Breast Cancer Women
Ibrahim HAM, Ebied SA, Abd El-Moneim NA and Hewala TI.
1111-1121
2 RA0397 Role of p73 polymorphism in Egyptian breast cancer patients as
molecular diagnostic markers.
Ibrahim HAM, Ebied SA, Abd El-Moneim NA and Hewala TI.
1122-1131
3
RA0419
Efficient methods for fast, producible, C-Phycocyanin from
Thermosynechococcus elongates.
El-Mohsnawy Eithar.
1132-1146
4 RA0406 Length-Weight relationship and condition factor of Channa
aurantimaculata (Musikasinthorn, 2000) studied in a riparian wetland
of Dhemaji District, Assam, India.
Banjit Bhatta and Mrigendra Mohan Goswami.
1147-1152
5 RA0412 Impact of ecological factors on genetic diversity in Nothapodytes
nimmoniana Graham based on ISSR amplification.
John De Britto A, Benjamin Jeya Rathna Kumar P and Herin Sheeba
Gracelin D.
1153-1161
Article Citation: Ibrahim HAM, Ebied SA, Abd El-Moneim NA and Hewala TI. Cyclin D1 Gene Polymorphism in Egyptian Breast Cancer Women. Journal of Research in Biology (2014) 3(8): 1111-1121
Jou
rn
al of R
esearch
in
Biology
Cyclin D1 gene polymorphism in Egyptian breast cancer women
Keywords: Breast Cancer, Cyclin D1, Polymorphism, Egypt
ABSTRACT: Background: Cyclin D1, a key regulator of G1 to S phase progression of the cell cycle, is strongly established as an oncogene with an important pathogenetic role in many human tumors; therefore any genetic variations that disturb the normal function of this gene product is ultimately a target for association with cancer risk and survival. Cyclin D1 silent mutation (G870A) in the splicing region of exon-4 enhances alternative splicing, resulting two CCND1 mRNA transcripts variant [a] and [b], in which transcript b has a longer half-life. It has been deduced that G870A polymorphism of the CCND1 gene may play a role in tumorigenesis. The aim of our study was to investigate the influence of CCND1 genotypes on the genetic susceptibility to breast cancer in Egyptian population. Patients and Methods: 80 newly diagnosed females representing Egyptian population confirmed breast cancer patients and 40 healthy controls were included in the study. Single nucleotide polymorphism (SNP) in CCND1 (G870A) was determined in these samples by polymerase chain reaction- restriction fragment length polymorphism (PCR-RFLP). Results: The frequencies of AG, AA genotypes between patients group and the healthy control group have shown a significant difference at (p=0,009). Subjects less than 45 years of age with AA genotype were at decreased risk (οdds ratio 0.438, 95% confidence interval 0.251-0.763) and postmenopausal subjects with AA genotype were at increased risk of developing breast cancer (οdds ratio 5.056, 95% confidence interval 1.239-20.626). We found that breast cancer females carrying A allele had longer DFS than did patients with GG genotype (p=0,001). Conclusion: This study provides the first indication that CCND1 870A alleles (AA/AG genotypes) are risk factors for breast cancer susceptibility in Egyptian women. Thus analysis of CCND1 G870A polymorphism may be useful for identifying females with higher risk to develop breast cancer.
1111-1121| JRB | 2014 | Vol 3 | No 8
This article is governed by the Creative Commons Attribution License (http://creativecommons.org/
licenses/by/2.0), which gives permission for unrestricted use, non-commercial, distribution and reproduction in all medium, provided the original work is properly cited.
www.jresearchbiology.com
Journal of Research in Biology
An International
Scientific Research Journal
Authors: Ibrahim HAM1, Ebied SA1,
Abd El-Moneim NA2 and
Hewala TI3.
Institution:
1. Department of Applied
Medical Chemistry,
Medical Research Institute,
Alexandria University,
Egypt.
2. Department of Cancer
Management and Research,
Medical Research Institute,
Alexandria University,
Egypt.
3. Department of Radiation
Sciences, Medical Research
Institute, Alexandria
University, Egypt.
Corresponding author:
Ibrahim HAM
Web Address: http://jresearchbiology.com/
documents/RA0396.pdf.
Dates: Received: 09 Oct 2013 Accepted: 17 Dec 2013 Published: 06 Feb 2014
Journal of Research in Biology An International Scientific Research Journal
Original Research
INTRODUCTION:
Breast cancer has become the leading cause of
cancer death for females in Egypt. It represents 31% of
all cancers diagnosed and 15% of all cancer death and
the incidence is increasing worldwide (Coral and Amy,
2010). Molecular biological studies have clearly
indicated that genetic alteration play significant role in
the development of breast carcinoma in some cases and
they addressed by better understanding of what genetic/
epigenetic events are likely to be associated with the
earliest phases of the disease (Sadikovic et al., 2008).
Cyclin D1 protein (35-KDa) is established as an
oncogene, gene considered as one of the human D-type
cyclin genes which encoded by the 5 exons and mapped
to chromosome bands 11q13 (Haber and Harlow, 1997).
Cyclin D1 proto oncogene acts as a growth sensor target
of proliferative signals in G1, by regulating the cell cycle
progression from G1-to- S phase transition in different
cell type from various tissues (Donnellan and Chetty,
1998; Baldin et al.,1993). Cyclin D1 active complexes
that phosphorylate and inactivate the retinoblastoma
tumor suppressor protein (RB), are formed by the
binding of cyclin D1 to its dependent kinases 4 and 6
(CDK4/6). Hyperphosphorylation of RB in early G1
phase allows to bind active RB to E2F transcription
factors and stimulates the cell cycle entry into S phase
(Sherr, 1993; Alao et al.,2006). Several studies have
demonstrated that cyclin D1 can also act as a
transcriptional co-factor for steroid hormone receptors
e.g., estrogen receptor (Neuman et al.,1997; Tashiro
et al.,2007). CCND1 overexpression occurs in a number
of cancers including breast cancer, conversely repression
of CCND1 gene expression is a hallmark of cell
differentiation (Gillett et al.,1996; James et al., 2006).
Moreover, Robert and Elizabeth (Sutherland and
Musgrove, 2002) reported that the cyclin d1 gene is
amplified in up to 20% of breast cancer patients and
overexpression occurs in more than 50% of mammary
tumors, and this appears to be an early event in the breast
cancer (Buckley et al.,1993). On the other hand it is also
demonstrated by a correlation between CCND1
overexpression and cellular metastasis (Drobnjak et al.,
2000). Silent polymorphism (G870A, pro241pro) occurs
in cyclin D1 coding gene, this commonly available SNP,
affects the exon 4/intron 4 splice donor site and leads to
two different variants of the cyclin D1 mRNA (Betticher
et al.,1995). Diverse studies demonstrated that variant
transcript (a) has carried all exons whereas variant (b)
lack exon 5 including a PEST domain, which was
hypothesized to acts as a degradation motif. It has been
shown that variant transcript b lead to a longer half- life
of cyclin D1 (Betticher et al.,1995; Sawa et al.,1998).
Furthermore, cyclin D1 transcript (b) was appear to be
weakly catalyst of RB phosphorylation / inactivation and
significantly enhanced cell transformation activity
compared to cyclin D1 transcript (a) (Solomon et al.,
2003). It has been proved that the cyclin D1 isoform
(cyclin D1b) is an unclear oncogene which is generated
via CCND1 mRNA alternative splicing and involved in
tumorigenesis through promoting the transition between
G1 and S phases (Sawa et al.,1998; Solomon et al.,
2003; Lu et al., 2003). Numerous studies have been
examined on the correlation between cyclin D1
polymorphism and risk of breast cancer, but those studies
yielded conflicting results (Grieu et al., 2003; Ceschi
et al., 2005; Yu et al.,2008; Forsti et al., 2004; Krippl
et al., 2003; Wang et al., 2002). The aim of our study
was to investigate the influence of CCND1 genotypes on
the genetic susceptibility to breast cancer in the Egyptian
population.
MATERIALS AND METHODS:
All patients (n=80) who had experienced primary
invasive breast carcinoma, with median age 52.0 (range
32.0-77.0) years, at the Experimental and Clinical
Surgery and Cancer Management and Research
Departments, Medical Research Institute, Alexandria
University From 2008 to 2012, were enrolled in this
Ibrahim et al., 2014
1112 Journal of Research in Biology (2014) 3(8): 1111-1121
study. The samples were collected before surgery or any
chemotherapeutic treatment. Blood samples were taken
from patients who had pathological diagnosis and had
not undergone blood transfusion or receiving
immunomodulatory agent. The non tumor control group
(n=40), with median age 49.50 (range 36.0-71.0) years,
was composed of healthy women volunteers clinically
free from any chronic disease. Questionnaires, medical
records, and pathological reports were used to confirm
the diagnosis and cancer status. This study protocol was
approved by the Local Ethical Committee at Alexandria
University.
CCND1 genotyping
5-mL blood samples were obtained from cases
and controls. The samples were collected in tubes
containing EDTA and genomic DNA was purified from
peripheral whole blood using a ready- for use DNA
extraction kit (QIA amp DNA Blood mini kit, Qiagen,
Hilden, Germany). Genotyping was performed by
polymerase chain reaction (PCR) and restriction
fragment length polymorphism (RFLP) (Enayat, 2002;
Onay et al., 2008), using semi quantitatively
conventional polymerase chain reaction (PCR) kits
(Qiagen, Germany) according to producer’s instructions.
For amplifying CCND1 gene we used the following
primers, Forward primer:5´- GTTTTCCCAGTCACGAC
-3´;Reverse primer: 5´ GGGACATCACCCTCACTTAC
-3´_; The CCND1 G870A polymorphism specific
primers were ordered from QIAGEN system (QIAGEN,
Germany) to amplify a 167-bp fragment of CCND1 gene
at exon 4/intron 4. The PCR reactions were performed on
a thermal cycler (Biometra- TProfessional Thermocycler
-Germany) and the cycling program was programmed
according to the manufacturer’s protocol. Specifically,
these reactions were carried out in a total volume 50 μl
of QIAGEN Multiplex PCR Master Mix 25 μl, primer
mix (2 μl taken from each 20μM primer working
solution) 4 μl and Template DNA 21 μl.
Each PCR started within the initial heat-
activation program to activate Hot Star Tag DNA
polymerase (95°C for 15 min), followed by 35 cycles of
denaturation at 94°C for 30 sec, annealing at 55°C for 90
sec, and extension at 72°C for 90 sec, with a final
extension step at 72°C for 10 minutes. For RFLP
analyses, each PCR product was subjected to ScrF1
restriction enzyme (New England, BioLabs Inc, UK).
According to the manufacture’s protocol, 1 unit of
restriction enzyme digests 1 μg of substrate DNA in a 50
μl reaction in 60 minutes. Agarose gel electrophoresis
was used as the appropriate detection system. This gave
a satisfactory signal with our PCR product. The DNA
fragments were separated using 2% agarose gel
containing ethidium bromide and the bands on the gel
were visualized by using UV Transilluminator.
The allele types were determined, GG genotype
showed two fragments (145 and 22bp), AG genotype
showed three fragments (167, 145, and 22 bp) and AA
genotype showed single fragment (167-bp).
Statistical Analysis
Predictive Analytics Software (PASW Statistics
18) for Windows (SPSS Inc, Chicago, USA) was used
for statistical analysis. Chi-square test and Firsher’s
Exact test (When more than 20% of the cells have
expected count less than five) were used for testing
Association between categorical variables. Quantitative
data were described using median, minimum and
maximum as well as mean and standard deviation.
Parametric and non-parametric tests were applied for
analyzed normal data and abnormally distributed data,
respectively. Odd ratio (OR) and 95% Confidence
Interval (CI) were used. Significance test results are
quoted as two-tailed probabilities. Significance of the
obtained results was judged at the 5% level.
RESULTS
The clinical profile of breast cancer patients
included in the current study presented in table (1). The
Ibrahim et al., 2014
Journal of Research in Biology (2014) 3(8): 1111-1121 1113
frequencies of GG, AG and AA genotypes were 37.5%,
20% and 42.5% respectively, in healthy controls
and16.3%, 28.8% 55.0% respectively, in patients group.
The statistical analyses of these results revealed that, in
comparison with that in control group CCND1 (G870A)
AG and AA genotypes frequencies in breast cancer
patients were insignificantly higher, whereas CCND1
(G870A) GG genotype frequency was significantly
lower (p= 0.009).Our results revealed that, frequencies of
the three genotypes GG, AG and AA between patients
and controls were significantly different (p =0.034,
table 2).
Table 3 shows the results of the CCND1
genotype effects on breast cancer risk. AA, AG were at
increased risk for developing breast cancer compared
with the GG genotype [OR= 2.986, 95%CI (1.178-
7.569); p= 0.019 and OR= 3.317, 95% CI (1.110-9.915);
p= 0.029, respectively]. In addition AA also had a higher
risk in postmenopausal women [OR=5.056, 95% CI
(1.239-20.626); p= 0.019] than premenopausal ones
[OR= 1.870, 95% CI (0.530-6.603); p= 0.328], table
(3a), and had reduced risk in younger women [<45 y/o,
OR=0.438, 95% CI (0.251-0.763); p= 0.046] than elder
ones[≥ 45 y/o, OR= 2.423, 95% CI (0.804-7.300);
p= 0.111], table (3b). Association of different CCND1
G870A polymorphic variants among breast cancer
patients with pathological features were shown in table
(4). There was no significant differences with (p=0.688)
Ibrahim et al., 2014
1114 Journal of Research in Biology (2014) 3(8): 1111-1121
Clinical characteristics Normal subjects (n = 40) Breast cancer patients n = 80) Test of significance
(P- value) No % No %
Age (years)
< 45 15 37.5 11 13.8 X2 test
(P = 0.454) ≥ 45 25 62.5 69 86.3
Range 36.00 –71.00 32.00 – 77.00
Student T test (P = 0.198)
Mean ± SD 50.15 ± 9.43 52.62 ± 10.07
Median 49.50 52.0
Menopausal status
X2test
X2P = 0.698 Premenopausal 20 50.0 37 46.3
Postmenopausal 20 50.0 43 53.8
Table 1: Characteristics of normal healthy controls and breast cancer patients
x2p: p value for Chi square test *: Statistically significant at p < 0.05
Normal healthy controls (n=40) Breast cancer patients (n = 80 )
p No. % No. %
Polymorphic variants
GG 15 37.5 13 16.33 0.009*
AG 8 20.0 23 28.80 0.302
AA 17 42.5 44 55.00 0.197
p 0.034*
Table 2: Frequencies of CCND1 G870A genotype in breast cancer patients and controls
p: p value for Chi-square test *: Statistically significant at p ≤ 0.05
in the CCND1 genotypes distribution between stage T3
and T4 tumors. Breast cancer patients carrying the
CCND1 A allele had a 1.04-fold increased risk for lymph
node metastasis but this was not statistically significant
(p=1.000). The CCND1 genotypes were furthermore not
associated with vascular invasion in carrier A allele
patients was higher when compared with G allele carriers
and this difference was statistically insignificant
(p=0.717). In addition breast cancer patients carrying A
allele (AA/AG genotypes) were at reduced risk of
metastasis [OR= 0.247, 95%CI (0.072-0.848); p= 0.020]
when compared with those carrying GG genotype.
Kaplen Meir disease free survival (DFS) curve was
constructed to study the prognostic value of CCND1
G870A genotypes. The median fallow up period 25
months (range 18-48 months) in which 22(27.5%) out of
80 patients had metastasis. The incidence of metastasis
was observed in 53.9% of patients with GG genotype
and 46.2% of patients carrying A allele (AA / AG
genotypes) (table 5). Survival curve of the different
Ibrahim et al., 2014
Journal of Research in Biology (2014) 3(8): 1111-1121 1115
Healthy control group
(n=40)
Breast cancer patients
(n=80) Test of sig OR ( 95% CI)
(lower– upper) No % No %
All participants
GG® 15 37.5 13 16.33 1.000 (reference)
AG 8 20.0 23 28.80 P = 0.029* 3.317 (1.110-9.915)
AA
AA+ AG
17
25
42.5
62.5
44
67
55.00
83.80
P = 0.019*
P = 0.009*
2.986 (1.178-7.569)
3.092 (1.291-7.405)
Table (3): Association of CCND1 G870A polymorphism with breast cancer risk
p: p value for Chi-square tes FEp : p value for Fisher Exact test
*: Statistically significant at p ≤ 0.05
Table (3a): Association of CCND1 G870A polymorphism with breast cancer risk
Healthy control group
(n=15) Breast cancer patients (n=11)
Test of sig OR ( 95% CI)
(lower– upper) No % No %
Women ages <45 years
GG® 6 40.0 0 00.0 1.000 (reference)
AG 2 13.3 2 18.2 FEp = 0.133 0.500 (0.188-1.332)
AA
AA+ AG
7
9
46.7
60.0
9
11
81.8
100.0
FEp = 0.046*
FEp= 0.024*
0.438 (0.251-0.763)
0.450 (0.277-0.731)
Healthy control group
(n=25) Breast cancer patients(n=69)
Test of sig OR ( 95% CI)
(lower– upper) No % No %
Women ages ≥ 45 years
GG® 9 36.0 13 18.8 1.000 (reference)
AG 6 24.0 21 30.4 p = 0.158 2.423 (0.699-8.400)
AA
AA+ AG
10
16
40.0
64.0
25
56
50.7
81.2
p = 0.111
P = 0.083
2.423 (0.804-7.300)
2.423 (0.878-6.689)
p: p value for Chi-square tes FEp : p value for Fisher Exact test
*: Statistically significant at p ≤ 0.05
genotypes are shown in Fig. 1. A significant association
between the genotypes and survival was found in the
patients (p < 0.001). Furthermore, patients with GG
genotype had a worse prognosis and short survival
(24.0±1.13 months) than patients carrying A allele (AA /
AG genotypes) (41.92±1.20 months).
DISCUSSION:
Cyclin D1 (CCND1) is considered as one of the
proteins that acts within a regulatory circuit that
dominate cell cycle G1 to S-phase transition (Diehl,
2002). Moreover, it is proved that cyclin D1 acts as a
dual function in promoting cell proliferation and
inhibiting drug- induced apoptosis; these finding are
attributed to the presence of a chemoresistance during
overexpression (Biliran et al., 2005). In a normal breast,
cyclin D1 protein plays uncompensated roles in
mammary gland development during different growth
cycles, whereas, enhanced oncogenic transformation and
tumorigenesis, of the CCND1 gene may be a primary
and early step in breast cancer formation (Fu et al.,
2004). It is found that 45-50% of human breast
carcinoma types are over expressed by the oncogenic
CCND1 mRNA (Sutherland and Musgrove, 2002).
Possible correlations between CCND1 gene
polymorphism and breast cancer susceptibility were
studied in different population and produced inconsistent
results. In the present study, we noticed that CCND1
AA, AG and AA/AG genotype frequencies were more
frequently observed in cases, whereas GG genotype
frequency was significantly higher in controls.
Furthermore, genotype distribution between patient
group and controls are markedly different, suggesting
that CCND1 G870A polymorphism is associated to
breast cancer susceptibility. These observations were in
concordance with previous findings suggesting that
CCND1 genotype is associated with the breast cancer
risk (Yu et al., 2008; Forsti et al., 2004). Multiple and
specialized studies were conducted to evaluate the
CCND1 polymorphic variants and breast cancer patients
from different ethnic groups. Yu et al., (2008) conducted
a study in China and found that cyclin D1 G870A
polymorphism lead a potential contribution to breast
cancer with superiority occurrence of breast cancer in
young women.
In the present series, Lu et al., (2009) conducted
a Meta analysis on the association between CCND1
G870A polymorphism and breast cancer susceptibility,
Ibrahim et al., 2014
1116 Journal of Research in Biology (2014) 3(8): 1111-1121
Table (3b): Association of CCND1 G870A polymorphism with breast cancer risk
Healthy control group
(n=21) Breast cancer patients(n=34)
Test of sig OR ( 95% CI)
(lower– upper) No % No %
Premenopausal status
GG® 8 83.1 7 20.6 1.000 (reference)
AG 2 9.5 9 26.5 FEp = 0.109 5.143 (0.819-32.302)
AA
AA+ AG
11
13
52.4
61.9
18
27
52.9
79.4
p = 0.328
P = 0.157
1.870 (0.530-6.603)
2.374 (0.707-7.969)
Healthy control group
(n=19) Breast cancer patients (n=46)
Test of sig OR ( 95% CI)
(lower– upper) No % No %
Postmenopausal status
GG® 7 36.8 6 13.0 1.000 (reference)
AG 6 31.6 14 30.4 p = 0.171 2.722 (0.638-11.610)
AA
AA+ AG
6
12
31.6
63.2
26
40
56.5
87.0
p = 0.019*
P = 0.029*
5.056 (1.239-20.626)
3.889 (1.095-13.806)
p: p value for Chi-square tes FEp : p value for Fisher Exact test
*: Statistically significant at p ≤ 0.05
he observed that the Caucasian population which
increased breast cancer susceptibility were carrying a
variant 870 A allele, however, it is not observed in the
Asians. The study reviewed that genetic and
environmental factors might also contribute to the ethnic
difference. In contrast, some studies reported that there
was no association between CCND1 polymorphic
variants and susceptibility to breast cancer (Grieu et al.,
2003; Krippl et al., 2003; Shu et al., 2005).
In the present study, We found that individuals
carrying A allele of CCND1 G870A polymorphism (AA,
AG, AA/AG) had a 2.9, 3.3 and 3.1 fold increased risk
for the development of breast cancer compared with
those carrying GG genotype (P=0.019, P=0.029,
P=0.009) respectively. These finding could be
interpreted in view of Betticher et al., (1995) who
indicated that the alternative splicing and production of
altered transcript b occurs in individuals those carrying
Journal of Research in Biology (2014) 3(8): 1111-1121 1117
Ibrahim et al., 2014
AA+AG GG® Test of sig
OR ( 95% CI)
(lower– upper) No % No %
Tumor pathological grade
FEp =0.679 2.357 (0.277-20.033)
II ® 56 83.6 12 92.3
III 11 16.4 1 7.7
Clinical stage
p = 0.688 0.784 (0.238-2.579) II ® 35 52.2 6 46.2
III 32 47.8 7 53.8
Tumor size (cm)
p = 0.363 0.571 (0.169-1.928) < 5® 35 52.2 5 38.5
≥ 5 32 47.8 8 61.5
Lymph node involvements
FEp= 1.000 1.040 (0.253-4.270) -ve® 15 22.4 3 23.1
+ve 52 77.6 10 76.9
Estrogen receptor status
FEp= 0.515 1.778 (0.170-18.560) -ve® 3 4.5 1 7.7
+ve 64 95.5 12 92.3
Progesterone receptor status
FEp=0.610 1.848 (0.330-10.367) -ve® 6 9.0 2 15.4
+ve 61 91.0 11 84.6
Her2/neu expression
FEp= 0.374 0.452 (0.102-1.999) -ve® 59 88.1 10 76.9
+ve 8 11.9 3 23.1
Vascular invasion
FEp= 0.717 1.246 (0.300-5.182) -ve® 13 19.4 3 23.1
+ve 54 80.6 10 76.9
Metastasis
p = 0.020* 0.247 (0.072-0.848) -ve® 52 77.6 6 46.2
+ve 15 22.4 7 53.8
Table (4): Association of CCND1 G870A polymorphism with clinicopathological features of breast cancer
p: p value for Chi-square test FEp : p value for Fisher Exact test *: Statistically significant at p ≤ 0.05
the homozygosity for CCND1 A allele that may have
longer half-life. Therefore cells will damaged DNA
carrying A allele of CCND1 G870A polymorphism may
bypass G1/S check point easily compared to GG
genotype. Also the study of Sawa et al., (1998) shown
that inhibition to the entry of the S phase in the cell cycle
is occurred within high level of normal transcript a
occurrence. All these observations lead to proved that
different polymorphic CCND1 variants affect the
biological behavior of the cells, thus altering the risk of
developing breast cancer.
Moreover, our results revealed that breast cancer
female patients < 45 years of age carrying AA or
combined variant AA/AG genotypes were at decreased
risk of breast cancer than those with GG genotype. These
finding are confirmed with the report of Shu et al.,
(2005) who stated that the A allele of the CCND1
G870A polymorphism was only weakly associated with
the risk of breast cancer among women ages < 45 years.
These results lead us to predict that variant 870A allele
may play a role in increasing estrogen metabolism and
inhibiting cell proliferation (Sutherland and Musgrove,
2002). On the other hand postmenopausal females
carrying AA or combined variant (AA/AG genotypes)
were at increased risk for breast cancer when compared
with those carrying GG genotype. These findings agreed
with the report of Grieu et al., (2003) who stated that A
allele of CCND1 G870A polymorphism might play a
more important role in the development of breast cancer
among postmenopausal females.
Furthermore, we evaluated the association of
CCND1 G870A polymorphism with clinicopathological
Ibrahim et al., 2014
1118 Journal of Research in Biology (2014) 3(8): 1111-1121
Figure 1: Kaplan-Meier disease free survival for CCND1 G870A genotypes
Metastasis
N =22 Non Metastasis
N = 58 Median (Mean ± SE)
DFS (months) Log rank p
GG (N= 13) 7 (53.9%) 6 (46.2%) 24.0 (23.14 ± 1.30)
26.617*
<0.001 AG/AA (N=67) 15 (22.4%) 52 (77.6%) 44.0 (41.92 ± 1.20)
Table (5): Association of CCND1 G870A genotypes with breast cancer disease free survival (DFS)
*: Statistically significant at p<0.05
features of breast cancer patients. We did not find any
significant association of carrying the A allele with
tumor pathological grade III, clinical stage III, tumor size
≥ 5, axillary lymph node involvement, +ve hormone
receptors status, +ve Her2/neu expression or vascular
invasion. These results may be attributed to the small
sample size which limited our ability to detect a
significant difference.
The correlation between CCND1 (A870G)
polymorphism and cancer progression produced different
results. It is found that, carrying of 870A allele in
patients with advanced preinvasive neoplasia of the
larynx and/or oral cavity was positively correlated with
CCND1 expression and poor disease prognosis (Izzo
et al., 2003).
Also in non-small cell lung cancer the A allele of
CCND1 (G870A) polymorphism had a more favorable
disease free-survival and showed positive association
with increasing risk of local relapse (Betticher
et al.,1995). In contrast to results, a study on ovarian
cancer revealed that CCND1 polymorphic variants were
not associated with the overall survival. On the other
hand there was a positive correlation between 870A
allele and early disease occurrence (Dhar et al., 1999).
Also the results of the study including 339 patients in
CCND1 G870A polymorphism with breast cancer
survival appear to be a null association with breast
cancer prognosis (Grieu et al., 2003). These different
results on CCND1 genotype and cancer prognosis may
be attributable to the cancer features in the study,
preparation design and treatment systems. Notably after
a median 25 months of fallow up, only 27.5% of our
patients had metastasis of their breast cancer, suggesting
that 72.5% of those patients are doing well in the short
term with improvement in therapy. In the present study
we found that carrying the A allele of CCND1 G870A
polymorphism was related to a longer disease free
survival for breast cancer than patients with GG
genotype (p < 0.001). The favorable DFS for breast
cancer patients carrying the A allele of CCND1 G870A
despite its positive association with increased risk of
breast cancer could be attributed to the induction of
cyclin D1 degradation by chemotherapy, causing cell
death and apoptosis (Zhou et al., 2001).
In conclusion, this study provides the first
indication that CCND1 870A allele (AA/AG genotypes)
is risk factors for breast cancer susceptibility in Egyptian
women. Thus analysis of CCND1 G870A polymorphism
may be useful for identifying females with higher risk to
develop cancer. As compared with CCND1 870A allele
and, CCND1 GG genotypes were significantly associated
with shorter disease free survival in breast cancer
patients. Therefore analysis of these genes may also be
useful in identifying the breast cancer patients that have a
high risk of relapse and most likely to be benefit from the
adjuvant chemotherapy.
REFERENCES
Alao JP, Gamble SC, Stavropoulou AV, Pomeranz
KM, Lam EW, Coombes RC, Vigushin DM. 2006.
The cyclin D1 proto-oncogene is sequestered in the
cytoplasm of mammalian cancer cell lines. Mol Cancer
5: 7.
Baldin V, Lukas J, Marcote MJ, Pagano M, Draetta
G. 1993. Cyclin D1 is a nuclear protein required for cell
cycle progression in G1. Genes Dev. 7(5): 812-21.
Betticher DC, Thatcher N, Altermatt HJ, Hoban P,
Ryder WD, Heighway J.1995. Alternate splicing
produces a novel cyclin D1 transcript. Oncogene 11:
1005-11.
Biliran H Jr, Wang Y, Banerjee S, Xu H, Heng H,
Thakur A, Bollig A, Sarkar FH, Liao JD. 2005.
Overexpression of cyclin D1 promotes tumor cell growth
and confers resistance to cisplatin-mediated apoptosis in
an elastase-myc transgene-expressing pancreatic tumor
cell line. Clin Cancer Res., 11(16):6075-86.
Ibrahim et al., 2014
Journal of Research in Biology (2014) 3(8): 1111-1121 1119
Buckley MF, Sweeney KJE, Hamilton JA, Sini RL,
Manning DL, Nicholson RI, deFazio A, Watts CKW,
Musgrove EA, Sutherland RL .1993. Expression and
amplification of cyclin genes in human breast cancer.
Oncogene 8:2127-2133.
Ceschi M, Sun CL, Van Den Berg D, Koh WP, Yu
MC, Probst-Hensch N. 2005. The effect of cyclin D1
(CCND1) G870A-polymorphism on breast cancer risk is
modified by oxidative stress among Chinese women in
Singapore. Carcinogenesis 26: 1457-64.
Coral O and Amy T. 2010. The Differences between
Male and Female Breast Cancer: In Principles of gender-
specific medicine (2th ed.). Marianne J L (eds). Elsevier
Inc (pub) 42(7): 459-69.
Dhar KK, Branigan K, Howells REJ Musgrove C,
Jones PW, Strange RC, Fryer AA, Redman CWE,
Hoban PR. 1999. Prognostic significance of cyclin D1
gene (CCND1) polymorphism in epithelial ovarian
cancer. Int J Gynecol Cancer. 9(4):342 –347.
Diehl JA. 2002. Cycling to cancer with cyclin D1.
Cancer Biol Ther., 1(3):226-31.
Donnellan R and Chetty R. 1998. Cyclin D1 and
human neoplasia. Mol Pathol., 51: 1-7.
Drobnjak M, Osman I, Scher HI, Fazzari M, Cordon-
Cardo C. 2000. Overexpression of cyclin D1 is
associated with metastatic prostate cancer to bone. Clin
Cancer Res., 6:1891-5.
Enayat MS. 2002. Restriction fragment length
polymorphism. In: Methods of in molecular biology,
PCR mutation detection protocols. Theophilus B D M,
Rapley R (eds). Human press Inc (pub), 5: 39-35.
Försti A, Angelini S, Festa F, Sanyal S, Zhang Z,
Grzybowska E, Pamula J, Pekala W, Zientek H,
Hemminki K, Kumar R.2004. Single nucleotide
polymorphisms in breast cancer. Oncol Rep., 1:917-22.
Fu M, Wang C, Li Z, Sakamaki T, Pestell RG. 2004.
Minireview: Cyclin D1: normal and abnormal functions.
Endocrinology 145(12):5439-47.
Gillett C, Smith P, Gregory W, Richards M, Millis R,
Peters G, Barnes D. 1996. Cyclin D1 and prognosis in
human breast cancer. Int J Cancer. 69(2):92-9.
Grieu F, Malaney S, Ward R, Joseph D, Iacopetta B.
2003. Lack of association between CCND1 G870A
polymorphism and the risk of breast and colorectal
cancers. Anticancer Res 23: 4257-9.
Haber D, Harlow E. 1997. Tumour-suppressor genes:
Evolving definitions in the genomic age. Nature Genetics
16: 320-322.
Izzo JG, Papadimitrakopoulou VA, Liu DD, den
Hollander PL, Babenko IM, Keck J, El-Naggar AK,
Dong M. Shin, Jack Lee J, Waun K. Hong and
Walter N. Hittelman. 2003. Cyclin D1 genotype,
response to biochemoprevention, and progression rate to
upper aerodigestive tract cancer. J Natl Cancer Inst 95
(3):198 – 205.
James CG, Woods A, Underhill TM, Beier F. 2006.
The transcription factor ATF3 is upregulated during
chondrocyte differentiation and represses cyclin D1 and
A gene transcription. 7:30.
Krippl P, Langsenlehner U, Renner W, Yazdani-
Biuki B, Wolf G, Wascher TC, Paulweber B, Weitzer
W, Leithner A, Samonigg H. 2003. The 870G>A
polymorphism of the cyclin D1 gene is not associated
with breast cancer. Breast Cancer Res Treat 82: 165-8.
Lu C, Dong J, Ma H, Jin G, Hu Z, Peng Y, Guo X,
Wang X, Shen H. 2009. CCND1 G870A polymorphism
contributes to breast cancer susceptibility: a meta-
analysis. Breast Cancer Res Treat 116: 571-5.
Ibrahim et al., 2014
1120 Journal of Research in Biology (2014) 3(8): 1111-1121
Lu F, Gladden AB, Diehl JA . 2003. An alternatively
spliced cyclin D1 isoform, cyclin D1b, is a nuclear
oncogene. Cancer Res., 63: 7056-61.
Neuman E, Ladha MH, Lin N, Upton TM, Miller SJ,
DiRenzo J, Pestell RG, Hinds PW, Dowdy SF, Brown
M, Ewen ME. 1997. Cyclin D1 stimulation of estrogen
receptor transcriptional activity independent of cdk4.
Mol Cell Biol., 9: 5338-47.
Onay UV, Aaltonen K, Briollais L, Knight JA,
Pabalan N, Kilpivaara O, Andrulis IL, Blomqvist C,
Nevanlinna H, Ozcelik H. 2008. Combined effect of
CCND1 and COMT polymorphisms and increased breast
cancer risk. BMC Cancer 8: 6.
Sadikovic B, Al-Romaih K, Squire JA and Zielenska
M. 2008. Cause and Consequences of Genetic and
Epigenetic Alterations in Human Cancer. Current
Genomics 9(6): 394 - 408.
Sawa H, Ohshima TA, Ukita H, Murakami H, Chiba
Y, Kamada H, Hara M, Saito I. 1998. Alternatively
spliced forms of Cyclin D1 modulate entry into the cell
cycle in an inverse manner. Oncogene 16: 1701-12.
Sherr CJ. 1993. Mammalian G1 cyclins. Cell.73:
1059-1065.
Shu XO, Moore DB, Cai Q, Cheng J, Wen W, Pierce
L, Cai H, Gao YT, Zheng Wl. 2005. Association of
cyclin D1 genotype with breast cancer risk and survival.
Cancer Epidemiol Biomarkers Prev., 1(14): 91-7.
Solomon DA, Wang Y, Fox SR, Lambeck TC,
Giesting S, Lan Z, Senderowicz AM, Conti CJ,
Knudsen ES. 2003. Cyclin D1 splice variants:
Differential effects on localization, RB phosphorylation,
and cellular transformation. J Biol Chem., 278: 30339-
30347.
Sutherland RL, Musgrove EA. 2002. Cyclin D1 and
mammary carcinoma: new insights from transgenic
mouse models. Breast Cancer Res 4(1):14-7. Epub 2001
Nov 30.
Tashiro E, Tsuchiya A, Imoto. 2007. Functions of
cyclin D1 as an oncogene and regulation of cyclin D1
expression. Cancer Sci., 98:629-35.
Wang L, Habuchi T, Takahashi T, Mitsu K, Kamoto
T, Kakehi Y, Kakinuma H, Sato K, Nakamura A,
Ogawa O and Kato T. 2002. Cyclin D1 gene
polymorphism is associated with an increased risk of
urinary bladder cancer. Carcinogenesis 23(2): 257-264.
Yu CP, Yu JC, Sun CA, Tzao C, Ho JY, Yen AM.
2008. Tumor susceptibility and prognosis of breast
cancer associated with the G870A polymorphism of
CCND1. Breast Cancer Res Treat. 107: 95-102.
Zhou Q, Hopp T, Fuqua SA, Steeg PS. 2001. Cyclin
D1 in breast premalignancy and early breast cancer:
implications for prevention and treatment. Cancer Lett.,
162(1):3 – 17.
Ibrahim et al., 2014
Journal of Research in Biology (2014) 3(8): 1111-1121 1121
Submit your articles online at www.jresearchbiology.com
Advantages
Easy online submission Complete Peer review Affordable Charges Quick processing Extensive indexing You retain your copyright
www.jresearchbiology.com/Submit.php.
An International Scientific Research Journal JJJJoooouuuurrrrnnnnaaaallll ooooffff RRRReeeesssseeeeaaaarrrrcccchhhh iiiinnnn BBBBiiiioooollllooooggggyyyy
Original Research
Role of p73 polymorphism in Egyptian breast cancer patients as
JournalofResearch
inBio
logy
Authors:
Ibrahim HAM1, Ebied SA1, Abd El-Moneim NA2 and Hewala TI3.
Institution: 1. Department of Applied
Medical Chemistry, Medical
Research Institute,
Alexandria University,
Egypt.
2. Department of Cancer
Management and Research,
Medical Research Institute,
Alexandria University,
Egypt.
3. Department of Radiation
Sciences, Medical Research
Institute, Alexandria
University, Egypt.
Corresponding author: Ibrahim HAM
Web Address: http://jresearchbiology.com/ documents/RA0397.pdf.
molecular diagnostic markers
ABSTRACT:
Background:
The incidence of breast cancer in Egyptian women is rising; to date, a few
susceptibility genes have been identified. p73 protein (also known as p53-like transcription
factor or p53-related protein) is one of the ancestors of the tumor suppressor p53 protein,
whose gene is located within the chromosomal loci 1p36; a region most frequently deleted in
human cancers. As a consequence of sharing same domain architecture with p53; p73 might
regulate p53- response genes and induced cell cycle arrest/ apoptosis in response to DNA
damage. A commonly studied non-coding polymorphism consisting of a double nucleotide
substitutions (G→A) and (C→T) at position 4 and 14 exon 2, situated upstream of the initial AUG
regions of p73. This functional consequence of p73 polymorphism may serve as a susceptibility
marker for human cancer, but the results are inconsistent.
Patients and Methods:
Eighty newly diagnosed females representing Egyptian population confirmed breast
cancer patients and forty healthy controls, recruited from the departments of Experimental and
Clinical Surgery and Cancer Management and Research, Medical Research Institute, Alexandria
University. Single Nucleotides Polymorphism (SNP) in p73 gene (G4C14-to-A4T14) was
determined in these samples by PCR-CTPP techniques.
Results:
Insignificant differences in the distributions of p73 genotypes between patients and
controls were observed (p = 0.126). When p73 GC/GC genotype was used as the reference, the
combined variant genotypes (AT/AT)/(GC/AT) was significantly associated with the risk for
breast cancer [OR= 2.418, 95% CI (1.018-5.746); p= 0.042]. p73 [(GC/AT) /(AT/AT) genotypes]
was found to be associated with increased risk for breast cancer among women with
pathological grade III, clinical stage III, tumor size ≥ 5 cm, axillary lymph node involvement and
the +ve (Her2/neu) expression, but not significantly associated with +ve ER/PR status, vascular
invasion and metastasis. Furthermore, patients carrying AT variant has a favorable prognosis (p
<0.001) and longer survival (41.33±1.45 months) than did patients carrying GC/GC genotype
(24.0±1.13 months).
Conclusion:
In conclusion, this study provides the first indication that p73 variants (AT/AT)/ (GC/
AT) are risk factors for breast cancer susceptibility in Egyptian women. Thus analysis of p73
G4C14- to- A4T14 polymorphism may be useful for identifying females with higher risk to
develop cancer. Additional studies are needed to confirm these findings.
Keywords:
p73, Cyclin D1, polymorphism, diagnosis, Egypt.
Article Citation:
Ibrahim HAM, Ebied SA, Abd El-Moneim NA and Hewala TI.
Role of p73 polymorphism in Egyptian breast cancer patients as molecular diagnostic
markers.
Journal of Research in Biology (2014) 3(8): 1122-1131
Dates:
Received: 09 Oct 2013 Accepted: 17 Dec 2013 Published: 06 Feb 2014
This article is governed by the Creative Commons Attribution License (http://creativecommons.org/ licenses/by/2.0), which gives permission for unrestricted use, non-commercial, distribution and reproduction in all medium, provided the original work is properly cited.
1122-1131 | JRB | 2014 | Vol 3 | No 8 Journal of Research in Biology
An International
Scientific Research Journal www.jresearchbiology.com
Ibrahim et al., 2014
INTRODUCTION:
The global burden of breast cancer is growing
larger in recent years .It is represent 31% of all cancers
diagnosed and 15% of all cancer death in women (Coral
and Amy, 2010). In Alexandria, Egypt, breast cancer
accounts for 42.7% of malignancies among females
(Alexandria Cancer Registry Annual Report, 2010).
Molecular epidemiology is an emerging new field that
for study not only the genetic and environmental causes
of carcinogenesis, but also interaction between the two
(Perera and Weinstein, 2000). Therefore medicine is
facing a new challenge, which is the identification of
determinations for genetic susceptibility to cancers
including breast cancer and the informations needed to
accomplish this role require an understanding of human
genetic variation (Lyla and Dan, 2006).
Recent breast cancer epidemiologic studies
provide some genetic and epigenetic factors that play a
role in the development of this disease, moreover, they
reported that individuals carrying breast carcinoma have
a high probability to carry one of these factors(Coral and
Amy, 2010).
p73 (Jost et al., 1997), tumor suppressor gene
encoded protein that shares structural and functional
homology with p53 but not identical. p73 gene located
on chromosomal region 1p63, locus is deleted in a
variety of tumorigenesis. Because of these similarities to
p53; p73 possiblely might activate p53 response genes
and induced cell cycle arrest or apoptosis in response to
DNA damage (Kaghad et al.,1997). The wild -type
isoform p73 α , contain 14 exons and gives rise to protein
containing 636 amino acids; it exhibits the same
structure of p53 and both have a transactivation domain
(TA), a DNA binding domain (DBD), and an
oligomerization domain (OD) (Kaghad et al.,1997; Barry
Trink et al., 1998; Thanos and Bowie, 1999). The
supreme similarity among all p53 family members
present within the DNA binding domain indicated that
p73 may bind the same DNA sequences like p53 and
strengthen transcription activation (Kaghad et al.,1997).
A part of p73 structure not present in p53 gene with an
expanded c-terminal region of p73 contains SAM (sterile
alpha motif) which acts as oligomerization domain and
involved in protein- protein interactions and
developmental regulation (Schultz et al., 1997; Ishimoto
et al., 2002).
p73 gene is characterized by two promoters
realizing different classes of proteins, the TAp73 protein
is generated by alternative splicing in the p1 promoter
region located upstream of exon 1, while the other
alternative splicing located in intron 3 in the p2 promoter
region is produceing the acidic NH2 terminally truncated
isoform (ΔNp73) which lack of all or most of the
transactivation domain (Ishimoto et al., 2002; Yang
et al., 2000; Stiewe et al., 2002).
This ΔNp73 acts as a negative inhibitor towards
TAp73 and p53 (Grob et al., 2001). Observed that
overexpression of p73 wild type is common alteration in
carcinogenesis particularly in patients with poor prognosis
(Stiewe and Putzer, 2002; Dominguez et al., 2001),
rather, ∆TA-p73 isoform is significantly detected
excessively in many types of cancers including breast
cancer (Alex et al., 2002; Uramoto et al., 2004; Douc-
Rasy et al., 2002; Casciano et al., 2002).
Two silent single nucleotide polymorphisms
affect the five untranslated region in exon 2 at position
4/14 (G4C14-to-A4T14) produced different variants of
p73 mRNAs (Kaghad et al.,1997). This p73 two linked
polymorphisms located upstream of the initiation AUG
codon of exon 2, causing stem-loop like structure during
transcription initiation thus, altering gene expression
[(Kaghad et al.,1997; Melino et al., 2002). Many of the
studies have examined the correlation between p73 (GC/
AT) polymorphism and the risk of carcinogenesis (De
Feo et al., 2009; Niwa et al., 2004; Li et al., 2004;
Pfeifer et al., 2005).
Though, few studies have been conducted to
investigate the impact of p73 dinucleotides
Journal of Research in Biology (2014) 3(8):1122-1131 1123
Ibrahim et al., 2014
polymorphism on breast cancer susceptibility (Huang
et al., 2003; Li et al., 2006). These studies producing a
confused results. the aim of our study is to determined
whether the p73 GC/AT dinucleotides polymorphism
are the risk factors for breast cancer susceptibility in
Egyptian females, and whether there were any
relationships of the p73 polymorphic variants with
clinicopathological status.
METHODS:
Patients:
All patients (n=80) who have experienced
primary invasive breast carcinoma, with a median age
52.0 ( range 32.0-77.0) years, at the Experimental and
Clinical Surgery and Cancer Management and Research
Departments, Medical Research Institute, Alexandria
University From 2008 to 2012, were enrolled in this
study. The samples were collected before starting any
cancer treatments. Non tumor control group (n=40), with
median age 49.50 (range 36.0-71.0) years, was composed
of healthy women volunteers clinically free from any
chronic disease. Other tools used to confirm our
information were questionnaires and medical reports.
This study protocol was approved by the Local Ethical
Committee at Alexandria University.
p73 genotyping: 5-mL blood samples were
obtained from cases and controls. The samples were
collected in tubes containing EDTA and genomic DNA
was purified from peripheral whole blood using a ready-
for use DNA extraction kit (QIA amp DNA Blood mini
kit, Qiagen, Hilden, Germany). Genotyping was
performed by Polymerase Chain Reaction with
Confronting Two-Pair Primers (PCR-CTPP) [(Hamajima
et al., 2000; Tamakoshi et al., 2003), using semi
quantitatively conventional Polymerase Chain Reaction
(PCR) kits (Qiagen, Germany) according to producer’s
instructions.
According to the published sequence of the human p73
gene, we designed four primers (Forward primer (F1):5
CCACGGATGGGTCTGATCC-3´; Reverse primer
(R1): 5´-GGCCTCCAAGGGCGACTT-3´ and (F2)
Forward primer (F2): 5´-CCTTCCTTCCTGCAGAGCG
3 ´ ; R e v e r s e p r i m e r ( R 2 ) : 5 ´
TTAGCCCAGCGAAGGTGG-3´; the p73 G4C14-to
A4T14 polymorphism specific primers were ordered
from QIAGEN system (QIAGEN, Germany) to amplify
a 260-bp fragment of p73 gene. The PCR reactions were
performed on a thermal cycler (Biometra- TProfessional
Thermocycler-Germany) and the cycling program was
programmed according to the manufacturer’s protocol.
Specifically, these reactions were carried out in a total
volume 50 µl of QIAGEN Multiplex PCR Master Mix 25
µl, primer mix (2 µl taken from each 20µM primer
working solution) 8 µl , Template DNA 17 µl. Each PCR
started within the initial heat- activation program to
activate HotStar Tag DNA polymerase (95°C for 15
min), followed by 35 cycles of denaturation at 94°C for
30 sec, annealing at 62°C for 90 sec, and extension at 72
C° for 90 sec, with a final extension step at 72 °C for 10
minutes. Agarose gel electrophoresis was used as the
appropriate detection system. This gave a satisfactory
signal with our PCR product. The DNA fragments were
separated using 2% agarose gel containing ethidium
bromide and the bands on the gel were visualized by
using UV Transilluminator. The allele types were
determined as follows: two fragments of (270-, 428-bp)
for the AA genotype, three fragments of (193- , 270-,
428- bp) for the GA genotype and two fragments of (193
-, 428- bp) for the GG genotype.
Statistical Analysis:
Data were analyzed using the Predictive Analysis
Software (PASW statistics) for windows (SPSS Inc.
Chicago, USA). Association between categorical
variables was tested using Chi – square test and Firsher’s
exact test if more than 20% of the cell has expected
account less than five. Range, mean, standard deviation
and median were used with quantitative data. Parametric
tests were applied that reveals normal data distribution. If
Journal of Research in Biology (2014) 3(8):1122-1131 1124
Ibrahim et al., 2014
data were abnormally distributed, the non parametric
tests were used. Odd ratio (OR) and 95% confidence
interval were used and the P value was assumed to be
significant at the 5% level.
RESULTS:
The clinical profile of breast cancer patients
included in the current study is presented in table (1).
Clinical characteristics of normal healthy female
volunteers and patients with breast cancer were depicted
in table (1). Because the cases and control were
frequency- matched for age, there were no significant
differences in the distributions of age between cases and
control (p=0.45). The genotype frequencies of P73
G4C14/A4T14 polymorphism were analyzed among the
controls and breast cancer patients. The frequencies of
GC/GC, GC/AT and AT/AT genotypes were 31(77.5%),
8(20.0%) and 1(2.5%) for healthy controls and 47
(58.8%), 29(36.3%) and 4(5.0%) for breast cancer
patients, respectively, table (2).
The GC/AT genotypes of p73 G4C14/A4T14
were not correlated with age, table (3a) and
Premenopausal status, table (3b). When p73 GC/GC
genotype was used as the reference, the combined variant
genotypes (AT/AT) / (GC/AT) was significantly
associated with the risk for breast cancer [OR= 2.418,
95% CI (1.018-5.746); p= 0.042] table(3).
Table 1: Characteristics of normal healthy controls and breast cancer patients
Clinical characteristics Normal subjects (n = 40)
No %
Breast cancer patients (n = 80)
No %
Test of significance (P- value)
Age (years)
< 45
≥ 45
15
25
37.5
62.5
11
69
13.8
86.3
X2 test (P = 0.454)
Range 36.00 –71.00 32.00 – 77.00
Mean ± SD
Median
50.15 ± 9.43
49.50
52.62 ± 10.07
52.0
Student T test (P = 0.198)
Menopausal status
Premenopausal
Postmenopausal
20
20
50.0
50.0
37
43
46.3
53.8
X2test X2P = 0.698
x2p: p value for Chi square test *: Statistically significant at p < 0.05
Table 2: Frequencies of P73 (G4C14/A4T14) genotype in breast cancer patients and healthy controls
Normal healthy controls (n=40) Breast cancer patients (n = 80 )
pNo. % No. %
Polymorphic variants
GC/GC 31 77.5 47 58.8 0.042 *
GC/AT 8 20.0 29 36.3 0.069
AT/AT 1 2.5 4 5.0 FEp =0.664
p 0.126
p: p value for Chi-square test FEp: p value for Fisher Exact test *: Statistically significant at p ≤ 0.05
1125 Journal of Research in Biology (2014) 3(8):1122-1131
Ibrahim et al., 2014
Table (3): Association of P73 (G4C14/A4T14) polymorphism with breast cancer risk
Normal healthy controls
Breast cancer patients Test of sig.
OR ( 95% CI) (lower– upper)
No % No %
All participants 1.000 (reference)
GC/GC® 31 77.5 47 58.8 2.391 (0.968-5.908)
GC/AT 8 20.0 29 36.3 P = 0.055 2.638 (0.968-5.908)
AT/AT 1 2.5 4 5.0 FEp = 0.644 2.418 (1.018-5.746)
AT/AT+GC/AT 9 22.5 33 41.3 P = 0.042 *
p: p value for Chi-square test FEp : p value for Fisher Exact test *: Statistically significant at p ≤ 0.05
Table (3a): Association of P73 (G4C14/A4T14) polymorphism with breast cancer risk
Normal healthy controls
Breast cancer patients Test of sig.
OR ( 95% CI) (lower– upper)
No % No %
Women age < 45years
GC/GC® 12 80.0 6 54.5 1.00 (reference) GC/AT 2 13.3 4 36.4 FEp = 0.192 4.00 (0.563-28.396)
AT/AT 1 6.7 1 9.1 FEp = 1.000 2.00 (0.106-37.830)
AT/AT+ GC/AT 3 20.0 5 45.5 FEp = 0.218 3.33 (0.588-18.891)
Women age ≥ 45 years
GC/GC® 19 76.0 41 59.4 1.00 (reference)
GC/AT 6 24.0 25 36.2 p = 0.322 1.931 (0.680-5.484)
AT/AT 0 0.0 3 4.3 FEp = 0.547 1.463 (1.232-1.738)
AT/AT+ GC/AT 6 24.0 28 40.6 p = 0.139 2.163 (0.767-6.094)
p: p value for Chi-square test FEp : p value for Fisher Exact test *: Statistically significant at p ≤ 0.05
Table (3b): Association of P73 (G4C14/A4T14) polymorphism with breast cancer risk
Normal healthy controls
Breast cancer patients Test of sig.
OR ( 95% CI) (lower– upper)
No % No %
Premenopausal status
GC/GC® 16 76.2 22 64.7 1.00 (reference)
GC/AT 4 19.0 10 29.4 FEp = 0.524 1.181 (0.483-6.850)
AT/AT 1 4.8 2 5.9 FEp = 1.000 1.455 (0.121-17.462)
AT/AT+ GC/AT 5 23.8 12 35.3 p = 0.371 1.745 (0.512-5.948)
Postmenopausal status
GC/GC® 15 78.9 25 54.3 1.00 (reference)
GC/AT 4 21.1 19 41.3 FEp = 0.153 2.850 (0.813-9.986) AT/AT 0 0.0 2 4.3 FEp = 0.530 1.600 (1.259-2.034)
AT/AT+ GC/AT 4 21.1 21 45.7 FEp = 0.093 3.150 (0.906-10.953)
p: p value for Chi-square test FEp : p value for Fisher Exact test *: Statistically significant at p ≤ 0.05
Association of different p73 (G4C14/A4T14) associated with tumor pathological grade, clinical stage,
polymorphic variants among breast cancer patients with tumor size, lymph node involvements and Her2/neu
clinicopathological features were shown in table (4). expression. Patients with AT allele (GC/AT or AT/AT
Compared with GC/GC genotype, the combined variant genotype) were potentially to be a positive lymph node
p73 GC/AT or AT/AT genotypes was significantly status, advanced tumor stage or recurrence than patients
Journal of Research in Biology (2014) 3(8):1122-1131 1126
Ibrahim et al., 2014
Table (4): Association of p73 (G4C14/A4T14) polymorphism with clinicopathological features of breast cancer
GC/AT+AT/AT® GC/GC®
Test of sig OR ( 95% CI) (lower– upper) No % No %
Tumor pathological grade
II ®
III
24
9
72.7
27.3
44
3
93.6
6.4 FEp= 0.023 *
5.500 (1.359-22.261)
Clinical stage
II ®
III
6
27
18.2
81.8
35
12
74.5
25.5 p <0.001 *
13.125 (4.364-39.473)
Tumor size (cm)
< 5®
≥ 5
4
29
12.1
87.9
36
11
76.6
23.4 FEp <0.001 *
23.727 (6.836-82.361)
Lymph node involvements -ve ®+ve 3 9.1 15 31.9 FEp= 0.028 *
30 90.9 32 68.1 4.688 (1.232-17.829)
Estrogen receptor status
-ve ® 2 6.1 2 4.2 FEp=1.000
+ve 31 93.9 45 95.7 0.689 (0.092-5.155)
Progesterone receptor status
-ve ® 4 12.1 4 8.5 FEp=1.000
+ve 29 87.9 43 91.5 0.674 (0.156-2.915)
Her2/neu expression
-ve ®
+ve
25
8
75.8
24.2
44
3
93.6
6.4 FEp= 0.044 *
4.693 (1.140-19.316)
Vascular invasion
-ve ®
+ve
6
27
18.2
81.8
10
37
21.3
78.7 P= 0.733
1.216 (0.394-3.754)
Metastasis -ve ®
+ve 24
9
72.7
27.3
34
13
72.3
27.7
p = 0.970 0.981 (0.362-2.660)
p: p value for Chi-square test FEp: p value for Fisher Exact test *: Statistically significant at p ≤ 0.05
with the GC/GC genotype. Kaplen Meir Disease Free
Survival (DFS) curve was constructed to study the
prognostic value of p73 (G4C14/A4T14) genotypes.
After a median fallow up period of 25 months (range 18
48 months), 22(27.5%) out of 80 patients had metastasis.
The incidence of metastasis was observed in 27.7% of
patients with GC/GC genotype and 27.3% of patients
carrying AT variant (AT/AT) / (GC/AT) genotypes
table (5). A significant association between the
genotypes and survival was found in the patients
(p <0.001), figure (1). Furthermore, patients carrying AT
variant (AT/AT)/ (GC/AT) genotypes has a favorable
prognosis and longer survival (41.33±1.45 months) than
did patients carrying GC/GC genotype (24.0±1.13
months).
DISCUSSION
p73 protein was considered as one among the
p53 family , the high level of similarity between p53 and
p73 is appeared in the DBD domain which revealed that
p73 can bind and activate p53 target genes , thus induced
cell cycle arrest and apoptosis (Kaghad et al.,1997).
Journal of Research in Biology (2014) 3(8):1122-1131 1127
Ibrahim et al., 2014
Table (5): Association of p73 (G4C14/A4T14) genotypes with breast cancer disease free survival (DFS)
Metastasis N =22
Non Metastasis N = 58
Median (Mean ± SE) DFS (months)
Log rank p
GC/GC (N=47) 13 (27.7) 34 (72.3) 24.0 (24±1.13) 20.557 * <0.001
[(GC/AT)/(AT/AT)](N=33) 9 (27.3%) 24 (72.7) 40.0 (41.33±1.45)
*: Statistically significant at p<0.05
Figure (1): Kaplan-Meier disease free survival for p73 (G4C14/A4T14) genotypes
Because of alternative N- and C- terminal splicing of
transcription, p73 gives a variety of isoforms. Formation
of ∆N-isoform (shorter amino terminus lacking the TA
domain) requires activation of the alternative P2
promoter in exon 3 / intron 3 � (Zaika et al., 2002). The
p73 amino-terminally truncated (∆N) isoform is
commonly called ∆TA-p73 and strongly established as
an oncogene. Therefore it is involved in the oncogenesis
by inhibiting tumor suppressive modulations of p53 and
TA p73 (Zaika et al., 2002).
Numerous studies have proven that p73 protein is
a classic tumor suppressor (Grob et al., 2001; Zaika
et al., 2002; Benard et al., 2003). Surprise investigations
proved that the NH2-terminal truncated isoform of
human p73 (Np73) owning an opposite activities of
TAp73 indicated that Np73 likely has an oncogenic
function (Zaika et al., 2002). It is found that p73 is over-
expressed in many cancer types including breast
carcinoma (Zaika et al., 1999; Cai et al., 2000; Kang
et al., 2000). Dinucleotides polymorphisms have been
found in the p73 gene (designated as G4C14-to-A4T14).
This functional polymorphism lies upstream of the codon
AUG of exon 2, region which might form a stem-loop
like structure and affect translation efficiency (Kaghad
et al.,1997).
The associations of p73 G4C14-to-A4T14
Polymorphism and cancer susceptibility have been
investigated in different molecular epidemiological
studies, and produce conflicting results (Douc-Rasy
et al., 2002; Casciano et al., 2002; De Feo et al., 2009;
Niwa et al., 2004; Li et al., 2004; Pfeifer et al., 2005;
Huang et al., 2003;Li et al., 2006).
Therefore, this study was objective to examine
the association of p73 G4C14→A4T14 polymorphism
with breast cancer susceptibility and survival in 80 breast
cancer Egyptian females with a median follow up of 25
months.
In this study, we noticed that the two genotypes
p73 (GC/AT) and (AT/AT) were more frequently
observed in breast cancer patients whereas p73 GC/GC
Journal of Research in Biology (2014) 3(8):1122-1131 1128
Ibrahim et al., 2014
genotype was significantly higher in controls. However,
insignificance difference in the genotypes distribution
between patients and controls was observed. Also found
that the combined variant genotypes (GC/AT) / (AT/AT)
were more frequent in breast cancer patients [OR 2.418,
p=0.042] than those with GC/GC genotype. These results
indicated possible relationship between p73 G4C14–to–
A4T14 polymorphism and breast cancer in Egyptian
population.
Moreover, we found that the combined variant
genotypes (GC/AT) / (AT/AT) were more frequent in
breast cancer patients [OR 2.418, p=0.042] than those
with GC/GC genotype. These results indicated possible
relationship between p73 G4C14–to–A4 T14
polymorphism and risk of breast cancer.
Many experimental studies showed that
individual carries AT allele is associated with increased
risk of developing breast cancers in Japanese population
(Li et al., 2004), gastric cancer in Caucasians population
(De Feo et al., 2009), colorectal cancer in Korean
population (Pfeifer et al., 2005) and lung cancer in a non
-Hispanic white population (Huang et al., 2003). But few
studies showed no correlations between p73 G4C14-to
A4T14 Polymorphism and cancer risk (Choi et al., 2006;
Hu et al., 2005). Furthermore, very recently, Hu Y et al.,
(2012) conducted a Meta Analysis study and found that
Tp73 polymorphism (GC/AT) is probability associated
with cancer risk in most cancer types and ethnicities (Hu
et al., 2012).
Also we evaluated the association of p73
genotypes with pathological parameters of breast cancer
patients. Compared with GC/GC genotype, the combined
variant genotypes (GC/AT) / (AT/AT) were found to be
associated with increased risk for breast cancer among
women with pathological grade III [OR= 5.500,
p= 0.023], clinical stage III [OR= 13.125, p < 0.001],
tumor size ≥ 5 cm [OR= 23.727, p < 0.001], axillary
lymph node involvement [OR= 4.688, p= 0.028] and the
+ve (Her2/neu) expression [OR= 4.693, p= 0.044]. These
results suggest that AT variant allele has an important
role in breast cancer progression, and may provide the
clinician with additional information regarding patients
carrying AT variant with the risk of recurrence.
Results from the present study showed that
patients with (AT/AT) / (GC/AT) genotypes had a more
favorable disease free survival than those with GC/GC
genotype. Unexpectedly, our results taken together seem
to show that there was a higher risk in developing breast
cancer of females carrying the AT/AT genotype, but
once affected, the patient has a better prognosis. Few
studies have shown that Tp73 polymorphism is a poor
prognostic factor in carcinogenesis (Grob et al., 2001;
Dominguez et al., 2001). Study in relationship between
ΔNp73 expression and prognosis in patient with lung
cancer have concluded that positive expression of ΔNp73
might be a possible marker in predicting poor prognosis
(Uramoto et al., 2004; Casciano et al., 2002). These
funding might be due to the negative effect of p73
polymorphism in translation efficiency; further research
with large number of samples are needed to confirm
these preliminary results.
In summary, we found that p73 exon 2 G4C14-to
-A4T14 polymorphism seem to have a major gene effect
on risk of breast cancer in Egyptian females. p73 GC/
GC genotype were significantly associated with shorter
disease free survival in breast cancer patients . Larger
prospective studies are needed to further confirm our
results.
REFERENCES:
Alex I. Zaika, Neda Slade, Susan H. Erster, Christine
Sansome, Troy W. Joseph, Michael Pearl , Eva
Chalas, and Ute M. Moll. 2002. ΔNp73, A Dominant-
Negative Inhibitor of Wild-type p53 and TAp73, Is Up-
regulated in Human Tumors. JEM. 196(6):765-780.
Alexandria Cancer Registry Annual. Report 2010.
Medical Research Institute, Alexandria University,
Egypt.
Journal of Research in Biology (2014) 3(8):1122-1131 1129
Ibrahim et al., 2014
Barry Trink, Kenji Okami, Li Wu, Virote
Sriuranpong, Jin Jen and David Sidransky. 1998. A
new human p53 homologue. Nature Medicine. 4(7): 747
– 748.
Benard J, Douc-Rasy S and Ahomadegbe JC 2003.
TP53 family members and human cancers Hum Mutat.
21(3):182-191.
Cai YC, Yang GY, Nie Y, Wang LD, Zhao X, Song
YL, Seril DN, Liao J, Xing EP and Yang CS. 2000.
Molecular alterations of p73 in human esophageal
squamous cell carcinomas: loss of heterozygosity occurs
frequently; loss of imprinting and elevation of p73
expression may be related to defective p53
Carcinogenesis. 21(4):683-689.
Casciano I, Mazzocco K, Boni L, Pagnan G, Banelli
B, Allemanni G, Ponzoni M, Tonini GP and Romani
M. 2002. Expression of ΔNp73 is a molecular marker for
adverse outcome in neuroblastoma patients. Cell Death
Differ., 9(3):246-51.
Choi JE, Kang HG, Chae MH, Kim EJ, Lee WK, Cha
SI, Kim CH, Jung TH and Park JY. 2006. No
association between p73 G4C14-to-A4T14
polymorphism and the risk of lung cancer in a Korean
population. Biochemical genetics 4444(11-12): 533-540.
Coral O and Amy T. 2010. The Differences between
Male and Female Breast Cancer In Principles of gender-
specific medicine (2th ed.). Marianne J L (eds). Elsevier
Inc (pub), 42(7): 459-472.
De Feo E, Persiani R, La Greca A, Amore R,
Arzani D, Rausei S, D'Ugo D, Magistrelli P, van
Duijn CM, Ricciardi G and Boccia S. 2009. A case-
control study on the effect of p53 and p73 gene
polymorphisms on gastric cancer risk and progression.
Mutat Res., 675(1-2):60-5.
Dominguez G, Silva JM, Silva J, Garcia JM, Sanchez
A, Navarro A, Gallego I, Provencio M, España P and
Bonilla F. 2001. Wild type p73 overexpression and high-
grade malignancy in breast cancer. Breast Cancer Res
Treat. 66 (3):183-90.
Douc-Rasy S, Barrois M, Echeynne M, Kaghad M,
Blanc E, Raguenez G, Goldschneider D, Terrier-
Lacombe MJ, Hartmann O, Moll U, Caput D and
Bénard J. 2002. ΔN-p73 α accumulates in human
neuroblastic tumors. Am J Pathol., 160(2):631-9.
Grob TJ, Novak U, Maisse C, Barcaroli D, Luthi AU,
Pirnia F, Hugli B, Graber HU, De Laurenzi V, Fey
MF, Melino G and Tobler A. 2001. Human ΔNp73
regulates a dominant negative feedback loop for TAp73
and p53 Cell Death Differ., 8(12):1213-1223.
Hamajima N, Saito T, Matsuo K, Kozaki K I,
Takahashi T and Tajima K. 2000. Polymerase Chain
Reaction with Confronting two-pair Primers for
Polymorphism Genotyping. Jpn J Cancer Res., 91(9):
865–868.
Hu Y, Jiang L, Zheng J, You Y, Zhou Y and Jiao S.
2012. Association between the p73 exon 2 G4C14-to
A4T14 polymorphism and cancer risk: a meta-analysis.
DNA Cell Biol., 31(2):230-7.
Hu Z, Miao X, Ma H, Tan W, Wang X, Lu D, Wei Q,
Lin D and Shen H. 2005. Dinucleotide polymorphism
of p73 gene is associated with a reduced risk of lung
cancer in a Chinese population. International journal of
cancer. 114(3):455-460.
Huang XE, Hamajima N, Katsuda N, Matsuo K,
Hirose K, Mizutani M, Iwata H, Miura S, Xiang J,
Tokudome S and Tajima K. 2003. Association of p53
codon Arg72Pro and p73 G4C14-to-A4T14 at exon 2
genetic polymorphisms with the risk of Japanese breast
cancer. Breast Cancer. 10(4):307-311.
Ishimoto O, Kawahara C, Enjo K, Obinata M,
Nukiwa T and Ikawa S. 2002. Possible oncogenic
potential of ΔNp73: a newly identified isoform of human
p73 Cancer Res., 62(3):636-641.
Jost CA, Marin MC and Kaelin WG Jr. 1997. p73 is a
human p53-related protein that can induce apoptosis.
Nature; 389(6647): 191-194.
Kaghad M, Bonnet H, Yang A, Creancier L, Biscan
JC, Valent A, Minty A, Chalon P, Lelias JM, Dumont
X, Ferrara P, McKeon F and Caput D. 1997.
Monoallelically expressed gene related to p53 at 1p36, a
region frequently deleted in neuroblastoma and other
human cancers. Cell; 90(4): 809- 819.
Kang MJ, Park BJ, Byun DS, Park JI, Kim HJ, Park
JH and Chi SG. 2000. Loss of imprinting and elevated
Journal of Research in Biology (2014) 3(8):1122-1131 1130
Ibrahim et al., 2014
expression of wild-type p73 in human gastric
adenocarcinoma. Clin Cancer Res., 6(5):1767-71.
Li G, Wang LE, Chamberlain RM, Amos CI, Spitz
MR and Wei Q. 2004. p73 G4C14-to-A4T14
polymorphism and risk of lung cancer. Cancer Res., 64
(19): 6863–6.
Li H, Yao L, Ouyang T, Li J, Wang T, Fan Z, Fan T,
Dong B, Lin B, Li j and Yuntao Xie. 2006. Association
of p73 G4C14-to-A4T14 (GC/AT) Polymorphism with
Breast Cancer Survival, Carcinogenesis. 28(2):372 - 377.
Lyla MH and Dan GB. 2006. Genes, Behavior, and the
Social Environment. National Academy of Sciences
USA (pub) 44-8.
Melino G, De Laurenzi Vand Vousden KH. 2002. p73:
friend or foe in tumorigenesis. Nat Rev Cancer. 2 (8):605
–615.
Niwa Y, Hamajima N, Atsuta Y, Yamamoto K,
Tamakoshi A, Saito T, Hirose K, Nakanishi T,
Nawa A, Kuzuya K and Tajima K. 2004. Genetic
polymorphisms of p73 G4C14-to-A4T14 at exon 2 and
p53 Arg72Pro and the risk of cervical cancer in
Japanese. Cancer Lett., 205(1):55-60.
Perera FP and Weinstein IB. 2000. Molecular
epidemiology: recent advances and future directions.
Carcinogenesis. 21(3):517-24.
Pfeifer D, Arbman G and Sun XF. 2005.
Polymorphism of the p73 gene in relation to colorectal
cancer risk and survival. Carcinogenesis. 26 (1): 103–7.
Schultz J, Ponting CP, Hofmann K and Bork P. 1997.
SAM as a protein interaction domain involved in
developmental regulation Protein Sci., 6 (1): 249-53.
Stiewe T and Putzer BM. 2002. Role of p73 in
malignancy: tumor suppressor or oncogene?. Cell death
and differentiation. 9(3):237-45.
Stiewe T, Zimmermann S, Frilling A, Esche H and
Putzer BM. 2002. Transactivation-deficient ΔTA-p73
acts as an oncogene. Cancer Res., 62(13): 3598–3602.
Tamakoshi A, Hamajima N, Kawase H, Wakai K,
Katsuda N, Saito T, Ito H, Hirose K, Takezaki T and
Tajima K. 2003. Duplex polymerase chain reaction with
confronting two-pair primers (PCR-CTPP) for
genotyping alcohol dehydrogenase β subunit (ADH2)
and aldehyde dehydrogenase 2 (ALDH2). Alcohol 38
(5):407-10.
Thanos CD and Bowie JU. 1999. p53 Family members
p63 and p73 are SAM domain-containing proteins.
Protein Sci., 8(8):1708-10.
Uramoto H, Sugio K, Oyama T, Nakata S, Ono K,
Morita M, Funa K and Yasumoto K. 2004. Expression
of ΔNp73 predicts poor prognosis in lung cancer. Clin
Cancer Res., 10(20):6905-11.
Yang A, Walker N, Bronson R, Kaghad M,
Oosterwegel M, Bonnin J, Vagner C, Bonnet H,
Dikkes P, Sharpe A, McKeon F and Caput D. 2000.
p73- deficient mice have neurological, pheromonal and
inflammatory defects but lack spontaneous tumours
Nature. 404(6773): 99-103.
Zaika AI, Kovalev S, Marchenko ND and Moll
UM.1999. Overexpression of the wild type p73 gene in
breast cancer tissues and cell lines Cancer Res., 59
(13):3257-3263.
Zaika AI, Slade N, Erster SH, Sansome C, Joseph
TW, Pearl M, Chalas E and Moll UM. 2002.
DeltaNp73, a dominant-negative inhibitor of wild-type
p53 and TAp73, is up-regulated in human tumors. J Exp
Med., 16; 196(6):765-80.
Submit your articles online at www.jresearchbiology.com
Advantages
• EEEEaaaassssyyyy oooonnnnlllliiiinnnneeee ssssuuuubbbbmmmmiiiissssssssiiiioooonnnn
• CCCCoooommmmpppplllleeeetttteeee PPPPeeeeeeeerrrr rrrreeeevvvviiiieeeewwww
• AAAAffffffffoooorrrrddddaaaabbbblllleeee CCCChhhhaaaarrrrggggeeeessss
QQQQuuuuiiiicccckkkk pppprrrroooocccceeeessssssssiiiinnnngggg•
EEEExxxxtttteeeennnnssssiiiivvvveeee iiiinnnnddddeeeexxxxiiiinnnngggg•
• YYYYoooouuuu rrrreeeettttaaaaiiiinnnn yyyyoooouuuurrrr ccccooooppppyyyyrrrriiiigggghhhhtttt
www.jresearchbiology.com/Submit.php.
1131 Journal of Research in Biology (2014) 3(8):1122-1131
Article Citation:
El-Mohsnawy Eithar. Efficient methods for fast, producible, C-Phycocyanin from Thermosynechococcus elongates.
Journal of Research in Biology (2014) 3(8): 1132-1146
Journal of Research in Bio
logy
Efficient methods for fast, producible, C-Phycocyanin from
Thermosynechococcus elongatus
Keywords:
A620/A280 value, C-PC purification, C-Phycocyanin, Cyanobacteria, Fluorescence
Spectra, IEC, Phycobilines, Sucrose Gradient, Thermosynechococcus elongatus.
ABSTRACT:
This article describes different protocols that enhance the extraction, isolation
and purification of phycocyanin from the cyanobacterium, Thermosynechococcus
elongatus as well as absorbance and fluorescence spectral characterization. A combination
of enzymatic degradation by Lysozyme followed by high pressure showed a mild cell wall
destruction except for the composition of thylakoid membrane compared with glass beads.
The use of ammonium sulfate precipitation as the first purification step exhibited high
efficiency in removing most of the protein contamination. The best purified phycocyanin
was obtained after using the second purification step that could be ion exchange
chromatography or sucrose gradient. Unexpected results that were not used earlier were
obtained by sucrose gradient, where a large amount of highly pure phycocyanin was
assembled compared with published methods. An evaluation of C-phycocyanin throughout
the series steps of isolation and purification was achieved by using absorbance and 77K
fluorescence spectral analysis. Besides a spectroscopical evaluation, SDS-PAGE,
productivity, and A620/A280 values pointed to the purity and structural preservation of a
purified complex. Compared with published methods, the existing method not only
reduces purification time but also enhances the productivity of phycocyanin in its native
structure.
The optimization of each purification step presented different purified
phycocyanin levels; hence, it could be used not only by microbiologists but also by other
researchers such as physicians and industrial applicants. In addition, this method could be
used as a model for all cyanobacterial species and could be also used for Rhodophytes with
some modifications.
1132-1146 | JRB | 2014 | Vol 3 | No 8
This article is governed by the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which gives permission for unrestricted use, non-commercial, distribution and reproduction in all medium, provided the original work is properly cited.
www.jresearchbiology.com Journal of Research in Biology
An International
Scientific Research Journal
Authors:
El-Mohsnawy Eithar.
Institution: Botany Department, Faculty
of Science, Damanhour
University, 22713, Egypt.
Corresponding author: El-Mohsnawy Eithar.
Web Address: http://jresearchbiology.com/documents/RA0419.pdf.
Dates:
Received: 24 Jan 2014 Accepted: 05 Feb 2014 Published: 10 Feb 2014
Journal of Research in BiologyJournal of Research in BiologyJournal of Research in BiologyJournal of Research in Biology An International Scientific Research Journal
Original Research
Abbreviations
A620/A280: Absorbance at 620 and 280 nm; Amm Sulf. ppt: Ammonium sulfate
precipitate; APC: Allophycocyanin; MCF-7: Michigan Cancer Founda,on-7, referring to the
ins;tute in Detroit where the cell line was established in 1973; OD: Op;cal density.,
PBP: Phycobilliprotein; PC (C-PC): Phycocyanin (phycocyanin from cyanobacteria);
T. elongatus: Thermosynechococcus elongates; IEC: Ion exchange column.
INTRODUCTION
Blue green are one of oldest prokaryotic fossils
(Schopf 2000) that have been known on the earth for
more than 3.5 billion years. The traditional name ‘blue-
green algae’ for Cyanophyceae is due to the presence of
phycocyanin, allophycocyanin, and phycoerythrin, which
mask the chlorophyll pigmentation. Most cyanobacteria
are found in fresh water, whereas others are found in
marines, in damp soil, or even in temporarily moistened
rocks in deserts as well as in hot springs such as
Thermosynechococcus elongatus. T. elongatus is
considered a thermophilic obligate photoautotrophic
organism that contains chlorophyll a, carotenoids, and
phycobilins. For this reason, it has usually been used as a
model organism for the study of photosynthesis; such as,
X-ray structure of PSI and PSII (Sonoike and Katoh
1989; Zouni et al., 2001; Jordan et al., 2001; and Katoh
et al., 2001).
In addition, Thermosynechococcus elongatus has
been postulated as the model organism of choice for
structural studies. X-ray of photosystem I are studied by
Jordan et al., 2001 and photosystem II are studied by
Ferreira et al., 2004 and Loll et al., 2005. A crystal
structure of the cytochrome b6f complex has been
determined from another thermophilic cyanobacterium,
Mastigocladus laminosus (Kurisu et al., 2003).
T h e t h y l a k o i d m e m b r a n e o f
Thermosynechococcus elongatus attached to external
light-harvesting structure known as the phycobilisome
(PBS; reviewed by Adir 2005), which acts as a light-
harvesting system for PSII and, to some extent, for PSI
(Rögner et al., 1996). The Synechococcus elongatus
phycobilisome consists of allophycocyanin (APC) and
C-phycocyanin (C-PC), along with the linker proteins
(Adir, 2005). The bilin pigments are open-chained
tetrapyrroles that are covalently bound to seven or more
proteins. These chromophores are composed of the
cyclic iron (heme) tetrapyrrole (Frankenberg and
Lagarias 2003; Frankenberg et al., 2003).
One function of PC is energy absorbance which
is transferred by non-radiative transfer into APC and
consequently into chlorophyll a, with an efficiency
approaching 100%. In the absence or blocked the
photosynthetic reaction center (RC), the PBPs are
strongly fluorescent.
C-phycocyanin is composed of two subunits: the
α-chain with one phycocyanobilin and the β-chain with
two phycocyanobilins (Troxler et al., 1981; Stec et al.,
1999; Adir et al., 2001; Contreras-Martel et al., 2007). In
between, there are large amino-acid sequence
similarities. The αβ subunits aggregate into α3 β3 trimers
and further into disc-shaped α6 β6 hexamers, the
functional unit of C-PC (Stec et al., 1999; Adir et al.,
2001; Contreras-Martel et al., 2007).
Nowadays, Phycocyanin receives a lot of
attention due to its potential in medical and
pharmaceutical treatments as well as in food industries.
Its antioxidant protection of DNA has been demonstrated
by (Pleonsil and Suwanwong, 2013). It also promotes
PC12 cell survival, modulates immune and inflammatory
genes and oxidative stress markers in acute cerebral
hypoperfusion in rats (Marín-Prida et al., 2013), prevents
hypertension and low serum adiponectin level in a rat
model of metabolic syndrome (Ichimura et al., 2013),
exhibits an antioxidant and in vitro antiproliferative
activity (Thangam et al., 2013), and involves an
apoptotic mechanism of MCF-7 breast cells either in vivo
or in vitro induced by photodynamic therapy with
C-phycocyanin (Li et al., 2010).
For these reasons, a lot of attention is directed
toward improving the purification of phycocyanin from
several cyanobacterial organisms. The purification of
C-phycocyanin from Spirulina platensis has been
reported by Bhaskar et al., (2005); from Anacystis
nidulans (Gupta and. Sainis 2010); and in aqueous
phytoplankton by Lawrenz et al., 2011.
Although all these represented evaluations were
based on the ratio of A620/A280, which is suggested by
El-Mohsnawy Eithar, 2014
1133 Journal of Research in Biology (2014) 3(8): 1132-1146
Bryant et al., (1979) and Boussiba and Richmond (1979),
this ratio does not save an optimum image of the
presence of other impurities such as APC with
C-phycocyanin, where the existence of APC does not
strongly disturb this ratio. Purity ratios varied among
publications: 4.3 (Minkova et al., 2003), 3.64 (Niu et al.,
2007), 4.05 (Patil and Raghavarao 2007), 4.72 (Gupta
and Sainis 2010), and more than four (Pleonsil and
Suwanwong 2013).
This article displays the simple, fast, and
effective protocol by which large scales of PC were
purified.
MATERIAL AND METHODS
Culturing and assembly of T. elongatus
Thermosynechococcus elongatus cells were
cultivated in BG-11 medium at 50 °C with a stream of
5% (v/v) CO2 in air (according to Rippka et al., 1979).
Cells were grown in Polyamide flasks (2.5-L). 200-ml
preculture cells were used for an inoculation of 2 L
culture. The used white light was provided at about 100
µE*m-2*s-1. After incubation period, the cells were
harvested in the exponential growth phase. The optical
density at 750 nm was 2.5 - 3.
Cells were sedimented by centrifugation at 2000
g for 15 minutes (GSA-Rotor, Sorvall). The supernatant
was removed. Cells in the pellet were washed once with
MES buffer (20mM MES, 10 mM Magnesium chloride,
and 10 mM Calcium Chloride) and then re-centrifuged at
the same speed and conditions.
Extraction of phycocyanin
The extraction of phycocyanin crude extract was
performed in two steps. The first step was cell wall
destruction, and the second step was isolation of
phycocyanin from the thylakoid membrane. Two
destruction techniques were applied. In both techniques,
collected T. elongatus cells were suspended in 100 ml of
MES containing Lysozyme buffer at pH 6.5 (20mM
MES, 10 mM Magnesium chloride, and 10 mM Calcium
Chloride and 0.2 % (w/v) Lysozyme). Stirring was
applied at 37 °C for 30 minutes in the dark condition. In
the first protocol, the cell wall was disrupted by applying
2000 psi pressure using Parr bomb at at 4°C for 20
minutes (El-Mohsnawy et al., 2010). However, in the
second protocol was done according to Kubota et al.,
2010, where T. elongatus cells were mixed with an equal
volume of glass beads (0.5 mm of Glass Beads, Soda
Lime, BioSpec Products), and then, the cells were
exposed to 18 disrupted cell cycles (10s ec glass beads
break and 2min 50sec pause) on a vortex mixer (BSP
Bead-Beater 1107900, BioSpec Products).
Phycocyanin crude extract was collected by
suspending the thylakoid membrane with HEPES buffer
at pH 7.5 (20mM HEPES, 10mM MgCl2, 10 mMCaCl2,
and 0.4 M mannitol) or with HEPES buffer at pH 7.5
containing 0.03% ß-DM and centrifugation at 3000 g at 4
°C for 10 min. The supernatant was collected, and pellets
were exposed to an additional extraction step using the
same buffer and centrifugation conditions. By using
glass bead disruption, an additional isolation step was not
required.
Purification steps
First purification step:
This step was preceded using two sequences of
ammonium sulfate precipitation steps. Ammonium
sulfate salts were added to the crude extract in HEPES
buffer till it reached 20 %, was stirred at 4°C for 30
minutes followed by centrifugation of 6000 g at 4 °C for
15 min (Beckman -JA-14 Rotor). The pellets were
discarded. Additional ammonium sulfate salts were
added to the supernatant till they reached 50 % saturation
and were stirred at 4°C for 60 minutes. Centrifugation of
12000 g at 4 °C for 30 min (Beckman -JA-14 Rotor) was
used to sediment partial purified phycocyanin
(El-Mohsnawy, 2013).
Second purification step:
Pellets were dissolved in HEPES buffer at pH 7.5
(20mM HEPES, 10mM MgCl2, 6mM CaCl2, and 0.4 M
Journal of Research in Biology (2014) 3(8): 1132-1146 1134
El-Mohsnawy Eithar, 2014
against HEPES buffer at pH 7.5 (20mM HEPES, 10mM
MgCl2, 10mMCaCl2, and 0.4 M mannitol) for 6 hours
before loading to IEC (POROS HQ/M).
Sucrose gradient
Sucrose gradient was prepared by dissolving
20 % (w/v) sucrose in HEPES buffer at pH 7.5 (20mM
HEPES, 10mM MgCl2, and 10 mMCaCl2). 12 ml of
sucrose solution was poured into each centrifuge tube
(SW40-Rotor ultracentrifuge, Beckman) followed by
freezing and slowly thawing overnight at 10°C. 100 µl of
OD620 nm 6 suspensions were slowly dropped onto the
top of sucrose gradients. After centrifugation at 36000
rpm for about 12 hours at 4°C (SW40-Rotor
ultracentrifuge, Beckman), two identical bands were
detected. The lower band (phycocyanin) was collected
for further investigation.
Ion Exchange Chromatography (IEC)
POROS HQ/M column was used as IEC for the
second purification step. The column was equilibrated by
8 CV of IEC equilibration buffer (20 mM MES, pH 6.5,
10mM MgCl2, and 10 mMCaCl2) before loading the
phycocyanin suspension. After loading the samples,
washing occurred for 5 CV. The gradient from 0 to 200
mM MgSO4 with a step at 35 mM that was carried out
for the elution of purified C-phycocyanin complex.
Purified phycocyanin was eluted at 23 mM MgSO4.
Purified phycocyanin was concentrated by centrifugation
at 3000 r/min for 40 min at 4°C using an Amicon 10,000
Dalton weight cut-off.
SDS-polyacrylamide gel electrophoresis (SDS-PAGE)
SDS-PAGE was performed according to
Schägger and Von Jagow (1987). Briefly, 6 µl of
phycocyanin (OD620 nm 3) was mixed with sample
buffer. Then, the mixture was injected into SDS-PAGE
(12% Acrylamide). The electrophoresis was carried out
by applying a current of 100 mA for 30 min, and then,
the current was reduced to 60 mA until the samples
reached the edge of the gel. After electrophoresis, SDS-
PAGE was fixed by incubation in a mixture of 50 %
methanol and 10% acetic acid for 20 min. The gel was
stained with Coomassie Brilliant Blue reagent (0.2% (w/
v), Coomassie Brilliant Blue R, 40% (v/v) methanol, and
7 % (v/v) acetic acid) for an additional 20 min. The gel
was destained by immersing the gel in a mixture of 30 %
(v/v) methanol and 10 % (v/v) acetic acid for 8–12 hours.
Absorption spectral analysis
1 ml of crude or purified phycocyanin complexes
was diluted in buffer (20 mM HEPES, pH 7.5, 10 mM
MgCl2, 10 mM CaCl2, and 0.5 M mannitol) till it
reached a maximum OD620 nm of 0.2–0.8 before
measuring the absorption spectra from 250 to 750 nm.
While thylakoid pellets were diluted to OD680 nm of 1.2-
2. Two spectrophotometers are used according to the
purpose of measurements. For fast evaluation of the
efficiency of each purification step, 2 µl of sample was
used (NanoDrop ND-1000 Spectrophotometer). 500 µl
samples were used in case of Shimadzu UV-2450 or
Beckman Du7400. Phycocyanin concentration was
estimated according to an equation suggested by Bennett
and Bogorad 1973; Bryant et al. 1979:
PC (mg.ml) = {A620 – (0.7*A650)}/ 7.38
Fluorescence emission spectra at 77 K
Fluorescence emission spectra were performed in
an SLM-AMINCO Bauman, Series 2 Luminescence
spectrometer (Schlodder et al., 2007). Phycocyanin
complex was diluted to OD620 nm 0.05 buffer containing
20 mM HEPES, pH 7.5, 10 mM MgCl2, 10 mM CaCl2,
and 60 % glycerol. The diluted sample was frozen to 77
K by gradual immersion in liquid nitrogen. 580 nm of
actinic light was used for excitation. Fluorescence
emission spectra were monitored in the range from 600
to 800 nm with a step size of 1 nm and a bandpass filter
of 4 nm.
RESULTS:
The purification of phycocyanin from
T. elongatus cells was achieved via several steps, so the
optimization of each step was required to enhance the
1135 Journal of Research in Biology (2014) 3(8): 1132-1146
El-Mohsnawy Eithar, 2014
mannitol) till they reached six at OD620nm. The
suspension was divided into two parts. The first part was
fractionated using 20% sucrose gradient, and the second
part was dialysis against HEPES buffer at pH 7.5 (20mM
HEPES, 10mM MgCl2, 10mMCaCl2, and 0.4 M
mannitol) for 6 hours before loading to IEC (POROS
HQ/M).
Sucrose gradient
20 g of sucrose was dissolved in 100 ml HEPES
buffer at pH 7.5 (20mM HEPES, 10mM MgCl2, and 10
mMCaCl2). 12 ml of sucrose solution was poured into
each centrifuge tube (SW40-Rotor ultracentrifuge,
Beckman) followed by freezing and slowly thawing
overnight at 10 °C. 100µl phycocyanin partially purified
extract of OD620 nm six was slowly dropped onto the top
of sucrose gradients. Centrifugation took place at 36k
rpm for about 12 hours at 4°C (SW40-Rotor
ultracentrifuge, Beckman); two identical bands were
observed. The lower band was found to be C-
phycocyanin (El-Mohsnawy, 2013).
Ion Exchange Chromatography (IEC)
POROS HQ/M column was used as the second
purification step. The column was equilibrated by 8 CV
of IEC equilibration buffer (20 mM MES, pH 6.5, 10mM
MgCl2, and 10 mMCaCl2) before loading the
phycocyanin partially purified extract. Samples were
loaded in the flow rate of 1 ml/min and then washing was
occurred for 5 CV. The magnesium sulfate gradient (0 to
200 mM) with a step at 35 mM was used for the elution
of purified C-phycocyanin complex. Purified
phycocyanin was eluted at 23 mM MgSO4. Amicon
10,000 Dalton weight cut-off tube was used for
concentrating the purified complex at 3000 r/min for 40
min at 4°C.
SDS-polyacrylamide gel electrophoresis (SDS-PAGE)
SDS-PAGE was performed according to
Schägger and Von Jagow (1987). Briefly, 6 µl of purified
phycocyanin (OD620 nm 3) was mixed with sample buffer.
Then, the mixture was injected into SDS-PAGE (12%
Acrylamide). Starting current was 100 mA for 30 min,
and then, reduced to 60 mA until the samples reached the
edge of the gel. After electrophoresis, a mixture of 50 %
methanol and 10 % acetic acid was used to fix SDS-
PAGE for 20 min. The gel was stained with Coomassie
Brilliant Blue reagent (0.2 % (w/v), Coomassie Brilliant
Blue R, 40 % (v/v) methanol, and 7 % (v/v) acetic acid)
for an additional 20 min. The gel was destained by
immersing the gel in a mixture of 30 % (v/v) methanol
and 10 % (v/v) acetic acid for 8–12 hours.
Absorption spectra
Crude or purified phycocyanin complex was
diluted in the buffer (20 mM HEPES, pH 7.5, 10 mM
MgCl2, 10 mM CaCl2, and 0.5 M mannitol) till it reaches
a maximum OD620 nm of 0.2–0.8. Then, the absorption
El-Mohsnawy Eithar, 2014
Journal of Research in Biology (2014) 3(8): 1132-1146 1136
Step A620/A280 ratio Productivity % Estimation Time
Crude HEPES 1.02909 ± 0.08229 100 30.0 min.
Crude ß-DM 0.26732 ± 0.05131 100 30.0 min.
Crude Beads 1.09185 ± 0.07352 100 30.0 min.
After Amm Sulf. ppt 3.49497 ± 0.11303 92 2.0 hours
After IEC 4.51656 ± 0.03006 76 7.5 hours
Step A620/A280 ratio Productivity % Estimation Time
After concentration 2.59960 ± 0.24710 93 30.0 min.
After Sucrose gradient 4.40767 ± 0.03941 85 8.0 hours
Table 1 b:
Table 1 a: Summary of purity of phycocyanin (expressed as A620/A280 ratio), productivity (expressed as percent to crude extracts), and required periods for each step.
spectra were measured in the range of 250 to 750 nm.
While thylakoid pellets were diluted to OD680 nm of 1.2-2.
Two different spectrophotometer apparatus were used
according to the purpose of measurements. For fast
evaluation of the efficiency of each purification step, 2 µl
of sample was used (NanoDrop ND-1000
Spectrophotometer). 500 µl samples were used in case of
Shimadzu UV-2450 or Beckman Du7400. Phycocyanin
concentration was estimated according to an equation
suggested by Bennett and Bogorad 1973; Bryant et al.,
1979:
PC (mg.ml) = {A620 – (0.7*A650)}/ 7.38
77 K Fluorescence emission spectra
Fluorescence emission spectra at 77K were
measured and investigated in an SLM-AMINCO
Bauman, Series 2 Luminescence spectrometer according
to Schlodder et al., 2007. Phycocyanin was diluted to
0.05 at optical density of 620 nm using buffer containing
El-Mohsnawy Eithar, 2014
1137 Journal of Research in Biology (2014) 3(8): 1132-1146
PC
Pu
rifi
cati
on
C
ell
Des
tru
ctio
n
Figure 1: Scheme shows different isolation and purification steps for phycocyanin purification. During the first purification step, two series of ammonium sulfate
precipitation were applied.
20 mM HEPES, pH 7.5, 10 mM MgCl2, 10 mM CaCl2
and 60 % glycerol. Sample was frozen to 77 K by
gradual immersion in liquid nitrogen. The used actinic
light was 580 nm. Fluorescence emission spectra were
observed in the range from 600 to 800 nm.
RESULTS:
The purification of phycocyanin from
T. elongatus cells was achieved via several steps, so the
optimization of each step was required to enhance the
productivity as well as the purity of phycocyanin. The
scheme shown in Figure 1 illustrates the summary steps
of extraction and purification of phycocyanin.
Cell destruction and extraction of crude extract.
Two different techniques have been used for cell
destruction: combination of 0.2 % Lysozyme with
pressure (2000 psi) or combination of 0.2 % Lysozyme
with glass-beads vortex. 0.2 % Lysozyme with pressure
(2000 psi) exhibited mild destruction of the cell wall
while keeping the thylakoid membrane in its native
structure, even the attached phycobilisomes. After cell
destruction, the crude extract was isolated using HEPES
(pH 7.5) buffer or HEPES (pH 7.5) containing 0.03 % ß-
DM. Both crude extracts exhibited different
spectroscopical behavior. On the other hand, glass beads
destroyed the cell wall and thylakoid membrane, so
centrifugation led to sedimentation of the largest
photosynthetic complexes. Figure 2a, b shows the
absorbance comparison between Lysozyme + HEPES,
Lysozyme + HEPES containing 0.03 % ß-DM, and
extraction by glass beads. It is obvious that the use of
glass-bead destruction yielded a large amount of
allophycocyanin which has a maximum absorbance at
650 nm, in addition to small peaks at 680 nm for PSI and
673 nm for PSII that also have a maximum absorbance
of nearly 440 nm. The absorption spectrum at 650 nm
proves the contamination of C-phycocyanin by a large
amount of allophycocyanin, whereas the absorbance at
280 nm proves the presence of an additional large
amount of non-colored proteins. Extraction by HEPES
buffer showed a small shoulder at 650 nm, compared
with the same buffer containing ß-DM. A remarkable
peak at 440 nm and small shoulders were observed at
650 nm and 680 nm in case of HEPES buffer containing
ß-DM, which confirmed the contamination with PS (I
and II) complexes. It should be pointed out that the high
absorbance value of HEPES buffer containing ß-DM
compared with other treatments may reflect the ability of
ß-DM to dissolve large amounts of protein which do not
have absorption spectra in visible regions. However, high
contamination of crude extract by allophycocyanin in
case of using glass beads did not exhibit a big difference
in A620/A680 value (Table 1) compared with HEPES
extraction.
This is regarding the close of absorption spectra
between allophycocyanin and phycocyanin (650 and 619
Journal of Research in Biology (2014) 3(8): 1132-1146 1138
El-Mohsnawy Eithar, 2014
0
0.2
0.4
0.6
0.8
1
1.2
450 500 550 600 650 700
Waveleng th (nm)
Ab
so
rba
nc
e (
RU
)
HEPES extraction
ß-DM extraction
Beads extraction
Amm Sulf sediment
B
0
0.2
0.4
0.6
0.8
1
1.2
250 350 450 550 650 750
Wavele ng th (nm)
Ab
so
rba
nc
e (
RU
)HEPES extraction
ß-DM extraction
Beads extraction
Amm Sulf sediment
A
Figure 2 a: Absorption spectra of crude extracts by different conditions and after ammonium sulfate precipitation. 500 µl samples were measured by Shimadzu UV-2450 spectrophotometer. Absorption
spectra 250-750 (A), absorbance 550-700 (B)
nm, respectively). It could be concluded that the
extraction with HEPES buffer was the best kind of
extraction. Re-dissolving the thylakoid membrane in
HEPES buffer not only enhanced the extraction of
phycocyanin but also increased the amount of
allophycocyanin. Absorption spectra of thylakoid
membrane pellets exhibited no significant differences
between phycocyanin extracted by HEPES buffer and
that extracted by HEPES buffer containing ß-DM,
whereas a remarkable reduction was observed in the
absorbance at 440 nm and 680 nm in case of extraction
by HEPES buffer only (Figure 3a). These results are
supported by 77K fluorescence spectra (Figure 3b),
where a high peak was observed at 647 nm for both
isolation steps; whereas higher peaks were detected at
664 nm, 686 nm, and 733 nm for PSI. These spectra
point to the presence of more allophycocyanin, PSII, and
PSI in case of isolation by buffer containing ß-DM.
Purification
Ammonium sulfate precipitation
Phycocyanin crude extract containing other
impurities (allophycocyanin, photosystem complexes,
and other soluble proteins) was exposed to two series of
ammonium sulfate precipitation. In the first step (20%
ammonium sulfate), large hydrophobic proteins were
sedimented; whereas after the second step, phycocyanin
was precipitated. A remarkable reduction in the
absorbance at 650 nm, 440 nm, and 280 nm (Figure 2a b)
was observed, which proves the high efficiency of these
two steps to remove most of the dissolved and large
hydrophobic contaminated proteins. These results were
supported by A620/A280 value (3.494 ± 0.113) as shown in
Table 1. This value is considered quite high, indicating
the purity of phycocyanin.
Although the absorption spectra and A620/A280
value pointed to pure phycocyanin, the emission
fluorescence spectra showed the presence of some
contamination (Figure 3b), where fluorescence emission
spectra at 664 nm and 686 nm were detected apart from
647 nm, which indicates the presence of a few
contaminations of allophycocyanin in phycocyanin crude
extracts.
Second purification steps.
Since purification by ammonium sulfate
precipitation did not reach an optimum A620/A280 value,
C-phycocyanin extract needs an additional purification
step. A chromatographic step has been applied to reach
an optimum value.
Purification by IEC
After 50% ammonium sulfate precipitation, the
pellet was dissolved in HEPES buffer followed by
dialysis against HEPES buffer for 8 hours. Changing of
dialysis buffer was done after 2 hours. POROS HQ/M
column was equilibrated with HEPES buffer before
El-Mohsnawy Eithar, 2014
1139 Journal of Research in Biology (2014) 3(8): 1132-1146
0
0.5
1
1.5
2
2.5
3
250 350 450 550 650 750
Thylak oid membrane
P ellets after ß-DM ex trac tion
P ellets without ß-DM extrac tion
Wav eleng th nm
Ab
so
rban
ce R
U
Figure 3 a: Absorption spectra of pellets after different extraction conditions. Pellets were suspended in HEPES 7.5 buffer till they reached an OD680 of 1.5−2. 500-µl samples were measured by a Shimadzu UV-2450 spectrophotometer.
Figure 3 b: 77K fluorescence emission spectra of
different extraction conditions compared with
ammonium sulfate precipitation. Samples were
diluted with HEPES 7.5 buffer containing 60 %
glycerol to OD620 = 0.05. The applied actinic light was
580 nm.
loading partial purified phycocyanin. Figure 4 shows the
elution gradient of MgSO4 (0-150 mM) with a step at 35
mM that was used to elute highly purified phycocyanin.
Pure phycocyanin was eluted at 35 mM of magnesium
sulfate. Phycocyanin complex was desalted and
concentrated to OD619 = 3. Quite a high A620/A280 value
(4.516 ± 0.03) was obtained.
Purification by sucrose density gradient
Although the chromatographic purification
presented a highly purified and large yield of C-
phycocyanin, sucrose gradient was found to be a fast and
effective step for the same purpose. Sucrose gradient was
prepared as described in the “Materials and Methods”
section. A highly contaminated crude extract-derived
glass-bead extraction step was concentrated using a
10,000 Amicon tube before being dropped directly onto
the top surface of the sucrose gradient tube. After
centrifugation, two distinct bands were observed. The
lower one was C-phycocyanin, and the upper one was
allophycocyanin (Figure 5). The phycocyanin band was
collected, washed by HEPES buffer, and concentrated to
OD619 = 3 before storing it.
Phycocyanin evaluation of both methods
Evaluation of the purification of C-phycocyanin
did not stop at the level of A620/A280 values and total
yield, whereas it extended to be investigated
spectroscopically and by SDS-gel PAGE. Room
temperature absorption spectra of C-phycocyanin
purified by IEC and sucrose gradient exhibited almost
the same behavior, where only one peak was detected at
a maximum absorbance of 619 nm; whereas a reduction
in the absorbance at 355 nm and 280 nm was observed.
Moreover, the small shoulder at 650 nm disappeared.
77K emission fluorescence spectral
investigations of phycocyanin purified by IEC or
fractionated by sucrose gradient exhibited only one peak
at 647 nm; whereas shoulders at 664 nm and 686 nm
disappeared (Figure 6b). These results supported
absorbance results and indicated the purity of the
complex. With regard to the A620/A280 value, purification
by IEC and sucrose gradient produced 4.5 and 4.4 (Table
1a &b). These values pointed to high-quality C-
phycocyanin. As shown in Figure 7, the SDS-gel
electrophoresis page, alpha, and beta phycocyanin
subunits are visualized without any additional
contamination. These results provided high evidence for
the efficiency of the presented methods.
A summary evaluation of chromatographic and
sucrose gradient methods are shown in Tables 1a and 1b.
El-Mohsnawy Eithar, 2014
Journal of Research in Biology (2014) 3(8): 1132-1146 1140
Figure 5: Sucrose density gradient of concentrated crude extract. 20% sucrose was frozen and slowly thawed at 10 °C. 100 µl of OD620 nm 6 suspensions were slowly dropped onto the top of sucrose gradients and centrifuged at 36000 rpm for about 12 hours at 4°C (SW40-Rotor ultracentrifuge, Beckman).
Figure 4: Elution profile of purified phycocyanin using IEC (Poros HQ/M). The column was equilibrated by 8 CV of HEPES 7.5 buffer before loading. PC was eluted at 35 mM of MgSO4.
There were no significant differences in A620/A280 values,
whereas the total productivity was high in case of the
sucrose gradient. In addition, a significant reduction in
purification time was observed in case of the sucrose
gradient.
DISCUSSION
The extraction and the purification of
C-phycocyanin have been reported for different
cyanobacterial species using several steps. These
protocols required longer time and more equipment. To
reach an optimum PC complex (large amount, pure, and
in a short time), the production of C-phycocyanin passed
through 2 main steps. The first step was the isolation of
PC, and the second one was purification. Each step was
monitored spectroscopically in order to achieve high
efficiency.
Since the cyanobacterial cell wall is composed of
peptidoglycan with an external lipopolysaccharide layer
such as gram-negative bacteria, the design of cell
destruction is very important, by which the cell wall is
destroyed while keeping the thylakoid membrane in its
native structure. As shown in the “Results” section, a
combination of Lysozyme with 2000 psi was effective
and mild. These results were in agreement with Gan
et al., (2004) for Spirulina sp., Santos et al., (2004) for
Calothrix sp., and Gupta and Sainis (2010) for Anacystis
nidulans. The use of a combination of Lysozyme and
glass beads was very strong and caused the destruction of
both the cell wall and the thylakoid membrane, resulting
in a huge amount of contamination, especially
allophycocyanin. These contaminations extended to
include photosystem complexes in case of using a buffer
containing ß-DM. It should be pointed out that further
extractions by HEPES buffer enhanced the isolation of
the remaining C-phycocyanin, in addition to a large
amount of allophycocyanin. There was an inverse
relationship between the repetition of extraction and PC
isolation, whereas a direct relationship has been recorded
with regard to allophycocyanin (El-Mohsnawy, 2013). A
model in Figure 8 illustrates a comparison between
different isolation conditions. It could be concluded that
a combination between Lysozyme and high pressure
(2000 psi) with HEPES buffer was ideal for phycocyanin
isolation with a low contamination. Different
C-phycocyanin purification conditions have been widely
investigated. A combination of two or more purification
steps were usually applied till they reach a high A620/A280
ratio. A combination of ultrafiltration charcoal
El-Mohsnawy Eithar, 2014
1141 Journal of Research in Biology (2014) 3(8): 1132-1146
Figure 6 a: Absorption spectra of purified phycocyanin after ammonium sulfate precipitation, IEC purification, and sucrose gradient. A partial purified phycocyanin was used to visualize the difference at 650 nm. 500-µl samples were measured by a Shimadzu UV-2450 spectrophotometer.
Figure 6 b: 77K fluorescence emission spectra of phycocyanin purified by ammonium sulfate precipitation, IEC, and sucrose gradient, and these were precipitated by ammonium sulfate. Samples were diluted with HEPES 7.5 buffer containing 60 % glycerol to OD620 = 0.05. The applied actinic light was 580 nm.
adsorption and spray drying was used to obtain C-PC
with A620/A280 of 0.74 and a yield of 34%, whereas
additional chromatographic steps were included to purify
C-PC to A620/A280 of 3.91 with a yield of 9% (Herrera et
al., 1989). This method was improved by Gupta and
Sainis (2010) and reached 2.18 and 4.72, respectively.
Combinat ion of ammonium sulfate with
chromatographic purification has been used for obtaining
C-phycocyanin in different purity levels and
recommended by Rito-Palomares et al., 2001 and Song
et al., 2013. On the other hand, the use of two-phase
aqueous extraction followed by chromatographic
purification was recently reported by Soni et al., 2008.
Although it produced extremely pure C-phycocyanin
with A620/A280=6.69, the total yield was affected. In the
present work, two strategies have been applied. The first
one was based on two steps: ammonium sulfate
precipitation followed by chromatographic purification
(IEC). The second strategy was based on the
concentration of crude extract followed by sucrose
gradient fractionation. Through concentration of crude
El-Mohsnawy Eithar, 2014
Journal of Research in Biology (2014) 3(8): 1132-1146 1142
Figure 7: SDS-gel PAGE of purified phycocyanin.
Lane 1 marker protein, lane 2 phycocyanin purified
by sucrose gradient and lane 3 phycocyanin purified
by IEC.
Photosystem II
Photosystem I
Cytochrome b6f
ATPase
Allophycocyanin
C-Phycocyanin
B-DM
Phospholipide Glass-beads
Components of crude extract
Figure 8: Model illustrates the major protein isolated as a result of different extraction conditions. This model is based on the results of absorbance and 77k fluorescence spectral analysis.
extract was considered important not only for
concentration C-phycocyanin but also for the removal of
the small-molecular-weight soluble protein.
To evaluate this new purification step (sucrose
gradient), a highly contaminated PC crude extract
(Lysozyme with glass beads) was concentrated by an
Amicon 10,000 centrifugation tube and exposed to
sucrose density gradient fractionation. The astonishing
results were recorded by the sucrose gradient that gave
almost the same purity and a much better yield.
After several optimization sequences, it could be
recommended that the digestion of T. elongatus cell wall
by Lysozyme and the exposure to high pressure (2000
psi) followed by PC extraction by HEPES buffer once or
twice was found to be the best condition for the isolation
of partial pure PC. This crude extract should be
concentrated through an Amicon 10,000 centrifugation
tube before fractionation by the sucrose gradient.
Isolation and purification should be quick, reliable, and
efficient; so, absorbance and fluorescence spectra
facilitated the purity of C-phycocyanin, thus enabling the
optimization of each step. Several advantages of the
sucrose gradient method are that it reduces the amount of
lost PC complex during purification sequences, produces
a highly purified complex (A620/A280 value), and reduces
time; thus, it could be considered a standard model that is
applied in different cyanobacteria species and too simple
not to be used by specialists.
ACKNOWLEDGMENTS
I would like to express my deep thanks for
Prof. Rögner Matthias (Ruhr University Bochum), who
giving me the opportunity to measure some
chromatographic and spectroscopical measurements.
Also, I acknowledge the German Research Council, DFG
for the financial support. Prof. Kurisu, Genji (Protein
Center of Osaka University) is gratefully acknowledged
for permitting me to do a part of practical work in
his laboratory. I would like to thank Hisako Kubota for
fruit discussions. I would like to thank Mrs Regina
Oworah-Nkruma for technical assistance rendered.
REFERENCES
Adir N, Dobrovetsky Y and Lerner N. 2001. Structure
of c-phycocyanin from the thermophilic cyanobacterium
Synechococcus vulcanus at 2.5 Å: structural implications
for thermal stability in phycobilisome Assembly. J Mol
Biol. 313(1):71–81.
Adir N. 2005. Elucidation of the molecular structures of
components of the phycobilisome: reconstructing a giant.
Photosynth. Res., 85(1): 15–32.
Bennett A and Bogorad L. 1973. Complementary
chromatic adaptation in a filamentous blue-green alga.
J Cell Biol., 58(2):419-35.
Bhaskar SU, Gopalaswamy G and Raghu R. 2005. A
simple method for efficient extraction and purification of
C-phycocyanin from Spirulina platensis Geitler. Indian J
Exp Biol., 43(3):277-279.
Boussiba S and Richmond AE. 1979. Isolation and
characterization of phycocyanins from the blue-green
alga Spirulina platensis. Arch Microbiol., 120(2):155–
159.
Bryant DA, Guglielmi G, Tandeau de marsac N,
Castets AM and Cohen-Bazire G. 1979. The structure
of cyanobacterial phycobilisomes: a model. Arch
Microbiol., 123(2):113–127.
Contreras-Martel C, Matamala A, Bruna C, Poo-
Caamaño G, Almonacid D, Figueroa M, Martínez-
Oyanedel J and Bunster M. 2007. The structure at 2 Å
resolution of phycocyanin from Gracilaria chilensis and
the energy transfer network in a PC–PC complex.
Biophys Chem., 125(2-3):388–396.
1143 Journal of Research in Biology (2014) 3(8): 1132-1146
El-Mohsnawy Eithar, 2014
El-Mohsnawy E, Kopczak MJ, Schlodder E,
Nowaczyk M, Meyer HE, Warscheid B,
Karapetyan NV and Rögner M. 2010. Structure and
function of intact photosystem 1 monomers from the
cyanobacterium Thermosynechococcus elongatus.
Biochemistry. 15; 49(23):4740-4751.
El-Mohsnawy E. 2013. Purification, Characterization,
and Activity Evaluation of Allophycocyanin from
Thermosynechococcus elongatus. Life Science Journal.
10(4): 3754-3761. 503.
Ferreira, KN, Iverson, TM, Maghlaoui, K, Barber, J
and Iwata S. 2004. Architecture of the photosynthetic
oxygen-evolving center. Science. 303 (5665):1831-1838.
Frankenberg N, Moser J and Jahn D. 2003. Bacterial
heme biosynthesis and its biotechnological application.
Appl Microbiol Biotechnol., 63(2):115-127.
Frankenberg N and Lagarias JC. 2003.
Phycocyanobilin: Ferredoxin Oxidoreductase of
Anabaena sp. PCC 7120: Biochemical and spectroscopic
characterization. The Journal of Biological Chemistry.
278(11): 9219-9226. DOI 10.1074/jbc.M211643200.
Gan X, Tang X, Shi C, Wang B, Cao Y and Zhao L.
2004. Preparation and regeneration of spheroplasts from
Arthrospira platensis (Spirulina). J Appl Phycol., 16
(6):513–517.
Gupta A and Sainis JK. 2010. Isolation of
C-phycocyanin from Synechococcus sp., (Anacystis
nidulans BD1). J Appl Phycol., 22(3):231–233.
Herrera A, Boussiba S, Napoleone V and Hohlberg A.
1989. Recovery of C-phycocyanin from the
cyanobacterium Spirulina maxima. J Appl Phycol., 1
(4):325–331.
Ichimura M, Kato S, Tsuneyama K, Matsutake S,
Kamogawa M, Hirao E, Miyata A, Mori S,
Yamaguchi N, Suruga K and Omagari K. 2013.
Phycocyanin prevents hypertension and low serum
adiponectin level in a rat model of metabolic syndrome.
Nutr Res., 33(5): 397-405.
Jordan P, Fromme P, Witt HT, Klukas O, Saenger W
and Krauss N. 2001. Threedimensional structure of
cyanobacterial photosystem I at 2.5 A resolution. Nature.
21 411(6840):909-917.
Katoh H, Hagino N, Grossmann AR and Ogawa T.
2001. Genes essential to iron transport in the
cyanobacterium Synechocystis sp. strain PCC 6803.
J Bacteriol., 183(9): 2779-2784.
Kubota H, Sakurai I, Katayama K, Mizusawa N,
Ohashi S, Kobayashi M, Zhang P, Aro EM and
Wada H. 2010. Purification and characterization of
photosystem I complex from Synechocystis sp. PCC
6803 by expressing histidine-tagged subunits. Biochim
Biophys Acta. 1797(1):98-105.
Kurisu G, Zhang H, Smith JL and Cramer WA.
2003. Structure of the cytochrome b6f complex of
oxygenic photosynthesis: Tuning the cavity. Science.
302(5647):1009-1014.
Lawrenz E, Fedewa EJ and Richardson TL. 2011.
Extraction protocols for the quantification of phycobilins
in aqueous phytoplankton extracts. J Appl Phycol., 23
(5):865–871.
Li B, Chu X, Gao M and Li W. 2010. Apoptotic
mechanism of MCF-7 breast cells in vivo and in vitro
induced by photodynamic therapy with C-phycocyanin.
Acta Biochimica et Biophysica Sinica. Sin (Shanghai). 42
(1):80-89.
Loll B, Kern J, Saenger W, Zouni A and Biesiadka J.
2005. Towards complete cofactor arrangement in the
3.0A resolution structure of photosystem II. Nature. 438
(7070):1040-4.
Journal of Research in Biology (2014) 3(8): 1132-1146 1144
El-Mohsnawy Eithar, 2014
Marín-Prida J, Pavón-Fuentes N, Llópiz-Arzuaga A,
Fernández-Massó JR, Delgado-Roche L, Mendoza-
Marí Y, Santana SP, Cruz-Ramírez A, Valenzuela-
Silva C, Nazábal-Gálvez M, Cintado-Benítez A,
Pardo-Andreu GL, Polentarutti N, Riva F, Pentón-
Arias E and Pentón-Rol G. 2013. Phycocyanobilin
promotes PC12 cell survival and modulates immune and
inflammatory genes and oxidative stress markers in acute
cerebral hypoperfusion in rats. Toxicol Appl
Pharmacol.,. 1; 272(1):49-60.
Minkova KM, Tchernov AA, Tchorbadjieva MI,
Fournadjieva ST, Antova RE and Busheva MCh.
2003. Purification of C-phycocyanin from Spirulina
(Arthrospira) fusiformis. J Biotechnol., 102(1):55–59.
Niu JF, Wang GC, Lin XZ and Zhou BC. 2007. Large
-scale recovery of C-phycocyanin from Spirulina
platensis using expanded bed adsorption
chromatography. J Chromatogr B. 850(1-2): 267–276.
Patil G and Raghavarao KSMS. 2007. Aqueous two
phase extraction for purification of C-phycocyanin.
Biochem Eng J., 34(2):156–164.
Pleonsil P and Suwanwong Y. 2013. An in vitro study
of c-phycocyanin activity on protection of DNA and
human erythrocyte membrane from oxidative damage.
Journal of Chemical and Pharmaceutical Research. 5
(5):332-336 .
Rippka R, Deruelles J, Waterbury JB, Herdman M
and Stanier RY. 1979. Generic assignments, strain
histories and properties of pure cultures of cyanobacteria.
J Gen Microbiology. 111(1):1–61.
Rito-Palomares M, Nuñez L and Amador D. 2001.
Practical application of aqueous two phase systems for
the development of a prototype process for c-
phycocyanin recovery from Spirulina maxima. J Chem
Techn Biotechnol., 76(12):1273–1280.
Rögner M, Boekema EJ and Barber J. 1996. How
does photosystem 2 split water? The structural basis of
efficient energy conversion. Trends Biochem Sci., 21
(2):44-9.
Santiago-Santos MC, Ponce-Noyola T, Olvera-
Ramirez R, Ortega-Lopez J and Canizares-
Villanueva RO. 2004. Extraction and purification of
phycocyanin from Calothrix sp. Process Biochemistry.
39(12): 2047-2052.
Schägger, H and von Jagow, G. 1987. Tricine-sodium
dodecyl sulfate-polyacrylamide gel electrophoresis for
the separation of proteins in the range from 1 to 100 kDa.
Analyt Biochem., 166(2): 368-379.
Schlodder E, Shubin VV, El-Mohsnawy E, Rögner M
and Karapetyan NV. 2007. Steady-state and transient
polarized absorption spectroscopy of photosystem I
complexes from the cyanobacteria Arthrospira platensis
and Thermosynechococcus elongatus. Biochim Biophys
Acta. 2007 (6):732-741.
Schopf JW. 2000. The fossil record: tracing the roots of
the cyanobacterial lineage. In: Whitton BA, Potts M
(eds) The ecology of cyanobacteria: Their Diversity in
Time and Space. Kluwer, Dordrecht. p 13–35.
Song W, Zhao C and Wang S. 2013. A Large-Scale
Preparation Method of High Purity CPhycocyanin.
International Journal of Bioscience, Biochemistry and
Bioinformatics. 3(4):293-297.
Soni B, Trivedi U and Madamwar D. 2008. A novel
method of single step hydrophobic interaction
chromatography for the purification of phycocyanin from
Phormidium fragile and its characterization for
antioxidant property. Bioresour Technol., 99(1):188–
194.
Sonoike K and Katoh S. 1989. Simple estimation of the
differential absorption coefficient of P-700 in detergent-
1145 Journal of Research in Biology (2014) 3(8): 1132-1146
El-Mohsnawy Eithar, 2014
treated preparations. Biochim Biophys Acta. 976(2-
3):210–213.
Stec B, Troxler RF and Teeter MM. 1999. Crystal
structure of C-phycocyanin from Cyanidium caldarium
provides a new perspective in on phycobilisome
assembly. Biophys J., 76(6): 2912–2921.
Thangam R, Suresh V, Asenath Princy W, Rajkumar
M, Senthilkumar N, Gunasekaran P, Rengasamy R,
Anbazhagan C, Kaveri K and Kannan S. 2013.
C-Phycocyanin from Oscillatoria tenuis exhibited an
antioxidant and in vitro antiproliferative activity through
induction of apoptosis and G0/G1 cell cycle arrest. Food
Chem., 140(1-2):262-72.
Troxler RF, Ehrhardt MM, Brown-Mason AS and
Offner GD. 1981. Primary structure of phycocyanin
from the unicellular rhodophyte Cyanidium caldarium.
II. Complete amino acid sequence of the beta subunit. J
Biol Chem., 256(23):12176–12184.
Zouni A, Witt HT, Kern J, Fromme P, Krauss N,
Saenger W and Orth P. 2001. Crystal structure of
photosystem II from Synechococcus elongatus at 3.8 A
resolution. Nature. 409(6821):739-43.
Journal of Research in Biology (2014) 3(8): 1132-1146 1146
El-Mohsnawy Eithar, 2014
Submit your articles online at www.jresearchbiology.com
Advantages
• Easy online submissionEasy online submissionEasy online submissionEasy online submission
• Complete Peer reviewComplete Peer reviewComplete Peer reviewComplete Peer review
• Affordable ChargesAffordable ChargesAffordable ChargesAffordable Charges
• Quick processingQuick processingQuick processingQuick processing
• Extensive indexingExtensive indexingExtensive indexingExtensive indexing
• You retain your copyright You retain your copyright You retain your copyright You retain your copyright
www.jresearchbiology.com/Submit.php.
Article Citation: Banjit Bhatta and Mrigendra Mohan Goswami. Length-Weight relationship and condition factor of Channa aurantimaculata (Musikasinthorn, 2000) studied in a riparian wetland of Dhemaji District, Assam, India. Journal of Research in Biology (2014) 3(8): 1147-1152
Jou
rn
al of R
esearch
in
Biology
Length-Weight relationship and condition factor of Channa aurantimaculata (Musikasinthorn, 2000) studied in a riparian wetland of Dhemaji District,
Assam, India
Keywords:
Channa aurantimaculata, L-W relationship, condition factor, Dhemaji district
ABSTRACT: Present study reports the length-weight relationship, condition factor and relative condition factor of Channa aurantimaculata (Musikasinthorn, 2000), a hole dwelling snakehead endemic fish species (Goswami et al., 2006, Vishwanath and Geetakumari, 2009) of a riparian wetland habitat of Dhemaji district, Assam. Length-weight relationship, condition factor and relative condition factor of the species was evaluated during the feeding cycle (December - March/April) in the year November 2008 to October 2009. The relative growth coefficient (b) values for male was found to be 4.18 and for female was 2.65, the condition factor (K) value was 1.29 ± 0.27 for male and 1.66 ± 0.28 for female, relative condition factor (Kn) value 1.05 ± 0.42 in male and 1.00 ± 0.40 in female were observed. The coefficient of correlation (r ) in both the sexes exhibit allometric growth (negative in female and highly positive in male).
1147-1152 | JRB | 2014 | Vol 3 | No 8
This article is governed by the Creative Commons Attribution License (http://creativecommons.org/
licenses/by/2.0), which gives permission for unrestricted use, non-commercial, distribution and reproduction in all medium, provided the original work is properly cited.
www.jresearchbiology.com Journal of Research in Biology
An International
Scientific Research Journal
Authors:
Banjit Bhatta1 and
Mrigendra Mohan
Goswami2.
Institution:
1. Department of Zoology,
Dhemaji College, Dhemaji-
787057 (Assam).
2. Department of Zoology,
Gauhati University,
Guwahati- 781014 (Assam).
Corresponding author:
Banjit Bhatta.
Web Address: http://jresearchbiology.com/documents/RA0406.pdf.
Dates: Received: 15 Dec 2013 Accepted: 15 Jan 2014 Published: 10 Feb 2014
Journal of Research in Biology An International Scientific Research Journal
Original Research
INTRODUCTION:
The growth performance and well-being of any
fish species in relation to habitat diversity are determined
through the measure of its length- weight relationship
and condition factor. Such a knowledge on length and
weight is useful in the assessment of fish stock and
population to predict the potential yield of the species.
The size variation in relation to growth in biomass of fish
is expressed in length-weight statistics. In the natural
population the growth dynamics of any fish species is
dependent on its habitat variability. The growth pattern
in fishes follow the cube law (Brody 1945; Lagler,
1952). As the fish grows isometrically exhibiting the
exponential value exactly at 3.0, such relationship is
considered valid. However, in reality, it may deviate
from this ideal value due to environmental condition or
condition of the fish (Le Cren, 1951). Therefore, as
suggested by Le Cren (1951) this relationship
is expressed by an equation- W= aLb or W= Log a + b
Log L.
Channa aurantimaculata (Musikasinthorn,
2000), one of the burrowing members of the Asian
snakehead exhibits its habitat range in the riparian
wetlands of upper Assam districts as distributed in
Tinsukia Dibrugarh Dhemaji districts. The dual life cycle
of the fish (living in burrows and enjoying free
swimming life) is a special behavioral character within
the riparian range of the habitat. This species endemic to
the upper Assam zone (Goswami et al., 2006;
Vishwanath and Geetakumari, 2009) is of special interest
for its assessment of growth dynamics and natural
population stock. The growth performance of the natural
population of the species needs to be examined to
ascertain its overall relationship of length and weight.
The general well-being of the species in the present
habitat characters is expressed in terms of its
mathematical expression of condition factor. The present
study deals with computing the length- weight
relationship, condition factor and relative condition
factor of Channa aurantimaculata from the natural stock
of Lachia beel, a riparian wetland (Longitude 94°57 /
27// E and Latitude 27°38/ 33// N ) located in Dhemaji
District of Assam.
MATERIALS AND METHODS
A total of 42 specimens with size ranges 21.4 -
39.6 in length and 150.25 – 769.82 in weight of both
sexes of Channa aurantimaculata were collected
randomly from a riparian weltand namely Lachia beel
(Longitude 94°57 / 27// E and Latitude 27°38/ 33// N ) of
Dhemaji district of Assam, India during Nov, 2008 –
Oct, 2009. Since sex of the collected samples could not
be distinguished by secondary sexual characters, all
fishes were dissected and identified the sex based on
gonadal structures following Mackie and Lewis, 2001.
The male specimens (15 number) and female specimens
(27number) were separated for their length and weight.
Total length (TL) were measured from tip of the snout to
tip of the caudal fin nearest to 0.01 mm by digital vernier
caliper and Body weight (BW) of the fish samples were
measured nearest to 0.01 gm by digital balance
(Sartorius BA 610, Germany) individually. Length-
weight relationship were estimated by the equation
W=a Lb (Le Cren, 1951) which further expressed
logarithmically as
Log W=Log a +b Log L
Where, W= Weight of the fish, L=length of the
fish and ‘a’ and ‘b’ are constant. Parameter ‘a’ and ‘b’
were calculated by the method of least square regression:
The value of correlation ‘r’, standard deviation
(SD) between total length and body weight were
calculated with the help of SPSS software (version-16)
Bhatta and Goswami, 2014
1148 Journal of Research in Biology (2014) 3(8): 1147-1152
Log a = ∑log W.∑(log L)2 - ∑log L. ∑(log L. log W)
N. ∑(log L)2 – (∑log L)2
Log b = ∑ Log W – N. Log a
∑ Log L
and Microsoft Office Excel. The Log transformed
regression was used to test the growth.
RESULTS AND DISCUSSION
In the present study the body weight of male and
female have been ranged between 180.42 and 750.01 gm
and 150.25 and 769.82 gm respectively and the total
length between 28.2 and 39.6 cm in male and 21.4 and
38.9 cm in female. The value of ‘a’, ’b’, ‘r’ and mean ±
SD of male and female are given in the Table 1. The
‘K’ and ‘Kn’ values are depicted in Table 2. The
regression graphs of LWR and condition factor (K) are
depicted in Fig.1 and Fig.2. Logarithmic form of Length-
weight relationship is expressed by the following
equations for male and females as
For Male, -Log W = - 3.68 + 4.18 Log L
For Female, -Log W = - 1.26 + 2.61Log L
Channa aurantimaculata is a hole dwelling
snakehead species enjoying aestivation of life during the
dry season (December – March/April) and free living life
during rest of the period (May- November). The growth
performance of the fish during the free living period is an
important part of its life cycle. In the present
investigation the growth performance of both the sexes
are found high since the correlation coefficient ‘r’
exhibits a high degree of positive allometric correlation
in male and feebly negative allometric correlation
between the L-W relationship (Table-1). Degree of
variation of exponential value of L-W relationship
indicated by ‘ b’ value in male (4.186) is higher than the
female (2.651). However, correlation coefficient ‘r’
value in female is found to be more closer to 1.0 (0.959)
than the ‘ r’ value in male (0.898). This indicates that the
female has higher degree of relationship in growth
performance than the male in spite of lower degree of
exponential growth than the latter. Notwithstanding the
value of exponent ‘b’ usually ranges between 2.5 and 4.0
(Hile, 1936, Martin, 1949) and remains constant at 3.0
for an exactly ideal fish (Allen,1938), the present study
indicates that the value of ‘b’ in case of
Channa aurantimaculata is found to be deviated from
‘Cube law’ in both the cases of male and female.
Considerably the growth coefficient ‘b’ of
Channa aurantimaculata is positively allometric, but
within the value (slightly higher in upper limit) as
suggested by Hile and Martin. Saikia et al., (2011) also
observed the allometric growth in Channa punctatus
from Assam. The higher ‘b’ value may be indicated by
Journal of Research in Biology (2014) 3(8): 1147-1152 1149
Bhatta and Goswami, 2014
Sex Weight range
(gm)
Size range
(cm) Range of K Range of Kn
Mean ± SD
K
Mean ± SD
Kn
Male N=15 180.42 - 750.01 28.2 - 39.6 0.78 - 1.66 0.41 - 1.69 1.29± 0.27 1.05 ± 0.42
Female N=27 150.25 - 769.82 21.4 - 38.9 1.31- 2.33 1.00 - 1.56 1.66 ± 0.28 1.00 ± 0.40
Table. 2: Mean ± standard deviation of Condition factor (K) and Relative condition factor (Kn)
Significant level at 0.05
Table. 1: Mean ± standard deviation of Body weight (BW) and Total length (TL), value of ‘a’ and ‘b’
Sex Weight range
(gm)
Size range
(cm)
Mean±SD
BW(gm)
Mean±SD
TL (cm)
Value
of ‘a’
Value
of ‘b’
‘r’
value
Male
N=15
180.42 - 750.01
28.2 - 39.6
443.12 ± 180.97
32.42 ± 3.147 -3.68
4.186
0.898
Female
N=27
150.25 - 769.82
21.4 -38.9
492.57 ± 193.85
30.47 ± 5.23 -1.26
2.651
0.959
the higher feeding proficiencies (Soni and Kathal, 1953;
Kaur, 1981; Saikia et al., 2011), which is observed with
the present study. The free moving period of
Channa aurantimaculata is marked as the best feeding
period, which reflects in correlation coefficient of L-W
relationship (r) and high degree of exponential
growth (b).
It is observed that Channa aurantimaculata lives
in burrows, which is followed by a free living life as
soon as the riparian swamp habitats are inundated with
flood water. The fish starts its feeding cycle overcoming
the non-feeding life of aestivation. As the feed intensity
increases during the feeding period the fish undergoes
enhancement of growth. As a result, it follows favorably
a normal growth showing positive allometric relation
which is reflected in the Length-Weight relationship.
‘Condition’, ‘fatness’ or well being of fish
expressed by K-factor is based on hypothesis that heavier
fish of a given length are in better condition (Bagenal
and Tesch, 1978). For monitoring of feeding intensity
and growth rate in fish in general K-factor is an essential
index (Oni et al.,1983). However, the condition factor
(K) and relative condition factor (Kn) in the free living
stage of Channa aurantimaculata (Table) clearly
indicate that the general well being and the status of
maturity and growth are favourably good. High K-value
in both the species suggests that condition factor
increased with increasing length and weight of the fish
(Yousuf and Khurshid, 2008). However in case of
Channa aurantimaculata it exhibits highest peak in
Bhatta and Goswami, 2014
1150 Journal of Research in Biology (2014) 3(8): 1147-1152
y = 4.186x - 3.688
R² = 0.806
A
y = 2.651x - 1.268
R² = 0.919
B
Fig.1: Relationship between Log Total length (cm) and Log body weight (gm) of
Channa aurantimaculata (A = Male and B= Female).
y = 0.001x + 0.816
R² = 0.506
C
y = -0.000x + 1.788
R² = 0.032
D
Fig.2: Condition factor (Kn) in relation to body weight (gm) of Channa aurantimaculata
(C=Male and D=Female
K-factor in relation to BW within the weight range of
400-600 gm BW and thereafter steady decline is noticed
(Figure 2). This may be due to completion of free
swimming stage and initiation of burrowing /aestivation
cycle.
CONCLUSION
Channa aurantimaculata is found to endemic in
the upper Assam zone (Goswami et al., 2006,
Vishwanath and Geetakumari, 2009) and dwindling in
the natural wetland habitat. The feeding and breeding
cycle of the fish is unidentical from the other common
snakeheads of the region. Due to rampant habitat
destruction the fish is dwindling and struggling for
survival in nature. For the conservation of the species the
basic data for growth, breeding and feeding behavior are
considered pre requisite. Steps related to conservation of
the habitat for the species is highly recommended.
ACKNOWLEDGEMENTS
The authors are very much grateful to the Head
of the Department of Zoology, Gauhati University and
Principal, Dhemaji College, Assam for extending their
help during the study period. The authors are also
thankful to the UGC-SAP (DRS) Laboratory of zoology
department of Gauhati University for helping
identification of the species. Appreciations are due to the
skilled fishers and local youths for their immense help
and cooperation during the course of field study.
REFERENCE
Allen KR. 1938. Some Observation on the Biology of
the Trout (Salmo trutta) in Windermere. J. Anim. Ecol.,
7(2): 333 - 349.
Bagenal TB, Tesch AT. 1978. Conditions and Growth
Patterns in Fresh Water Habitats. Blackwell Scientific
Publications, Oxford. 75-89.
Brody S. 1945. Bioenergetics and growth. Reichold
Publishing Corporation, New York. 1023.
Goswami MM, Borthakur Arunav, and Pathak
Janardan. 2006. Comparative biometry, habitat
structure and distribution of four endemic snakehead
(Teleostei : Channidae) species of Assam, India. J.
Inland Fish. Soc. India. 38 (1): 1-8.
Hile R. 1936. Age and Growth of the Cisco,
Leucichthys artedi (Le Sueur), in the Lakes of the North-
eastern High Lands. Wisconsin. Bulletin U. S. Bur.
Fishery. 48: 211 - 317.
Kaur S. 1981. Studies on Some Aspects of the Ecology
and Biology of Channa gachua (Ham.) and Channa
stewartii (Playfair). Ph.D. Thesis. North Eastern Hill
University, Shillong.
Lagler KF. 1952. Freshwater Fishery Biology. Wim C
Brown Co. Dubugue, Iowa. 360.
Le-Cren ED. 1951. The Length-Weight Relationship
and Seasonal Cycle in Gonad-Weight and Condition in
the Perch (Perca fluviatilis). J. Anim. Ecol., 20:201-219.
Mackie M, Lewis P. 2001. Assessment of gonad staging
system and other methods used in the study of the
reproductive biology of narrow-barred Spanish
Mackeral, Scomberomorus commerson, in Western
Australia. Fish Res. Rep. West Aust. 136 :1-32.
Martin WR. 1949. The Mechanics of Enivironmental
Control of Body Form in Fishes. Univ. Toronto Stud.
Biol. 58 (Publ. Ont. Fish. Res. Lab.). 70: 1 -19.
Musikasinthorn P. 2000. Channa aurantimaculata, a
new channid fish from Assam (Brahmaputra River
basin), India, with designation of a neotype for
C. amphibeus (McClelland,1845), Ichthyological
Research. 47: 27 -37.
Bhatta and Goswami, 2014
Journal of Research in Biology (2014) 3(8): 1147-1152 1151
Oni SK, Olayemi JY and Adegboye JD. 1983.
Comparative physiology of three ecologically distinct
fresh water fishes, Alestes nurse Ruppell, Synodontis
schall Bloch and S. Schneider and Tilapia Zilli Gervais.
J. Fish Biol., 22: 105- 109.
Saikia AK, Singh ASK, Das DN and Biswas SP. 2011.
Length-Weight relationship and condition factor of
spotted snakehead, Channa punctatus ( Bloch), Bulletin
of Life Science. XVII : 102-108.
Soni DD, Kathal M. 1953. Length - Weight
Relationship in Cirrhina mrigala (Val.) and Cyprinus
carpio (Ham.) Matsya. 5: 67 -72.
Vishwanath W. and Geetakumari KH. 2009.
Diagnosis and interrelationships of fishes of the genus
Channa Scopoli (Teleostei : Channidae) of northeastern
India. Journal of Threatened Taxa., 1(2) : 97-105.
Yousuf F and Khurshid S. 2008. Length- weight
relationship and relative conditions factor for the
halfbeak Hamirampus far Forssk ÃҰl,1775 from the
Karachi coast. Univ. J. zool. Rajashahi Univ., 27:103-
104.
Bhatta and Goswami, 2014
1152 Journal of Research in Biology (2014) 3(8): 1147-1152
Submit your articles online at www.jresearchbiology.com
Advantages
Easy online submission Complete Peer review Affordable Charges Quick processing Extensive indexing You retain your copyright
www.jresearchbiology.com/Submit.php.
Journal of Research in Biology
Authors:
John De Britto A*,
Benjamin Jeya Rathna,
Kumar P and Herin Sheeba
Gracelin D.
Institution:
Plant Molecular Biology
Research Unit, Post Graduate
and Research Department of
Plant Biology and Plant
Biotechnology,
St.Xavier's College
(Autonomous), Palayamkottai
- 627 002, Tamil Nadu, India.
Corresponding author:
John De Britto A.
An International Scientific Research Journal
Impact of ecological factors on genetic diversity in
Nothapodytes nimmoniana Graham based on ISSR amplification
Keywords: Ecological factors, Genetic diversity, Nothapodytes nimmoniana, ISSR.
ABSTRACT: Nothapodytes nimmoniana Graham is one of the most important anti cancer phytochemical yielding plant belongs to the family of Icacinaceae. In order to evaluate the genetic diversity of different N. nimmoniana land races based on molecular markers, five landraces were collected from different populations of the Western Ghats of South India. The ISSR method was utilized employed for evaluating the genetic diversity within the species, using 12 ISSR primers. A total of 108 bands were produced. The overall percentage of polymorphism was 87.10. Nei’s overall gene heterozygosity was found to be 0.3333. The genetic distance between the samples ranged from 0.2146 to 0.4099 and the genetic identity ranged from 0.6637 to 0.8068. The Shannon’s information index was found to be 0.4924. The UPGMA dendrogram showed the relationship between five different populations in two major clusters. Genetic diversity is correlated with soil factors for ascertaining the validity of the markers.
Guidelines for Authors
The article should be addressed to "The Editor".
Submission of an article implies that it has never been published in any other journals and if accepted, it will not be publi shed
elsewhere.
All papers are first reviewed by the editor. Papers found lacking will not be considered. Others will be sent for a detailed peer-review
process.
Journal Manuscript Format
The manuscript should be typed in “Times new Roman” font with font size 11 and 1.5 line spacing. The page size should be strictly
A4. All images should be in JPEG format. The article is to be submitted should accompany a covering letter with name and complete address
(including Telephone Number and e-mail ID) of the author/s. The completed article should be sent to [email protected]
Title
The title should briefly identify the subject and indicate the purpose of the document. The title should supply enough information for
the reader to make a reliable decision on probable interest. Do not use all caps; instead use caps only at the first word of the title and/or at
scientific names, abbreviations etc., Center the authors' initials and last names directly below the title.
Abstract
The abstract should include a hypothesis or rationale for the work, a brief description of the methods, a summary of the results, and a conclusion:
The abstract should be less than 250 words. Do not include literature citations or references to tables, figures or equations.
Keywords
A short list of keywords or phrases should be included immediately after the abstract as index words. Choose keywords that reflect the
content of your article. Note that words in the title are not searchable as keywords unless they are also included in the keyword list.
Body of the Article
The introductory section of the text should include a brief statement of why the research was conducted. It should also define the
problem and present objectives along with a plan of development of the subject matter. The introductory section also usually includes a brief
survey of the relevant literature on the topic.
Materials and Methods
Provide sufficient detail so that the work may be repeated. Do not give details of methods described in readily available sources.
Instead, refer to the source and describe any modification. Figures that illustrate test apparatus and tables of treatment parameters or equipment
specifications are appropriate here.
Results and Discussion
This section describes the solution to the problem stated in the introductory section. Use figures and tables to visually supplement the
presentation of your results. The text must refer explicitly to all visuals, and you must interpret the visual elements to emphasize the evidence on
which your conclusions are based. Do not omit important negative results.
In addition, relate your findings to previous findings by identifying how and why there are differences and where there is agreement. Speculation
is encouraged, but it must be identified.
Conclusion
This is a summary of your results. In this section, state any conclusions that can be drawn from your data. You may also include
suggestions for future research. The conclusion may be a subsection of the Results and Discussion section, or it may be a separate section. Data
or statements cited in your conclusion must have been stated previously in the article. Do not introduce new information in the conclusion.
Acknowledgement
Acknowledgements are optional. Use them to thank individuals or organizations that provided assistance in materials, expertise, or
financing. The acknowledgements will appear at the end of the text and should be limited to one or two sentences.
References
All sources cited in the text must be listed in the References, and all documents listed in the References must be cited in the text.
Accuracy of citation is the author's responsibility.
Reference Style
References should be cited in the text in the form (Author et al, 1987) and listed in alphabetical order at the end of the article as follows:
Schernewski G, Neumann T. The trophic state of the Baltic Sea a century ago: a model simulation study. J Mar Sys., 2005;53:109–
124.
Kaufman PD, Cseke LJ, Warber S, Duke JA and Brielman HL. Natural Products from plants. CRC press, Bocaralon, Florida. 1999;
15-16.
Kala CP. Ecology and Conservation of alphine meadows in the valley of flowers national park, Garhwal Himalaya. Ph.D Thesis,
Dehradun: Forest Research Institute, 1998; 75-76.
http://www.ethnobiomed.com/content/pdf/1746-4269-1-11.pdf.
Appendix
Use an appendix for material that is too long to include in the text of the article.
Manuscript Charges
Journal of Research in Biology is an International Research Journal. This Journal provides immediate access to all published full-text
articles to interested readers from all around the world. The availability of the author’s paper makes the scientific community to understand and
develop an impact in the concerned research field. It also increases the chance of more citations of the published work, which in turn can be
translated into more recognition of research. This journal also accelerates research and knowledge building worldwide.
Publishing an article in Journal of Research in Biology requires payment of the manuscript processing charges, once the manuscript is
accepted for publication. The payment is to be made by one of the authors, their university/organization, or funding entity. The manuscript
processing charges are fixed so as to allow publishers to recover manuscript processing expenses and the cost of making the full-text available on
the Internet to all interested researchers.
For Indians
The charges for submission of a Research article is Rs 2100, up to 8 pages and for more pages, each page costs Rs 250.
For Foreign nationals
The charges for submission of a Research article is USD 100, up to 8 pages and for more pages, each page costs 15 USD.
Copyright
Authors who publish in Journal of Research in Biology retain the copyright of their work which allows the unrestricted use,
distribution, and reproduction of an article in any medium, provided that the original work is properly cited.
If you have any queries kindly contact us at [email protected]