Aim and Scope

Journal of Research in Biology is an international scientific journal committed to the development and spread of research in Biological sciences. It accepts research articles with affiliation to biological science from all around the globe and

publishes them in the journal. The submitted articles are peer-reviewed by experts in the field and editorial board members. Make

the most of your research by publishing articles in Journal of Research in Biology.

Journal of Research in Biology works as a portal for biological scientific research publication. It works to promote the use of biological sciences knowledge in the world public policy, and to develop and advance science policy that serves the needs of

scientific research and education communities, particularly the biological sciences.

The journal has been uniquely positioned to help members of the scientific community; become effective advocates

for their science and to be better known for the public that relate to or impact the biological sciences.

Call for Papers

Journal of Research in Biology seeks Research Articles, Short Communications and Mini reviews. The Journal will accept

and review submissions in English from any author, in any global locality. A body of international peers will review all submissions with potential author revisions as recommended by reviewers, with the intent to achieve published papers that:

Relate to the field of Biology

Represent new, previously unpublished work

Advance the state of knowledge of the field

Conform to a high standard of presentation.

Disclaimer: Journal of Research in Biology is not responsible for the content of individual manuscripts. Manuscripts available in this journal were peer reviewed. Manuscripts accepted in the issues conform to the editorial policies. But more details regarding the nature of their research, conflicts in their workplace, plagiarisms, stealing of others property, manipulation of data, illegal formulation of a paper from other allied papers etc., were all not known to us. Any details, queries regarding the manuscripts should be only dealt with the authors and not with the publisher. The concept of peer review can only limit the plagiarism to a small extent where as it is the work of the public and the individuals to identify and stop the illegal formulation of new articles from the other. The publisher invites all details regarding the plagiarism of an article published in the journal provided with the original data and supplementary files for confirmation. On identifying plagiarism issues in an article, the article published will be removed from the journal website and further on the citation of the same will be debarred. Provided the author of the manuscript will be prohibited to publish his/her other studies in our journal or throughout the journals under our portal.

List of Editors of Editors in the Journal of Research in Biology

Managing and Executive Editor:

Abiya Chelliah [Molecular Biology]

Publisher, Journal of Research in Biology.

Editorial Board Members:

Ciccarese [Molecular Biology] Universita di Bari, Italy.

Sathishkumar [Plant Biotechnologist]

Bharathiar University.

SUGANTHY [Entomologist]

TNAU, Coimbatore.

Elanchezhyan [Agriculture, Entomology]

TNAU, Tirunelveli.

Syed Mohsen Hosseini [Forestry & Ecology]

Tarbiat Modares University (TMU), Iran.

Dr. Ramesh. C. K [Plant Tissue Culture] Sahyadri Science College, Karnataka.

Kamal Prasad Acharya [Conservation Biology]

Norwegian University of Science and Technology (NTNU), Norway.

Dr. Ajay Singh [Zoology]

Gorakhpur University, Gorakhpur

Dr. T. P. Mall [Ethnobotany and Plant pathoilogy]

Kisan PG College, BAHRAICH

Ramesh Chandra [Hydrobiology, Zoology]

S.S.(P.G.)College, Shahjahanpur, India.

Adarsh Pandey [Mycology and Plant Pathology]

SS P.G.College, Shahjahanpur, India

Hanan El-Sayed Mohamed Abd El-All Osman [Plant Ecology]

Al-Azhar university, Egypt

Ganga suresh [Microbiology]

Sri Ram Nallamani Yadava College of Arts & Sciences, Tenkasi, India.

T.P. Mall [Ethnobotany, Plant pathology]

Kisan PG College,BAHRAICH, India.

Mirza Hasanuzzaman [Agronomy, Weeds, Plant]

Sher-e-Bangla Agricultural University, Bangladesh

Mukesh Kumar Chaubey [Immunology, Zoology]

Mahatma Gandhi Post Graduate College, Gorakhpur, India.

N.K. Patel [Plant physiology & Ethno Botany]

Sheth M.N.Science College, Patan, India.

Kumudben Babulal Patel [Bird, Ecology]

Gujarat, India.

CHANDRAMOHAN [Biochemist]

College of Applied Medical Sciences, King Saud University.

B.C. Behera [Natural product and their Bioprospecting]

Agharkar Research Institute, Pune, INDIA.

Kuvalekar Aniket Arun [Biotechnology]

Lecturer, Pune.

Mohd. Kamil Usmani [Entomology, Insect taxonomy]

Aligarh Muslim university, Aligarh, india.

Dr. Lachhman Das Singla [Veterinary Parasitology]

Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana, India.

Vaclav Vetvicka [Immunomodulators and Breast Cancer]

University of Louisville, Kentucky.

José F. González-Maya [Conservation Biology]

Laboratorio de ecología y conservación de fauna Silvestre,

Instituto de Ecología, UNAM, México.

Dr. Afreenish Hassan [Microbiology]

Department of Pathology, Army Medical College, Rawalpindi, Pakistan.

Gurjit Singh [Soil Science]

Krishi Vigyan Kendra, Amritsar, Punjab, India.

Dr. Marcela Pagano [Mycology]

Universidade Federal de São João del-Rei, Brazil.

Dr.Amit Baran Sharangi [Horticulture]

BCKV (Agri University), West Bengal, INDIA.

Dr. Bhargava [Melittopalynology]

School of Chemical & Biotechnology, Sastra University, Tamilnadu, INDIA.

Dr. Sri Lakshmi Sunitha Merla [Plant Biotechnology]

Jawaharlal Technological University, Hyderabad.

Dr. Mrs. Kaiser Jamil [Biotechnology]

Bhagwan Mahavir Medical Research Centre, Hyderabad, India.

Ahmed Mohammed El Naim [Agronomy]

University of Kordofan, Elobeid-SUDAN.

Dr. Zohair Rahemo [Parasitology]

University of Mosul, Mosul,Iraq.

Dr. Birendra Kumar [Breeding and Genetic improvement]

Central Institute of Medicinal and Aromatic Plants, Lucknow, India.

Dr. Sanjay M. Dave [Ornithology and Ecology]

Hem. North Gujarat University, Patan.

Dr. Nand Lal [Micropropagation Technology Development]

C.S.J.M. University, India.

Fábio M. da Costa [Biotechnology: Integrated pest control, genetics]

Federal University of Rondônia, Brazil.

Marcel Avramiuc [Biologist]

Stefan cel Mare University of Suceava, Romania.

Dr. Meera Srivastava [Hematology , Entomology] Govt. Dungar College, Bikaner.

P. Gurusaravanan [Plant Biology ,Plant Biotechnology and Plant Science]

School of Life Sciences, Bharathidasan University, India.

Dr. Mrs Kavita Sharma [Botany]

Arts and commerce girl’s college Raipur (C.G.), India.

Suwattana Pruksasri [Enzyme technology, Biochemical Engineering]

Silpakorn University, Thailand.

Dr.Vishwas Balasaheb Sakhare [Reservoir Fisheries]

Yogeshwari Mahavidyalaya, Ambajogai, India.

Dr. Pankaj Sah [Environmental Science, Plant Ecology]

Higher College of Technology (HCT), Al-Khuwair.

Dr. Erkan Kalipci [Environmental Engineering]

Selcuk University, Turkey.

Dr Gajendra Pandurang Jagtap [Plant Pathology]

College of Agriculture, India.

Dr. Arun M. Chilke [Biochemistry, Enzymology, Histochemistry]

Shree Shivaji Arts, Commerce & Science College, India.

Dr. AC. Tangavelou [Biodiversity, Plant Taxonomy]

Bio-Science Research Foundation, India.

Nasroallah Moradi Kor [Animal Science]

Razi University of Agricultural Sciences and Natural Resources, Iran

T. Badal Singh [plant tissue culture]

Panjab University, India

Dr. Kalyan Chakraborti [Agriculture, Pomology, horticulture]

AICRP on Sub-Tropical Fruits, Bidhan Chandra Krishi Viswavidyalaya,

Kalyani, Nadia, West Bengal, India.

Dr. Monanjali Bandyopadhyay [Farmlore, Traditional and indigenous

practices, Ethno botany]

V. C., Vidyasagar University, Midnapore.

M.Sugumaran [Phytochemistry]

Adhiparasakthi College of Pharmacy, Melmaruvathur, Kancheepuram District.

Prashanth N S [Public health, Medicine]

Institute of Public Health, Bangalore.

Tariq Aftab

Department of Botany, Aligarh Muslim University, Aligarh, India.

Manzoor Ahmad Shah

Department of Botany, University of Kashmir, Srinagar, India.

Syampungani Stephen

School of Natural Resources, Copperbelt University, Kitwe, Zambia.

Iheanyi Omezuruike OKONKO

Department of Biochemistry & Microbiology, Lead City University,

Ibadan, Nigeria.

Sharangouda Patil

Toxicology Laboratory, Bioenergetics & Environmental Sciences Division,

National Institue of Animal Nutrition

and Physiology (NIANP, ICAR), Adugodi, Bangalore.

Jayapal

Nandyal, Kurnool, Andrapradesh, India.

T.S. Pathan [Aquatic toxicology and Fish biology]

Department of Zoology, Kalikadevi Senior College, Shirur, India.

Aparna Sarkar [Physiology and biochemistry] Amity Institute of Physiotherapy, Amity campus, Noida, INDIA.

Dr. Amit Bandyopadhyay [Sports & Exercise Physiology]

Department of Physiology, University of Calcutta, Kolkata, INDIA .

Maruthi [Plant Biotechnology]

Dept of Biotechnology, SDM College (Autonomous),

Ujire Dakshina Kannada, India.

Veeranna [Biotechnology]

Dept of Biotechnology, SDM College (Autonomous),

Ujire Dakshina Kannada, India.

RAVI [Biotechnology & Bioinformatics]

Department of Botany, Government Arts College, Coimbatore, India.

Sadanand Mallappa Yamakanamardi [Zoology]

Department of Zoology, University of Mysore, Mysore, India.

Anoop Das [Ornithologist]

Research Department of Zoology, MES Mampad College, Kerala, India.

Dr. Satish Ambadas Bhalerao [Environmental Botany]

Wilson College, Mumbai

Rafael Gomez Kosky [Plant Biotechnology]

Instituto de Biotecnología de las Plantas, Universidad Central de Las Villas

Eudriano Costa [Aquatic Bioecology]

IOUSP - Instituto Oceanográfico da Universidade de São Paulo, Brasil

M. Bubesh Guptha [Wildlife Biologist] Wildlife Management Circle (WLMC), India

Rajib Roychowdhury [Plant science]

Centre for biotechnology visva-bharati, India.

Dr. S.M.Gopinath [Environmental Biotechnology]

Acharya Institute of Technology, Bangalore.

Dr. U.S. Mahadeva Rao [Bio Chemistry]

Universiti Sultan Zainal Abidin, Malaysia.

Hérida Regina Nunes Salgado [Pharmacist]

Unesp - Universidade Estadual Paulista, Brazil

Mandava Venkata Basaveswara Rao [Chemistry]

Krishna University, India.

Dr. Mostafa Mohamed Rady [Agricultural Sciences]

Fayoum University, Egypt.

Dr. Hazim Jabbar Shah Ali [Poultry Science]

College of Agriculture, University of Baghdad , Iraq.

Danial Kahrizi [Plant Biotechnology, Plant Breeding,Genetics]

Agronomy and Plant Breeding Dept., Razi University, Iran

Dr. Houhun LI [Systematics of Microlepidoptera, Zoogeography, Coevolution,

Forest protection]

College of Life Sciences, Nankai University, China.

María de la Concepción García Aguilar [Biology] Center for Scientific Research and Higher Education of Ensenada, B. C., Mexico

Fernando Reboredo [Archaeobotany, Forestry, Ecophysiology]

New University of Lisbon, Caparica, Portugal

Dr. Pritam Chattopadhyay [Agricultural Biotech, Food Biotech, Plant Biotech]

Visva-Bharati (a Central University), India

Dr. Preetham Elumalai [Biochemistry and Immunology] Institute for

Immunology Uniklinikum, Regensburg, Germany

Dr. Mrs. Sreeja Lakshmi PV [Biochemistry and Cell Biology] University of Regensburg, Germany

Dr. Alma Rus [Experimental Biology]

University of jaén, Spain.

Dr. Milan S. Stanković [Biology, Plant Science]

University of Kragujevac, Serbia.

Dr. Manoranjan chakraborty [Mycology and plant pathology]

Bishnupur ramananda college, India.

Table of Contents (Volume 3 - Issue 8)

Serial No Accession No Title of the article Page No

1 RA0396 Cyclin D1 Gene Polymorphism in Egyptian Breast Cancer Women

Ibrahim HAM, Ebied SA, Abd El-Moneim NA and Hewala TI.

1111-1121

2 RA0397 Role of p73 polymorphism in Egyptian breast cancer patients as

molecular diagnostic markers.

Ibrahim HAM, Ebied SA, Abd El-Moneim NA and Hewala TI.

1122-1131

3

RA0419

Efficient methods for fast, producible, C-Phycocyanin from

Thermosynechococcus elongates.

El-Mohsnawy Eithar.

1132-1146

4 RA0406 Length-Weight relationship and condition factor of Channa

aurantimaculata (Musikasinthorn, 2000) studied in a riparian wetland

of Dhemaji District, Assam, India.

Banjit Bhatta and Mrigendra Mohan Goswami.

1147-1152

5 RA0412 Impact of ecological factors on genetic diversity in Nothapodytes

nimmoniana Graham based on ISSR amplification.

John De Britto A, Benjamin Jeya Rathna Kumar P and Herin Sheeba

Gracelin D.

1153-1161

Article Citation: Ibrahim HAM, Ebied SA, Abd El-Moneim NA and Hewala TI. Cyclin D1 Gene Polymorphism in Egyptian Breast Cancer Women. Journal of Research in Biology (2014) 3(8): 1111-1121

Jou

rn

al of R

esearch

in

Biology

Cyclin D1 gene polymorphism in Egyptian breast cancer women

Keywords: Breast Cancer, Cyclin D1, Polymorphism, Egypt

ABSTRACT: Background: Cyclin D1, a key regulator of G1 to S phase progression of the cell cycle, is strongly established as an oncogene with an important pathogenetic role in many human tumors; therefore any genetic variations that disturb the normal function of this gene product is ultimately a target for association with cancer risk and survival. Cyclin D1 silent mutation (G870A) in the splicing region of exon-4 enhances alternative splicing, resulting two CCND1 mRNA transcripts variant [a] and [b], in which transcript b has a longer half-life. It has been deduced that G870A polymorphism of the CCND1 gene may play a role in tumorigenesis. The aim of our study was to investigate the influence of CCND1 genotypes on the genetic susceptibility to breast cancer in Egyptian population. Patients and Methods: 80 newly diagnosed females representing Egyptian population confirmed breast cancer patients and 40 healthy controls were included in the study. Single nucleotide polymorphism (SNP) in CCND1 (G870A) was determined in these samples by polymerase chain reaction- restriction fragment length polymorphism (PCR-RFLP). Results: The frequencies of AG, AA genotypes between patients group and the healthy control group have shown a significant difference at (p=0,009). Subjects less than 45 years of age with AA genotype were at decreased risk (οdds ratio 0.438, 95% confidence interval 0.251-0.763) and postmenopausal subjects with AA genotype were at increased risk of developing breast cancer (οdds ratio 5.056, 95% confidence interval 1.239-20.626). We found that breast cancer females carrying A allele had longer DFS than did patients with GG genotype (p=0,001). Conclusion: This study provides the first indication that CCND1 870A alleles (AA/AG genotypes) are risk factors for breast cancer susceptibility in Egyptian women. Thus analysis of CCND1 G870A polymorphism may be useful for identifying females with higher risk to develop breast cancer.

1111-1121| JRB | 2014 | Vol 3 | No 8

This article is governed by the Creative Commons Attribution License (http://creativecommons.org/

licenses/by/2.0), which gives permission for unrestricted use, non-commercial, distribution and reproduction in all medium, provided the original work is properly cited.

www.jresearchbiology.com

Journal of Research in Biology

An International

Scientific Research Journal

Authors: Ibrahim HAM1, Ebied SA1,

Abd El-Moneim NA2 and

Hewala TI3.

Institution:

1. Department of Applied

Medical Chemistry,

Medical Research Institute,

Alexandria University,

Egypt.

2. Department of Cancer

Management and Research,

Medical Research Institute,

Alexandria University,

Egypt.

3. Department of Radiation

Sciences, Medical Research

Institute, Alexandria

University, Egypt.

Corresponding author:

Ibrahim HAM

Web Address: http://jresearchbiology.com/

documents/RA0396.pdf.

Dates: Received: 09 Oct 2013 Accepted: 17 Dec 2013 Published: 06 Feb 2014

Journal of Research in Biology An International Scientific Research Journal

Original Research

INTRODUCTION:

Breast cancer has become the leading cause of

cancer death for females in Egypt. It represents 31% of

all cancers diagnosed and 15% of all cancer death and

the incidence is increasing worldwide (Coral and Amy,

2010). Molecular biological studies have clearly

indicated that genetic alteration play significant role in

the development of breast carcinoma in some cases and

they addressed by better understanding of what genetic/

epigenetic events are likely to be associated with the

earliest phases of the disease (Sadikovic et al., 2008).

Cyclin D1 protein (35-KDa) is established as an

oncogene, gene considered as one of the human D-type

cyclin genes which encoded by the 5 exons and mapped

to chromosome bands 11q13 (Haber and Harlow, 1997).

Cyclin D1 proto oncogene acts as a growth sensor target

of proliferative signals in G1, by regulating the cell cycle

progression from G1-to- S phase transition in different

cell type from various tissues (Donnellan and Chetty,

1998; Baldin et al.,1993). Cyclin D1 active complexes

that phosphorylate and inactivate the retinoblastoma

tumor suppressor protein (RB), are formed by the

binding of cyclin D1 to its dependent kinases 4 and 6

(CDK4/6). Hyperphosphorylation of RB in early G1

phase allows to bind active RB to E2F transcription

factors and stimulates the cell cycle entry into S phase

(Sherr, 1993; Alao et al.,2006). Several studies have

demonstrated that cyclin D1 can also act as a

transcriptional co-factor for steroid hormone receptors

e.g., estrogen receptor (Neuman et al.,1997; Tashiro

et al.,2007). CCND1 overexpression occurs in a number

of cancers including breast cancer, conversely repression

of CCND1 gene expression is a hallmark of cell

differentiation (Gillett et al.,1996; James et al., 2006).

Moreover, Robert and Elizabeth (Sutherland and

Musgrove, 2002) reported that the cyclin d1 gene is

amplified in up to 20% of breast cancer patients and

overexpression occurs in more than 50% of mammary

tumors, and this appears to be an early event in the breast

cancer (Buckley et al.,1993). On the other hand it is also

demonstrated by a correlation between CCND1

overexpression and cellular metastasis (Drobnjak et al.,

2000). Silent polymorphism (G870A, pro241pro) occurs

in cyclin D1 coding gene, this commonly available SNP,

affects the exon 4/intron 4 splice donor site and leads to

two different variants of the cyclin D1 mRNA (Betticher

et al.,1995). Diverse studies demonstrated that variant

transcript (a) has carried all exons whereas variant (b)

lack exon 5 including a PEST domain, which was

hypothesized to acts as a degradation motif. It has been

shown that variant transcript b lead to a longer half- life

of cyclin D1 (Betticher et al.,1995; Sawa et al.,1998).

Furthermore, cyclin D1 transcript (b) was appear to be

weakly catalyst of RB phosphorylation / inactivation and

significantly enhanced cell transformation activity

compared to cyclin D1 transcript (a) (Solomon et al.,

2003). It has been proved that the cyclin D1 isoform

(cyclin D1b) is an unclear oncogene which is generated

via CCND1 mRNA alternative splicing and involved in

tumorigenesis through promoting the transition between

G1 and S phases (Sawa et al.,1998; Solomon et al.,

2003; Lu et al., 2003). Numerous studies have been

examined on the correlation between cyclin D1

polymorphism and risk of breast cancer, but those studies

yielded conflicting results (Grieu et al., 2003; Ceschi

et al., 2005; Yu et al.,2008; Forsti et al., 2004; Krippl

et al., 2003; Wang et al., 2002). The aim of our study

was to investigate the influence of CCND1 genotypes on

the genetic susceptibility to breast cancer in the Egyptian

population.

MATERIALS AND METHODS:

All patients (n=80) who had experienced primary

invasive breast carcinoma, with median age 52.0 (range

32.0-77.0) years, at the Experimental and Clinical

Surgery and Cancer Management and Research

Departments, Medical Research Institute, Alexandria

University From 2008 to 2012, were enrolled in this

Ibrahim et al., 2014

1112 Journal of Research in Biology (2014) 3(8): 1111-1121

study. The samples were collected before surgery or any

chemotherapeutic treatment. Blood samples were taken

from patients who had pathological diagnosis and had

not undergone blood transfusion or receiving

immunomodulatory agent. The non tumor control group

(n=40), with median age 49.50 (range 36.0-71.0) years,

was composed of healthy women volunteers clinically

free from any chronic disease. Questionnaires, medical

records, and pathological reports were used to confirm

the diagnosis and cancer status. This study protocol was

approved by the Local Ethical Committee at Alexandria

University.

CCND1 genotyping

5-mL blood samples were obtained from cases

and controls. The samples were collected in tubes

containing EDTA and genomic DNA was purified from

peripheral whole blood using a ready- for use DNA

extraction kit (QIA amp DNA Blood mini kit, Qiagen,

Hilden, Germany). Genotyping was performed by

polymerase chain reaction (PCR) and restriction

fragment length polymorphism (RFLP) (Enayat, 2002;

Onay et al., 2008), using semi quantitatively

conventional polymerase chain reaction (PCR) kits

(Qiagen, Germany) according to producer’s instructions.

For amplifying CCND1 gene we used the following

primers, Forward primer:5´- GTTTTCCCAGTCACGAC

-3´;Reverse primer: 5´ GGGACATCACCCTCACTTAC

-3´_; The CCND1 G870A polymorphism specific

primers were ordered from QIAGEN system (QIAGEN,

Germany) to amplify a 167-bp fragment of CCND1 gene

at exon 4/intron 4. The PCR reactions were performed on

a thermal cycler (Biometra- TProfessional Thermocycler

-Germany) and the cycling program was programmed

according to the manufacturer’s protocol. Specifically,

these reactions were carried out in a total volume 50 μl

of QIAGEN Multiplex PCR Master Mix 25 μl, primer

mix (2 μl taken from each 20μM primer working

solution) 4 μl and Template DNA 21 μl.

Each PCR started within the initial heat-

activation program to activate Hot Star Tag DNA

polymerase (95°C for 15 min), followed by 35 cycles of

denaturation at 94°C for 30 sec, annealing at 55°C for 90

sec, and extension at 72°C for 90 sec, with a final

extension step at 72°C for 10 minutes. For RFLP

analyses, each PCR product was subjected to ScrF1

restriction enzyme (New England, BioLabs Inc, UK).

According to the manufacture’s protocol, 1 unit of

restriction enzyme digests 1 μg of substrate DNA in a 50

μl reaction in 60 minutes. Agarose gel electrophoresis

was used as the appropriate detection system. This gave

a satisfactory signal with our PCR product. The DNA

fragments were separated using 2% agarose gel

containing ethidium bromide and the bands on the gel

were visualized by using UV Transilluminator.

The allele types were determined, GG genotype

showed two fragments (145 and 22bp), AG genotype

showed three fragments (167, 145, and 22 bp) and AA

genotype showed single fragment (167-bp).

Statistical Analysis

Predictive Analytics Software (PASW Statistics

18) for Windows (SPSS Inc, Chicago, USA) was used

for statistical analysis. Chi-square test and Firsher’s

Exact test (When more than 20% of the cells have

expected count less than five) were used for testing

Association between categorical variables. Quantitative

data were described using median, minimum and

maximum as well as mean and standard deviation.

Parametric and non-parametric tests were applied for

analyzed normal data and abnormally distributed data,

respectively. Odd ratio (OR) and 95% Confidence

Interval (CI) were used. Significance test results are

quoted as two-tailed probabilities. Significance of the

obtained results was judged at the 5% level.

RESULTS

The clinical profile of breast cancer patients

included in the current study presented in table (1). The

Ibrahim et al., 2014

Journal of Research in Biology (2014) 3(8): 1111-1121 1113

frequencies of GG, AG and AA genotypes were 37.5%,

20% and 42.5% respectively, in healthy controls

and16.3%, 28.8% 55.0% respectively, in patients group.

The statistical analyses of these results revealed that, in

comparison with that in control group CCND1 (G870A)

AG and AA genotypes frequencies in breast cancer

patients were insignificantly higher, whereas CCND1

(G870A) GG genotype frequency was significantly

lower (p= 0.009).Our results revealed that, frequencies of

the three genotypes GG, AG and AA between patients

and controls were significantly different (p =0.034,

table 2).

Table 3 shows the results of the CCND1

genotype effects on breast cancer risk. AA, AG were at

increased risk for developing breast cancer compared

with the GG genotype [OR= 2.986, 95%CI (1.178-

7.569); p= 0.019 and OR= 3.317, 95% CI (1.110-9.915);

p= 0.029, respectively]. In addition AA also had a higher

risk in postmenopausal women [OR=5.056, 95% CI

(1.239-20.626); p= 0.019] than premenopausal ones

[OR= 1.870, 95% CI (0.530-6.603); p= 0.328], table

(3a), and had reduced risk in younger women [<45 y/o,

OR=0.438, 95% CI (0.251-0.763); p= 0.046] than elder

ones[≥ 45 y/o, OR= 2.423, 95% CI (0.804-7.300);

p= 0.111], table (3b). Association of different CCND1

G870A polymorphic variants among breast cancer

patients with pathological features were shown in table

(4). There was no significant differences with (p=0.688)

Ibrahim et al., 2014

1114 Journal of Research in Biology (2014) 3(8): 1111-1121

Clinical characteristics Normal subjects (n = 40) Breast cancer patients n = 80) Test of significance

(P- value) No % No %

Age (years)

< 45 15 37.5 11 13.8 X2 test

(P = 0.454) ≥ 45 25 62.5 69 86.3

Range 36.00 –71.00 32.00 – 77.00

Student T test (P = 0.198)

Mean ± SD 50.15 ± 9.43 52.62 ± 10.07

Median 49.50 52.0

Menopausal status

X2test

X2P = 0.698 Premenopausal 20 50.0 37 46.3

Postmenopausal 20 50.0 43 53.8

Table 1: Characteristics of normal healthy controls and breast cancer patients

x2p: p value for Chi square test *: Statistically significant at p < 0.05

Normal healthy controls (n=40) Breast cancer patients (n = 80 )

p No. % No. %

Polymorphic variants

GG 15 37.5 13 16.33 0.009*

AG 8 20.0 23 28.80 0.302

AA 17 42.5 44 55.00 0.197

p 0.034*

Table 2: Frequencies of CCND1 G870A genotype in breast cancer patients and controls

p: p value for Chi-square test *: Statistically significant at p ≤ 0.05

in the CCND1 genotypes distribution between stage T3

and T4 tumors. Breast cancer patients carrying the

CCND1 A allele had a 1.04-fold increased risk for lymph

node metastasis but this was not statistically significant

(p=1.000). The CCND1 genotypes were furthermore not

associated with vascular invasion in carrier A allele

patients was higher when compared with G allele carriers

and this difference was statistically insignificant

(p=0.717). In addition breast cancer patients carrying A

allele (AA/AG genotypes) were at reduced risk of

metastasis [OR= 0.247, 95%CI (0.072-0.848); p= 0.020]

when compared with those carrying GG genotype.

Kaplen Meir disease free survival (DFS) curve was

constructed to study the prognostic value of CCND1

G870A genotypes. The median fallow up period 25

months (range 18-48 months) in which 22(27.5%) out of

80 patients had metastasis. The incidence of metastasis

was observed in 53.9% of patients with GG genotype

and 46.2% of patients carrying A allele (AA / AG

genotypes) (table 5). Survival curve of the different

Ibrahim et al., 2014

Journal of Research in Biology (2014) 3(8): 1111-1121 1115

Healthy control group

(n=40)

Breast cancer patients

(n=80) Test of sig OR ( 95% CI)

(lower– upper) No % No %

All participants

GG® 15 37.5 13 16.33 1.000 (reference)

AG 8 20.0 23 28.80 P = 0.029* 3.317 (1.110-9.915)

AA

AA+ AG

17

25

42.5

62.5

44

67

55.00

83.80

P = 0.019*

P = 0.009*

2.986 (1.178-7.569)

3.092 (1.291-7.405)

Table (3): Association of CCND1 G870A polymorphism with breast cancer risk

p: p value for Chi-square tes FEp : p value for Fisher Exact test

*: Statistically significant at p ≤ 0.05

Table (3a): Association of CCND1 G870A polymorphism with breast cancer risk

Healthy control group

(n=15) Breast cancer patients (n=11)

Test of sig OR ( 95% CI)

(lower– upper) No % No %

Women ages <45 years

GG® 6 40.0 0 00.0 1.000 (reference)

AG 2 13.3 2 18.2 FEp = 0.133 0.500 (0.188-1.332)

AA

AA+ AG

7

9

46.7

60.0

9

11

81.8

100.0

FEp = 0.046*

FEp= 0.024*

0.438 (0.251-0.763)

0.450 (0.277-0.731)

Healthy control group

(n=25) Breast cancer patients(n=69)

Test of sig OR ( 95% CI)

(lower– upper) No % No %

Women ages ≥ 45 years

GG® 9 36.0 13 18.8 1.000 (reference)

AG 6 24.0 21 30.4 p = 0.158 2.423 (0.699-8.400)

AA

AA+ AG

10

16

40.0

64.0

25

56

50.7

81.2

p = 0.111

P = 0.083

2.423 (0.804-7.300)

2.423 (0.878-6.689)

p: p value for Chi-square tes FEp : p value for Fisher Exact test

*: Statistically significant at p ≤ 0.05

genotypes are shown in Fig. 1. A significant association

between the genotypes and survival was found in the

patients (p < 0.001). Furthermore, patients with GG

genotype had a worse prognosis and short survival

(24.0±1.13 months) than patients carrying A allele (AA /

AG genotypes) (41.92±1.20 months).

DISCUSSION:

Cyclin D1 (CCND1) is considered as one of the

proteins that acts within a regulatory circuit that

dominate cell cycle G1 to S-phase transition (Diehl,

2002). Moreover, it is proved that cyclin D1 acts as a

dual function in promoting cell proliferation and

inhibiting drug- induced apoptosis; these finding are

attributed to the presence of a chemoresistance during

overexpression (Biliran et al., 2005). In a normal breast,

cyclin D1 protein plays uncompensated roles in

mammary gland development during different growth

cycles, whereas, enhanced oncogenic transformation and

tumorigenesis, of the CCND1 gene may be a primary

and early step in breast cancer formation (Fu et al.,

2004). It is found that 45-50% of human breast

carcinoma types are over expressed by the oncogenic

CCND1 mRNA (Sutherland and Musgrove, 2002).

Possible correlations between CCND1 gene

polymorphism and breast cancer susceptibility were

studied in different population and produced inconsistent

results. In the present study, we noticed that CCND1

AA, AG and AA/AG genotype frequencies were more

frequently observed in cases, whereas GG genotype

frequency was significantly higher in controls.

Furthermore, genotype distribution between patient

group and controls are markedly different, suggesting

that CCND1 G870A polymorphism is associated to

breast cancer susceptibility. These observations were in

concordance with previous findings suggesting that

CCND1 genotype is associated with the breast cancer

risk (Yu et al., 2008; Forsti et al., 2004). Multiple and

specialized studies were conducted to evaluate the

CCND1 polymorphic variants and breast cancer patients

from different ethnic groups. Yu et al., (2008) conducted

a study in China and found that cyclin D1 G870A

polymorphism lead a potential contribution to breast

cancer with superiority occurrence of breast cancer in

young women.

In the present series, Lu et al., (2009) conducted

a Meta analysis on the association between CCND1

G870A polymorphism and breast cancer susceptibility,

Ibrahim et al., 2014

1116 Journal of Research in Biology (2014) 3(8): 1111-1121

Table (3b): Association of CCND1 G870A polymorphism with breast cancer risk

Healthy control group

(n=21) Breast cancer patients(n=34)

Test of sig OR ( 95% CI)

(lower– upper) No % No %

Premenopausal status

GG® 8 83.1 7 20.6 1.000 (reference)

AG 2 9.5 9 26.5 FEp = 0.109 5.143 (0.819-32.302)

AA

AA+ AG

11

13

52.4

61.9

18

27

52.9

79.4

p = 0.328

P = 0.157

1.870 (0.530-6.603)

2.374 (0.707-7.969)

Healthy control group

(n=19) Breast cancer patients (n=46)

Test of sig OR ( 95% CI)

(lower– upper) No % No %

Postmenopausal status

GG® 7 36.8 6 13.0 1.000 (reference)

AG 6 31.6 14 30.4 p = 0.171 2.722 (0.638-11.610)

AA

AA+ AG

6

12

31.6

63.2

26

40

56.5

87.0

p = 0.019*

P = 0.029*

5.056 (1.239-20.626)

3.889 (1.095-13.806)

p: p value for Chi-square tes FEp : p value for Fisher Exact test

*: Statistically significant at p ≤ 0.05

he observed that the Caucasian population which

increased breast cancer susceptibility were carrying a

variant 870 A allele, however, it is not observed in the

Asians. The study reviewed that genetic and

environmental factors might also contribute to the ethnic

difference. In contrast, some studies reported that there

was no association between CCND1 polymorphic

variants and susceptibility to breast cancer (Grieu et al.,

2003; Krippl et al., 2003; Shu et al., 2005).

In the present study, We found that individuals

carrying A allele of CCND1 G870A polymorphism (AA,

AG, AA/AG) had a 2.9, 3.3 and 3.1 fold increased risk

for the development of breast cancer compared with

those carrying GG genotype (P=0.019, P=0.029,

P=0.009) respectively. These finding could be

interpreted in view of Betticher et al., (1995) who

indicated that the alternative splicing and production of

altered transcript b occurs in individuals those carrying

Journal of Research in Biology (2014) 3(8): 1111-1121 1117

Ibrahim et al., 2014

AA+AG GG® Test of sig

OR ( 95% CI)

(lower– upper) No % No %

Tumor pathological grade

FEp =0.679 2.357 (0.277-20.033)

II ® 56 83.6 12 92.3

III 11 16.4 1 7.7

Clinical stage

p = 0.688 0.784 (0.238-2.579) II ® 35 52.2 6 46.2

III 32 47.8 7 53.8

Tumor size (cm)

p = 0.363 0.571 (0.169-1.928) < 5® 35 52.2 5 38.5

≥ 5 32 47.8 8 61.5

Lymph node involvements

FEp= 1.000 1.040 (0.253-4.270) -ve® 15 22.4 3 23.1

+ve 52 77.6 10 76.9

Estrogen receptor status

FEp= 0.515 1.778 (0.170-18.560) -ve® 3 4.5 1 7.7

+ve 64 95.5 12 92.3

Progesterone receptor status

FEp=0.610 1.848 (0.330-10.367) -ve® 6 9.0 2 15.4

+ve 61 91.0 11 84.6

Her2/neu expression

FEp= 0.374 0.452 (0.102-1.999) -ve® 59 88.1 10 76.9

+ve 8 11.9 3 23.1

Vascular invasion

FEp= 0.717 1.246 (0.300-5.182) -ve® 13 19.4 3 23.1

+ve 54 80.6 10 76.9

Metastasis

p = 0.020* 0.247 (0.072-0.848) -ve® 52 77.6 6 46.2

+ve 15 22.4 7 53.8

Table (4): Association of CCND1 G870A polymorphism with clinicopathological features of breast cancer

p: p value for Chi-square test FEp : p value for Fisher Exact test *: Statistically significant at p ≤ 0.05

the homozygosity for CCND1 A allele that may have

longer half-life. Therefore cells will damaged DNA

carrying A allele of CCND1 G870A polymorphism may

bypass G1/S check point easily compared to GG

genotype. Also the study of Sawa et al., (1998) shown

that inhibition to the entry of the S phase in the cell cycle

is occurred within high level of normal transcript a

occurrence. All these observations lead to proved that

different polymorphic CCND1 variants affect the

biological behavior of the cells, thus altering the risk of

developing breast cancer.

Moreover, our results revealed that breast cancer

female patients < 45 years of age carrying AA or

combined variant AA/AG genotypes were at decreased

risk of breast cancer than those with GG genotype. These

finding are confirmed with the report of Shu et al.,

(2005) who stated that the A allele of the CCND1

G870A polymorphism was only weakly associated with

the risk of breast cancer among women ages < 45 years.

These results lead us to predict that variant 870A allele

may play a role in increasing estrogen metabolism and

inhibiting cell proliferation (Sutherland and Musgrove,

2002). On the other hand postmenopausal females

carrying AA or combined variant (AA/AG genotypes)

were at increased risk for breast cancer when compared

with those carrying GG genotype. These findings agreed

with the report of Grieu et al., (2003) who stated that A

allele of CCND1 G870A polymorphism might play a

more important role in the development of breast cancer

among postmenopausal females.

Furthermore, we evaluated the association of

CCND1 G870A polymorphism with clinicopathological

Ibrahim et al., 2014

1118 Journal of Research in Biology (2014) 3(8): 1111-1121

Figure 1: Kaplan-Meier disease free survival for CCND1 G870A genotypes

Metastasis

N =22 Non Metastasis

N = 58 Median (Mean ± SE)

DFS (months) Log rank p

GG (N= 13) 7 (53.9%) 6 (46.2%) 24.0 (23.14 ± 1.30)

26.617*

<0.001 AG/AA (N=67) 15 (22.4%) 52 (77.6%) 44.0 (41.92 ± 1.20)

Table (5): Association of CCND1 G870A genotypes with breast cancer disease free survival (DFS)

*: Statistically significant at p<0.05

features of breast cancer patients. We did not find any

significant association of carrying the A allele with

tumor pathological grade III, clinical stage III, tumor size

≥ 5, axillary lymph node involvement, +ve hormone

receptors status, +ve Her2/neu expression or vascular

invasion. These results may be attributed to the small

sample size which limited our ability to detect a

significant difference.

The correlation between CCND1 (A870G)

polymorphism and cancer progression produced different

results. It is found that, carrying of 870A allele in

patients with advanced preinvasive neoplasia of the

larynx and/or oral cavity was positively correlated with

CCND1 expression and poor disease prognosis (Izzo

et al., 2003).

Also in non-small cell lung cancer the A allele of

CCND1 (G870A) polymorphism had a more favorable

disease free-survival and showed positive association

with increasing risk of local relapse (Betticher

et al.,1995). In contrast to results, a study on ovarian

cancer revealed that CCND1 polymorphic variants were

not associated with the overall survival. On the other

hand there was a positive correlation between 870A

allele and early disease occurrence (Dhar et al., 1999).

Also the results of the study including 339 patients in

CCND1 G870A polymorphism with breast cancer

survival appear to be a null association with breast

cancer prognosis (Grieu et al., 2003). These different

results on CCND1 genotype and cancer prognosis may

be attributable to the cancer features in the study,

preparation design and treatment systems. Notably after

a median 25 months of fallow up, only 27.5% of our

patients had metastasis of their breast cancer, suggesting

that 72.5% of those patients are doing well in the short

term with improvement in therapy. In the present study

we found that carrying the A allele of CCND1 G870A

polymorphism was related to a longer disease free

survival for breast cancer than patients with GG

genotype (p < 0.001). The favorable DFS for breast

cancer patients carrying the A allele of CCND1 G870A

despite its positive association with increased risk of

breast cancer could be attributed to the induction of

cyclin D1 degradation by chemotherapy, causing cell

death and apoptosis (Zhou et al., 2001).

In conclusion, this study provides the first

indication that CCND1 870A allele (AA/AG genotypes)

is risk factors for breast cancer susceptibility in Egyptian

women. Thus analysis of CCND1 G870A polymorphism

may be useful for identifying females with higher risk to

develop cancer. As compared with CCND1 870A allele

and, CCND1 GG genotypes were significantly associated

with shorter disease free survival in breast cancer

patients. Therefore analysis of these genes may also be

useful in identifying the breast cancer patients that have a

high risk of relapse and most likely to be benefit from the

adjuvant chemotherapy.

REFERENCES

Alao JP, Gamble SC, Stavropoulou AV, Pomeranz

KM, Lam EW, Coombes RC, Vigushin DM. 2006.

The cyclin D1 proto-oncogene is sequestered in the

cytoplasm of mammalian cancer cell lines. Mol Cancer

5: 7.

Baldin V, Lukas J, Marcote MJ, Pagano M, Draetta

G. 1993. Cyclin D1 is a nuclear protein required for cell

cycle progression in G1. Genes Dev. 7(5): 812-21.

Betticher DC, Thatcher N, Altermatt HJ, Hoban P,

Ryder WD, Heighway J.1995. Alternate splicing

produces a novel cyclin D1 transcript. Oncogene 11:

1005-11.

Biliran H Jr, Wang Y, Banerjee S, Xu H, Heng H,

Thakur A, Bollig A, Sarkar FH, Liao JD. 2005.

Overexpression of cyclin D1 promotes tumor cell growth

and confers resistance to cisplatin-mediated apoptosis in

an elastase-myc transgene-expressing pancreatic tumor

cell line. Clin Cancer Res., 11(16):6075-86.

Ibrahim et al., 2014

Journal of Research in Biology (2014) 3(8): 1111-1121 1119

Buckley MF, Sweeney KJE, Hamilton JA, Sini RL,

Manning DL, Nicholson RI, deFazio A, Watts CKW,

Musgrove EA, Sutherland RL .1993. Expression and

amplification of cyclin genes in human breast cancer.

Oncogene 8:2127-2133.

Ceschi M, Sun CL, Van Den Berg D, Koh WP, Yu

MC, Probst-Hensch N. 2005. The effect of cyclin D1

(CCND1) G870A-polymorphism on breast cancer risk is

modified by oxidative stress among Chinese women in

Singapore. Carcinogenesis 26: 1457-64.

Coral O and Amy T. 2010. The Differences between

Male and Female Breast Cancer: In Principles of gender-

specific medicine (2th ed.). Marianne J L (eds). Elsevier

Inc (pub) 42(7): 459-69.

Dhar KK, Branigan K, Howells REJ Musgrove C,

Jones PW, Strange RC, Fryer AA, Redman CWE,

Hoban PR. 1999. Prognostic significance of cyclin D1

gene (CCND1) polymorphism in epithelial ovarian

cancer. Int J Gynecol Cancer. 9(4):342 –347.

Diehl JA. 2002. Cycling to cancer with cyclin D1.

Cancer Biol Ther., 1(3):226-31.

Donnellan R and Chetty R. 1998. Cyclin D1 and

human neoplasia. Mol Pathol., 51: 1-7.

Drobnjak M, Osman I, Scher HI, Fazzari M, Cordon-

Cardo C. 2000. Overexpression of cyclin D1 is

associated with metastatic prostate cancer to bone. Clin

Cancer Res., 6:1891-5.

Enayat MS. 2002. Restriction fragment length

polymorphism. In: Methods of in molecular biology,

PCR mutation detection protocols. Theophilus B D M,

Rapley R (eds). Human press Inc (pub), 5: 39-35.

Försti A, Angelini S, Festa F, Sanyal S, Zhang Z,

Grzybowska E, Pamula J, Pekala W, Zientek H,

Hemminki K, Kumar R.2004. Single nucleotide

polymorphisms in breast cancer. Oncol Rep., 1:917-22.

Fu M, Wang C, Li Z, Sakamaki T, Pestell RG. 2004.

Minireview: Cyclin D1: normal and abnormal functions.

Endocrinology 145(12):5439-47.

Gillett C, Smith P, Gregory W, Richards M, Millis R,

Peters G, Barnes D. 1996. Cyclin D1 and prognosis in

human breast cancer. Int J Cancer. 69(2):92-9.

Grieu F, Malaney S, Ward R, Joseph D, Iacopetta B.

2003. Lack of association between CCND1 G870A

polymorphism and the risk of breast and colorectal

cancers. Anticancer Res 23: 4257-9.

Haber D, Harlow E. 1997. Tumour-suppressor genes:

Evolving definitions in the genomic age. Nature Genetics

16: 320-322.

Izzo JG, Papadimitrakopoulou VA, Liu DD, den

Hollander PL, Babenko IM, Keck J, El-Naggar AK,

Dong M. Shin, Jack Lee J, Waun K. Hong and

Walter N. Hittelman. 2003. Cyclin D1 genotype,

response to biochemoprevention, and progression rate to

upper aerodigestive tract cancer. J Natl Cancer Inst 95

(3):198 – 205.

James CG, Woods A, Underhill TM, Beier F. 2006.

The transcription factor ATF3 is upregulated during

chondrocyte differentiation and represses cyclin D1 and

A gene transcription. 7:30.

Krippl P, Langsenlehner U, Renner W, Yazdani-

Biuki B, Wolf G, Wascher TC, Paulweber B, Weitzer

W, Leithner A, Samonigg H. 2003. The 870G>A

polymorphism of the cyclin D1 gene is not associated

with breast cancer. Breast Cancer Res Treat 82: 165-8.

Lu C, Dong J, Ma H, Jin G, Hu Z, Peng Y, Guo X,

Wang X, Shen H. 2009. CCND1 G870A polymorphism

contributes to breast cancer susceptibility: a meta-

analysis. Breast Cancer Res Treat 116: 571-5.

Ibrahim et al., 2014

1120 Journal of Research in Biology (2014) 3(8): 1111-1121

Lu F, Gladden AB, Diehl JA . 2003. An alternatively

spliced cyclin D1 isoform, cyclin D1b, is a nuclear

oncogene. Cancer Res., 63: 7056-61.

Neuman E, Ladha MH, Lin N, Upton TM, Miller SJ,

DiRenzo J, Pestell RG, Hinds PW, Dowdy SF, Brown

M, Ewen ME. 1997. Cyclin D1 stimulation of estrogen

receptor transcriptional activity independent of cdk4.

Mol Cell Biol., 9: 5338-47.

Onay UV, Aaltonen K, Briollais L, Knight JA,

Pabalan N, Kilpivaara O, Andrulis IL, Blomqvist C,

Nevanlinna H, Ozcelik H. 2008. Combined effect of

CCND1 and COMT polymorphisms and increased breast

cancer risk. BMC Cancer 8: 6.

Sadikovic B, Al-Romaih K, Squire JA and Zielenska

M. 2008. Cause and Consequences of Genetic and

Epigenetic Alterations in Human Cancer. Current

Genomics 9(6): 394 - 408.

Sawa H, Ohshima TA, Ukita H, Murakami H, Chiba

Y, Kamada H, Hara M, Saito I. 1998. Alternatively

spliced forms of Cyclin D1 modulate entry into the cell

cycle in an inverse manner. Oncogene 16: 1701-12.

Sherr CJ. 1993. Mammalian G1 cyclins. Cell.73:

1059-1065.

Shu XO, Moore DB, Cai Q, Cheng J, Wen W, Pierce

L, Cai H, Gao YT, Zheng Wl. 2005. Association of

cyclin D1 genotype with breast cancer risk and survival.

Cancer Epidemiol Biomarkers Prev., 1(14): 91-7.

Solomon DA, Wang Y, Fox SR, Lambeck TC,

Giesting S, Lan Z, Senderowicz AM, Conti CJ,

Knudsen ES. 2003. Cyclin D1 splice variants:

Differential effects on localization, RB phosphorylation,

and cellular transformation. J Biol Chem., 278: 30339-

30347.

Sutherland RL, Musgrove EA. 2002. Cyclin D1 and

mammary carcinoma: new insights from transgenic

mouse models. Breast Cancer Res 4(1):14-7. Epub 2001

Nov 30.

Tashiro E, Tsuchiya A, Imoto. 2007. Functions of

cyclin D1 as an oncogene and regulation of cyclin D1

expression. Cancer Sci., 98:629-35.

Wang L, Habuchi T, Takahashi T, Mitsu K, Kamoto

T, Kakehi Y, Kakinuma H, Sato K, Nakamura A,

Ogawa O and Kato T. 2002. Cyclin D1 gene

polymorphism is associated with an increased risk of

urinary bladder cancer. Carcinogenesis 23(2): 257-264.

Yu CP, Yu JC, Sun CA, Tzao C, Ho JY, Yen AM.

2008. Tumor susceptibility and prognosis of breast

cancer associated with the G870A polymorphism of

CCND1. Breast Cancer Res Treat. 107: 95-102.

Zhou Q, Hopp T, Fuqua SA, Steeg PS. 2001. Cyclin

D1 in breast premalignancy and early breast cancer:

implications for prevention and treatment. Cancer Lett.,

162(1):3 – 17.

Ibrahim et al., 2014

Journal of Research in Biology (2014) 3(8): 1111-1121 1121

Submit your articles online at www.jresearchbiology.com

Advantages

Easy online submission Complete Peer review Affordable Charges Quick processing Extensive indexing You retain your copyright

submit@jresearchbiology.com

www.jresearchbiology.com/Submit.php.

An International Scientific Research Journal       JJJJoooouuuurrrrnnnnaaaallll ooooffff RRRReeeesssseeeeaaaarrrrcccchhhh iiiinnnn BBBBiiiioooollllooooggggyyyy            

Original Research  

Role of p73 polymorphism in Egyptian breast cancer patients as  

JournalofResearch

inBio

logy

Authors:

Ibrahim HAM1, Ebied SA1, Abd El-Moneim NA2 and Hewala TI3.

Institution: 1. Department of Applied

Medical Chemistry, Medical

Research Institute,

Alexandria University,

Egypt.

2. Department of Cancer

Management and Research,

Medical Research Institute,

Alexandria University,

Egypt.

3. Department of Radiation

Sciences, Medical Research

Institute, Alexandria

University, Egypt.

Corresponding author: Ibrahim HAM

Web Address: http://jresearchbiology.com/ documents/RA0397.pdf.

molecular diagnostic markers 

ABSTRACT:

Background:

The incidence of breast cancer in Egyptian women is rising; to date, a few

susceptibility genes have been identified. p73 protein (also known as p53-like transcription

factor or p53-related protein) is one of the ancestors of the tumor suppressor p53 protein,

whose gene is located within the chromosomal loci 1p36; a region most frequently deleted in

human cancers. As a consequence of sharing same domain architecture with p53; p73 might

regulate p53- response genes and induced cell cycle arrest/ apoptosis in response to DNA

damage. A commonly studied non-coding polymorphism consisting of a double nucleotide

substitutions (G→A) and (C→T) at position 4 and 14 exon 2, situated upstream of the initial AUG

regions of p73. This functional consequence of p73 polymorphism may serve as a susceptibility

marker for human cancer, but the results are inconsistent.

Patients and Methods:

Eighty newly diagnosed females representing Egyptian population confirmed breast

cancer patients and forty healthy controls, recruited from the departments of Experimental and

Clinical Surgery and Cancer Management and Research, Medical Research Institute, Alexandria

University. Single Nucleotides Polymorphism (SNP) in p73 gene (G4C14-to-A4T14) was

determined in these samples by PCR-CTPP techniques.

Results:

Insignificant differences in the distributions of p73 genotypes between patients and

controls were observed (p = 0.126). When p73 GC/GC genotype was used as the reference, the

combined variant genotypes (AT/AT)/(GC/AT) was significantly associated with the risk for

breast cancer [OR= 2.418, 95% CI (1.018-5.746); p= 0.042]. p73 [(GC/AT) /(AT/AT) genotypes]

was found to be associated with increased risk for breast cancer among women with

pathological grade III, clinical stage III, tumor size ≥ 5 cm, axillary lymph node involvement and

the +ve (Her2/neu) expression, but not significantly associated with +ve ER/PR status, vascular

invasion and metastasis. Furthermore, patients carrying AT variant has a favorable prognosis (p

<0.001) and longer survival (41.33±1.45 months) than did patients carrying GC/GC genotype

(24.0±1.13 months).

Conclusion:

In conclusion, this study provides the first indication that p73 variants (AT/AT)/ (GC/

AT) are risk factors for breast cancer susceptibility in Egyptian women. Thus analysis of p73

G4C14- to- A4T14 polymorphism may be useful for identifying females with higher risk to

develop cancer. Additional studies are needed to confirm these findings.

Keywords:

p73, Cyclin D1, polymorphism, diagnosis, Egypt.

Article Citation:

Ibrahim HAM, Ebied SA, Abd El-Moneim NA and Hewala TI.

Role of p73 polymorphism in Egyptian breast cancer patients as molecular diagnostic

markers.

Journal of Research in Biology (2014) 3(8): 1122-1131

Dates:

Received: 09 Oct 2013 Accepted: 17 Dec 2013 Published: 06 Feb 2014

This article is governed by the Creative Commons Attribution License (http://creativecommons.org/ licenses/by/2.0), which gives permission for unrestricted use, non-commercial, distribution and reproduction in all medium, provided the original work is properly cited.

1122-1131 | JRB | 2014 | Vol 3 | No 8 Journal of Research in Biology

An International

Scientific Research Journal www.jresearchbiology.com

                    

Ibrahim et al., 2014

INTRODUCTION:

The global burden of breast cancer is growing

larger in recent years .It is represent 31% of all cancers

diagnosed and 15% of all cancer death in women (Coral

and Amy, 2010). In Alexandria, Egypt, breast cancer

accounts for 42.7% of malignancies among females

(Alexandria Cancer Registry Annual Report, 2010).

Molecular epidemiology is an emerging new field that

for study not only the genetic and environmental causes

of carcinogenesis, but also interaction between the two

(Perera and Weinstein, 2000). Therefore medicine is

facing a new challenge, which is the identification of

determinations for genetic susceptibility to cancers

including breast cancer and the informations needed to

accomplish this role require an understanding of human

genetic variation (Lyla and Dan, 2006).

Recent breast cancer epidemiologic studies

provide some genetic and epigenetic factors that play a

role in the development of this disease, moreover, they

reported that individuals carrying breast carcinoma have

a high probability to carry one of these factors(Coral and

Amy, 2010).

p73 (Jost et al., 1997), tumor suppressor gene

encoded protein that shares structural and functional

homology with p53 but not identical. p73 gene located

on chromosomal region 1p63, locus is deleted in a

variety of tumorigenesis. Because of these similarities to

p53; p73 possiblely might activate p53 response genes

and induced cell cycle arrest or apoptosis in response to

DNA damage (Kaghad et al.,1997). The wild -type

isoform p73 α , contain 14 exons and gives rise to protein

containing 636 amino acids; it exhibits the same

structure of p53 and both have a transactivation domain

(TA), a DNA binding domain (DBD), and an

oligomerization domain (OD) (Kaghad et al.,1997; Barry

Trink et al., 1998; Thanos and Bowie, 1999). The

supreme similarity among all p53 family members

present within the DNA binding domain indicated that

p73 may bind the same DNA sequences like p53 and

strengthen transcription activation (Kaghad et al.,1997).

A part of p73 structure not present in p53 gene with an

expanded c-terminal region of p73 contains SAM (sterile

alpha motif) which acts as oligomerization domain and

involved in protein- protein interactions and

developmental regulation (Schultz et al., 1997; Ishimoto

et al., 2002).

p73 gene is characterized by two promoters

realizing different classes of proteins, the TAp73 protein

is generated by alternative splicing in the p1 promoter

region located upstream of exon 1, while the other

alternative splicing located in intron 3 in the p2 promoter

region is produceing the acidic NH2 terminally truncated

isoform (ΔNp73) which lack of all or most of the

transactivation domain (Ishimoto et al., 2002; Yang

et al., 2000; Stiewe et al., 2002).

This ΔNp73 acts as a negative inhibitor towards

TAp73 and p53 (Grob et al., 2001). Observed that

overexpression of p73 wild type is common alteration in

carcinogenesis particularly in patients with poor prognosis

(Stiewe and Putzer, 2002; Dominguez et al., 2001),

rather, ∆TA-p73 isoform is significantly detected

excessively in many types of cancers including breast

cancer (Alex et al., 2002; Uramoto et al., 2004; Douc-

Rasy et al., 2002; Casciano et al., 2002).

Two silent single nucleotide polymorphisms

affect the five untranslated region in exon 2 at position

4/14 (G4C14-to-A4T14) produced different variants of

p73 mRNAs (Kaghad et al.,1997). This p73 two linked

polymorphisms located upstream of the initiation AUG

codon of exon 2, causing stem-loop like structure during

transcription initiation thus, altering gene expression

[(Kaghad et al.,1997; Melino et al., 2002). Many of the

studies have examined the correlation between p73 (GC/

AT) polymorphism and the risk of carcinogenesis (De

Feo et al., 2009; Niwa et al., 2004; Li et al., 2004;

Pfeifer et al., 2005).

Though, few studies have been conducted to

investigate the impact of p73 dinucleotides

Journal of Research in Biology (2014) 3(8):1122-1131 1123

                    

Ibrahim et al., 2014

polymorphism on breast cancer susceptibility (Huang

et al., 2003; Li et al., 2006). These studies producing a

confused results. the aim of our study is to determined

whether the p73 GC/AT dinucleotides polymorphism

are the risk factors for breast cancer susceptibility in

Egyptian females, and whether there were any

relationships of the p73 polymorphic variants with

clinicopathological status.

METHODS:

Patients:

All patients (n=80) who have experienced

primary invasive breast carcinoma, with a median age

52.0 ( range 32.0-77.0) years, at the Experimental and

Clinical Surgery and Cancer Management and Research

Departments, Medical Research Institute, Alexandria

University From 2008 to 2012, were enrolled in this

study. The samples were collected before starting any

cancer treatments. Non tumor control group (n=40), with

median age 49.50 (range 36.0-71.0) years, was composed

of healthy women volunteers clinically free from any

chronic disease. Other tools used to confirm our

information were questionnaires and medical reports.

This study protocol was approved by the Local Ethical

Committee at Alexandria University.

p73 genotyping: 5-mL blood samples were

obtained from cases and controls. The samples were

collected in tubes containing EDTA and genomic DNA

was purified from peripheral whole blood using a ready-

for use DNA extraction kit (QIA amp DNA Blood mini

kit, Qiagen, Hilden, Germany). Genotyping was

performed by Polymerase Chain Reaction with

Confronting Two-Pair Primers (PCR-CTPP) [(Hamajima

et al., 2000; Tamakoshi et al., 2003), using semi

quantitatively conventional Polymerase Chain Reaction

(PCR) kits (Qiagen, Germany) according to producer’s

instructions.

According to the published sequence of the human p73

gene, we designed four primers (Forward primer (F1):5 ­

CCACGGATGGGTCTGATCC-3´; Reverse primer

(R1): 5´-GGCCTCCAAGGGCGACTT-3´ and (F2)

Forward primer (F2): 5´-CCTTCCTTCCTGCAGAGCG­

3 ´ ; R e v e r s e p r i m e r ( R 2 ) : 5 ´ ­

TTAGCCCAGCGAAGGTGG-3´; the p73 G4C14-to­

A4T14 polymorphism specific primers were ordered

from QIAGEN system (QIAGEN, Germany) to amplify

a 260-bp fragment of p73 gene. The PCR reactions were

performed on a thermal cycler (Biometra- TProfessional

Thermocycler-Germany) and the cycling program was

programmed according to the manufacturer’s protocol.

Specifically, these reactions were carried out in a total

volume 50 µl of QIAGEN Multiplex PCR Master Mix 25

µl, primer mix (2 µl taken from each 20µM primer

working solution) 8 µl , Template DNA 17 µl. Each PCR

started within the initial heat- activation program to

activate HotStar Tag DNA polymerase (95°C for 15

min), followed by 35 cycles of denaturation at 94°C for

30 sec, annealing at 62°C for 90 sec, and extension at 72

C° for 90 sec, with a final extension step at 72 °C for 10

minutes. Agarose gel electrophoresis was used as the

appropriate detection system. This gave a satisfactory

signal with our PCR product. The DNA fragments were

separated using 2% agarose gel containing ethidium

bromide and the bands on the gel were visualized by

using UV Transilluminator. The allele types were

determined as follows: two fragments of (270-, 428-bp)

for the AA genotype, three fragments of (193- , 270-,

428- bp) for the GA genotype and two fragments of (193

-, 428- bp) for the GG genotype.

Statistical Analysis:

Data were analyzed using the Predictive Analysis

Software (PASW statistics) for windows (SPSS Inc.

Chicago, USA). Association between categorical

variables was tested using Chi – square test and Firsher’s

exact test if more than 20% of the cell has expected

account less than five. Range, mean, standard deviation

and median were used with quantitative data. Parametric

tests were applied that reveals normal data distribution. If

Journal of Research in Biology (2014) 3(8):1122-1131 1124

                    

Ibrahim et al., 2014

data were abnormally distributed, the non parametric

tests were used. Odd ratio (OR) and 95% confidence

interval were used and the P value was assumed to be

significant at the 5% level.

RESULTS:

The clinical profile of breast cancer patients

included in the current study is presented in table (1).

Clinical characteristics of normal healthy female

volunteers and patients with breast cancer were depicted

in table (1). Because the cases and control were

frequency- matched for age, there were no significant

differences in the distributions of age between cases and

control (p=0.45). The genotype frequencies of P73

G4C14/A4T14 polymorphism were analyzed among the

controls and breast cancer patients. The frequencies of

GC/GC, GC/AT and AT/AT genotypes were 31(77.5%),

8(20.0%) and 1(2.5%) for healthy controls and 47

(58.8%), 29(36.3%) and 4(5.0%) for breast cancer

patients, respectively, table (2).

The GC/AT genotypes of p73 G4C14/A4T14

were not correlated with age, table (3a) and

Premenopausal status, table (3b). When p73 GC/GC

genotype was used as the reference, the combined variant

genotypes (AT/AT) / (GC/AT) was significantly

associated with the risk for breast cancer [OR= 2.418,

95% CI (1.018-5.746); p= 0.042] table(3).

Table 1: Characteristics of normal healthy controls and breast cancer patients

Clinical characteristics Normal subjects (n = 40)

No %

Breast cancer patients (n = 80)

No %

Test of significance (P- value)

Age (years)

< 45

≥ 45

15

25

37.5

62.5

11

69

13.8

86.3

X2 test (P = 0.454)

Range 36.00 –71.00 32.00 – 77.00

Mean ± SD

Median

50.15 ± 9.43

49.50

52.62 ± 10.07

52.0

Student T test (P = 0.198)

Menopausal status

Premenopausal

Postmenopausal

20

20

50.0

50.0

37

43

46.3

53.8

X2test X2P = 0.698

x2p: p value for Chi square test *: Statistically significant at p < 0.05

Table 2: Frequencies of P73 (G4C14/A4T14) genotype in breast cancer patients and healthy controls

Normal healthy controls (n=40) Breast cancer patients (n = 80 )

pNo. % No. %

Polymorphic variants

GC/GC 31 77.5 47 58.8 0.042 *

GC/AT 8 20.0 29 36.3 0.069

AT/AT 1 2.5 4 5.0 FEp =0.664

p 0.126

p: p value for Chi-square test FEp: p value for Fisher Exact test *: Statistically significant at p ≤ 0.05

1125 Journal of Research in Biology (2014) 3(8):1122-1131

                    

Ibrahim et al., 2014

Table (3): Association of P73 (G4C14/A4T14) polymorphism with breast cancer risk

Normal healthy controls

Breast cancer patients Test of sig.

OR ( 95% CI) (lower– upper)

No % No %

All participants 1.000 (reference)

GC/GC® 31 77.5 47 58.8 2.391 (0.968-5.908)

GC/AT 8 20.0 29 36.3 P = 0.055 2.638 (0.968-5.908)

AT/AT 1 2.5 4 5.0 FEp = 0.644 2.418 (1.018-5.746)

AT/AT+GC/AT 9 22.5 33 41.3 P = 0.042 *

p: p value for Chi-square test FEp : p value for Fisher Exact test *: Statistically significant at p ≤ 0.05

Table (3a): Association of P73 (G4C14/A4T14) polymorphism with breast cancer risk

Normal healthy controls

Breast cancer patients Test of sig.

OR ( 95% CI) (lower– upper)

No % No %

Women age < 45years

GC/GC® 12 80.0 6 54.5 1.00 (reference) GC/AT 2 13.3 4 36.4 FEp = 0.192 4.00 (0.563-28.396)

AT/AT 1 6.7 1 9.1 FEp = 1.000 2.00 (0.106-37.830)

AT/AT+ GC/AT 3 20.0 5 45.5 FEp = 0.218 3.33 (0.588-18.891)

Women age ≥ 45 years

GC/GC® 19 76.0 41 59.4 1.00 (reference)

GC/AT 6 24.0 25 36.2 p = 0.322 1.931 (0.680-5.484)

AT/AT 0 0.0 3 4.3 FEp = 0.547 1.463 (1.232-1.738)

AT/AT+ GC/AT 6 24.0 28 40.6 p = 0.139 2.163 (0.767-6.094)

p: p value for Chi-square test FEp : p value for Fisher Exact test *: Statistically significant at p ≤ 0.05

Table (3b): Association of P73 (G4C14/A4T14) polymorphism with breast cancer risk

Normal healthy controls

Breast cancer patients Test of sig.

OR ( 95% CI) (lower– upper)

No % No %

Premenopausal status

GC/GC® 16 76.2 22 64.7 1.00 (reference)

GC/AT 4 19.0 10 29.4 FEp = 0.524 1.181 (0.483-6.850)

AT/AT 1 4.8 2 5.9 FEp = 1.000 1.455 (0.121-17.462)

AT/AT+ GC/AT 5 23.8 12 35.3 p = 0.371 1.745 (0.512-5.948)

Postmenopausal status

GC/GC® 15 78.9 25 54.3 1.00 (reference)

GC/AT 4 21.1 19 41.3 FEp = 0.153 2.850 (0.813-9.986) AT/AT 0 0.0 2 4.3 FEp = 0.530 1.600 (1.259-2.034)

AT/AT+ GC/AT 4 21.1 21 45.7 FEp = 0.093 3.150 (0.906-10.953)

p: p value for Chi-square test FEp : p value for Fisher Exact test *: Statistically significant at p ≤ 0.05

Association of different p73 (G4C14/A4T14) associated with tumor pathological grade, clinical stage,

polymorphic variants among breast cancer patients with tumor size, lymph node involvements and Her2/neu

clinicopathological features were shown in table (4). expression. Patients with AT allele (GC/AT or AT/AT

Compared with GC/GC genotype, the combined variant genotype) were potentially to be a positive lymph node

p73 GC/AT or AT/AT genotypes was significantly status, advanced tumor stage or recurrence than patients

Journal of Research in Biology (2014) 3(8):1122-1131 1126

                    

Ibrahim et al., 2014

Table (4): Association of p73 (G4C14/A4T14) polymorphism with clinicopathological features of breast cancer

GC/AT+AT/AT® GC/GC®

Test of sig OR ( 95% CI) (lower– upper) No % No %

Tumor pathological grade

II ®

III

24

9

72.7

27.3

44

3

93.6

6.4 FEp= 0.023 *

5.500 (1.359-22.261)

Clinical stage

II ®

III

6

27

18.2

81.8

35

12

74.5

25.5 p <0.001 *

13.125 (4.364-39.473)

Tumor size (cm)

< 5®

≥ 5

4

29

12.1

87.9

36

11

76.6

23.4 FEp <0.001 *

23.727 (6.836-82.361)

Lymph node involvements -ve ®+ve 3 9.1 15 31.9 FEp= 0.028 *

30 90.9 32 68.1 4.688 (1.232-17.829)

Estrogen receptor status

-ve ® 2 6.1 2 4.2 FEp=1.000

+ve 31 93.9 45 95.7 0.689 (0.092-5.155)

Progesterone receptor status

-ve ® 4 12.1 4 8.5 FEp=1.000

+ve 29 87.9 43 91.5 0.674 (0.156-2.915)

Her2/neu expression

-ve ®

+ve

25

8

75.8

24.2

44

3

93.6

6.4 FEp= 0.044 *

4.693 (1.140-19.316)

Vascular invasion

-ve ®

+ve

6

27

18.2

81.8

10

37

21.3

78.7 P= 0.733

1.216 (0.394-3.754)

Metastasis -ve ®

+ve 24

9

72.7

27.3

34

13

72.3

27.7

p = 0.970 0.981 (0.362-2.660)

p: p value for Chi-square test FEp: p value for Fisher Exact test *: Statistically significant at p ≤ 0.05

with the GC/GC genotype. Kaplen Meir Disease Free

Survival (DFS) curve was constructed to study the

prognostic value of p73 (G4C14/A4T14) genotypes.

After a median fallow up period of 25 months (range 18­

48 months), 22(27.5%) out of 80 patients had metastasis.

The incidence of metastasis was observed in 27.7% of

patients with GC/GC genotype and 27.3% of patients

carrying AT variant (AT/AT) / (GC/AT) genotypes

table (5). A significant association between the

genotypes and survival was found in the patients

(p <0.001), figure (1). Furthermore, patients carrying AT

variant (AT/AT)/ (GC/AT) genotypes has a favorable

prognosis and longer survival (41.33±1.45 months) than

did patients carrying GC/GC genotype (24.0±1.13

months).

DISCUSSION

p73 protein was considered as one among the

p53 family , the high level of similarity between p53 and

p73 is appeared in the DBD domain which revealed that

p73 can bind and activate p53 target genes , thus induced

cell cycle arrest and apoptosis (Kaghad et al.,1997).

Journal of Research in Biology (2014) 3(8):1122-1131 1127

                    

Ibrahim et al., 2014

Table (5): Association of p73 (G4C14/A4T14) genotypes with breast cancer disease free survival (DFS)

Metastasis N =22

Non Metastasis N = 58

Median (Mean ± SE) DFS (months)

Log rank p

GC/GC (N=47) 13 (27.7) 34 (72.3) 24.0 (24±1.13) 20.557 * <0.001

[(GC/AT)/(AT/AT)](N=33) 9 (27.3%) 24 (72.7) 40.0 (41.33±1.45)

*: Statistically significant at p<0.05

Figure (1): Kaplan-Meier disease free survival for p73 (G4C14/A4T14) genotypes

Because of alternative N- and C- terminal splicing of

transcription, p73 gives a variety of isoforms. Formation

of ∆N-isoform (shorter amino terminus lacking the TA

domain) requires activation of the alternative P2

promoter in exon 3 / intron 3 � (Zaika et al., 2002). The

p73 amino-terminally truncated (∆N) isoform is

commonly called ∆TA-p73 and strongly established as

an oncogene. Therefore it is involved in the oncogenesis

by inhibiting tumor suppressive modulations of p53 and

TA p73 (Zaika et al., 2002).

Numerous studies have proven that p73 protein is

a classic tumor suppressor (Grob et al., 2001; Zaika

et al., 2002; Benard et al., 2003). Surprise investigations

proved that the NH2-terminal truncated isoform of

human p73 (Np73) owning an opposite activities of

TAp73 indicated that Np73 likely has an oncogenic

function (Zaika et al., 2002). It is found that p73 is over-

expressed in many cancer types including breast

carcinoma (Zaika et al., 1999; Cai et al., 2000; Kang

et al., 2000). Dinucleotides polymorphisms have been

found in the p73 gene (designated as G4C14-to-A4T14).

This functional polymorphism lies upstream of the codon

AUG of exon 2, region which might form a stem-loop

like structure and affect translation efficiency (Kaghad

et al.,1997).

The associations of p73 G4C14-to-A4T14

Polymorphism and cancer susceptibility have been

investigated in different molecular epidemiological

studies, and produce conflicting results (Douc-Rasy

et al., 2002; Casciano et al., 2002; De Feo et al., 2009;

Niwa et al., 2004; Li et al., 2004; Pfeifer et al., 2005;

Huang et al., 2003;Li et al., 2006).

Therefore, this study was objective to examine

the association of p73 G4C14→A4T14 polymorphism

with breast cancer susceptibility and survival in 80 breast

cancer Egyptian females with a median follow up of 25

months.

In this study, we noticed that the two genotypes

p73 (GC/AT) and (AT/AT) were more frequently

observed in breast cancer patients whereas p73 GC/GC

Journal of Research in Biology (2014) 3(8):1122-1131 1128

                    Ibrahim et al., 2014

genotype was significantly higher in controls. However,

insignificance difference in the genotypes distribution

between patients and controls was observed. Also found

that the combined variant genotypes (GC/AT) / (AT/AT)

were more frequent in breast cancer patients [OR 2.418,

p=0.042] than those with GC/GC genotype. These results

indicated possible relationship between p73 G4C14–to–

A4T14 polymorphism and breast cancer in Egyptian

population.

Moreover, we found that the combined variant

genotypes (GC/AT) / (AT/AT) were more frequent in

breast cancer patients [OR 2.418, p=0.042] than those

with GC/GC genotype. These results indicated possible

relationship between p73 G4C14–to–A4 T14

polymorphism and risk of breast cancer.

Many experimental studies showed that

individual carries AT allele is associated with increased

risk of developing breast cancers in Japanese population

(Li et al., 2004), gastric cancer in Caucasians population

(De Feo et al., 2009), colorectal cancer in Korean

population (Pfeifer et al., 2005) and lung cancer in a non

-Hispanic white population (Huang et al., 2003). But few

studies showed no correlations between p73 G4C14-to­

A4T14 Polymorphism and cancer risk (Choi et al., 2006;

Hu et al., 2005). Furthermore, very recently, Hu Y et al.,

(2012) conducted a Meta Analysis study and found that

Tp73 polymorphism (GC/AT) is probability associated

with cancer risk in most cancer types and ethnicities (Hu

et al., 2012).

Also we evaluated the association of p73

genotypes with pathological parameters of breast cancer

patients. Compared with GC/GC genotype, the combined

variant genotypes (GC/AT) / (AT/AT) were found to be

associated with increased risk for breast cancer among

women with pathological grade III [OR= 5.500,

p= 0.023], clinical stage III [OR= 13.125, p < 0.001],

tumor size ≥ 5 cm [OR= 23.727, p < 0.001], axillary

lymph node involvement [OR= 4.688, p= 0.028] and the

+ve (Her2/neu) expression [OR= 4.693, p= 0.044]. These

results suggest that AT variant allele has an important

role in breast cancer progression, and may provide the

clinician with additional information regarding patients

carrying AT variant with the risk of recurrence.

Results from the present study showed that

patients with (AT/AT) / (GC/AT) genotypes had a more

favorable disease free survival than those with GC/GC

genotype. Unexpectedly, our results taken together seem

to show that there was a higher risk in developing breast

cancer of females carrying the AT/AT genotype, but

once affected, the patient has a better prognosis. Few

studies have shown that Tp73 polymorphism is a poor

prognostic factor in carcinogenesis (Grob et al., 2001;

Dominguez et al., 2001). Study in relationship between

ΔNp73 expression and prognosis in patient with lung

cancer have concluded that positive expression of ΔNp73

might be a possible marker in predicting poor prognosis

(Uramoto et al., 2004; Casciano et al., 2002). These

funding might be due to the negative effect of p73

polymorphism in translation efficiency; further research

with large number of samples are needed to confirm

these preliminary results.

In summary, we found that p73 exon 2 G4C14-to

-A4T14 polymorphism seem to have a major gene effect

on risk of breast cancer in Egyptian females. p73 GC/

GC genotype were significantly associated with shorter

disease free survival in breast cancer patients . Larger

prospective studies are needed to further confirm our

results.

REFERENCES:

Alex I. Zaika, Neda Slade, Susan H. Erster, Christine

Sansome, Troy W. Joseph, Michael Pearl , Eva

Chalas, and Ute M. Moll. 2002. ΔNp73, A Dominant-

Negative Inhibitor of Wild-type p53 and TAp73, Is Up-

regulated in Human Tumors. JEM. 196(6):765-780.

Alexandria Cancer Registry Annual. Report 2010.

Medical Research Institute, Alexandria University,

Egypt.

Journal of Research in Biology (2014) 3(8):1122-1131 1129

                    Ibrahim et al., 2014

Barry Trink, Kenji Okami, Li Wu, Virote

Sriuranpong, Jin Jen and David Sidransky. 1998. A

new human p53 homologue. Nature Medicine. 4(7): 747

– 748.

Benard J, Douc-Rasy S and Ahomadegbe JC 2003.

TP53 family members and human cancers Hum Mutat.

21(3):182-191.

Cai YC, Yang GY, Nie Y, Wang LD, Zhao X, Song

YL, Seril DN, Liao J, Xing EP and Yang CS. 2000.

Molecular alterations of p73 in human esophageal

squamous cell carcinomas: loss of heterozygosity occurs

frequently; loss of imprinting and elevation of p73

expression may be related to defective p53

Carcinogenesis. 21(4):683-689.

Casciano I, Mazzocco K, Boni L, Pagnan G, Banelli

B, Allemanni G, Ponzoni M, Tonini GP and Romani

M. 2002. Expression of ΔNp73 is a molecular marker for

adverse outcome in neuroblastoma patients. Cell Death

Differ., 9(3):246-51.

Choi JE, Kang HG, Chae MH, Kim EJ, Lee WK, Cha

SI, Kim CH, Jung TH and Park JY. 2006. No

association between p73 G4C14-to-A4T14

polymorphism and the risk of lung cancer in a Korean

population. Biochemical genetics 4444(11-12): 533-540.

Coral O and Amy T. 2010. The Differences between

Male and Female Breast Cancer In Principles of gender-

specific medicine (2th ed.). Marianne J L (eds). Elsevier

Inc (pub), 42(7): 459-472.

De Feo E, Persiani R, La Greca A, Amore R,

Arzani D, Rausei S, D'Ugo D, Magistrelli P, van

Duijn CM, Ricciardi G and Boccia S. 2009. A case-

control study on the effect of p53 and p73 gene

polymorphisms on gastric cancer risk and progression.

Mutat Res., 675(1-2):60-5.

Dominguez G, Silva JM, Silva J, Garcia JM, Sanchez

A, Navarro A, Gallego I, Provencio M, España P and

Bonilla F. 2001. Wild type p73 overexpression and high-

grade malignancy in breast cancer. Breast Cancer Res

Treat. 66 (3):183-90.

Douc-Rasy S, Barrois M, Echeynne M, Kaghad M,

Blanc E, Raguenez G, Goldschneider D, Terrier-

Lacombe MJ, Hartmann O, Moll U, Caput D and

Bénard J. 2002. ΔN-p73 α accumulates in human

neuroblastic tumors. Am J Pathol., 160(2):631-9.

Grob TJ, Novak U, Maisse C, Barcaroli D, Luthi AU,

Pirnia F, Hugli B, Graber HU, De Laurenzi V, Fey

MF, Melino G and Tobler A. 2001. Human ΔNp73

regulates a dominant negative feedback loop for TAp73

and p53 Cell Death Differ., 8(12):1213-1223.

Hamajima N, Saito T, Matsuo K, Kozaki K I,

Takahashi T and Tajima K. 2000. Polymerase Chain

Reaction with Confronting two-pair Primers for

Polymorphism Genotyping. Jpn J Cancer Res., 91(9):

865–868.

Hu Y, Jiang L, Zheng J, You Y, Zhou Y and Jiao S.

2012. Association between the p73 exon 2 G4C14-to­

A4T14 polymorphism and cancer risk: a meta-analysis.

DNA Cell Biol., 31(2):230-7.

Hu Z, Miao X, Ma H, Tan W, Wang X, Lu D, Wei Q,

Lin D and Shen H. 2005. Dinucleotide polymorphism

of p73 gene is associated with a reduced risk of lung

cancer in a Chinese population. International journal of

cancer. 114(3):455-460.

Huang XE, Hamajima N, Katsuda N, Matsuo K,

Hirose K, Mizutani M, Iwata H, Miura S, Xiang J,

Tokudome S and Tajima K. 2003. Association of p53

codon Arg72Pro and p73 G4C14-to-A4T14 at exon 2

genetic polymorphisms with the risk of Japanese breast

cancer. Breast Cancer. 10(4):307-311.

Ishimoto O, Kawahara C, Enjo K, Obinata M,

Nukiwa T and Ikawa S. 2002. Possible oncogenic

potential of ΔNp73: a newly identified isoform of human

p73 Cancer Res., 62(3):636-641.

Jost CA, Marin MC and Kaelin WG Jr. 1997. p73 is a

human p53-related protein that can induce apoptosis.

Nature; 389(6647): 191-194.

Kaghad M, Bonnet H, Yang A, Creancier L, Biscan

JC, Valent A, Minty A, Chalon P, Lelias JM, Dumont

X, Ferrara P, McKeon F and Caput D. 1997.

Monoallelically expressed gene related to p53 at 1p36, a

region frequently deleted in neuroblastoma and other

human cancers. Cell; 90(4): 809- 819.

Kang MJ, Park BJ, Byun DS, Park JI, Kim HJ, Park

JH and Chi SG. 2000. Loss of imprinting and elevated

Journal of Research in Biology (2014) 3(8):1122-1131 1130

Ibrahim et al., 2014  

expression of wild-type p73 in human gastric

adenocarcinoma. Clin Cancer Res., 6(5):1767-71.

Li G, Wang LE, Chamberlain RM, Amos CI, Spitz

MR and Wei Q. 2004. p73 G4C14-to-A4T14

polymorphism and risk of lung cancer. Cancer Res., 64

(19): 6863–6.

Li H, Yao L, Ouyang T, Li J, Wang T, Fan Z, Fan T,

Dong B, Lin B, Li j and Yuntao Xie. 2006. Association

of p73 G4C14-to-A4T14 (GC/AT) Polymorphism with

Breast Cancer Survival, Carcinogenesis. 28(2):372 - 377.

Lyla MH and Dan GB. 2006. Genes, Behavior, and the

Social Environment. National Academy of Sciences

USA (pub) 44-8.

Melino G, De Laurenzi Vand Vousden KH. 2002. p73:

friend or foe in tumorigenesis. Nat Rev Cancer. 2 (8):605

–615.

Niwa Y, Hamajima N, Atsuta Y, Yamamoto K,

Tamakoshi A, Saito T, Hirose K, Nakanishi T,

Nawa A, Kuzuya K and Tajima K. 2004. Genetic

polymorphisms of p73 G4C14-to-A4T14 at exon 2 and

p53 Arg72Pro and the risk of cervical cancer in

Japanese. Cancer Lett., 205(1):55-60.

Perera FP and Weinstein IB. 2000. Molecular

epidemiology: recent advances and future directions.

Carcinogenesis. 21(3):517-24.

Pfeifer D, Arbman G and Sun XF. 2005.

Polymorphism of the p73 gene in relation to colorectal

cancer risk and survival. Carcinogenesis. 26 (1): 103–7.

Schultz J, Ponting CP, Hofmann K and Bork P. 1997.

SAM as a protein interaction domain involved in

developmental regulation Protein Sci., 6 (1): 249-53.

Stiewe T and Putzer BM. 2002. Role of p73 in

malignancy: tumor suppressor or oncogene?. Cell death

and differentiation. 9(3):237-45.

Stiewe T, Zimmermann S, Frilling A, Esche H and

Putzer BM. 2002. Transactivation-deficient ΔTA-p73

acts as an oncogene. Cancer Res., 62(13): 3598–3602.

Tamakoshi A, Hamajima N, Kawase H, Wakai K,

Katsuda N, Saito T, Ito H, Hirose K, Takezaki T and

Tajima K. 2003. Duplex polymerase chain reaction with

confronting two-pair primers (PCR-CTPP) for

genotyping alcohol dehydrogenase β subunit (ADH2)

and aldehyde dehydrogenase 2 (ALDH2). Alcohol 38

(5):407-10.

Thanos CD and Bowie JU. 1999. p53 Family members

p63 and p73 are SAM domain-containing proteins.

Protein Sci., 8(8):1708-10.

Uramoto H, Sugio K, Oyama T, Nakata S, Ono K,

Morita M, Funa K and Yasumoto K. 2004. Expression

of ΔNp73 predicts poor prognosis in lung cancer. Clin

Cancer Res., 10(20):6905-11.

Yang A, Walker N, Bronson R, Kaghad M,

Oosterwegel M, Bonnin J, Vagner C, Bonnet H,

Dikkes P, Sharpe A, McKeon F and Caput D. 2000.

p73- deficient mice have neurological, pheromonal and

inflammatory defects but lack spontaneous tumours

Nature. 404(6773): 99-103.

Zaika AI, Kovalev S, Marchenko ND and Moll

UM.1999. Overexpression of the wild type p73 gene in

breast cancer tissues and cell lines Cancer Res., 59

(13):3257-3263.

Zaika AI, Slade N, Erster SH, Sansome C, Joseph

TW, Pearl M, Chalas E and Moll UM. 2002.

DeltaNp73, a dominant-negative inhibitor of wild-type

p53 and TAp73, is up-regulated in human tumors. J Exp

Med., 16; 196(6):765-80.

Submit your articles online at www.jresearchbiology.com

Advantages

• EEEEaaaassssyyyy oooonnnnlllliiiinnnneeee ssssuuuubbbbmmmmiiiissssssssiiiioooonnnn

• CCCCoooommmmpppplllleeeetttteeee PPPPeeeeeeeerrrr rrrreeeevvvviiiieeeewwww

• AAAAffffffffoooorrrrddddaaaabbbblllleeee CCCChhhhaaaarrrrggggeeeessss

QQQQuuuuiiiicccckkkk pppprrrroooocccceeeessssssssiiiinnnngggg•

EEEExxxxtttteeeennnnssssiiiivvvveeee iiiinnnnddddeeeexxxxiiiinnnngggg•

• YYYYoooouuuu rrrreeeettttaaaaiiiinnnn yyyyoooouuuurrrr ccccooooppppyyyyrrrriiiigggghhhhtttt

submit@jresearchbiology.com

www.jresearchbiology.com/Submit.php.

1131 Journal of Research in Biology (2014) 3(8):1122-1131

Article Citation:

El-Mohsnawy Eithar. Efficient methods for fast, producible, C-Phycocyanin from Thermosynechococcus elongates.

Journal of Research in Biology (2014) 3(8): 1132-1146

Journal of Research in Bio

logy

Efficient methods for fast, producible, C-Phycocyanin from

Thermosynechococcus elongatus

Keywords:

A620/A280 value, C-PC purification, C-Phycocyanin, Cyanobacteria, Fluorescence

Spectra, IEC, Phycobilines, Sucrose Gradient, Thermosynechococcus elongatus.

ABSTRACT:

This article describes different protocols that enhance the extraction, isolation

and purification of phycocyanin from the cyanobacterium, Thermosynechococcus

elongatus as well as absorbance and fluorescence spectral characterization. A combination

of enzymatic degradation by Lysozyme followed by high pressure showed a mild cell wall

destruction except for the composition of thylakoid membrane compared with glass beads.

The use of ammonium sulfate precipitation as the first purification step exhibited high

efficiency in removing most of the protein contamination. The best purified phycocyanin

was obtained after using the second purification step that could be ion exchange

chromatography or sucrose gradient. Unexpected results that were not used earlier were

obtained by sucrose gradient, where a large amount of highly pure phycocyanin was

assembled compared with published methods. An evaluation of C-phycocyanin throughout

the series steps of isolation and purification was achieved by using absorbance and 77K

fluorescence spectral analysis. Besides a spectroscopical evaluation, SDS-PAGE,

productivity, and A620/A280 values pointed to the purity and structural preservation of a

purified complex. Compared with published methods, the existing method not only

reduces purification time but also enhances the productivity of phycocyanin in its native

structure.

The optimization of each purification step presented different purified

phycocyanin levels; hence, it could be used not only by microbiologists but also by other

researchers such as physicians and industrial applicants. In addition, this method could be

used as a model for all cyanobacterial species and could be also used for Rhodophytes with

some modifications.

1132-1146 | JRB | 2014 | Vol 3 | No 8

This article is governed by the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which gives permission for unrestricted use, non-commercial, distribution and reproduction in all medium, provided the original work is properly cited.

www.jresearchbiology.com Journal of Research in Biology

An International

Scientific Research Journal

Authors:

El-Mohsnawy Eithar.

Institution: Botany Department, Faculty

of Science, Damanhour

University, 22713, Egypt.

Corresponding author: El-Mohsnawy Eithar.

Web Address: http://jresearchbiology.com/documents/RA0419.pdf.

Dates:

Received: 24 Jan 2014 Accepted: 05 Feb 2014 Published: 10 Feb 2014

Journal of Research in BiologyJournal of Research in BiologyJournal of Research in BiologyJournal of Research in Biology An International Scientific Research Journal

Original Research

Abbreviations

A620/A280: Absorbance at 620 and 280 nm; Amm Sulf. ppt: Ammonium sulfate

precipitate; APC: Allophycocyanin; MCF-7: Michigan Cancer Founda,on-7, referring to the

ins;tute in Detroit where the cell line was established in 1973; OD: Op;cal density.,

PBP: Phycobilliprotein; PC (C-PC): Phycocyanin (phycocyanin from cyanobacteria);

T. elongatus: Thermosynechococcus elongates; IEC: Ion exchange column.

INTRODUCTION

Blue green are one of oldest prokaryotic fossils

(Schopf 2000) that have been known on the earth for

more than 3.5 billion years. The traditional name ‘blue-

green algae’ for Cyanophyceae is due to the presence of

phycocyanin, allophycocyanin, and phycoerythrin, which

mask the chlorophyll pigmentation. Most cyanobacteria

are found in fresh water, whereas others are found in

marines, in damp soil, or even in temporarily moistened

rocks in deserts as well as in hot springs such as

Thermosynechococcus elongatus. T. elongatus is

considered a thermophilic obligate photoautotrophic

organism that contains chlorophyll a, carotenoids, and

phycobilins. For this reason, it has usually been used as a

model organism for the study of photosynthesis; such as,

X-ray structure of PSI and PSII (Sonoike and Katoh

1989; Zouni et al., 2001; Jordan et al., 2001; and Katoh

et al., 2001).

In addition, Thermosynechococcus elongatus has

been postulated as the model organism of choice for

structural studies. X-ray of photosystem I are studied by

Jordan et al., 2001 and photosystem II are studied by

Ferreira et al., 2004 and Loll et al., 2005. A crystal

structure of the cytochrome b6f complex has been

determined from another thermophilic cyanobacterium,

Mastigocladus laminosus (Kurisu et al., 2003).

T h e t h y l a k o i d m e m b r a n e o f

Thermosynechococcus elongatus attached to external

light-harvesting structure known as the phycobilisome

(PBS; reviewed by Adir 2005), which acts as a light-

harvesting system for PSII and, to some extent, for PSI

(Rögner et al., 1996). The Synechococcus elongatus

phycobilisome consists of allophycocyanin (APC) and

C-phycocyanin (C-PC), along with the linker proteins

(Adir, 2005). The bilin pigments are open-chained

tetrapyrroles that are covalently bound to seven or more

proteins. These chromophores are composed of the

cyclic iron (heme) tetrapyrrole (Frankenberg and

Lagarias 2003; Frankenberg et al., 2003).

One function of PC is energy absorbance which

is transferred by non-radiative transfer into APC and

consequently into chlorophyll a, with an efficiency

approaching 100%. In the absence or blocked the

photosynthetic reaction center (RC), the PBPs are

strongly fluorescent.

C-phycocyanin is composed of two subunits: the

α-chain with one phycocyanobilin and the β-chain with

two phycocyanobilins (Troxler et al., 1981; Stec et al.,

1999; Adir et al., 2001; Contreras-Martel et al., 2007). In

between, there are large amino-acid sequence

similarities. The αβ subunits aggregate into α3 β3 trimers

and further into disc-shaped α6 β6 hexamers, the

functional unit of C-PC (Stec et al., 1999; Adir et al.,

2001; Contreras-Martel et al., 2007).

Nowadays, Phycocyanin receives a lot of

attention due to its potential in medical and

pharmaceutical treatments as well as in food industries.

Its antioxidant protection of DNA has been demonstrated

by (Pleonsil and Suwanwong, 2013). It also promotes

PC12 cell survival, modulates immune and inflammatory

genes and oxidative stress markers in acute cerebral

hypoperfusion in rats (Marín-Prida et al., 2013), prevents

hypertension and low serum adiponectin level in a rat

model of metabolic syndrome (Ichimura et al., 2013),

exhibits an antioxidant and in vitro antiproliferative

activity (Thangam et al., 2013), and involves an

apoptotic mechanism of MCF-7 breast cells either in vivo

or in vitro induced by photodynamic therapy with

C-phycocyanin (Li et al., 2010).

For these reasons, a lot of attention is directed

toward improving the purification of phycocyanin from

several cyanobacterial organisms. The purification of

C-phycocyanin from Spirulina platensis has been

reported by Bhaskar et al., (2005); from Anacystis

nidulans (Gupta and. Sainis 2010); and in aqueous

phytoplankton by Lawrenz et al., 2011.

Although all these represented evaluations were

based on the ratio of A620/A280, which is suggested by

El-Mohsnawy Eithar, 2014

1133 Journal of Research in Biology (2014) 3(8): 1132-1146

Bryant et al., (1979) and Boussiba and Richmond (1979),

this ratio does not save an optimum image of the

presence of other impurities such as APC with

C-phycocyanin, where the existence of APC does not

strongly disturb this ratio. Purity ratios varied among

publications: 4.3 (Minkova et al., 2003), 3.64 (Niu et al.,

2007), 4.05 (Patil and Raghavarao 2007), 4.72 (Gupta

and Sainis 2010), and more than four (Pleonsil and

Suwanwong 2013).

This article displays the simple, fast, and

effective protocol by which large scales of PC were

purified.

MATERIAL AND METHODS

Culturing and assembly of T. elongatus

Thermosynechococcus elongatus cells were

cultivated in BG-11 medium at 50 °C with a stream of

5% (v/v) CO2 in air (according to Rippka et al., 1979).

Cells were grown in Polyamide flasks (2.5-L). 200-ml

preculture cells were used for an inoculation of 2 L

culture. The used white light was provided at about 100

µE*m-2*s-1. After incubation period, the cells were

harvested in the exponential growth phase. The optical

density at 750 nm was 2.5 - 3.

Cells were sedimented by centrifugation at 2000

g for 15 minutes (GSA-Rotor, Sorvall). The supernatant

was removed. Cells in the pellet were washed once with

MES buffer (20mM MES, 10 mM Magnesium chloride,

and 10 mM Calcium Chloride) and then re-centrifuged at

the same speed and conditions.

Extraction of phycocyanin

The extraction of phycocyanin crude extract was

performed in two steps. The first step was cell wall

destruction, and the second step was isolation of

phycocyanin from the thylakoid membrane. Two

destruction techniques were applied. In both techniques,

collected T. elongatus cells were suspended in 100 ml of

MES containing Lysozyme buffer at pH 6.5 (20mM

MES, 10 mM Magnesium chloride, and 10 mM Calcium

Chloride and 0.2 % (w/v) Lysozyme). Stirring was

applied at 37 °C for 30 minutes in the dark condition. In

the first protocol, the cell wall was disrupted by applying

2000 psi pressure using Parr bomb at at 4°C for 20

minutes (El-Mohsnawy et al., 2010). However, in the

second protocol was done according to Kubota et al.,

2010, where T. elongatus cells were mixed with an equal

volume of glass beads (0.5 mm of Glass Beads, Soda

Lime, BioSpec Products), and then, the cells were

exposed to 18 disrupted cell cycles (10s ec glass beads

break and 2min 50sec pause) on a vortex mixer (BSP

Bead-Beater 1107900, BioSpec Products).

Phycocyanin crude extract was collected by

suspending the thylakoid membrane with HEPES buffer

at pH 7.5 (20mM HEPES, 10mM MgCl2, 10 mMCaCl2,

and 0.4 M mannitol) or with HEPES buffer at pH 7.5

containing 0.03% ß-DM and centrifugation at 3000 g at 4

°C for 10 min. The supernatant was collected, and pellets

were exposed to an additional extraction step using the

same buffer and centrifugation conditions. By using

glass bead disruption, an additional isolation step was not

required.

Purification steps

First purification step:

This step was preceded using two sequences of

ammonium sulfate precipitation steps. Ammonium

sulfate salts were added to the crude extract in HEPES

buffer till it reached 20 %, was stirred at 4°C for 30

minutes followed by centrifugation of 6000 g at 4 °C for

15 min (Beckman -JA-14 Rotor). The pellets were

discarded. Additional ammonium sulfate salts were

added to the supernatant till they reached 50 % saturation

and were stirred at 4°C for 60 minutes. Centrifugation of

12000 g at 4 °C for 30 min (Beckman -JA-14 Rotor) was

used to sediment partial purified phycocyanin

(El-Mohsnawy, 2013).

Second purification step:

Pellets were dissolved in HEPES buffer at pH 7.5

(20mM HEPES, 10mM MgCl2, 6mM CaCl2, and 0.4 M

Journal of Research in Biology (2014) 3(8): 1132-1146 1134

El-Mohsnawy Eithar, 2014

against HEPES buffer at pH 7.5 (20mM HEPES, 10mM

MgCl2, 10mMCaCl2, and 0.4 M mannitol) for 6 hours

before loading to IEC (POROS HQ/M).

Sucrose gradient

Sucrose gradient was prepared by dissolving

20 % (w/v) sucrose in HEPES buffer at pH 7.5 (20mM

HEPES, 10mM MgCl2, and 10 mMCaCl2). 12 ml of

sucrose solution was poured into each centrifuge tube

(SW40-Rotor ultracentrifuge, Beckman) followed by

freezing and slowly thawing overnight at 10°C. 100 µl of

OD620 nm 6 suspensions were slowly dropped onto the

top of sucrose gradients. After centrifugation at 36000

rpm for about 12 hours at 4°C (SW40-Rotor

ultracentrifuge, Beckman), two identical bands were

detected. The lower band (phycocyanin) was collected

for further investigation.

Ion Exchange Chromatography (IEC)

POROS HQ/M column was used as IEC for the

second purification step. The column was equilibrated by

8 CV of IEC equilibration buffer (20 mM MES, pH 6.5,

10mM MgCl2, and 10 mMCaCl2) before loading the

phycocyanin suspension. After loading the samples,

washing occurred for 5 CV. The gradient from 0 to 200

mM MgSO4 with a step at 35 mM that was carried out

for the elution of purified C-phycocyanin complex.

Purified phycocyanin was eluted at 23 mM MgSO4.

Purified phycocyanin was concentrated by centrifugation

at 3000 r/min for 40 min at 4°C using an Amicon 10,000

Dalton weight cut-off.

SDS-polyacrylamide gel electrophoresis (SDS-PAGE)

SDS-PAGE was performed according to

Schägger and Von Jagow (1987). Briefly, 6 µl of

phycocyanin (OD620 nm 3) was mixed with sample

buffer. Then, the mixture was injected into SDS-PAGE

(12% Acrylamide). The electrophoresis was carried out

by applying a current of 100 mA for 30 min, and then,

the current was reduced to 60 mA until the samples

reached the edge of the gel. After electrophoresis, SDS-

PAGE was fixed by incubation in a mixture of 50 %

methanol and 10% acetic acid for 20 min. The gel was

stained with Coomassie Brilliant Blue reagent (0.2% (w/

v), Coomassie Brilliant Blue R, 40% (v/v) methanol, and

7 % (v/v) acetic acid) for an additional 20 min. The gel

was destained by immersing the gel in a mixture of 30 %

(v/v) methanol and 10 % (v/v) acetic acid for 8–12 hours.

Absorption spectral analysis

1 ml of crude or purified phycocyanin complexes

was diluted in buffer (20 mM HEPES, pH 7.5, 10 mM

MgCl2, 10 mM CaCl2, and 0.5 M mannitol) till it

reached a maximum OD620 nm of 0.2–0.8 before

measuring the absorption spectra from 250 to 750 nm.

While thylakoid pellets were diluted to OD680 nm of 1.2-

2. Two spectrophotometers are used according to the

purpose of measurements. For fast evaluation of the

efficiency of each purification step, 2 µl of sample was

used (NanoDrop ND-1000 Spectrophotometer). 500 µl

samples were used in case of Shimadzu UV-2450 or

Beckman Du7400. Phycocyanin concentration was

estimated according to an equation suggested by Bennett

and Bogorad 1973; Bryant et al. 1979:

PC (mg.ml) = {A620 – (0.7*A650)}/ 7.38

Fluorescence emission spectra at 77 K

Fluorescence emission spectra were performed in

an SLM-AMINCO Bauman, Series 2 Luminescence

spectrometer (Schlodder et al., 2007). Phycocyanin

complex was diluted to OD620 nm 0.05 buffer containing

20 mM HEPES, pH 7.5, 10 mM MgCl2, 10 mM CaCl2,

and 60 % glycerol. The diluted sample was frozen to 77

K by gradual immersion in liquid nitrogen. 580 nm of

actinic light was used for excitation. Fluorescence

emission spectra were monitored in the range from 600

to 800 nm with a step size of 1 nm and a bandpass filter

of 4 nm.

RESULTS:

The purification of phycocyanin from

T. elongatus cells was achieved via several steps, so the

optimization of each step was required to enhance the

1135 Journal of Research in Biology (2014) 3(8): 1132-1146

El-Mohsnawy Eithar, 2014

mannitol) till they reached six at OD620nm. The

suspension was divided into two parts. The first part was

fractionated using 20% sucrose gradient, and the second

part was dialysis against HEPES buffer at pH 7.5 (20mM

HEPES, 10mM MgCl2, 10mMCaCl2, and 0.4 M

mannitol) for 6 hours before loading to IEC (POROS

HQ/M).

Sucrose gradient

20 g of sucrose was dissolved in 100 ml HEPES

buffer at pH 7.5 (20mM HEPES, 10mM MgCl2, and 10

mMCaCl2). 12 ml of sucrose solution was poured into

each centrifuge tube (SW40-Rotor ultracentrifuge,

Beckman) followed by freezing and slowly thawing

overnight at 10 °C. 100µl phycocyanin partially purified

extract of OD620 nm six was slowly dropped onto the top

of sucrose gradients. Centrifugation took place at 36k

rpm for about 12 hours at 4°C (SW40-Rotor

ultracentrifuge, Beckman); two identical bands were

observed. The lower band was found to be C-

phycocyanin (El-Mohsnawy, 2013).

Ion Exchange Chromatography (IEC)

POROS HQ/M column was used as the second

purification step. The column was equilibrated by 8 CV

of IEC equilibration buffer (20 mM MES, pH 6.5, 10mM

MgCl2, and 10 mMCaCl2) before loading the

phycocyanin partially purified extract. Samples were

loaded in the flow rate of 1 ml/min and then washing was

occurred for 5 CV. The magnesium sulfate gradient (0 to

200 mM) with a step at 35 mM was used for the elution

of purified C-phycocyanin complex. Purified

phycocyanin was eluted at 23 mM MgSO4. Amicon

10,000 Dalton weight cut-off tube was used for

concentrating the purified complex at 3000 r/min for 40

min at 4°C.

SDS-polyacrylamide gel electrophoresis (SDS-PAGE)

SDS-PAGE was performed according to

Schägger and Von Jagow (1987). Briefly, 6 µl of purified

phycocyanin (OD620 nm 3) was mixed with sample buffer.

Then, the mixture was injected into SDS-PAGE (12%

Acrylamide). Starting current was 100 mA for 30 min,

and then, reduced to 60 mA until the samples reached the

edge of the gel. After electrophoresis, a mixture of 50 %

methanol and 10 % acetic acid was used to fix SDS-

PAGE for 20 min. The gel was stained with Coomassie

Brilliant Blue reagent (0.2 % (w/v), Coomassie Brilliant

Blue R, 40 % (v/v) methanol, and 7 % (v/v) acetic acid)

for an additional 20 min. The gel was destained by

immersing the gel in a mixture of 30 % (v/v) methanol

and 10 % (v/v) acetic acid for 8–12 hours.

Absorption spectra

Crude or purified phycocyanin complex was

diluted in the buffer (20 mM HEPES, pH 7.5, 10 mM

MgCl2, 10 mM CaCl2, and 0.5 M mannitol) till it reaches

a maximum OD620 nm of 0.2–0.8. Then, the absorption

El-Mohsnawy Eithar, 2014

Journal of Research in Biology (2014) 3(8): 1132-1146 1136

Step A620/A280 ratio Productivity % Estimation Time

Crude HEPES 1.02909 ± 0.08229 100 30.0 min.

Crude ß-DM 0.26732 ± 0.05131 100 30.0 min.

Crude Beads 1.09185 ± 0.07352 100 30.0 min.

After Amm Sulf. ppt 3.49497 ± 0.11303 92 2.0 hours

After IEC 4.51656 ± 0.03006 76 7.5 hours

Step A620/A280 ratio Productivity % Estimation Time

After concentration 2.59960 ± 0.24710 93 30.0 min.

After Sucrose gradient 4.40767 ± 0.03941 85 8.0 hours

Table 1 b:

Table 1 a: Summary of purity of phycocyanin (expressed as A620/A280 ratio), productivity (expressed as percent to crude extracts), and required periods for each step.

spectra were measured in the range of 250 to 750 nm.

While thylakoid pellets were diluted to OD680 nm of 1.2-2.

Two different spectrophotometer apparatus were used

according to the purpose of measurements. For fast

evaluation of the efficiency of each purification step, 2 µl

of sample was used (NanoDrop ND-1000

Spectrophotometer). 500 µl samples were used in case of

Shimadzu UV-2450 or Beckman Du7400. Phycocyanin

concentration was estimated according to an equation

suggested by Bennett and Bogorad 1973; Bryant et al.,

1979:

PC (mg.ml) = {A620 – (0.7*A650)}/ 7.38

77 K Fluorescence emission spectra

Fluorescence emission spectra at 77K were

measured and investigated in an SLM-AMINCO

Bauman, Series 2 Luminescence spectrometer according

to Schlodder et al., 2007. Phycocyanin was diluted to

0.05 at optical density of 620 nm using buffer containing

El-Mohsnawy Eithar, 2014

1137 Journal of Research in Biology (2014) 3(8): 1132-1146

PC

Pu

rifi

cati

on

C

ell

Des

tru

ctio

n

Figure 1: Scheme shows different isolation and purification steps for phycocyanin purification. During the first purification step, two series of ammonium sulfate

precipitation were applied.

20 mM HEPES, pH 7.5, 10 mM MgCl2, 10 mM CaCl2

and 60 % glycerol. Sample was frozen to 77 K by

gradual immersion in liquid nitrogen. The used actinic

light was 580 nm. Fluorescence emission spectra were

observed in the range from 600 to 800 nm.

RESULTS:

The purification of phycocyanin from

T. elongatus cells was achieved via several steps, so the

optimization of each step was required to enhance the

productivity as well as the purity of phycocyanin. The

scheme shown in Figure 1 illustrates the summary steps

of extraction and purification of phycocyanin.

Cell destruction and extraction of crude extract.

Two different techniques have been used for cell

destruction: combination of 0.2 % Lysozyme with

pressure (2000 psi) or combination of 0.2 % Lysozyme

with glass-beads vortex. 0.2 % Lysozyme with pressure

(2000 psi) exhibited mild destruction of the cell wall

while keeping the thylakoid membrane in its native

structure, even the attached phycobilisomes. After cell

destruction, the crude extract was isolated using HEPES

(pH 7.5) buffer or HEPES (pH 7.5) containing 0.03 % ß-

DM. Both crude extracts exhibited different

spectroscopical behavior. On the other hand, glass beads

destroyed the cell wall and thylakoid membrane, so

centrifugation led to sedimentation of the largest

photosynthetic complexes. Figure 2a, b shows the

absorbance comparison between Lysozyme + HEPES,

Lysozyme + HEPES containing 0.03 % ß-DM, and

extraction by glass beads. It is obvious that the use of

glass-bead destruction yielded a large amount of

allophycocyanin which has a maximum absorbance at

650 nm, in addition to small peaks at 680 nm for PSI and

673 nm for PSII that also have a maximum absorbance

of nearly 440 nm. The absorption spectrum at 650 nm

proves the contamination of C-phycocyanin by a large

amount of allophycocyanin, whereas the absorbance at

280 nm proves the presence of an additional large

amount of non-colored proteins. Extraction by HEPES

buffer showed a small shoulder at 650 nm, compared

with the same buffer containing ß-DM. A remarkable

peak at 440 nm and small shoulders were observed at

650 nm and 680 nm in case of HEPES buffer containing

ß-DM, which confirmed the contamination with PS (I

and II) complexes. It should be pointed out that the high

absorbance value of HEPES buffer containing ß-DM

compared with other treatments may reflect the ability of

ß-DM to dissolve large amounts of protein which do not

have absorption spectra in visible regions. However, high

contamination of crude extract by allophycocyanin in

case of using glass beads did not exhibit a big difference

in A620/A680 value (Table 1) compared with HEPES

extraction.

This is regarding the close of absorption spectra

between allophycocyanin and phycocyanin (650 and 619

Journal of Research in Biology (2014) 3(8): 1132-1146 1138

El-Mohsnawy Eithar, 2014

0

0.2

0.4

0.6

0.8

1

1.2

450 500 550 600 650 700

Waveleng th (nm)

Ab

so

rba

nc

e (

RU

)

HEPES extraction

ß-DM extraction

Beads extraction

Amm Sulf sediment

B

0

0.2

0.4

0.6

0.8

1

1.2

250 350 450 550 650 750

Wavele ng th (nm)

Ab

so

rba

nc

e (

RU

)HEPES extraction

ß-DM extraction

Beads extraction

Amm Sulf sediment

A

Figure 2 a: Absorption spectra of crude extracts by different conditions and after ammonium sulfate precipitation. 500 µl samples were measured by Shimadzu UV-2450 spectrophotometer. Absorption

spectra 250-750 (A), absorbance 550-700 (B)

nm, respectively). It could be concluded that the

extraction with HEPES buffer was the best kind of

extraction. Re-dissolving the thylakoid membrane in

HEPES buffer not only enhanced the extraction of

phycocyanin but also increased the amount of

allophycocyanin. Absorption spectra of thylakoid

membrane pellets exhibited no significant differences

between phycocyanin extracted by HEPES buffer and

that extracted by HEPES buffer containing ß-DM,

whereas a remarkable reduction was observed in the

absorbance at 440 nm and 680 nm in case of extraction

by HEPES buffer only (Figure 3a). These results are

supported by 77K fluorescence spectra (Figure 3b),

where a high peak was observed at 647 nm for both

isolation steps; whereas higher peaks were detected at

664 nm, 686 nm, and 733 nm for PSI. These spectra

point to the presence of more allophycocyanin, PSII, and

PSI in case of isolation by buffer containing ß-DM.

Purification

Ammonium sulfate precipitation

Phycocyanin crude extract containing other

impurities (allophycocyanin, photosystem complexes,

and other soluble proteins) was exposed to two series of

ammonium sulfate precipitation. In the first step (20%

ammonium sulfate), large hydrophobic proteins were

sedimented; whereas after the second step, phycocyanin

was precipitated. A remarkable reduction in the

absorbance at 650 nm, 440 nm, and 280 nm (Figure 2a b)

was observed, which proves the high efficiency of these

two steps to remove most of the dissolved and large

hydrophobic contaminated proteins. These results were

supported by A620/A280 value (3.494 ± 0.113) as shown in

Table 1. This value is considered quite high, indicating

the purity of phycocyanin.

Although the absorption spectra and A620/A280

value pointed to pure phycocyanin, the emission

fluorescence spectra showed the presence of some

contamination (Figure 3b), where fluorescence emission

spectra at 664 nm and 686 nm were detected apart from

647 nm, which indicates the presence of a few

contaminations of allophycocyanin in phycocyanin crude

extracts.

Second purification steps.

Since purification by ammonium sulfate

precipitation did not reach an optimum A620/A280 value,

C-phycocyanin extract needs an additional purification

step. A chromatographic step has been applied to reach

an optimum value.

Purification by IEC

After 50% ammonium sulfate precipitation, the

pellet was dissolved in HEPES buffer followed by

dialysis against HEPES buffer for 8 hours. Changing of

dialysis buffer was done after 2 hours. POROS HQ/M

column was equilibrated with HEPES buffer before

El-Mohsnawy Eithar, 2014

1139 Journal of Research in Biology (2014) 3(8): 1132-1146

0

0.5

1

1.5

2

2.5

3

250 350 450 550 650 750

Thylak oid membrane

P ellets after ß-DM ex trac tion

P ellets without ß-DM extrac tion

Wav eleng th nm

Ab

so

rban

ce R

U

Figure 3 a: Absorption spectra of pellets after different extraction conditions. Pellets were suspended in HEPES 7.5 buffer till they reached an OD680 of 1.5−2. 500-µl samples were measured by a Shimadzu UV-2450 spectrophotometer.

Figure 3 b: 77K fluorescence emission spectra of

different extraction conditions compared with

ammonium sulfate precipitation. Samples were

diluted with HEPES 7.5 buffer containing 60 %

glycerol to OD620 = 0.05. The applied actinic light was

580 nm.

loading partial purified phycocyanin. Figure 4 shows the

elution gradient of MgSO4 (0-150 mM) with a step at 35

mM that was used to elute highly purified phycocyanin.

Pure phycocyanin was eluted at 35 mM of magnesium

sulfate. Phycocyanin complex was desalted and

concentrated to OD619 = 3. Quite a high A620/A280 value

(4.516 ± 0.03) was obtained.

Purification by sucrose density gradient

Although the chromatographic purification

presented a highly purified and large yield of C-

phycocyanin, sucrose gradient was found to be a fast and

effective step for the same purpose. Sucrose gradient was

prepared as described in the “Materials and Methods”

section. A highly contaminated crude extract-derived

glass-bead extraction step was concentrated using a

10,000 Amicon tube before being dropped directly onto

the top surface of the sucrose gradient tube. After

centrifugation, two distinct bands were observed. The

lower one was C-phycocyanin, and the upper one was

allophycocyanin (Figure 5). The phycocyanin band was

collected, washed by HEPES buffer, and concentrated to

OD619 = 3 before storing it.

Phycocyanin evaluation of both methods

Evaluation of the purification of C-phycocyanin

did not stop at the level of A620/A280 values and total

yield, whereas it extended to be investigated

spectroscopically and by SDS-gel PAGE. Room

temperature absorption spectra of C-phycocyanin

purified by IEC and sucrose gradient exhibited almost

the same behavior, where only one peak was detected at

a maximum absorbance of 619 nm; whereas a reduction

in the absorbance at 355 nm and 280 nm was observed.

Moreover, the small shoulder at 650 nm disappeared.

77K emission fluorescence spectral

investigations of phycocyanin purified by IEC or

fractionated by sucrose gradient exhibited only one peak

at 647 nm; whereas shoulders at 664 nm and 686 nm

disappeared (Figure 6b). These results supported

absorbance results and indicated the purity of the

complex. With regard to the A620/A280 value, purification

by IEC and sucrose gradient produced 4.5 and 4.4 (Table

1a &b). These values pointed to high-quality C-

phycocyanin. As shown in Figure 7, the SDS-gel

electrophoresis page, alpha, and beta phycocyanin

subunits are visualized without any additional

contamination. These results provided high evidence for

the efficiency of the presented methods.

A summary evaluation of chromatographic and

sucrose gradient methods are shown in Tables 1a and 1b.

El-Mohsnawy Eithar, 2014

Journal of Research in Biology (2014) 3(8): 1132-1146 1140

Figure 5: Sucrose density gradient of concentrated crude extract. 20% sucrose was frozen and slowly thawed at 10 °C. 100 µl of OD620 nm 6 suspensions were slowly dropped onto the top of sucrose gradients and centrifuged at 36000 rpm for about 12 hours at 4°C (SW40-Rotor ultracentrifuge, Beckman).

Figure 4: Elution profile of purified phycocyanin using IEC (Poros HQ/M). The column was equilibrated by 8 CV of HEPES 7.5 buffer before loading. PC was eluted at 35 mM of MgSO4.

There were no significant differences in A620/A280 values,

whereas the total productivity was high in case of the

sucrose gradient. In addition, a significant reduction in

purification time was observed in case of the sucrose

gradient.

DISCUSSION

The extraction and the purification of

C-phycocyanin have been reported for different

cyanobacterial species using several steps. These

protocols required longer time and more equipment. To

reach an optimum PC complex (large amount, pure, and

in a short time), the production of C-phycocyanin passed

through 2 main steps. The first step was the isolation of

PC, and the second one was purification. Each step was

monitored spectroscopically in order to achieve high

efficiency.

Since the cyanobacterial cell wall is composed of

peptidoglycan with an external lipopolysaccharide layer

such as gram-negative bacteria, the design of cell

destruction is very important, by which the cell wall is

destroyed while keeping the thylakoid membrane in its

native structure. As shown in the “Results” section, a

combination of Lysozyme with 2000 psi was effective

and mild. These results were in agreement with Gan

et al., (2004) for Spirulina sp., Santos et al., (2004) for

Calothrix sp., and Gupta and Sainis (2010) for Anacystis

nidulans. The use of a combination of Lysozyme and

glass beads was very strong and caused the destruction of

both the cell wall and the thylakoid membrane, resulting

in a huge amount of contamination, especially

allophycocyanin. These contaminations extended to

include photosystem complexes in case of using a buffer

containing ß-DM. It should be pointed out that further

extractions by HEPES buffer enhanced the isolation of

the remaining C-phycocyanin, in addition to a large

amount of allophycocyanin. There was an inverse

relationship between the repetition of extraction and PC

isolation, whereas a direct relationship has been recorded

with regard to allophycocyanin (El-Mohsnawy, 2013). A

model in Figure 8 illustrates a comparison between

different isolation conditions. It could be concluded that

a combination between Lysozyme and high pressure

(2000 psi) with HEPES buffer was ideal for phycocyanin

isolation with a low contamination. Different

C-phycocyanin purification conditions have been widely

investigated. A combination of two or more purification

steps were usually applied till they reach a high A620/A280

ratio. A combination of ultrafiltration charcoal

El-Mohsnawy Eithar, 2014

1141 Journal of Research in Biology (2014) 3(8): 1132-1146

Figure 6 a: Absorption spectra of purified phycocyanin after ammonium sulfate precipitation, IEC purification, and sucrose gradient. A partial purified phycocyanin was used to visualize the difference at 650 nm. 500-µl samples were measured by a Shimadzu UV-2450 spectrophotometer.

Figure 6 b: 77K fluorescence emission spectra of phycocyanin purified by ammonium sulfate precipitation, IEC, and sucrose gradient, and these were precipitated by ammonium sulfate. Samples were diluted with HEPES 7.5 buffer containing 60 % glycerol to OD620 = 0.05. The applied actinic light was 580 nm.

adsorption and spray drying was used to obtain C-PC

with A620/A280 of 0.74 and a yield of 34%, whereas

additional chromatographic steps were included to purify

C-PC to A620/A280 of 3.91 with a yield of 9% (Herrera et

al., 1989). This method was improved by Gupta and

Sainis (2010) and reached 2.18 and 4.72, respectively.

Combinat ion of ammonium sulfate with

chromatographic purification has been used for obtaining

C-phycocyanin in different purity levels and

recommended by Rito-Palomares et al., 2001 and Song

et al., 2013. On the other hand, the use of two-phase

aqueous extraction followed by chromatographic

purification was recently reported by Soni et al., 2008.

Although it produced extremely pure C-phycocyanin

with A620/A280=6.69, the total yield was affected. In the

present work, two strategies have been applied. The first

one was based on two steps: ammonium sulfate

precipitation followed by chromatographic purification

(IEC). The second strategy was based on the

concentration of crude extract followed by sucrose

gradient fractionation. Through concentration of crude

El-Mohsnawy Eithar, 2014

Journal of Research in Biology (2014) 3(8): 1132-1146 1142

Figure 7: SDS-gel PAGE of purified phycocyanin.

Lane 1 marker protein, lane 2 phycocyanin purified

by sucrose gradient and lane 3 phycocyanin purified

by IEC.

Photosystem II

Photosystem I

Cytochrome b6f

ATPase

Allophycocyanin

C-Phycocyanin

B-DM

Phospholipide Glass-beads

Components of crude extract

Figure 8: Model illustrates the major protein isolated as a result of different extraction conditions. This model is based on the results of absorbance and 77k fluorescence spectral analysis.

extract was considered important not only for

concentration C-phycocyanin but also for the removal of

the small-molecular-weight soluble protein.

To evaluate this new purification step (sucrose

gradient), a highly contaminated PC crude extract

(Lysozyme with glass beads) was concentrated by an

Amicon 10,000 centrifugation tube and exposed to

sucrose density gradient fractionation. The astonishing

results were recorded by the sucrose gradient that gave

almost the same purity and a much better yield.

After several optimization sequences, it could be

recommended that the digestion of T. elongatus cell wall

by Lysozyme and the exposure to high pressure (2000

psi) followed by PC extraction by HEPES buffer once or

twice was found to be the best condition for the isolation

of partial pure PC. This crude extract should be

concentrated through an Amicon 10,000 centrifugation

tube before fractionation by the sucrose gradient.

Isolation and purification should be quick, reliable, and

efficient; so, absorbance and fluorescence spectra

facilitated the purity of C-phycocyanin, thus enabling the

optimization of each step. Several advantages of the

sucrose gradient method are that it reduces the amount of

lost PC complex during purification sequences, produces

a highly purified complex (A620/A280 value), and reduces

time; thus, it could be considered a standard model that is

applied in different cyanobacteria species and too simple

not to be used by specialists.

ACKNOWLEDGMENTS

I would like to express my deep thanks for

Prof. Rögner Matthias (Ruhr University Bochum), who

giving me the opportunity to measure some

chromatographic and spectroscopical measurements.

Also, I acknowledge the German Research Council, DFG

for the financial support. Prof. Kurisu, Genji (Protein

Center of Osaka University) is gratefully acknowledged

for permitting me to do a part of practical work in

his laboratory. I would like to thank Hisako Kubota for

fruit discussions. I would like to thank Mrs Regina

Oworah-Nkruma for technical assistance rendered.

REFERENCES

Adir N, Dobrovetsky Y and Lerner N. 2001. Structure

of c-phycocyanin from the thermophilic cyanobacterium

Synechococcus vulcanus at 2.5 Å: structural implications

for thermal stability in phycobilisome Assembly. J Mol

Biol. 313(1):71–81.

Adir N. 2005. Elucidation of the molecular structures of

components of the phycobilisome: reconstructing a giant.

Photosynth. Res., 85(1): 15–32.

Bennett A and Bogorad L. 1973. Complementary

chromatic adaptation in a filamentous blue-green alga.

J Cell Biol., 58(2):419-35.

Bhaskar SU, Gopalaswamy G and Raghu R. 2005. A

simple method for efficient extraction and purification of

C-phycocyanin from Spirulina platensis Geitler. Indian J

Exp Biol., 43(3):277-279.

Boussiba S and Richmond AE. 1979. Isolation and

characterization of phycocyanins from the blue-green

alga Spirulina platensis. Arch Microbiol., 120(2):155–

159.

Bryant DA, Guglielmi G, Tandeau de marsac N,

Castets AM and Cohen-Bazire G. 1979. The structure

of cyanobacterial phycobilisomes: a model. Arch

Microbiol., 123(2):113–127.

Contreras-Martel C, Matamala A, Bruna C, Poo-

Caamaño G, Almonacid D, Figueroa M, Martínez-

Oyanedel J and Bunster M. 2007. The structure at 2 Å

resolution of phycocyanin from Gracilaria chilensis and

the energy transfer network in a PC–PC complex.

Biophys Chem., 125(2-3):388–396.

1143 Journal of Research in Biology (2014) 3(8): 1132-1146

El-Mohsnawy Eithar, 2014

El-Mohsnawy E, Kopczak MJ, Schlodder E,

Nowaczyk M, Meyer HE, Warscheid B,

Karapetyan NV and Rögner M. 2010. Structure and

function of intact photosystem 1 monomers from the

cyanobacterium Thermosynechococcus elongatus.

Biochemistry. 15; 49(23):4740-4751.

El-Mohsnawy E. 2013. Purification, Characterization,

and Activity Evaluation of Allophycocyanin from

Thermosynechococcus elongatus. Life Science Journal.

10(4): 3754-3761. 503.

Ferreira, KN, Iverson, TM, Maghlaoui, K, Barber, J

and Iwata S. 2004. Architecture of the photosynthetic

oxygen-evolving center. Science. 303 (5665):1831-1838.

Frankenberg N, Moser J and Jahn D. 2003. Bacterial

heme biosynthesis and its biotechnological application.

Appl Microbiol Biotechnol., 63(2):115-127.

Frankenberg N and Lagarias JC. 2003.

Phycocyanobilin: Ferredoxin Oxidoreductase of

Anabaena sp. PCC 7120: Biochemical and spectroscopic

characterization. The Journal of Biological Chemistry.

278(11): 9219-9226. DOI 10.1074/jbc.M211643200.

Gan X, Tang X, Shi C, Wang B, Cao Y and Zhao L.

2004. Preparation and regeneration of spheroplasts from

Arthrospira platensis (Spirulina). J Appl Phycol., 16

(6):513–517.

Gupta A and Sainis JK. 2010. Isolation of

C-phycocyanin from Synechococcus sp., (Anacystis

nidulans BD1). J Appl Phycol., 22(3):231–233.

Herrera A, Boussiba S, Napoleone V and Hohlberg A.

1989. Recovery of C-phycocyanin from the

cyanobacterium Spirulina maxima. J Appl Phycol., 1

(4):325–331.

Ichimura M, Kato S, Tsuneyama K, Matsutake S,

Kamogawa M, Hirao E, Miyata A, Mori S,

Yamaguchi N, Suruga K and Omagari K. 2013.

Phycocyanin prevents hypertension and low serum

adiponectin level in a rat model of metabolic syndrome.

Nutr Res., 33(5): 397-405.

Jordan P, Fromme P, Witt HT, Klukas O, Saenger W

and Krauss N. 2001. Threedimensional structure of

cyanobacterial photosystem I at 2.5 A resolution. Nature.

21 411(6840):909-917.

Katoh H, Hagino N, Grossmann AR and Ogawa T.

2001. Genes essential to iron transport in the

cyanobacterium Synechocystis sp. strain PCC 6803.

J Bacteriol., 183(9): 2779-2784.

Kubota H, Sakurai I, Katayama K, Mizusawa N,

Ohashi S, Kobayashi M, Zhang P, Aro EM and

Wada H. 2010. Purification and characterization of

photosystem I complex from Synechocystis sp. PCC

6803 by expressing histidine-tagged subunits. Biochim

Biophys Acta. 1797(1):98-105.

Kurisu G, Zhang H, Smith JL and Cramer WA.

2003. Structure of the cytochrome b6f complex of

oxygenic photosynthesis: Tuning the cavity. Science.

302(5647):1009-1014.

Lawrenz E, Fedewa EJ and Richardson TL. 2011.

Extraction protocols for the quantification of phycobilins

in aqueous phytoplankton extracts. J Appl Phycol., 23

(5):865–871.

Li B, Chu X, Gao M and Li W. 2010. Apoptotic

mechanism of MCF-7 breast cells in vivo and in vitro

induced by photodynamic therapy with C-phycocyanin.

Acta Biochimica et Biophysica Sinica. Sin (Shanghai). 42

(1):80-89.

Loll B, Kern J, Saenger W, Zouni A and Biesiadka J.

2005. Towards complete cofactor arrangement in the

3.0A resolution structure of photosystem II. Nature. 438

(7070):1040-4.

Journal of Research in Biology (2014) 3(8): 1132-1146 1144

El-Mohsnawy Eithar, 2014

Marín-Prida J, Pavón-Fuentes N, Llópiz-Arzuaga A,

Fernández-Massó JR, Delgado-Roche L, Mendoza-

Marí Y, Santana SP, Cruz-Ramírez A, Valenzuela-

Silva C, Nazábal-Gálvez M, Cintado-Benítez A,

Pardo-Andreu GL, Polentarutti N, Riva F, Pentón-

Arias E and Pentón-Rol G. 2013. Phycocyanobilin

promotes PC12 cell survival and modulates immune and

inflammatory genes and oxidative stress markers in acute

cerebral hypoperfusion in rats. Toxicol Appl

Pharmacol.,. 1; 272(1):49-60.

Minkova KM, Tchernov AA, Tchorbadjieva MI,

Fournadjieva ST, Antova RE and Busheva MCh.

2003. Purification of C-phycocyanin from Spirulina

(Arthrospira) fusiformis. J Biotechnol., 102(1):55–59.

Niu JF, Wang GC, Lin XZ and Zhou BC. 2007. Large

-scale recovery of C-phycocyanin from Spirulina

platensis using expanded bed adsorption

chromatography. J Chromatogr B. 850(1-2): 267–276.

Patil G and Raghavarao KSMS. 2007. Aqueous two

phase extraction for purification of C-phycocyanin.

Biochem Eng J., 34(2):156–164.

Pleonsil P and Suwanwong Y. 2013. An in vitro study

of c-phycocyanin activity on protection of DNA and

human erythrocyte membrane from oxidative damage.

Journal of Chemical and Pharmaceutical Research. 5

(5):332-336 .

Rippka R, Deruelles J, Waterbury JB, Herdman M

and Stanier RY. 1979. Generic assignments, strain

histories and properties of pure cultures of cyanobacteria.

J Gen Microbiology. 111(1):1–61.

Rito-Palomares M, Nuñez L and Amador D. 2001.

Practical application of aqueous two phase systems for

the development of a prototype process for c-

phycocyanin recovery from Spirulina maxima. J Chem

Techn Biotechnol., 76(12):1273–1280.

Rögner M, Boekema EJ and Barber J. 1996. How

does photosystem 2 split water? The structural basis of

efficient energy conversion. Trends Biochem Sci., 21

(2):44-9.

Santiago-Santos MC, Ponce-Noyola T, Olvera-

Ramirez R, Ortega-Lopez J and Canizares-

Villanueva RO. 2004. Extraction and purification of

phycocyanin from Calothrix sp. Process Biochemistry.

39(12): 2047-2052.

Schägger, H and von Jagow, G. 1987. Tricine-sodium

dodecyl sulfate-polyacrylamide gel electrophoresis for

the separation of proteins in the range from 1 to 100 kDa.

Analyt Biochem., 166(2): 368-379.

Schlodder E, Shubin VV, El-Mohsnawy E, Rögner M

and Karapetyan NV. 2007. Steady-state and transient

polarized absorption spectroscopy of photosystem I

complexes from the cyanobacteria Arthrospira platensis

and Thermosynechococcus elongatus. Biochim Biophys

Acta. 2007 (6):732-741.

Schopf JW. 2000. The fossil record: tracing the roots of

the cyanobacterial lineage. In: Whitton BA, Potts M

(eds) The ecology of cyanobacteria: Their Diversity in

Time and Space. Kluwer, Dordrecht. p 13–35.

Song W, Zhao C and Wang S. 2013. A Large-Scale

Preparation Method of High Purity CPhycocyanin.

International Journal of Bioscience, Biochemistry and

Bioinformatics. 3(4):293-297.

Soni B, Trivedi U and Madamwar D. 2008. A novel

method of single step hydrophobic interaction

chromatography for the purification of phycocyanin from

Phormidium fragile and its characterization for

antioxidant property. Bioresour Technol., 99(1):188–

194.

Sonoike K and Katoh S. 1989. Simple estimation of the

differential absorption coefficient of P-700 in detergent-

1145 Journal of Research in Biology (2014) 3(8): 1132-1146

El-Mohsnawy Eithar, 2014

treated preparations. Biochim Biophys Acta. 976(2-

3):210–213.

Stec B, Troxler RF and Teeter MM. 1999. Crystal

structure of C-phycocyanin from Cyanidium caldarium

provides a new perspective in on phycobilisome

assembly. Biophys J., 76(6): 2912–2921.

Thangam R, Suresh V, Asenath Princy W, Rajkumar

M, Senthilkumar N, Gunasekaran P, Rengasamy R,

Anbazhagan C, Kaveri K and Kannan S. 2013.

C-Phycocyanin from Oscillatoria tenuis exhibited an

antioxidant and in vitro antiproliferative activity through

induction of apoptosis and G0/G1 cell cycle arrest. Food

Chem., 140(1-2):262-72.

Troxler RF, Ehrhardt MM, Brown-Mason AS and

Offner GD. 1981. Primary structure of phycocyanin

from the unicellular rhodophyte Cyanidium caldarium.

II. Complete amino acid sequence of the beta subunit. J

Biol Chem., 256(23):12176–12184.

Zouni A, Witt HT, Kern J, Fromme P, Krauss N,

Saenger W and Orth P. 2001. Crystal structure of

photosystem II from Synechococcus elongatus at 3.8 A

resolution. Nature. 409(6821):739-43.

Journal of Research in Biology (2014) 3(8): 1132-1146 1146

El-Mohsnawy Eithar, 2014

Submit your articles online at www.jresearchbiology.com

Advantages

• Easy online submissionEasy online submissionEasy online submissionEasy online submission

• Complete Peer reviewComplete Peer reviewComplete Peer reviewComplete Peer review

• Affordable ChargesAffordable ChargesAffordable ChargesAffordable Charges

• Quick processingQuick processingQuick processingQuick processing

• Extensive indexingExtensive indexingExtensive indexingExtensive indexing

• You retain your copyright You retain your copyright You retain your copyright You retain your copyright

submit@jresearchbiology.com

www.jresearchbiology.com/Submit.php.

Article Citation: Banjit Bhatta and Mrigendra Mohan Goswami. Length-Weight relationship and condition factor of Channa aurantimaculata (Musikasinthorn, 2000) studied in a riparian wetland of Dhemaji District, Assam, India. Journal of Research in Biology (2014) 3(8): 1147-1152

Jou

rn

al of R

esearch

in

Biology

Length-Weight relationship and condition factor of Channa aurantimaculata (Musikasinthorn, 2000) studied in a riparian wetland of Dhemaji District,

Assam, India

Keywords:

Channa aurantimaculata, L-W relationship, condition factor, Dhemaji district

ABSTRACT: Present study reports the length-weight relationship, condition factor and relative condition factor of Channa aurantimaculata (Musikasinthorn, 2000), a hole dwelling snakehead endemic fish species (Goswami et al., 2006, Vishwanath and Geetakumari, 2009) of a riparian wetland habitat of Dhemaji district, Assam. Length-weight relationship, condition factor and relative condition factor of the species was evaluated during the feeding cycle (December - March/April) in the year November 2008 to October 2009. The relative growth coefficient (b) values for male was found to be 4.18 and for female was 2.65, the condition factor (K) value was 1.29 ± 0.27 for male and 1.66 ± 0.28 for female, relative condition factor (Kn) value 1.05 ± 0.42 in male and 1.00 ± 0.40 in female were observed. The coefficient of correlation (r ) in both the sexes exhibit allometric growth (negative in female and highly positive in male).

1147-1152 | JRB | 2014 | Vol 3 | No 8

This article is governed by the Creative Commons Attribution License (http://creativecommons.org/

licenses/by/2.0), which gives permission for unrestricted use, non-commercial, distribution and reproduction in all medium, provided the original work is properly cited.

www.jresearchbiology.com Journal of Research in Biology

An International

Scientific Research Journal

Authors:

Banjit Bhatta1 and

Mrigendra Mohan

Goswami2.

Institution:

1. Department of Zoology,

Dhemaji College, Dhemaji-

787057 (Assam).

2. Department of Zoology,

Gauhati University,

Guwahati- 781014 (Assam).

Corresponding author:

Banjit Bhatta.

Web Address: http://jresearchbiology.com/documents/RA0406.pdf.

Dates: Received: 15 Dec 2013 Accepted: 15 Jan 2014 Published: 10 Feb 2014

Journal of Research in Biology An International Scientific Research Journal

Original Research

INTRODUCTION:

The growth performance and well-being of any

fish species in relation to habitat diversity are determined

through the measure of its length- weight relationship

and condition factor. Such a knowledge on length and

weight is useful in the assessment of fish stock and

population to predict the potential yield of the species.

The size variation in relation to growth in biomass of fish

is expressed in length-weight statistics. In the natural

population the growth dynamics of any fish species is

dependent on its habitat variability. The growth pattern

in fishes follow the cube law (Brody 1945; Lagler,

1952). As the fish grows isometrically exhibiting the

exponential value exactly at 3.0, such relationship is

considered valid. However, in reality, it may deviate

from this ideal value due to environmental condition or

condition of the fish (Le Cren, 1951). Therefore, as

suggested by Le Cren (1951) this relationship

is expressed by an equation- W= aLb or W= Log a + b

Log L.

Channa aurantimaculata (Musikasinthorn,

2000), one of the burrowing members of the Asian

snakehead exhibits its habitat range in the riparian

wetlands of upper Assam districts as distributed in

Tinsukia Dibrugarh Dhemaji districts. The dual life cycle

of the fish (living in burrows and enjoying free

swimming life) is a special behavioral character within

the riparian range of the habitat. This species endemic to

the upper Assam zone (Goswami et al., 2006;

Vishwanath and Geetakumari, 2009) is of special interest

for its assessment of growth dynamics and natural

population stock. The growth performance of the natural

population of the species needs to be examined to

ascertain its overall relationship of length and weight.

The general well-being of the species in the present

habitat characters is expressed in terms of its

mathematical expression of condition factor. The present

study deals with computing the length- weight

relationship, condition factor and relative condition

factor of Channa aurantimaculata from the natural stock

of Lachia beel, a riparian wetland (Longitude 94°57 /

27// E and Latitude 27°38/ 33// N ) located in Dhemaji

District of Assam.

MATERIALS AND METHODS

A total of 42 specimens with size ranges 21.4 -

39.6 in length and 150.25 – 769.82 in weight of both

sexes of Channa aurantimaculata were collected

randomly from a riparian weltand namely Lachia beel

(Longitude 94°57 / 27// E and Latitude 27°38/ 33// N ) of

Dhemaji district of Assam, India during Nov, 2008 –

Oct, 2009. Since sex of the collected samples could not

be distinguished by secondary sexual characters, all

fishes were dissected and identified the sex based on

gonadal structures following Mackie and Lewis, 2001.

The male specimens (15 number) and female specimens

(27number) were separated for their length and weight.

Total length (TL) were measured from tip of the snout to

tip of the caudal fin nearest to 0.01 mm by digital vernier

caliper and Body weight (BW) of the fish samples were

measured nearest to 0.01 gm by digital balance

(Sartorius BA 610, Germany) individually. Length-

weight relationship were estimated by the equation

W=a Lb (Le Cren, 1951) which further expressed

logarithmically as

Log W=Log a +b Log L

Where, W= Weight of the fish, L=length of the

fish and ‘a’ and ‘b’ are constant. Parameter ‘a’ and ‘b’

were calculated by the method of least square regression:

The value of correlation ‘r’, standard deviation

(SD) between total length and body weight were

calculated with the help of SPSS software (version-16)

Bhatta and Goswami, 2014

1148 Journal of Research in Biology (2014) 3(8): 1147-1152

Log a = ∑log W.∑(log L)2 - ∑log L. ∑(log L. log W)

N. ∑(log L)2 – (∑log L)2

Log b = ∑ Log W – N. Log a

∑ Log L

and Microsoft Office Excel. The Log transformed

regression was used to test the growth.

RESULTS AND DISCUSSION

In the present study the body weight of male and

female have been ranged between 180.42 and 750.01 gm

and 150.25 and 769.82 gm respectively and the total

length between 28.2 and 39.6 cm in male and 21.4 and

38.9 cm in female. The value of ‘a’, ’b’, ‘r’ and mean ±

SD of male and female are given in the Table 1. The

‘K’ and ‘Kn’ values are depicted in Table 2. The

regression graphs of LWR and condition factor (K) are

depicted in Fig.1 and Fig.2. Logarithmic form of Length-

weight relationship is expressed by the following

equations for male and females as

For Male, -Log W = - 3.68 + 4.18 Log L

For Female, -Log W = - 1.26 + 2.61Log L

Channa aurantimaculata is a hole dwelling

snakehead species enjoying aestivation of life during the

dry season (December – March/April) and free living life

during rest of the period (May- November). The growth

performance of the fish during the free living period is an

important part of its life cycle. In the present

investigation the growth performance of both the sexes

are found high since the correlation coefficient ‘r’

exhibits a high degree of positive allometric correlation

in male and feebly negative allometric correlation

between the L-W relationship (Table-1). Degree of

variation of exponential value of L-W relationship

indicated by ‘ b’ value in male (4.186) is higher than the

female (2.651). However, correlation coefficient ‘r’

value in female is found to be more closer to 1.0 (0.959)

than the ‘ r’ value in male (0.898). This indicates that the

female has higher degree of relationship in growth

performance than the male in spite of lower degree of

exponential growth than the latter. Notwithstanding the

value of exponent ‘b’ usually ranges between 2.5 and 4.0

(Hile, 1936, Martin, 1949) and remains constant at 3.0

for an exactly ideal fish (Allen,1938), the present study

indicates that the value of ‘b’ in case of

Channa aurantimaculata is found to be deviated from

‘Cube law’ in both the cases of male and female.

Considerably the growth coefficient ‘b’ of

Channa aurantimaculata is positively allometric, but

within the value (slightly higher in upper limit) as

suggested by Hile and Martin. Saikia et al., (2011) also

observed the allometric growth in Channa punctatus

from Assam. The higher ‘b’ value may be indicated by

Journal of Research in Biology (2014) 3(8): 1147-1152 1149

Bhatta and Goswami, 2014

Sex Weight range

(gm)

Size range

(cm) Range of K Range of Kn

Mean ± SD

K

Mean ± SD

Kn

Male N=15 180.42 - 750.01 28.2 - 39.6 0.78 - 1.66 0.41 - 1.69 1.29± 0.27 1.05 ± 0.42

Female N=27 150.25 - 769.82 21.4 - 38.9 1.31- 2.33 1.00 - 1.56 1.66 ± 0.28 1.00 ± 0.40

Table. 2: Mean ± standard deviation of Condition factor (K) and Relative condition factor (Kn)

Significant level at 0.05

Table. 1: Mean ± standard deviation of Body weight (BW) and Total length (TL), value of ‘a’ and ‘b’

Sex Weight range

(gm)

Size range

(cm)

Mean±SD

BW(gm)

Mean±SD

TL (cm)

Value

of ‘a’

Value

of ‘b’

‘r’

value

Male

N=15

180.42 - 750.01

28.2 - 39.6

443.12 ± 180.97

32.42 ± 3.147 -3.68

4.186

0.898

Female

N=27

150.25 - 769.82

21.4 -38.9

492.57 ± 193.85

30.47 ± 5.23 -1.26

2.651

0.959

the higher feeding proficiencies (Soni and Kathal, 1953;

Kaur, 1981; Saikia et al., 2011), which is observed with

the present study. The free moving period of

Channa aurantimaculata is marked as the best feeding

period, which reflects in correlation coefficient of L-W

relationship (r) and high degree of exponential

growth (b).

It is observed that Channa aurantimaculata lives

in burrows, which is followed by a free living life as

soon as the riparian swamp habitats are inundated with

flood water. The fish starts its feeding cycle overcoming

the non-feeding life of aestivation. As the feed intensity

increases during the feeding period the fish undergoes

enhancement of growth. As a result, it follows favorably

a normal growth showing positive allometric relation

which is reflected in the Length-Weight relationship.

‘Condition’, ‘fatness’ or well being of fish

expressed by K-factor is based on hypothesis that heavier

fish of a given length are in better condition (Bagenal

and Tesch, 1978). For monitoring of feeding intensity

and growth rate in fish in general K-factor is an essential

index (Oni et al.,1983). However, the condition factor

(K) and relative condition factor (Kn) in the free living

stage of Channa aurantimaculata (Table) clearly

indicate that the general well being and the status of

maturity and growth are favourably good. High K-value

in both the species suggests that condition factor

increased with increasing length and weight of the fish

(Yousuf and Khurshid, 2008). However in case of

Channa aurantimaculata it exhibits highest peak in

Bhatta and Goswami, 2014

1150 Journal of Research in Biology (2014) 3(8): 1147-1152

y = 4.186x - 3.688

R² = 0.806

A

y = 2.651x - 1.268

R² = 0.919

B

Fig.1: Relationship between Log Total length (cm) and Log body weight (gm) of

Channa aurantimaculata (A = Male and B= Female).

y = 0.001x + 0.816

R² = 0.506

C

y = -0.000x + 1.788

R² = 0.032

D

Fig.2: Condition factor (Kn) in relation to body weight (gm) of Channa aurantimaculata

(C=Male and D=Female

K-factor in relation to BW within the weight range of

400-600 gm BW and thereafter steady decline is noticed

(Figure 2). This may be due to completion of free

swimming stage and initiation of burrowing /aestivation

cycle.

CONCLUSION

Channa aurantimaculata is found to endemic in

the upper Assam zone (Goswami et al., 2006,

Vishwanath and Geetakumari, 2009) and dwindling in

the natural wetland habitat. The feeding and breeding

cycle of the fish is unidentical from the other common

snakeheads of the region. Due to rampant habitat

destruction the fish is dwindling and struggling for

survival in nature. For the conservation of the species the

basic data for growth, breeding and feeding behavior are

considered pre requisite. Steps related to conservation of

the habitat for the species is highly recommended.

ACKNOWLEDGEMENTS

The authors are very much grateful to the Head

of the Department of Zoology, Gauhati University and

Principal, Dhemaji College, Assam for extending their

help during the study period. The authors are also

thankful to the UGC-SAP (DRS) Laboratory of zoology

department of Gauhati University for helping

identification of the species. Appreciations are due to the

skilled fishers and local youths for their immense help

and cooperation during the course of field study.

REFERENCE

Allen KR. 1938. Some Observation on the Biology of

the Trout (Salmo trutta) in Windermere. J. Anim. Ecol.,

7(2): 333 - 349.

Bagenal TB, Tesch AT. 1978. Conditions and Growth

Patterns in Fresh Water Habitats. Blackwell Scientific

Publications, Oxford. 75-89.

Brody S. 1945. Bioenergetics and growth. Reichold

Publishing Corporation, New York. 1023.

Goswami MM, Borthakur Arunav, and Pathak

Janardan. 2006. Comparative biometry, habitat

structure and distribution of four endemic snakehead

(Teleostei : Channidae) species of Assam, India. J.

Inland Fish. Soc. India. 38 (1): 1-8.

Hile R. 1936. Age and Growth of the Cisco,

Leucichthys artedi (Le Sueur), in the Lakes of the North-

eastern High Lands. Wisconsin. Bulletin U. S. Bur.

Fishery. 48: 211 - 317.

Kaur S. 1981. Studies on Some Aspects of the Ecology

and Biology of Channa gachua (Ham.) and Channa

stewartii (Playfair). Ph.D. Thesis. North Eastern Hill

University, Shillong.

Lagler KF. 1952. Freshwater Fishery Biology. Wim C

Brown Co. Dubugue, Iowa. 360.

Le-Cren ED. 1951. The Length-Weight Relationship

and Seasonal Cycle in Gonad-Weight and Condition in

the Perch (Perca fluviatilis). J. Anim. Ecol., 20:201-219.

Mackie M, Lewis P. 2001. Assessment of gonad staging

system and other methods used in the study of the

reproductive biology of narrow-barred Spanish

Mackeral, Scomberomorus commerson, in Western

Australia. Fish Res. Rep. West Aust. 136 :1-32.

Martin WR. 1949. The Mechanics of Enivironmental

Control of Body Form in Fishes. Univ. Toronto Stud.

Biol. 58 (Publ. Ont. Fish. Res. Lab.). 70: 1 -19.

Musikasinthorn P. 2000. Channa aurantimaculata, a

new channid fish from Assam (Brahmaputra River

basin), India, with designation of a neotype for

C. amphibeus (McClelland,1845), Ichthyological

Research. 47: 27 -37.

Bhatta and Goswami, 2014

Journal of Research in Biology (2014) 3(8): 1147-1152 1151

Oni SK, Olayemi JY and Adegboye JD. 1983.

Comparative physiology of three ecologically distinct

fresh water fishes, Alestes nurse Ruppell, Synodontis

schall Bloch and S. Schneider and Tilapia Zilli Gervais.

J. Fish Biol., 22: 105- 109.

Saikia AK, Singh ASK, Das DN and Biswas SP. 2011.

Length-Weight relationship and condition factor of

spotted snakehead, Channa punctatus ( Bloch), Bulletin

of Life Science. XVII : 102-108.

Soni DD, Kathal M. 1953. Length - Weight

Relationship in Cirrhina mrigala (Val.) and Cyprinus

carpio (Ham.) Matsya. 5: 67 -72.

Vishwanath W. and Geetakumari KH. 2009.

Diagnosis and interrelationships of fishes of the genus

Channa Scopoli (Teleostei : Channidae) of northeastern

India. Journal of Threatened Taxa., 1(2) : 97-105.

Yousuf F and Khurshid S. 2008. Length- weight

relationship and relative conditions factor for the

halfbeak Hamirampus far Forssk ÃҰl,1775 from the

Karachi coast. Univ. J. zool. Rajashahi Univ., 27:103-

104.

Bhatta and Goswami, 2014

1152 Journal of Research in Biology (2014) 3(8): 1147-1152

Submit your articles online at www.jresearchbiology.com

Advantages

Easy online submission Complete Peer review Affordable Charges Quick processing Extensive indexing You retain your copyright

submit@jresearchbiology.com

www.jresearchbiology.com/Submit.php.

Journal of Research in Biology

Authors:

John De Britto A*,

Benjamin Jeya Rathna,

Kumar P and Herin Sheeba

Gracelin D.

Institution:

Plant Molecular Biology

Research Unit, Post Graduate

and Research Department of

Plant Biology and Plant

Biotechnology,

St.Xavier's College

(Autonomous), Palayamkottai

- 627 002, Tamil Nadu, India.

Corresponding author:

John De Britto A.

An International Scientific Research Journal

Impact of ecological factors on genetic diversity in

Nothapodytes nimmoniana Graham based on ISSR amplification

Keywords: Ecological factors, Genetic diversity, Nothapodytes nimmoniana, ISSR.

ABSTRACT: Nothapodytes nimmoniana Graham is one of the most important anti cancer phytochemical yielding plant belongs to the family of Icacinaceae. In order to evaluate the genetic diversity of different N. nimmoniana land races based on molecular markers, five landraces were collected from different populations of the Western Ghats of South India. The ISSR method was utilized employed for evaluating the genetic diversity within the species, using 12 ISSR primers. A total of 108 bands were produced. The overall percentage of polymorphism was 87.10. Nei’s overall gene heterozygosity was found to be 0.3333. The genetic distance between the samples ranged from 0.2146 to 0.4099 and the genetic identity ranged from 0.6637 to 0.8068. The Shannon’s information index was found to be 0.4924. The UPGMA dendrogram showed the relationship between five different populations in two major clusters. Genetic diversity is correlated with soil factors for ascertaining the validity of the markers.

Guidelines for Authors

The article should be addressed to "The Editor".

Submission of an article implies that it has never been published in any other journals and if accepted, it will not be publi shed

elsewhere.

All papers are first reviewed by the editor. Papers found lacking will not be considered. Others will be sent for a detailed peer-review

process.

Journal Manuscript Format

The manuscript should be typed in “Times new Roman” font with font size 11 and 1.5 line spacing. The page size should be strictly

A4. All images should be in JPEG format. The article is to be submitted should accompany a covering letter with name and complete address

(including Telephone Number and e-mail ID) of the author/s. The completed article should be sent to submit@jresearchbiology.com

Title

The title should briefly identify the subject and indicate the purpose of the document. The title should supply enough information for

the reader to make a reliable decision on probable interest. Do not use all caps; instead use caps only at the first word of the title and/or at

scientific names, abbreviations etc., Center the authors' initials and last names directly below the title.

Abstract

The abstract should include a hypothesis or rationale for the work, a brief description of the methods, a summary of the results, and a conclusion:

The abstract should be less than 250 words. Do not include literature citations or references to tables, figures or equations.

Keywords

A short list of keywords or phrases should be included immediately after the abstract as index words. Choose keywords that reflect the

content of your article. Note that words in the title are not searchable as keywords unless they are also included in the keyword list.

Body of the Article

The introductory section of the text should include a brief statement of why the research was conducted. It should also define the

problem and present objectives along with a plan of development of the subject matter. The introductory section also usually includes a brief

survey of the relevant literature on the topic.

Materials and Methods

Provide sufficient detail so that the work may be repeated. Do not give details of methods described in readily available sources.

Instead, refer to the source and describe any modification. Figures that illustrate test apparatus and tables of treatment parameters or equipment

specifications are appropriate here.

Results and Discussion

This section describes the solution to the problem stated in the introductory section. Use figures and tables to visually supplement the

presentation of your results. The text must refer explicitly to all visuals, and you must interpret the visual elements to emphasize the evidence on

which your conclusions are based. Do not omit important negative results.

In addition, relate your findings to previous findings by identifying how and why there are differences and where there is agreement. Speculation

is encouraged, but it must be identified.

Conclusion

This is a summary of your results. In this section, state any conclusions that can be drawn from your data. You may also include

suggestions for future research. The conclusion may be a subsection of the Results and Discussion section, or it may be a separate section. Data

or statements cited in your conclusion must have been stated previously in the article. Do not introduce new information in the conclusion.

Acknowledgement

Acknowledgements are optional. Use them to thank individuals or organizations that provided assistance in materials, expertise, or

financing. The acknowledgements will appear at the end of the text and should be limited to one or two sentences.

References

All sources cited in the text must be listed in the References, and all documents listed in the References must be cited in the text.

Accuracy of citation is the author's responsibility.

Reference Style

References should be cited in the text in the form (Author et al, 1987) and listed in alphabetical order at the end of the article as follows:

Schernewski G, Neumann T. The trophic state of the Baltic Sea a century ago: a model simulation study. J Mar Sys., 2005;53:109–

124.

Kaufman PD, Cseke LJ, Warber S, Duke JA and Brielman HL. Natural Products from plants. CRC press, Bocaralon, Florida. 1999;

15-16.

Kala CP. Ecology and Conservation of alphine meadows in the valley of flowers national park, Garhwal Himalaya. Ph.D Thesis,

Dehradun: Forest Research Institute, 1998; 75-76.

http://www.ethnobiomed.com/content/pdf/1746-4269-1-11.pdf.

Appendix

Use an appendix for material that is too long to include in the text of the article.

Manuscript Charges

Journal of Research in Biology is an International Research Journal. This Journal provides immediate access to all published full-text

articles to interested readers from all around the world. The availability of the author’s paper makes the scientific community to understand and

develop an impact in the concerned research field. It also increases the chance of more citations of the published work, which in turn can be

translated into more recognition of research. This journal also accelerates research and knowledge building worldwide.

Publishing an article in Journal of Research in Biology requires payment of the manuscript processing charges, once the manuscript is

accepted for publication. The payment is to be made by one of the authors, their university/organization, or funding entity. The manuscript

processing charges are fixed so as to allow publishers to recover manuscript processing expenses and the cost of making the full-text available on

the Internet to all interested researchers.

For Indians

The charges for submission of a Research article is Rs 2100, up to 8 pages and for more pages, each page costs Rs 250.

For Foreign nationals

The charges for submission of a Research article is USD 100, up to 8 pages and for more pages, each page costs 15 USD.

Copyright

Authors who publish in Journal of Research in Biology retain the copyright of their work which allows the unrestricted use,

distribution, and reproduction of an article in any medium, provided that the original work is properly cited.

If you have any queries kindly contact us at contact@jresearchbiology.com