journal of research in biology volume 4 issue 2

Aim and Scope

Journal of Research in Biology is an international scientific journal committed to the development and spread of

research in Biological sciences. It accepts research articles with affiliation to biological science from all around the globe and

publishes them in the journal. The submitted articles are peer-reviewed by experts in the field and editorial board members. Make

the most of your research by publishing articles in Journal of Research in Biology.

Journal of Research in Biology works as a portal for biological scientific research publication. It works to promote the use

of biological sciences knowledge in the world public policy, and to develop and advance science policy that serves the needs of scientific research and education communities, particularly the biological sciences.

The journal has been uniquely positioned to help members of the scientific community; become effective advocates for their science and to be better known for the public that relate to or impact the biological sciences.

Call for Papers

Journal of Research in Biology seeks Research Articles, Short Communications and Mini reviews. The Journal will accept

and review submissions in English from any author, in any global locality. A body of international peers will review all

submissions with potential author revisions as recommended by reviewers, with the intent to achieve published papers that:

Relate to the field of Biology

Represent new, previously unpublished work

Advance the state of knowledge of the field

Conform to a high standard of presentation.

Disclaimer: Journal of Research in Biology is not responsible for the content of individual manuscripts. Manuscripts available in this journal were peer reviewed. Manuscripts accepted in the issues conform to the editorial policies. But more details regarding the nature of their research, conflicts in their workplace, plagiarisms, stealing of others property, manipulation of data, illegal formulation of a paper from other allied papers etc., were all not known to us. Any details, queries regarding the manuscripts should be only dealt with the authors and not with the publisher. The concept of peer review can only limit the plagiarism to a small extent where as it is the work of the public and the individuals to identify and stop the illegal formulation of new articles from the other. The publisher invites all details regarding the plagiarism of an article published in the journal provided with the original data and supplementary files for confirmation. On identifying plagiarism issues in an article, the article published will be removed from the journal website and further on the citation of the same will be debarred. Provided the author of the manuscript will be prohibited to publish his/her other studies in our journal or throughout the journals under our portal.

List of Editors of Editors in the Journal of Research in Biology

Managing and Executive Editor:

Abiya Chelliah [Molecular Biology] Publisher, Journal of Research in Biology.

Editorial Board Members:

Ciccarese [Molecular Biology] Universita di Bari, Italy.

Sathishkumar [Plant Biotechnologist] Bharathiar University.

SUGANTHY [Entomologist] TNAU, Coimbatore.

Elanchezhyan [Agriculture, Entomology] TNAU, Tirunelveli.

Syed Mohsen Hosseini [Forestry & Ecology] Tarbiat Modares University (TMU), Iran.

Dr. Ramesh. C. K [Plant Tissue Culture] Sahyadri Science College, Karnataka.

Kamal Prasad Acharya [Conservation Biology] Norwegian University of Science and Technology (NTNU), Norway.

Dr. Ajay Singh [Zoology] Gorakhpur University, Gorakhpur

Dr. T. P. Mall [Ethnobotany and Plant pathoilogy] Kisan PG College, BAHRAICH

Ramesh Chandra [Hydrobiology, Zoology] S.S.(P.G.)College, Shahjahanpur, India.

Adarsh Pandey [Mycology and Plant Pathology] SS P.G.College, Shahjahanpur, India

Hanan El-Sayed Mohamed Abd El-All Osman [Plant Ecology] Al-Azhar university, Egypt

Ganga suresh [Microbiology] Sri Ram Nallamani Yadava College of Arts & Sciences, Tenkasi, India.

T.P. Mall [Ethnobotany, Plant pathology] Kisan PG College,BAHRAICH, India.

Mirza Hasanuzzaman [Agronomy, Weeds, Plant] Sher-e-Bangla Agricultural University, Bangladesh

Mukesh Kumar Chaubey [Immunology, Zoology] Mahatma Gandhi Post Graduate College, Gorakhpur, India.

N.K. Patel [Plant physiology & Ethno Botany] Sheth M.N.Science College, Patan, India.

Kumudben Babulal Patel [Bird, Ecology] Gujarat, India.

CHANDRAMOHAN [Biochemist] College of Applied Medical Sciences, King Saud University.

B.C. Behera [Natural product and their Bioprospecting] Agharkar Research Institute, Pune, INDIA.

Kuvalekar Aniket Arun [Biotechnology] Lecturer, Pune.

Mohd. Kamil Usmani [Entomology, Insect taxonomy] Aligarh Muslim university, Aligarh, india.

Dr. Lachhman Das Singla [Veterinary Parasitology] Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana, India.

Vaclav Vetvicka [Immunomodulators and Breast Cancer] University of Louisville, Kentucky.

José F. González-Maya [Conservation Biology] Laboratorio de ecología y conservación de fauna Silvestre, Instituto de Ecología, UNAM, México.

Dr. Afreenish Hassan [Microbiology] Department of Pathology, Army Medical College, Rawalpindi, Pakistan.

Gurjit Singh [Soil Science] Krishi Vigyan Kendra, Amritsar, Punjab, India.

Dr. Marcela Pagano [Mycology] Universidade Federal de São João del-Rei, Brazil.

Dr.Amit Baran Sharangi [Horticulture] BCKV (Agri University), West Bengal, INDIA.

Dr. Bhargava [Melittopalynology] School of Chemical & Biotechnology, Sastra University, Tamilnadu, INDIA.

Dr. Sri Lakshmi Sunitha Merla [Plant Biotechnology] Jawaharlal Technological University, Hyderabad.

Dr. Mrs. Kaiser Jamil [Biotechnology] Bhagwan Mahavir Medical Research Centre, Hyderabad, India.

Ahmed Mohammed El Naim [Agronomy] University of Kordofan, Elobeid-SUDAN.

Dr. Zohair Rahemo [Parasitology] University of Mosul, Mosul,Iraq.

Dr. Birendra Kumar [Breeding and Genetic improvement] Central Institute of Medicinal and Aromatic Plants, Lucknow, India.

Dr. Sanjay M. Dave [Ornithology and Ecology] Hem. North Gujarat University, Patan.

Dr. Nand Lal [Micropropagation Technology Development] C.S.J.M. University, India.

Fábio M. da Costa [Biotechnology: Integrated pest control, genetics] Federal University of Rondônia, Brazil.

Marcel Avramiuc [Biologist] Stefan cel Mare University of Suceava, Romania.

Dr. Meera Srivastava [Hematology , Entomology] Govt. Dungar College, Bikaner.

P. Gurusaravanan [Plant Biology ,Plant Biotechnology and Plant Science] School of Life Sciences, Bharathidasan University, India.

Dr. Mrs Kavita Sharma [Botany] Arts and commerce girl’s college Raipur (C.G.), India.

Suwattana Pruksasri [Enzyme technology, Biochemical Engineering] Silpakorn University, Thailand.

Dr.Vishwas Balasaheb Sakhare [Reservoir Fisheries] Yogeshwari Mahavidyalaya, Ambajogai, India.

Dr. Pankaj Sah [Environmental Science, Plant Ecology] Higher College of Technology (HCT), Al-Khuwair.

Dr. Erkan Kalipci [Environmental Engineering] Selcuk University, Turkey.

Dr Gajendra Pandurang Jagtap [Plant Pathology] College of Agriculture, India.

Dr. Arun M. Chilke [Biochemistry, Enzymology, Histochemistry] Shree Shivaji Arts, Commerce & Science College, India.

Dr. AC. Tangavelou [Biodiversity, Plant Taxonomy] Bio-Science Research Foundation, India.

Nasroallah Moradi Kor [Animal Science] Razi University of Agricultural Sciences and Natural Resources, Iran

T. Badal Singh [plant tissue culture] Panjab University, India

Dr. Kalyan Chakraborti [Agriculture, Pomology, horticulture] AICRP on Sub-Tropical Fruits, Bidhan Chandra Krishi Viswavidyalaya,

Kalyani, Nadia, West Bengal, India.

Dr. Monanjali Bandyopadhyay [Farmlore, Traditional and indigenous

practices, Ethno botany] V. C., Vidyasagar University, Midnapore.

M.Sugumaran [Phytochemistry] Adhiparasakthi College of Pharmacy, Melmaruvathur, Kancheepuram District.

Prashanth N S [Public health, Medicine] Institute of Public Health, Bangalore.

Tariq Aftab Department of Botany, Aligarh Muslim University, Aligarh, India.

Manzoor Ahmad Shah Department of Botany, University of Kashmir, Srinagar, India.

Syampungani Stephen School of Natural Resources, Copperbelt University, Kitwe, Zambia.

Iheanyi Omezuruike OKONKO Department of Biochemistry & Microbiology, Lead City University,

Ibadan, Nigeria.

Sharangouda Patil Toxicology Laboratory, Bioenergetics & Environmental Sciences Division,

National Institue of Animal Nutrition

and Physiology (NIANP, ICAR), Adugodi, Bangalore.

Jayapal Nandyal, Kurnool, Andrapradesh, India.

T.S. Pathan [Aquatic toxicology and Fish biology] Department of Zoology, Kalikadevi Senior College, Shirur, India.

Aparna Sarkar [Physiology and biochemistry] Amity Institute of Physiotherapy, Amity campus, Noida, INDIA.

Dr. Amit Bandyopadhyay [Sports & Exercise Physiology] Department of Physiology, University of Calcutta, Kolkata, INDIA .

Maruthi [Plant Biotechnology] Dept of Biotechnology, SDM College (Autonomous),

Ujire Dakshina Kannada, India.

Veeranna [Biotechnology] Dept of Biotechnology, SDM College (Autonomous), Ujire Dakshina Kannada, India.

RAVI [Biotechnology & Bioinformatics] Department of Botany, Government Arts College, Coimbatore, India.

Sadanand Mallappa Yamakanamardi [Zoology] Department of Zoology, University of Mysore, Mysore, India.

Anoop Das [Ornithologist] Research Department of Zoology, MES Mampad College, Kerala, India.

Dr. Satish Ambadas Bhalerao [Environmental Botany] Wilson College, Mumbai

Rafael Gomez Kosky [Plant Biotechnology] Instituto de Biotecnología de las Plantas, Universidad Central de Las Villas

Eudriano Costa [Aquatic Bioecology] IOUSP - Instituto Oceanográfico da Universidade de São Paulo, Brasil

M. Bubesh Guptha [Wildlife Biologist] Wildlife Management Circle (WLMC), India

Rajib Roychowdhury [Plant science] Centre for biotechnology visva-bharati, India.

Dr. S.M.Gopinath [Environmental Biotechnology] Acharya Institute of Technology, Bangalore.

Dr. U.S. Mahadeva Rao [Bio Chemistry] Universiti Sultan Zainal Abidin, Malaysia.

Hérida Regina Nunes Salgado [Pharmacist] Unesp - Universidade Estadual Paulista, Brazil

Mandava Venkata Basaveswara Rao [Chemistry] Krishna University, India.

Dr. Mostafa Mohamed Rady [Agricultural Sciences] Fayoum University, Egypt.

Dr. Hazim Jabbar Shah Ali [Poultry Science] College of Agriculture, University of Baghdad , Iraq.

Danial Kahrizi [Plant Biotechnology, Plant Breeding,Genetics]

Agronomy and Plant Breeding Dept., Razi University, Iran

Dr. Houhun LI [Systematics of Microlepidoptera, Zoogeography, Coevolution,

Forest protection] College of Life Sciences, Nankai University, China.

María de la Concepción García Aguilar [Biology] Center for Scientific Research and Higher Education of Ensenada, B. C., Mexico

Fernando Reboredo [Archaeobotany, Forestry, Ecophysiology] New University of Lisbon, Caparica, Portugal

Dr. Pritam Chattopadhyay [Agricultural Biotech, Food Biotech, Plant Biotech] Visva-Bharati (a Central University), India

Table of Contents (Volume 4 - Issue 2)

Serial No Accession No Title of the article Page No

1 RA0416 Associations of Arbuscular Mycorrhizal (AM) fungi in the

Phytoremediation of Trace Metal (TM) Contaminated Soils.

Dhritiman Chanda, Sharma GD, Jha DK and Hijri M.

1247-1263

2 RA0423 Biometry and fouling study of intertidal black-lip pearl oyster, Pinctada

margaritifera (Linnaeus, 1758) to determine their eligibility in the pearl

culture industry.

Jha S and Mohan PM.

1264-1275

3

RA0429

Genetics characterization, nutritional and phytochemicals potential of

gedi leaves (Abelmoschus manihot (L.) Medik) growing in the North

Sulawesi of Indonesia as a candidate of poultry feed.

Jet S Mandey, Hendrawan Soetanto, Osfar Sjofjan and Bernat Tulung.

1276-1286

4 RA0392 The growth performance of Clarias gariepinus fries raised in varying

coloured receptacles.

Ekokotu Paterson Adogbaji and Nwachi Oster Francis.

1287-1292

5 RA0407 High adaptability of Blepharis sindica T. Anders seeds towards

moisture scarcity: A possible reason for the vulnerability of this

medicinal plant from the Indian Thar desert.

Purushottam Lal, Sher Mohammed and Pawan K. Kasera.

1293-1300

http://jresearchbiology.com/documents/RA0416.pdf





Article Citation: Dhritiman Chanda, Sharma GD, Jha DK and Hijri M.

Associations of Arbuscular Mycorrhizal (AM) fungi in the Phytoremediation of Trace Metal (TM) Contaminated Soils. Journal of Research in Biology (2014) 4(2): 1247-1263

Jou

rn

al of R

esearch

in

Biology

Associations of Arbuscular Mycorrhizal (AM) fungi in the

Phytoremediation of Trace Metal (TM) Contaminated Soils.

Keywords: Arbuscular Mycorrhiza, Heavy metals, Phytoremediation, Glomus, Paper mill effluents.

ABSTRACT: Arbuscular mycorrhizal fungi (AM) are integral, functioning parts of plant roots, widely recognized as plant growth enhancing beneficial mycobionts and tolerance to variety of stresses such as nutrient, drought, salinity and trace metals (TM). A study was undertaken to access the influence of paper mill effluents on mycorrhizal colonization and mycorrhizal spore count. Plants grown in metal contaminated site were found less mycotrophic than their counterparts on the non-polluted one. Regression analyses revealed that the mycorrhizal colonization and mycorrhizal spore count are significantly and positively correlated with various soil physio-chemical properties in the polluted and non-polluted site. Glomus was the most frequently isolated mycorrhizal species from the polluted site. The isolated indigenous strains of AM can be used for inoculation of plant species that might be used for rehabilitation of contaminated site. The study highlights the potential use of AM as bioremediation agent of polluted soils and as bioindicator of pollution for future research priorities.

1247-1263 | JRB | 2014 | Vol 4 | No 2

This article is governed by the Creative Commons Attribution License (http://creativecommons.org/

licenses/by/2.0), which gives permission for unrestricted use, non-commercial, distribution and reproduction in all medium, provided the original work is properly cited.

www.jresearchbiology.com Journal of Research in Biology

An International

Scientific Research Journal

Authors:

Dhritiman Chanda 1,

Sharma GD2, Jha DK3 and

Hijri M4.

Institution:

1. Microbiology Laboratory,

Department of Life Science

and Bioinformatics, Assam

University, Silchar, Assam,

India.

2. Bilaspur University,

Bilaspur, India.

3. Department of Botany,

Gauhati University, Assam,

India.

4. Institut de Recherche en

Biologie Vegetale,

University de Montreal,

Montreal, Canada.

Corresponding author:

Dhritiman Chanda.

Email Id:

Web Address: http://jresearchbiology.com/documents/RA0416.pdf.

Dates: Received: 17 Jan 2014 Accepted: 22 March 2014 Published: 23 April 2014

Journal of Research in Biology

An International Scientific Research Journal

Original Research

ISSN No: Print: 2231 – 6280; Online: 2231- 6299.

INTRODUCTION:

Arbuscualr mycorrhizal (AM) fungi are

ubiquitous obligate mycobionts forming symbiosis with

the terrstrial plant communities (Barea and Jeffries

1995). They are essential components of soil biota and

are found in almost all ecological situations particularly

those supporting plant communities with high species

diversity. AM are known to enhance plant tolerance to a

variety of stresses including nutrients, drought, metal

toxicity, salinity and pathogens all of which may affect

plants success in a contaminated or polluted soil (Olexa

et al., 2000; Zarei et al., 2010). AM can help alleviate

metal toxicity to plants by reducing metal translocation

from root to shoot (Leyval et al., 1997). Therefore they

may contribute to plant establishment and survival in

trace metals polluted sites and could be used as a

complement to immobilization strategies. In the last few

years, research interest has been focused on the diversity

and tolerance of AM in trace metals contaminated soil.

To understand the basis underlying adaptation and

tolerance of AM to trace metals in soils,since this could

facilitate and manage these soil microoraganisms for

restoration and bioremediation programs (Khan et al.,

2000; Shah et al., 2010). AM constitute an important

functional component of the soil plant system that is

critical for sustainable productivity in stressed soils and

promote plant growth to reduce or eliminate the

bioavilibility of plants as studied by Joner and Leyval

(2003). The variation in metal accumulation and inter-

plant translocation depends on the different factors like

host-plant, root density, soil characteristics, metals and

their availibility. Metal tolerant AM isolates can decrease

metal absorption capacity of these fungi, which could

filter metal ions during uptake as described (Val et al.,

1999; Andrew et al., 2013 and Martina and Vosatka

(2005)). AM increases its host’s uptake of nutrients and

can improve the growth and resistance to environmental

stresses (Biro et al., 2005; Smith and Read, 2008).

AM fungi could prove beneficial in

phytoremediation system as they can increase the rate of

plant survival and establishment, reduce plant stress and

increase plant nutrients acquisition, increase carbon and

nitrogen deposition into soil, thereby contributing to

bacterial growth and increase the volume of soil being

remediated (Almas et al., 2004).Trace metals

concentration may decrease the number and vitality of

AM as a result of HM toxicity. Metal transporters and

plant-encoded transporters are involved in the tolerance

and uptake of TM (Glassman and Casper 2012;

Rahmanian et al., 2011).

In recent times, one of the challenges facing the

mankind is the degradation and pollution of soil by

industrial effluents, sludge and solid waste. The pulp and

paper mill which has been categorized as one of the

twenty most polluting industries in India discharge huge

quantities of coloured and waste water (effluent) into the

environment and are responsible for soil pollution

consequently the hazardous chemicals enter into surface

or ground water and poison the soil or crops. The decline

of plant diversity is due to the soil toxicity generated by

dumping of solid paper mill wastes in the area. Several

researches have been carrying out to understand the role

of AM fungi in plant interaction with toxic metal for

promoting plant growth and the bioavailibility in stressed

soils. In order to develop the restoration protocol for

disturbed habitats, it is necesaary to study benificial

rhizosphere fungi like AM fungi that are tolerant to

various stresses. This will help us develop a protocol by

studying the association of arbuscular mycorrhizal fungi

in plants growing in soils polluted with paper mill

effluents.

MATERIAL AND METHODS:

Location of the study area:

The study was conducted at two sites i.e. one

polluted with paper mill effluents and another non-

polluted site. The first site was effluent dumping site

Chanda et al., 2014

1248 Journal of Research in Biology (2014) 4(2): 1247-1263

inside the campus of Hindustan Paper Corporation

Limited, HPC, Assam, India. The two sites were

approximately 2 Km apart. The study area was located at

an altitude of 116mMSL between 24052`N and 92036`E

longitides.

Collection of soil Sample:

From the polluted and non-polluted site,10

dominant plant species were selected for the study of

mycorrhizal association. The rhizosphere soil samples of

these individuals of a species were collected. The

rhizospheric soil samples were randomly selected and

then mixed together to obtain a composite representative

sample. The soil samplings were done trimonthly from

April 2010 to January 2012. The soil samples were

brought to the laboratory in sterile condition and stored

in a refrigerator at 4°C until they were processed.

Collection of root samples:

Fine roots from ten dominant different plants of

the same species were randomly collected and mixed

properly and a composite root sample was obtained for

each plant species. Trypan blue method was followed for

the determination of the intensity of root colonization as

described by Phillips and Hayman (1970).

Isolation of Mycorrhizal spores:

Spore extraction from the soil was carried out

using the Wet Sieving and Decanting Technique by

Gerdemann and Nicolson (1963). The isolated spores

were mounted on glass slide using Polyvinyl Alcohol-

Lactic acid Glycerol (PVLG) and observed under

compound microscope (100-1000X). Spores were

identified according to the manual of identification of

VAM fungi by Schenck and Perez (1990). The INVAM

worksheet was used for diagnosing the spores.

Additional spores not included in the manual were

identified as per the description given in the INVAM

website (http://invam.caf.wvu.edu/).

Soil Physico-chemical analysis:

The physical chracteristics of soil i.e., Moisture

content, soil pH and soil temperature were recorded in

both polluted and non-polluted sites.

The chemical chracteristic i.e., N, P, K, Ca, Mg

etc of the soil samples were estimated using the

technique in the polluted and non-polluted site

(Jackson,1985). Concentration of trace metalss i.e., Zn,

Journal of Research in Biology (2014) 4(2): 1247-1263 1249

Chanda et al., 2014

Caesalpinia pulcherrima

Fig 1: Monthly variation in Mycorrhizal spore population 50gm-1soil of different plant

species growing in the polluted site.

http://invam.caf.wvu.edu/

Ni and Cu were determined by Atomic Absorption

Spectrophotometer (VARIAN Spectra AA 220).

Statistical analysis:

Statistical analysis was carried out by following

the techniques of Gomez and Gomez (1984). Linear

Regression analyses and correlation-coefficient values

were calculated to find out the influence and association

of various edaphic factors with mycorrhizal spore

population and mycorrhizal root colonization (%) in the

both polluted and non-polluted site.

RESULTS AND DISCUSSION:

The plants were more mycotrophic in the non-

polluted site than those growing in the polluted site. The

maximum root colonization was obtained in July both in

the polluted and non-polluted site. The mycorrhizal root

colonization were estimated maximum in the month of

July and decreased gradually from October to January

and again increased from April. The rhizosphere soil of

the non-polluted site harboured more mycorrhizal spores

in all the selected plants than the non-polluted site.

Among the different plant species studied, maximum

mycorrhizal spore count was estimated in Melastoma

malabathricum (54, 50 gm-1 soil) followed by Samanea

saman (52, 50 gm-1 soil) and Caesalpinia pulcherrima

(49, 50 gm-1 soil) in the polluted site and in the non-

polluted site Melastoma malabathricum (123, 50 gm-1

soil) harboured maximum number of mycorrhizal spores

followed by Samanea saman (109,50 gm-1 soil) ,Cassia

sophera (109,50 gm-1 soil) and Caesalpinia pulcherrima

(98, 50 gm-1 soil) (Figures-1 and 2).

The maximum root colonization was obtained in

July and found decreased gradually until January and

again increased in April studied among the different

plant species studied in the both polluted and non-

polluted site. In the polluted site the maximum root

colonization was estimated in Melastoma malabathricum

(44%) followed by Caesalpinia pulcherrima (43%) and

Mimosa pudica (41%) and the minimum percentage

colonization was obtained in Colocasia esculenta (35%)

and Axonopus compressus (32%). In the non-polluted

site the maximum root colonization was estimated in

Melastoma malabathricum (68%) followed by

Caesalpinia pulcherrima (64%), Samanea saman (62%)

and Axonopus compressus (61%) and the minimum root

Chanda et al., 2014

Fig 2: Monthly variation in mycorrhizal spore population 50gm-1soil of different plant

species growing in the non-polluted site.



colonization was estimated in Eupatorium odoratum

(54%) and Mimosa pudica (52%) (Figures- 3 and 4).

Inter relationship of mycorrhizal association with soil

Physio-chemical factors

The different soil parameters like N, P, K,

Organic C (%), Ca and Mg were estimated in the

polluted and non-polluted site. The polluted soil was less

moist than the non-polluted one. The rhizosphere soil

from polluted site was more alkaline than the non-

polluted one. Likewise more temperature was recorded

in the polluted site and less temperature was recorded in

the non-polluted site. All physical parameters were

recorded maximum in the month of July that gradually

decreased from October till April except soil pH

(Table- 1).

The soil samples from polluted and non-polluted

site showed marked monthly variation in their chemical

properties. Nitrogen, phosphorous and organic carbon

(%) content of the rhizosphere soil gradually decreased

from July to January and slightly increased in April.

A similar trend of monthly variation was also observed

in the non-polluted site as well. The soil phosphorus

content of polluted site was found less than the non-

polluted site. The soil calcium and magnesium content

were also found more in the polluted site than the non-

polluted site. The various trace metals like Cu, Ni and Zn

were also estimated and found gradually decreased from

July to January and then slightly increased from the

month of April (Tables- 2 and 3).

Liner regression analyses were calculated to find

out the influence of various edaphic factors on

mycorrhizal colonization and mycorrhizal spore

population. The results of regression analysis showed a

positive and significant correlation coefficient(R) values

between mycorrhizal spore population with soil moisture

content (r = 0.95; P < 0.01; Fig. 5(a)), soil temperature

(r = 0.86; P < 0.01; Fig. 5(b)), Nitrogen (r = 0.81;

P < 0.01;Fig. 5(d)), Organic carbon (r = 0.82; P < 0.01;

Fig. 5(g)), Calcium (r = 0.84; P < 0.01; Fig. 5(h)), Zinc

(r = 0.59; P < 0.01; Fig. 5(k)), Cu (r = 0.97;P < 0.01; Fig.

5(i)) and Ni (r = 0.92; P < 0.01; Fig. 5(j)). The

correlation coefficient with soil pH (r = 0.75; P < 0.01;

Fig 5(c)) and soil phosphorus (r = 0.75; P < 0.01; Fig. 5

(e)) were however, negative and significant.

Chanda et al., 2014

Fig 3: Monthly variation in mycorrhizal colonization (%) of different plant

species growing in the polluted site.



The positive and significant correlation

coefficient values were between mycorrhizal

colonization and soil moisture content (r = 0.86;

P < 0.01; Fig. 7(a)), soil temperature (r = 0.70; P < 0.01;

Fig. 7(b)), Nitrogen (r = 0.85;P < 0.01; Fig. 7(d)),

phosphorus (r = 0.90;P < 0.01; Fig. 7(e)), soil organic

carbon (r = 0.64; P < 0.01; Fig. 7(f)), Calcium (r = 0.97;P

< 0.01; Fig. 7(g)), copper (r = 0.78; P < 0.01; Fig. 7(i))

and Nickel (r = 0.82; P < 0.01; Fig. 7(j)) and Zinc (r =

0.39; P < 0.01; Fig. 7(k)) in the polluted site. The

correlation coefficient with soil Mg and soil pH was

however found negative and significant.

In the non-polluted site, a significant correlation

coefficient values were estimated between mycorrhizal

spore population soil pH (r = 0.67; P<0.01; Fig. 6(b)),

soil moisture content (r = 0.82;P < 0.01; Fig. 6(a)), soil

organic carbon (r = 0.82; P < 0.01; Fig. 6(f)), soil

nitrogen (r = 0.94; P<0.01; Fig. 6(d)), soil phosphorus

Chanda et al., 2014

Sampling Period Physical parameters

Months Moisture Content (%) pH Soil Temperature (C0)

April,10 7.8 ± 0.08 (16.3 ± 0.05) 6.9 ± 0.08 (4.10 ± 0.05) 23.1 ± 0.08 (15.2 ± 0.03)

July,10 14.4 ± 0.12 (24.8 ± 0.05) 6.1 ± 0.05 (4.80 ± 0.06) 27.5 ± 0.03 (21.5 ± 0.05)

October,10 11.3 ± 0.05 (18.8 ± 0.03) 6.7 ± 0.03 (4.30 ± 0.03) 22.8 ± 0.03 (17.8 ± 0.08)

January,11 5.7 ± 0.03 ( 8.2 ± 0.08) 7.1 ± 0.03 (4.48 ± 0.13) 19.8 ± 0.06 (14.6 ± 0.03)

April,11 8.1 ± 0.03 (14.2 ± 0.06) 6.9 ± 0.05 (4.00 ± 0.05) 22.8 ± 0.03 (15.4 ± 0.08)

July,11 16.5 ± 0.05 (23.8 ± 0.05) 6.5 ± 0.03 (5.30 ± 0.03) 28.2 ± 0.06 (21.0 ± 0.03)

October,11 12.5 ± 0.03 (18.2 ± 0.03) 6.9 ± 0.03 (4.60 ± 0.03) 23.0 ± 0.05 (18.2 ± 0.08)

January,12 6.2 ± 0.03 ( 8.4 ± 0.05) 7.2 ± 0.03 (4.40 ± 0.05) 18.7 ± 0.06 (15.1 ± 0.05)

Table 1: Monthly Variation in the physical properties of polluted & non-polluted soils.

Data are represented in mean ±SE; Value in parentheses represents the data from non-polluted site


Fig 4: Monthly variation in mycorrhizal colonization (%) of different plant spe-

cies growing in the non-polluted site.


Chanda et al., 2014

Sam

pli

ng p

erio

ds

Mon

ths

Ch

em

ica

l p

aram

ete

rs

N (

mg/g

) P

(m

g/g

) K

(m

g/g

) O

rg

an

ic C

%

Mg

(m

g/g

) C

a (

mg/g

) C

u (

pp

m)

Ni

(pp

m)

Zn

(p

pm

)

Apri

l,10

0.3

125±

0.0

80

(0.0

217±

0.0

50)

0.0

057±

0.0

6

(0.0

027±

0.0

3)

0.2

1±

0.0

2

(0.0

50

±0.0

3)

1.7

8±

0.0

8

(0.4

13

±0.0

3)

3.2

4±

0.0

5

(0.1

32

±0.0

3)

4.7

6±

0.0

3

(0.1

2±

0.0

5)

0.0

34

±0.0

2

BD

L

0.0

13

± 0

.05

BD

L

0.3

17

±0.0

4

BD

L

July

,10

0.4

270±

0.0

60

(0.0

740±

0.0

30)

0.0

016±

0.0

5(0

.0062±

0.0

6)

0.3

8±

0.0

5(0

.04

6±

0.0

6)

2.1

7±

0.0

6(0

.61

5±

0.0

5)

1.8

9±

0.0

6(0

.08

1±

0.0

8)

5.7

9±

0.0

6(0

.07

±0

.03

) 0

.07

5±

0.0

5

BD

L

0.0

34

±0.0

3

BD

L

0.3

58

±0.0

6

BD

L

Oct

ober

,10

0.4

100±

0.0

50

(0.0

380±

0.0

30)

0.0

035±

0.0

7(0

.0047±

0.0

3)

0.2

6±

0.0

5(0

.03

2±

0.0

3)

1.8

6±

0.0

7(0

.57

8±

0.0

3)

2.2

4±

0.0

7(0

.11

8±

0.0

5)

5.3

1±

0.0

2(0

.06

8±

0.0

6)

0.0

47

±0.0

7

BD

L

0.0

22

±0.0

6

BD

L

0.2

97

±0.0

5

BD

L

Januar

y,11

0.3

630±

0.0

60

(0.0

240±

0.0

50)

0.0

047±

0.0

5(0

.0020±

0.0

3)

0.1

8±

0.0

6(0

.01

7±

0.0

5)

1.2

3±

0.0

5(0

.43

9±

0.0

6)

2.0

8±

0.0

3(0

.12

7±

0.0

6)

4.8

6±

0.0

8(0

.07

9±

0.0

7)

0.0

23

±0.0

8

BD

L

0.0

08

±0.0

2

BD

L

0.2

78

±0.0

3

BD

L

Apri

l,11

0.3

290±

0.0

70

(0.0

260±

0.0

30)

0.0

062±

0.0

6

(0.0

034±

0.0

5)

0.3

1±

0.0

7

(0.0

80

±0.0

4)

1.8

2±

0.0

7

(0.4

24

±0.0

3)

3.1

9±

0.0

7

(0.1

41

±0.0

5)

4.6

7±

0.0

5

(0.1

7±

0.0

3)

0.0

41

±0.0

6

BD

L

0.0

16

±0.0

3

BD

L

0.3

24

±0.0

4

BD

L

July

,11

0.4

510±

0.0

50

(0.0

870±

0.0

30)

0.0

021±

0.0

3(0

.0071±

0.0

5)

0.4

6±

0.0

5(0

.05

7±

0.0

3)

2.3

4±

0.0

7(0

.64

8±

0.0

3)

1.7

5±

0.5

7(0

.10

5±

0.3

8)

5.6

3±

0.0

5(0

.11

±0

.06

) 0

.08

7±

0.0

3

BD

L

0.0

41

±0.0

5

BD

L

0.3

49

±0.0

3

BD

L

Oct

ober

,11

0.3

800±

0.0

57

(0.0

420±

0.0

60)

0.0

031±

0.0

6(0

.0039±

0.0

3)

0.3

7±

0.0

5(0

.03

7±

0.0

6)

1.8

9±

0.0

6(0

.58

0±

0.0

5)

2.1

5±

0.0

3(0

.12

0±

0.0

4)

5.3

7±

0.0

3(0

.07

±0

.05

)

0.0

52

±0.0

6

BD

L

0.0

29

±0.0

6

BD

L

0.2

85

±0.0

6

BD

L

Januar

y,12

0.3

200±

0.0

30

(0.0

280±

0.0

28)

.0049±

0.0

7(0

.0051±

0.0

3)

0.2

2±

0.0

3(0

.02

2±

0.0

6)

1.2

8±

0.0

3(0

.44

7±

0.0

2)

2.0

1±

0.0

5(0

.12

9±

0.0

6)

4.7

7±

0.0

6(0

.08

2±

0.0

2)

0.0

29

±0.0

5

BD

L

0.0

06

±0.0

7

BD

L

0.2

75

±0.0

4

BD

L

Tab

le 2

: M

on

thly

Varia

tion

in

th

e c

hem

ical

prop

erti

es

of

poll

ute

d a

nd

non

-poll

ute

d s

oil

.

Dat

a ar

e re

pre

sen

ted

in

mea

n ±

SE

; B

DL

=B

elo

w D

etec

table

Lim

it;

Val

ue

in p

aren

thes

es r

epre

sen

ts t

he

dat

a fr

om

non

-poll

ute

d s

ite


(r = 0.85; P < 0.01; Fig. 6(e)) and soil magnesium (r =

0.77; P < 0.01; Fig. 6(g)).

In the non-polluted site, the mycorrhizal

colonization was found significantly and positively

correlated with soil moisture content (r = 0.80; P < 0.01;

Fig. 8(a)), soil temperature (r = 0.94; P < 0.01; Fig. 8(c)),

soil pH (r = 0.54; P < 0.01; Fig. 8(b)) soil Nitrogen (r =

0.79; P < 0.01; Fig. 8(d)), phosphorus (r = 0.92; P < 0.01;

Fig. 8(e)), soil organic carbon (r = 0.90; P < 0.01; Fig. 8

(f)), Magnesium (r = 0.85; P < 0.01; Fig. 8(h)). The

correlation coefficient with soil Calcium was however

found negative and significant.

The present experimental findings revealed the

relationship of mycorrhizal spore population and

mycorrhizal colonization with various physio-chemical

properties of soil polluted with trace metals. The low

intensity of root colonization and low spore count in the

polluted site may be attributed to the sensitivity of

endomycorrhizal fungi to various soil pollutants. This

may be due to the alkaline pH, higher soil temperature

due to the deposition of more amounts of Calcium and

trace metals that might have adversely affected the

sporulation and colonization ability of the mycorrhizal

fungi as reported by Schenck and Smith (1982). Rohyadi

et al., (2004) also observed that the relative growth

improvement by mycorrhizas was highest at pH 4.7 and

the same decreased as the pH increased. The presence of

trace metals in the polluted soil may be responsible for

less percentage of root colonization in the polluted site.

AM spore population decreased with increased amount

of trace metals in the soil (Val et al., 1999; Hayes et al.,

2003).The negative correlation with soil Phosphorous,

Magnesium and pH is may be responsible for the less

percentage of root colonization in the plants. High

alkalinity in the soil was also responsible for decrease in

the number of spores as well as root colonization in the

polluted soil. The spore population and mycorrhizal root

colonization of AMF fungi were found decreased by the

higher levels of heavy metals in the soil. Our results also

supports the findings of (Shah et al., (2010); Biro et al.,

(2005); Göhre and Paszkowski (2006); Mathur et al.,

(2007)).

Among the isolated genera of AM fungi, Glomus

was the most dominant AM genus isolated during the

present investigation followed by Gigaspora and

Scutellospora sp. Dominance of Glomus sp in the

polluted soil may be due to its higher metal tolerance

capacity as reported earlier by various workers (Martina

and Vosatka 2005; Carrasco et al., 2011; Chen et al.,

2007; Zaefarian et al., 2010). The decline of AM fungal

occurance (propagule density) and infectivity in trace

metal polluted site which can be used as bioindicators of

Chanda et al., 2014

Sampling Periods Endogonaceous Spore Population(50gm-1) Mycorrhizal colonization (%)

Months

April,10 24 ± 0.6 ( 52 ±0.8) 21 ± 0.8 (32 ± 0.6)

July,10 54 ± 0.5 (118 ±0.8) 44 ± 0.3 (68 ± 0.4)

October,10 39 ± 0.3 ( 75 ±0.8) 34 ± 0.5 (53 ± 0.3)

January,11 18 ± 0.5 ( 46 ±0.5) 21 ± 0.5 (26 ± 0.3)

April,11 26 ± 0.5 ( 49 ±0.8) 19 ± 0.5 (34 ± 0.6)

July,11 61 ± 0.5 (124 ±0.5) 39 ± 0.3 (61 ± 0.5)

October,11 35 ± 0.5 ( 68 ±0.8) 32 ± 0.3 (48 ± 0.8)

January,12 20 ± 0.5 ( 40 ±0.5) 18 ± 0.3 (28 ± 0.4)

Table 3: Monthly Variation in the Mycorrhizal spore population and Mycorrhizal root colonization (%) in

50gm-1 soil of polluted and non-polluted sites

Data are represented in mean ±SEM; Value in parentheses represents the data from non-polluted site


soil contamination (Citterio et al., 2005; Liao et al.,

2003).

CONCLUSION:

Our study suggests that the effluents and the

solid wastes dumped by the paper mill have high

concentration of trace metals that changed the other

physical and chemical properties of the soil. The

indigenous AM isolates existing naturally which are

isolated from trace metal polluted soils are reported

efficiently to colonize plant roots in trace metal-stressed

environments by significantly correlated with various

physic-chemical properties of the soil. It is therefore of

great importance that we combine selected plants with

specific AM fungal isolates adapted to high

concentrations of trace metal in future research for

phytoremediation programes. Thus, the isolated strains

of AM fungi can be of great interest since they can be

used for inoculation of the plant species and the present

study provides evidences for the potential use of the

Chanda et al., 2014

(a) (b)

(c) (d)

(e) (f)


Chanda et al., 2014

Figure 5: Mycorrhizal spore population 50gm-1 soil (X) expressed as a function of soil physio-chemical

factors (Y) in the polluted site.Regression is drawn only for statistically significant relationship (p < 0.01).

(MC=Moisture Content; Soil temp(C0),soil pH,Nitrogen (N), Potassium (K), Phosphorus (K),Organic

Carbon (%),Calcium (Ca),Copper (Cu), Nickel (Ni) and Zinc (Zn)).

(g) (h)

(i) (j)

(k)


Chanda et al., 2014

(a) (b)

(c) (d)

(e)

Figure 6: Mycorrhizal spore population 50gm-1 soil (X) expressed as a function of soil physio-chemical factors (Y) in the

non-polluted site.Regression is drawn only for statistically significant relationship (p < 0.01). (MC=Moisture Content;

Soil temp(C0),Soil pH, Nitrogen(N), Potassium(K),Phosphorus(P),Organic Carbon (%),Magnesium(Mg)).

(g)

(f)


(e)

(d)

(a)

(f)

(b)

(c)

Chanda et al., 2014


Chanda et al., 2014

Figure 7: Mycorrhizal colonization (X) expressed as a function of soil physio-chemical factors (Y) in

the polluted site.Regression is drawn only for statistically significant relationship (p < 0.01).

MC=Moisture Content; Soil temp(C0),Nitrogen (N), Phosphorous (P),Organic Carbon (%),Calcium

(Ca),Magnesium (Mg),Copper (Cu),Nickel (Ni) and Zinc (Zn)).

(i)

(g) (h)

(k)

(j)


Chanda et al., 2014

(k)

(a) (b)

(c) (d)

(e) (f)

(g) (h)


plant species in combination with AM fungi in the paper

mill polluted with paper mill effluents contaminated with

various trace metals.

ACKNOWLEDGEMENT:

The authors are grateful to the Department of

Life Science, Microbiology Laboratory, Assam

University (Silchar), India for providing the laboratory

facilities.

REFERENCES:

Almas AR, Bakken LR and Jan Mulder. 2004.

Changes in tolerance of soil microbial communities in

Zn and Cd contaminated soils. Soil Biol Biochem. 36(5):

805–813.

Andrew B, Brown MV, Steven DS and Peter HT.

2013. Microbial community responses to

anthropogenically induced environmental change:

towards a systems approach. Ecol Lett. 16 (Supplement

S1): 128-139.

Barea JM and Jeffries P. 1995. Arbuscular

mycorrhizas in sustainable soil plant systems. In: B.

Hock and A. Varma (eds) Mycorrhiza, structure,

Function, Molecular Biology and biotechnology.

Springer-Verlag, Heidelberg. 521-559.

Biró B, Posta K, Füzy A, Kádár I and Németh T.

2005. Mycorrhizal Functioning as part of the Survival

Mechanisms of Barley (Hordeum vulgare L.) at Long-

term Heavy Metal Stress, Acta Biol.Szegedien. 49 (1-2):

65-67.

Carrasco L, Azcon R, Kohler J, Roldán A and

Caravaca F. 2011. Comparative effects of native

filamentous and arbuscular mycorrhizal fungi in the

establishment of an autochthonous, leguminous shrub

growing in a metal-contaminated soil. Sci Total

Environ., 409(6): 1205-1209.

Chen BD, Zhu Y.-G, Duan J, Xiao XY and Smith SE.

2007. Effects of the arbuscular mycorrhizal

fungus Glomus mosseae on growth and metal uptake by

four plant species in copper mine tailings. Environ

Pollut. 147(2): 374-380.

Citterio S, Prato N, Fumagalli P. Aina R, Massa N,

Santagostino A, Sgorbati S and Berta G. 2005. The

arbuscular mycorrhizal fungus Glomus mosseae induces

growth and metal accumulation changes in Cannabis

Chanda et al., 2014

Figure 8: Mycorrhizal colonization (X) expressed as a function of soil physio-chemical factors (Y) in

the non-polluted site.Regression is drawn only for statistically significant relationship (p < 0.01).

(MC = Moisture Content; Soil temp(C0),Soil pH, Nitrogen(N), Potassium (K),Phosphorus (P),Organic

Carbon (%),Magnesium (Mg) and Calcium (Ca)).

(i)


http://lib.bioinfo.pl/auth:Carrasco,L

http://lib.bioinfo.pl/auth:Kohler,J

http://lib.bioinfo.pl/pmid:21211827




http://lib.bioinfo.pl/pmid/journal/Sci%20Total%20Environ

http://lib.bioinfo.pl/pmid/journal/Sci%20Total%20Environ

http://www.sciencedirect.com/science/article/pii/S0269749106003150




sativa L. Chemosphere. 59(1): 21-29.

Glassman SI and Casper BB. 2012. Biotic contexts

alter metal sequestration and AMF effects on plant

growth in soils polluted with heavy metals. Ecology.

93(7): 1550-1559.

Gerdemann JW and Nicolson TH. 1963. Spores of

mycorrhizal Endogone species extracted from soil by wet

sieving and decanting. Trans Br Mycol Soc., 46(2):

235-244.

Göhre V and Paszkowski U. 2006. Contribution of the

Arbuscular Mycorrhizal Symbiosis to Heavy Metal

Phytoremediation. Planta. 223(6): 1115-1122.

Gomez KA and Gomez AA. 1984. Statistical

Procedures for Agricultural Research (2nd edn), An

International Rice Research Institute book, A Wiley-

Interscience Publication, John Willey and Sons, New

York.

Hayes WJ, Chaudhry TM, Buckney RT and Khan

AG. 2003. Phytoaccumulation of Trace Metals at the

Sunny Corner Mine, New South Wales with Suggestions

for a Possible Remediation Strategy, Aust J Toxicol.,

9(1):69-82.

Jackson ML. 1985. Soil chemical analysis, 2nd edition,

Madison, WI, USA.

Joner EJ and Leyval C. 2003. Phytoremediation of

organic pollutants using mycorrhizal plants: a new aspect

of rhizosphere interactions. Agronomie. 23(5-6):

495-502.

Khan AG, Kuek C, Chaudhry TM, Khoo CS and

Hayes WJ. 2000. Role of plants,mycorrhizae and

phytochelators in heavy metal contaminated land

remediation. Chemosphere. 41(1-2):197-207.

Leyval C, Turnau K and Haselwandter K. 1997.

Effect of heavy metal pollution on mycorrhizal

colonization and function: physiological, ecological and

applied aspects. Mycorrhiza. 7(3): 139-153.

Liao JP, Lin XG, Cao ZH, Shi YQ and Wong MH.

2003. Interactions between arbuscular mycorrhizae and

heavy metals under sand culture experiment.

Chemosphere. 50(6): 847-853.

Mathur N, Bohra JSS, Quaizi A and Vyas A. 2007.

Arbuscular Mycorrhizal Fungi: A Potential Tool for

Phytoremediation, J Plant Sci., 2(2): 127-140.

Martina J and Vosatka M. 2005. Response to

Cadmium of Daucus carota hairy roots dual cultures

with Glomus intraradices or Gigaspora margarita.

Mycorrhiza. 15(3): 217-224.

Olexa TJ, Gentry TJ, Hartel PG. Wolfb DC,

Fuhrmannc JJ and Reynoldsd CM. 2000.

Mycorrhizal Colonization and microbial community

structure in the rhizosphere of annual ryegrass grown in

pyrene-amended soils. Int J Phytol., 2(3): 213-231.

Phillips JM and Hayman DS. 1970. Improved

procedures for cleaning and staining parasitic and

vesicular-arbuscular mycorrhizal fungi for rapid

assessment of infection. Trans Br Mycol Soc., 55(1):

158-161.

Rahmanian M, Khodaverdiloo H, Rezaee DY and

Rasouli SMH. 2011. Effects of Heavy Metal Resistant

Soil Microbes Inoculation and Soil Cd Concentration on

Growth and Metal Uptake of Millet, Couch Grass and

Alfalfa. Afr J Microbiol Res., 5(4): 403-410.

Rohyadi A, Smith FA, Murray RS and Smith SE.

2004. Effects of pH on mycorrhizal colonisation and

nutrient uptake in cowpea under conditions that minimise

confounding effects of elevated available aluminium.

Plant Soil. 260(1-2): 283-290.

Shah FR, Ahmad N, Masood KR. Peralta-Videa JR

and Ahmad FuD. 2010. Heavy Metal Toxicity in Plants.

Chanda et al., 2014


In: Ashraf, M. Ozturk M. and S.A. Ahmad (eds) Plant

Adaptation and Phytoremediation, Springer Dordrecht

Heidelberg London, New York.71-98.

Schenck NC and Smith GS. 1982. Responses of six

species of vesicular arbuscular mycorrhizal fungi and

their effects on soybean at four-soil temperatures. New

Phytol., 92(2):193-201.

Schenck, NC and Perez Y. 1990. Manual for the

Identification of VA Mycorrhizal Fungi. (3rd edn).

Gainesville, Florida, Synergistic Publications.

Smith SE and Read DJ. 2008. Mycorrhizal Symbiosis

Academic press London.

Val CD, Barea, JM and Azcon-Aguilar C. 1999.

Diversity of arbuscular mycorrhizal fungus populations

in heavy- metal- contaminated soils. Appl Environ.

Microbiol., 65(2): 718-723.

Zaefarian F, Rezvani M, Rejali F, Ardakani MR and

Noormohammadi G. 2010 Ability of Glomus mosseae-

Alfalfa (Medicago sativa L.) Association for Heavy

Metal Phytoextraction from Soil. Environ Sci., 7(3):

77-90.

Zarei M, Hempel S, Wubet T, Schäfer SH,

Savaghebi G, Jouzani GS, Nekouei MK and Buscot F.

2010. Molecular diversity of arbuscular mycorrhizal

fungi in relation to soil chemical properties and heavy

metal contamination. Environ. Pollu., 158(8): 2757-

2765.

Submit your articles online at www.jresearchbiology.com

Advantages

Easy online submission Complete Peer review Affordable Charges Quick processing Extensive indexing You retain your copyright

[email protected]

www.jresearchbiology.com/Submit.php.

Chanda et al., 2014


Article Citation: Jha S and Mohan PM. Biometry and fouling study of intertidal black-lip pearl oyster, Pinctada margaritifera (Linnaeus, 1758) to determine their eligibility in the pearl culture industry. Journal of Research in Biology (2014) 4(2): 1264-1275

Jou

rn

al of R

esearch

in

Biology

Biometry and fouling study of intertidal black-lip pearl oyster, Pinctada margaritifera

(Linnaeus, 1758) to determine their eligibility in the pearl culture industry

Keywords: Black-lip pearl oyster, Allometry, Biofouling, Intertidal Limiting factors, Reproductive maturity, Pearl culture.

ABSTRACT: The present study on the biometry and fouling load of black-lip pearl oyster, Pinctada margaritifera (Linnaeus, 1758), was conducted to understand the eco-biology of these intertidal oysters so that their eligibility in the pearl culture industry could be determined. Biometric parameters viz., Anteroposterior measurement (APM), hinge length (HL), thickness (THK) and total weight (TWT) of each oyster were checked for their correlation with dorsoventral measurement (DVM) and fouling load (ΔF) separately by regression analysis. Shell length of collected specimens ranged between 16 ± 3.7- 88.2 ± 6.5 mm. Most of the P. margaritifera from intertidal regions of Andaman were confined to 61-80 mm size group. The average size of all the shell dimensions and TWT increased with increase in the shell length. The rate of increase of all the biometric parameters except TWT, declined in size range >41-60 mm. Maximum and minimum fouling load was observed during September 2011 (27.8 ± 5.1 g) and July 2012 (3.2 ± 3.7 g), respectively. Lower size groups showed maximum correlation indicating isometric growth but in higher size range, allometry was observed as the rate of increase of biometric parameters varied with increasing size range. On the basis of this study it could be concluded that if transferred to suspended culture at an early stage, these intertidal oysters, adapted to survive in harsh environmental conditions, would acclimatize more easily to the new environment and would cross the 61-80 mm size range becoming larger and thicker, a parameter favourable for pearl production.

1264-1275| JRB | 2014 | Vol 4 | No 2

This article is governed by the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which gives permission for unrestricted use, non-commercial, distribution and reproduction in all medium, provided the original work is properly cited.


An International


Authors:

Jha S and Mohan PM.

Institution:

Department of Ocean

Studies and Marine Biology,

Pondicherry University

(Brookshabad Campus),

Chakkargaon Post, Port

Blair, 744112,

Andaman and Nicobar

Islands, India.


Jha S.

Email Id:

Web Address: http://jresearchbiology.com/

documents/RA0423.pdf.

Dates: Received: 19 Feb 2014 Accepted: 01 Apr 2014 Published: 14 May 2014



Original Research

ISSN No: Print: 2231 – 6280; Online: 2231 - 6299.

INTRODUCTION

Pearl oyster Pinctada margaritifera (Linnaeus,

1758) is commonly known as the black-lip pearl oyster

due to dark colouration of the nacre of its inner shell

towards the distal rim (Saville-Kent, 1893). This

exclusively marine, sedentary bivalve is distributed along

the tropic belt within the Indo-Pacific Ocean (Pouvreau

and Prasil, 2001; El-Sayed et al., 2011).

P. margaritifera are cultured around the world

for the production of black pearls, designer mabe (Kripa

et al., 2008), and for their lustrous inner shell known as

mother of pearl which is used in the ornamental and

button industry (Kimani and Mavuti, 2002; Fletcher

et al., 2006). A thorough knowledge of the biometry of

pearl oyster is of prime importance in the pearl culture

industry. Thickness and wet weight of the pearl oyster

helps in predicting the nuclei size (Mohamed et al.,

2006; Abraham et al., 2007). Kripa et al., (2008)

considered shell size to be an important criteria for mabe

production.

In different parts of the world, research is being

carried out to understand the biometric relationship of

black pearl oysters in natural and cultured conditions.

Friedman and Southgate (1999) studied the biometric

relationship of these oysters in Solomon Islands.

Pouvreau et al., (2000a) reported the isometric relation

between their length and thickness in French Polynesia.

El-Sayed (2011) studied the concept of allometric growth

in P. margaritifera from the Egyptian coastal waters.

In India P. margaritifera is the most abundant in

Andaman and Nicobar Islands (Alagarswami, 1983).

Alagarswami (1983) and Abraham et al., (2007) studied

the biometric relationship between various shell

dimensions viz., hinge length (HL), thickness (THK) and

total weight (TWT) with the dorsoventral measurement

(DVM) or the shell length of the black-lip pearl oyster in

Andaman and Nicobar Islands. But the size range and

total number of specimens studied by them were

different from the present study. Alagarswami studied

the correlation of biometric parameter of all the oysters

without dividing them into any size group. None of these

authors studied the correlation between DVM and the

fouling load (ΔF).

In the natural habitat, several environmental

factors such as availability of food and space, nature of

substratum, fouling, competition, predation etc., affect

the biometric growth of black pearl oysters

(Alagarswami, 1991; Gervis and Sims, 1992; Mohamed

et al., 2006). Fouling on the sedentary organism plays a

major role in adversely affecting their growth and

development as more the fouling more is the energy

required for oysters to open its valve for food filtration

and respiration (Alagarswami and Chellam, 1976;

Mohammad, 1976; Alagarswami, 1987; Taylor et al.,

1997; Mohammed, 1998; Pit and Southgate, 2003).

The main objective of the present study was to

determine the eligibility of intertidal P. margaritifera in

the pearl culture industry by understanding their

biometry as well as month-wise variation in the fouling

load at natural habitat. A novel aspect of pearl oyster

ecology explored in this study was the correlation

between DVM-ΔF, which shall be the first known

reference available from Andaman and elsewhere.

MATERIALS AND METHODS

Study Area

Preliminary surveys were conducted in 10

intertidal regions of South Andaman, out of which only

three regions viz. Burmanallah (11°34’19” N; 92°44’39”

E), Carbyn (11°38’49” N; 92°44’81” E) and Marina Jetty

area (11°40’16” N; 92°44’53” E) showed natural

availability of P. margaritifera and hence were selected

as the study area for the present study conducted during

July 2011 to July 2012.

Sampling Method

For studying the relationship between various

shell dimensions during different growth size of the

oysters, 151 specimens of P. margaritifera were

Jha and Mohan, 2014


collected and brought to the laboratory in a bucket filled

with raw sea water.

The individual morphometric parameters viz.

shell length or the dorsoventral measurement (DVM),

anteroposterior measurement (APM), hinge length (HL)

and shell thickness (THK) were measured with the help

of a digital vernier calliper (Aerospace, accuracy = 0.01

mm) using the method of Hynd (1955) and then grouped

into five length classes with a class interval of 20 mm

viz., 1-20, 21-40, 41-60, 61-80 and 81-100 mm. DVM

and APM were measured excluding the growth process.

To minimize any error during the measurement

of total weight (TWT), oysters were taken out from the

bucket and kept outside in a tray covered with wet cloth

for 15 minutes to remove the water trapped inside the

oyster as described in Moullac et al., (2012). Once most

of the in-held water had seeped out, weight of the fouled

oysters were measured by using digital balance

(Professional Digital Scale, accuracy = 0.01 g).

The attached foulers on the shells of the oysters

were then scrapped off and oysters were washed with

filtered sea water to clean all the epiphytic growth. The

cleaned oysters were weighed again to determine their

actual total weight (foul free weight). The fouling load

(ΔF) was calculated by comparing the individual weight

of each fouled oyster with their respective weight after

cleaning.

Statistical Analysis

The average value of biometric dimensions,

fouling load and their rate of increment for five different

size groups were obtained by calculating the mean and

standard deviation. Month-wise average fouling load was

also calculated using the same method. Pearson’s

Correlation Coefficient between biometric relationships

viz., DVM-APM, DVM-HL, DVM-THK and the

correlation between ΔF with biometric parameters

(DVM, APM, HL, THK and TWT) were calculated by

fitting the least square method equation, y = a+bx, of

linear regression.

The length-weight relationship was determined

by following the method of Abraham et al., (2007) where

the length measurements were expressed in centimeters

and the weight was expressed in grams. Exponential

curvi-linear regression models were prepared for the

estimation of correlation between DVM-TWT, as their

relationship was non-linear. The correlation values were

tested for significance with one-way ANOVA adopting

Hynd (1955).

RESULTS

Trend of biometric growth and fouling

The DVM of the 151 collected specimens ranged

between 16 ± 3.7- 88.2 ± 6.5 mm. The average values of

biometric dimensions of all the size groups and their

fouling load have been graphically represented in Fig.1,


Jha and Mohan, 2014

Fig. 1 Average biometric dimensions (±SE) of 5 size groups of

Pinctada margaritifera.

along with their standard deviation values.

From the observation it was found that as the

DVM increased the average size of all other shell

dimensions also increased, though not at a constant rate

(Fig. 2). ΔF also increased with the DVM except for the

largest size group (81-100 mm) where ΔF was lesser

than 61-80 mm group. The size group, 61-80 mm was

the most heavily fouled of all the other size ranges. The

monthly average fouling load on an individual specimen

of P. margaritifera has been graphically shown in Fig.3.

It can be inferred that ΔF showed a changing trend over a

span of one year. Maximum fouling load was observed

during the month of September 2011 (27.8 ± 5.1 g)

followed by February 2012 (19.5 ± 13.5 g) and June

2012 (15.0 ± 3.6 g).

Fouling load was minimal during July 2012 (3.2

± 3.7 g) followed by November 2011 (4.6 ± 6.9 g) and

December 2011 (4.7 ± 14.1 g).

Correlation of DVM with other biometric parameters

The size-wise correlation of biometric

dimensions with the DVM (at 99.5% significance level)

has been presented in Table 1.

In the lower size group of 1-20 mm, the

maximum correlation was observed between DVM-APM

(r2 = 0.876, P > 0.05, n = 18). Correlation coefficient

values of DVM-THK (r2 = 0.673, P < 0.001, n = 18) and

DVM-HL (r2 = 0.550, P > 0.05, n = 18) were moderate to

low.

In the size group of 21-40 mm, higher degree of

correlation was observed between DVM-APM

(r2 = 0.802, P > 0.05, n = 24) and DVM-HL (r2 = 0.808,

P < 0.001, n = 24). DVM-THK (r2 = 0.673, P < 0.001,

n = 24) and DVM-TWT (r2 = 0.304, P > 0.05, n = 24)

showed moderate and poor correlation, respectively.

The value of correlation between DVM-TWT

(r2 = 0.725, P < 0.001, n = 33) was highest for the 41-60

mm size group. However, it showed moderate correlation

between DVM-APM (r2 = 0.577, P = 0.002, n = 33) and

DVM-HL (r2 = 0.523, P < 0.001, n = 33).

Maximum number of individuals collected

during the study belonged to the size group 61-80 mm.

The regression analysis of this size group showed

moderate to low correlation between DVM and all the

other parameters, with the exception of DVM-APM

(r2 = 0.721, P < 0.001, n = 52).

In the largest size group of 81-100 mm (n = 24),

all the parameters showed poor correlation with the

DVM. The regression coefficient for most of

the parameters of the above mentioned size ranges

when tested against DVM with one-way ANOVA,

showed significant value except for a few as mentioned

in Table 1.

Jha and Mohan, 2014


Fig. 2 Average increment (±SE) in the biometric dimensions of 5 size groups

of Pinctada margaritifera.

Correlation of ΔF with biometric parameters

The regression analysis of biometric parameters

with ΔF showed poor correlation in all the size groups

except for a moderate correlation between TWT-ΔF

(r2 = 0.619, P < 0.001, n = 33) for the 41-60 mm size

group (Table 2).

DISCUSSION

Maximum value of correlation coefficient for

most of the shell dimensions was seen in small size

oysters hinting towards isometric growth of the oyster at

this stage. The site of attachment selected by settling

larval stage plays a pivotal role in the biometric growth

of these sessile organisms, as the Pediveliger larvae settle

in the crevices of rocks during the juvenile stage and it

has enough space available for growth in all the

dimensions. Optimum space availability and lesser food

requirement could be a possible reason for such type of

growth.

Harsh environmental conditions viz. atmospheric

and respiratory stress due to exposure during low tide,

limited food availability (Bartol et al., 1999), water

temperature and turbidity (Pouvreau and Prasil, 2001),

competition between foulers with oyster (Zhenxia et al.,

2007), limited space for growth (Abraham et al., 2007),

decrease in growth rate with age due to progressive

investment of body energy in reproduction rather than

shell growth (Pouvreau et al., 2000b), etc., might have

consequently resulted in the slow allometric growth rate

(Gimin et al., 2004; El-Sayed et al., 2011) and hence

poor correlation between DVM and other shell

dimensions in the higher size groups of black-lip pearl

oyster of intertidal region of South Andaman.

Shell Dimensional Relationship

The smaller oysters showed more increment in

shell dimension than in total weight. It might be due to

the fact that in the initial stages of the oyster’s

development, the body energy is mainly utilized towards

the shell growth when compared to the tissue growth or

reproductive development (Chellam, 1987; Dharmaraj

et al., 1987b; Gimin et al., 2004).

A good correlation between DVM-APM was

observed between smaller size groups, 1-20 mm

(r2 = 0.876, P > 0.05, n = 18) and 21-40 mm, (r2 = 0.802,

P > 0.05, n = 24) indicating comparable increase in the

growth rate of the two variables. Low regression value

for higher size groups could have been due to the

investment of energy for tissue development or

reproductive maturity.

The correlation values for DVM-HL in

the present study were slightly better (highest

being r2 = 0.808, P = 0.001, n = 24, 21-40 mm) than that

Jha and Mohan, 2014


Fig. 3 Month-wise average fouling load (±SE) on Pinctada margaritifera.

Jha and Mohan, 2014

Size Group (mm) N Variables ‘a’ Value ‘b’ value r2 value P value- S/NS

1-20 18

DVM- APM 0.848 0.878 0.876* 0.370 - NS

DVM-HL 1.547 0.793 0.550 0.180 - NS

DVM-THK 2.402 0.430 0.673* < 0.001 - S

DVM-TWT 0.275 1.218 0.218 < 0.001 - S

21-40 24

DVM-APM 1.113 0.955 0.802* 0.120 - NS

DVM-HL 3.006 0.926 0.808* 0.001 - S

DVM-THK 3.113 0.402 0.673* < 0.001 - S

DVM-TWT 0.304 2.236 0.304 0.110 - NS

41-60 33

DVM-APM 1.525 0.936 0.577* 0.002 - S

DVM-HL 3.664 0.666 0.523* < 0.001 - S

DVM-THK 2.076 0.380 0.372 < 0.001 - S

DVM-TWT 0.144 3.015 0.725* < 0.001 - S

61-80 52

DVM-APM 20.16 1.182 0.721* < 0.001 - S

DVM-HL 1.911 0.554 0.378* < 0.001 - S

DVM-THK 2.158 0.355 0.343* < 0.001 - S

DVM-TWT 0.127 3.026 0.412* < 0.001 - S

81-100 24

DVM-APM 48.46 0.351 0.210 0.001 - S

DVM-HL 30.68 0.191 0.101 < 0.001 - S

DVM-THK 12.82 0.148 0.106 < 0.001 - S

DVM-TWT 1.878 1.786 0.180 < 0.001 - S

Table 1. Estimates of biometric relationship between DVM and other shell parameters in different size

groups of Pinctada margaritifera, along with the results of one-way ANOVA.

N= Number of individuals, a= Slope, b= Intercept, r2= Correlation coefficient, *Pearson’s correlation coefficient

significance level= 99.5%, P= Significance value, S= Significant, NS= Non-Significant.


Jha and Mohan, 2014

Size Group (mm) N Variables ‘a’ Value ‘b’ value r2 value P value- S/NS

1-20 18

DVM - ΔF 0.019 2.032 0.293 <0.001- S

APM - ΔF 0.020 2.232 0.325 <0.001- S

HL - ΔF 0.029 1.592 0.292 <0.001- S

THK - ΔF 0.076 0.429 0.236 <0.001- S

TWT - ΔF 0.167 0.018 0.293 <0.001- S

21-40 24

DVM - ΔF 0.005 4.402 0.243 <0.001- S

APM - ΔF 0.030 2.938 0.142 <0.001- S

HL - ΔF 0.056 2.569 0.120 <0.001- S

THK - ΔF 0.786 2.196 0.190 <0.001- S

TWT - ΔF 0.235 0.111 0.331 <0.001- S

41-60 33

DVM - ΔF 0.012 3.649 0.300 <0.001- S

APM - ΔF 0.034 3.248 0.412 <0.001- S

HL - ΔF 0.646 1.890 0.211 <0.001- S

THK - ΔF 1.790 1.981 0.341 <0.001- S

TWT - ΔF 0.495 4.893 0.619* <0.001- S

61-80 52

DVM - ΔF 0.031 3.035 0.088 <0.001- S

APM - ΔF 0.286 2.017 0.091 <0.001- S

HL - ΔF 1.214 1.61 0.063 0.002- S

THK - ΔF 5.468 0.924 0.029 <0.001- S

TWT - ΔF 0.150 7.487 0.066 <0.001- S

81-100 24

DVM - ΔF 7.363 1.940 0.046 <0.001- S

APM - ΔF 1.717 2.450 0.057 <0.001- S

HL - ΔF 10.81 0.134 0.038 <0.001- S

THK - ΔF 1.949 1.802 0.096 <0.001- S

TWT - ΔF 0.015 11.300 0.004 <0.001- S

Table 2. Estimates of biometric relationship between ΔF and other shell parameters in different size groups

of Pinctada margaritifera, along with the results of one-way ANOVA.

N= Number of individuals, a= Slope, b= Intercept, r2= Correlation coefficient, * Pearson’s correlation coefficient

significance level= 99.5%, P= Significance value, S= Significant, NS= Non-Significant.


obtained by Abraham et al., 2007 (highest being

r2 = 0.31, n = 22, 36-55 mm) and the value (r2 = 0.79,

n = 106, 34.0-109.5 mm) obtained by Alagarswami

(1983). The site of collection of specimen may also have

an impact on this observation because oysters in the

present study were collected exclusively from intertidal

area where they are attached to the crevices of rocks

having limited space for growth whereas in case of other

authors sub tidal and deep water specimens were also

studied.

The values obtained for coefficient of correlation

between DVM-THK in the present study was moderate

for size range 1-20 mm (r2 = 0.673, P < 0.001, n = 18)

and 21-40 mm (r2 = 0.673, P < 0.001, n = 24). But was

slightly lower (r2 = 0.372, P < 0.001, n = 33) for size

range 41-60mm) than those obtained by Abraham,

(2007) (r2 = 0.82 for size range 36-55 mm). In larger

oysters, a poor correlation existed between DVM-THK

(r2 = 0.343, P < 0.001, n = 52 and r2 = 0.106, P < 0.001,

n = 24 for 61-80 mm and 81-100 mm size group

respectively). This could be explained by the report of

Sims (1993) which stated that, in the larger oysters the

rate of increase of DVM becomes very slow and the

subsequent growth consists mainly of increase in shell

thickness with continuous secretion of nacre throughout

its life.

As the size range and total number of specimen

in biometry study by other authors (34-109.5 mm,

n = 106, Alagarswami, 1983; 40.18-132.72 mm, n = 458,

Abraham et al., 2007) were different from the present

study (7.06-99.01 mm, n = 151) the correlation value

between shell dimensions also differed and only few size

ranges could be compared.

Length –Weight Relationship

Similar to the observation of Abraham et al.,

(2007), there was an increase in the average total weight

with respect to increase in the average shell length

(Fig. 1). Hence, the low value of correlation between

these two variables in the present study suggests that the

rate of increase in the individual TWT with respect to the

increase in individual DVM is not uniform amongst the

specimen belonging to the same size class.

In the size group of 1-20 mm (r2 = 0.218,

P < 0.001, n = 18) and 21-40 mm (r2 = 0.304, P > 0.05,

n = 24) the correlation between DVM-TWT was poor

indicating gonadal development might still be in the

nascent stages accounting for slower rate of increase in

their tissue weight (Chellam, 1987). However, good and

moderate correlation was observed in the size group

41-60 mm (r2 = 0.725, P < 0.001, n = 33) and 61-80 mm

(r2 = 0.412, P < 0.001, n = 52), respectively, indicating

that the concentration of body energy was beginning to

direct more towards tissue growth rather than shell

growth which finally concluded with low correlation

values in the 81-100 mm group (r2 = 0.180, P < 0.001,

n = 24), where most of the body energy was directed

towards tissue growth indicated by a higher rate of

increase in TWT when the rate of increase of all the

other biometric parameters declined.

In the present study, the lower degree of

correlation between DVM-TWT compared to

Alagarswami (1983), Friedman and Southgate (1999)

and Pouvreau (2000) who obtained very good correlation

between these two variables (r2 = 0.96, 0.86 and 0.97

respectively) could be due to the fact that in the other

studies specimen were either cultured in farm (Friedman

and Southgate, 1999; Pouvreau, 2000a) or collected

mostly from sub tidal or deep waters (Alagarswami,

1983; Abraham et al., 2007).

In those habitats isometric growth can take place

due to less stress per unit area in terms of availability of

food and space, protection from direct sunlight and

desiccation, predators, low turbidity and continuous

oxygen supplies as opposed to the harsh intertidal

condition in this study.

Shell Dimensions and Fouling Load

Biofouling caused by the settlement of fouling

organisms on the shell surface adversely affects the

Jha and Mohan, 2014


wellbeing of pearl oysters. It leads to retarded growth

(Southgate and Beer, 2000), deformation and

deterioration of the shell (Taylor et al., 1997b; Doroudi,

1996) and even mortality of the oyster in extreme cases

(Alagarswami and Chellam, 1976; Mohammad, 1976).

Maximum fouling load observed during the

month of September 2011 (27.8 ± 5.1 g) followed by

February 2012 (19.5 ± 13.5 g) and June 2012 (15.0 ± 3.6

g) could be attributed to the settlement of heavy foulers

(weight-wise) such as predatory mussel, tube forming

polychaetes, barnacles, sponges and ascidians found to

be dominant during these months. Such settlement may

have caused the increase in the fouling load (Dharmaraj

1987a) and in turn might have influenced the recruitment

of other foulers.

Minimal fouling load during July 2012

(3.2 ± 3.7 g), November 2011 (4.6 ± 6.9 g) and

December 2011 (4.7 ± 14.1 g) could be due to the fact

that these months are peak period of spawning of the

above foulers, no attachment of heavy foulers occurred

during this period. Similar results were reported by

Alagarswami and Chellam (1976), Dev and Muthuraman

(1987) and Velayudhan (1988) in their studies on

biofouling of Akoya pearl oyster Pinctada fucata.

Scardino et al., (2003) and Aji (2011) in their

respective studies on pearl oysters reported that the rate

of fouling is lower in the smaller oysters due to the

presence of periostracum layer (a physical defence

against fouling) which wears off with aging in larger

oysters. An increase in the shell surface area also

facilitates higher settlement of biofoulers (Mohammed,

1998).

This explains the lower values of fouling load in

size groups 1-20 mm (0.1 ± 0.1 g, n = 18) and 21-40 mm

(1.0 ± 1.0 g, n = 24). Availability of more surface area

for settlement of foulers and wearing off of the

periostracum layer could be responsible for multifold

time increment in the fouling load in the size groups

41-60 mm (7.3 ± 5.3 g, n = 33) and 61-80 mm (14.9 ±

9.9 g, n = 52) expressed in Fig. 1.

Occurrence of lesser ΔF in 81-100 mm size

group (12.8 ± 7.1 g, n = 24) as compared to its preceding

length group could be attributed to the attachment of

these specimens in area having oligotrophic waters with

less fouling activity, lesser competition for available

resources and lower risk of predators which could be the

reason for their large size in the first place.

A poor correlation in general was observed

between ΔF and other shell dimensions for all the size

groups except 41-60 mm (r2 = 0.619, P < 0.001, n = 33)

in Table 2. The variation in the growth rate of shell and

rate of fouling in different size groups could be the

reason for their poor correlation.

The Critical Size Group, 41-60 mm

Contrary to all the other size groups, 41-60 mm

size group showed the best correlation between DVM-

TWT with r2 corresponding to 0.725. However, the

correlation between other biometric dimensions was

moderate to low (Table 1). Amongst all the size classes,

ΔF showed better correlation with other shell dimensions

in this size class (Table 2). The above observations

suggest that the P. margaritifera of the intertidal regions

of Andaman, attains initial sexual maturity in this size

group with the beginning of their gonad development

and complete reproductive development takes place as

the oyster reaches 61-80 mm size group and becomes

fully mature. This justifies their increased tissue weight

and retarded growth of other shell dimensions with

respect to DVM (Fig. 2). The body energy at this stage

gets distributed more towards tissue growth than shell

growth (Bayne and Newell, 1983; Dharmaraj, 1987b).

Gervis and Sims (1992) also stated that full

maturity occurs in P. margaritifera in 2nd year at size

>70 mm. Pouvreau et al., (2000b) and Kimani and

Mavuti (2002) in their respective studies on black-lip

pearl oyster of French Polynesia and Kenya reported that

the initial sexual maturity, corresponding to the smallest

individual with mature gonads occur at the end of 1st

Jha and Mohan, 2014


year at size <40 mm. Chellam (1987) in his study on

Indian Pinctada fucata also reported that cultured oysters

became sexually mature in 9 months (size <47 mm). This

difference in size at sexual maturity of both the species

in India is possible as P. margaritifera in comparison to

P. fucata is a larger and late maturing species (Pouvreau

et al., 2000b).

From the present study it can be concluded that,

1) Smaller oysters show isometric growth pattern but in

larger oysters, allometry is observed as the rate of

increase of biometric parameters vary with increasing

size range. 2) September, February and June months

witness settlement of heavy foulers whereas fouling load

is minimal during the month of July, November and

December, 3) Even though ΔF did not show any

significant correlation with the DVM, biofouling could

also be a possible factor responsible for restricting the

maximum size attained by these oysters or in extreme

cases even mortality of the oyster by competing for

resources required for their growth, 4) 41-60 mm size

group is a critical stage in the life cycle of these

specimen when sexual maturity initiates, 5) Harsh

intertidal environment could be responsible for

difference in growth pattern and also for confining most

of the P. margaritifera from intertidal regions of

Andaman, to the size group of 61-80 mm, 6) The

intertidal P. margaritifera which are adapted to survive

in tough environmental conditions would more easily

acclimatize to a new environment such as in the case of

suspended or raft culture, if transferred at an early stage,

they could cross the 61-80 mm size range and become

larger and thicker, a parameter favourable for pearl

production.

The present biometric study of P. margaritifera

will be helpful in 1) Understanding the correlation

existing between length and other shell dimensions of

different size groups in intertidal rocky habitat and the

factors responsible for it, 2) Observing the trend of

biofouling on various size ranges of P. margaritifera and

its effect on their biometry. 3) It shall also throw some

light on the importance of these intertidal oysters in the

pearl culture industry.

ACKNOWLEDGEMENT

The authors are thankful to the Vice Chancellor,

Pondicherry University for providing infrastructural

support for this study at the Department of Ocean Studies

and Marine Biology, Pondicherry University, Port Blair

campus. The first author is also obliged to the University

Grants Commission (UGC), New Delhi for providing

financial aid in the form of Research Fellowship in

Science for Meritorious Student (RFSMS).

REFERENCES

Abraham KJ, Libini CL, Basak R, Madhupal P,

Kripa V, Velayudhan TS, Mohamed KS and Modayil

MJ. 2007. Biometric relationships of the black-lip pearl

oyster Pinctada margaritifera (Linnaeus, 1758) from the

Andaman and Nicobar waters. Indian J Fish. 54(4):409-

415.

Aji L. 2011. An overview of the method, management,

problem and their solution in the pearl oyster (Pinctada

margaritifera) culture. J Coast Develop., 14(3):181-190.

Alagarswami K. 1991. Production of cultured pearls.

ICAR, New Delhi.15-21.

Alagarswami K. 1983. The black-lip pear oyster

resource and pearl culture potential. In: Mariculture

potential of Andaman and Nicobar Islands-An indicative

survey (K. Alagarswami, Ed.). Bulletin of Central

Marine Fisheries Research Institute, CMFRI, Cochin.

34:72-78.

Alagarswami K. 1987. Pearl culture. Bulletin of Central


39:136 p.

Alagarswami K and Chellam A. 1976. On fouling and

boring organisms and mortality of pearl oysters in the

farm at Veppalodai, Gulf of Mannar. Indian J Fish. 23

(1-2):10-22.

Bartol IK, Mann R and Luckenbach M. 1999. Growth

and mortality of oysters (Crassostrea virginica) on

Jha and Mohan, 2014


constructed intertidal reefs: effects of tidal height and

substrate level. J Expt Mar Boil Ecol., 237(2):157-184.

Bayne BL and Newell RCA. 1983. Physiological

energetics of marine molluscs. In: The Mollusca,

Volume 4, Physiology, part 1 (eds: S. M. Saleuddin, Karl

Milton Wilbur), Academic Press, London. p.407-515.

Chellam A. 1987. Biology of pearl oyster. In: Pearl

culture (K. Alagarswami, Ed.). Bulletin of Central


39:13-20.

Dev DS and Muthuraman AI. 1987. Observation on

the biofouling in pearl oyster farm at Krusadai Island,

Gulf of Mannar. In: National seminar on shellfish

resources and farming sessions-II-IV (eds: Mahadevan S,

Narasimham KA, Satya Narayana Rao K, Ameer Hamsa

KMS and Muthiah P). Bulletin of Central Marine

Fisheries Research Institute, CMFRI, Cochin. 42(2): 306

-310.

Dharmaraj S, Chellam A and Velayudhan TS. 1987a.

Biofouling, boring and predation of pearl oyster. In:

Pearl culture (K. Alagarswami, Ed.). Bulletin of Central

Marine Fisheries Research Institute, CMFRI, Cochin, p.

39: 92-97.

Dharmaraj S, Kandasami D and Alagarswami K.

1987b. Some aspects of physiology of Indian pearl

oyster. In: Pearl culture (K. Alagarswami, Ed.). Bulletin

of Central Marine Fisheries Research Institute, CMFRI,

Cochin. 39: 21-28.

Doroudi MS. 1996. Infestation of pearl oysters by

boring and fouling organisms in the northern Persian

Gulf. Indian J. Mar. Sci., 25(2):168–169.

El-Sayed AEH, Razek FAA, Abou-Zaid MM and

Taha SM. 2011. Measures of allometric growth of black

-lip pearl oyster Pinctada margaritifera (Linnaeus, 1758)

Red Sea, Egypt. Int J Zool Res., 7(2):201-211.

Fletcher W, Friedman K, Weir V, McCrea J and

Clark R. 2006. Pearl oyster fishery. Department of

Fisheries, Western Australia.

Friedman KJ and Southgate PC. 1999. Grow-out of

black-lip pearl oysters, Pinctada margaritifera (Linnaeus

1758) on chaplets in suspended culture in Solomon

Islands. J Shellfish Res., 18:451-458.

Gervis MH and Sims NA. 1992. The biology and

culture of pearl oysters (Bivalvia: Pteriidae). Manila

(Philippines). ICLARM Stud. Rev., 21:1-49.

Gimin R, Mohan R, Thinh LV and Griffiths AD.

2004. The relationship of shell dimensions and shell

volume to live weight and soft tissue weight in the

mangrove clam, Polymesoda erosa (Solander, 1786)

from Northern Australia. NAGA, World Fish Center

Quarterly. 27(3 and 4): 32-35.

Hynd JS. 1955. A revision of Australian pearl- shells,

genus Pinctada (Lamelli-branchia). Aust J Mar

Freshwater Res., 6(1):98-138.

Kimani EN and Mavuti KM. 2002. Abundance and

population structure of the black-lip pearl oyster,

Pinctada margaritifera L. 1758 (Bivalvia: Pteriidae), in

coastal Kenya. Western Indian Ocean J Mar Sci.,

1(2):169-179.

Kripa V, Abraham KJ, Libini CL, Velayudhan TS,

Radhakrishnan P, Mohamed KS and Modayil MJ.

2008. Production of designer Mabe Pearls in the black-

lipped pearl oyster, Pinctada margaritifera, and the

winged pearl oyster, Pteria penguin, from Andaman and

Nicobar Islands, India. J World Aquacult Soc., 39(1):131

-137.

Mohamed KS, Kripa V, Velayudhan TS and

Appukuttan KK. 2006. Growth and biometric

relationships of the pearl oyster Pinctada fucata (Gould)

on transplanting from the Gulf of Mannar to the Arabian

sea. Aquaculture Research. 37(7):725-741.

Mohammad MBM. 1976. Relationship between

biofouling and growth of the pearl oyster Pinctada

fucata (Gould) in Kuwait, Arabian Gulf. Hydrobiologia.

51(2):129-138.

Mohammed SZ. 1998. On the epifouling of pearl oyster

(Pinctada radiata) in Qatari water Arabian Gulf and its

influence on the flesh growth. Egyptain J Aquat Biol and

Fish. 2(2):73-85.

Moullac GL, Tiapari J, Teissier H, Martinez E and

Cochard JC. 2012. Growth and gonad development of

the tropical black-lip pearl oyster, Pinctada

Jha and Mohan, 2014


margaritifera (L.), in the Gambier archipelago (French

Polynesia). Aquac Internat. 20(2): 305-315.

Pit JH and Southgate PC. 2003. Fouling and predation;

how do they affect growth and survival of the black-lip

pearl oyster, Pinctada margaritifera, during nursery

culture? Aquac Internat. 11(6): 545 555.

Pouvreau S, Gangnery A, Tiapari J, Lagarde F,

Garnier M and Bodoy A. 2000b. Gametogenic cycle

and reproductive effort of the tropical black- lip pearl

oyster, Pinctada margaritifera (Bivalvia: Pteriidae),

cultivated in Takapoto atoll (French Polynesia). Aquat

Living Resour., 13(1): 37-48.

Pouvreau S and Prasil V. 2001. Growth of the black-lip

pearl oyster, Pinctada margaritifera, at nine culture sites

of French Polynesia: synthesis of several sampling

designs conducted between 1994 and 1999. Aquat Living

Resour., 14(3): 155-163.

Pouvreau S, Tiapari J, Gangnery A, Lagarde F,

Garnier M, Teissier H, Haumani G, Buestel D and

Bodoy A. 2000a. Growth of the black-lip pearl oyster,

Pinctada margaritifera, in suspended culture under

hydrobiological conditions of Takapoto lagoon (French

Polynesia). Aquaculture. 184(1-2):133-154.

Saville-Kent W. 1893. The great barrier reef of

Australia: its products and potentialities, W.H. Allen and

Co., London, p. 204-224.

Scardino A, Nys RD, Ison O, Connor WO and

Steinberg P. 2003. Microtopography and antifouling

properties of the shell surface of the bivalve molluscs

Mytilus galloprovincialis and Pinctada imbricata.

Biofouling. 19(Supplement 1): 221-230.

Sims NA. 1993. Size, age and growth of the black-lip

pearl oyster, Pinctada margaritifera (L.) (Bivalvia:

Pteriidae). J Shellfish Res., 12:223-228.

Southgate PC and Beer A. 2000. Growth of black-lip

pearl oyster (Pinctada margaritifera) juveniles using

different nursery culture techniques. Aquaculture. 187

(1-2): 97-104.

Taylor JJ, Rose RA, Southgate PC and Taylor CE.

1997. Effects of stocking density on growth and survival

of early juvenile silver-lip pearl oysters, Pinctada

maxima (Jameson), held in suspended nursery culture.

Aquaculture. 153(1-2): 41-49.

Velayudhan TS. 1988. Studies on the settlement

of barnacles at different depths in the pearl oyster farm

at Tuticorin. In: National seminar on shellfish resources

and farming sessions-II-IV (eds: Mahadevan S,

Narasimham KA, Satya Narayana Rao K, Ameer

Hamsa KMS and Muthiah P). Bulletin of Central


42(2): 301-305.

Zhenxia SU, Yan Y and Liangmin H. 2007. Effect of

Fouling on Feeding, Oxygen Consumption and Waste

Excretion of Pearl Oyster Pinctada martensii in Daya

Bay Cultivation. Mar Sci Bull., 9(2): 34-42.

Jha and Mohan, 2014



Advantages


[email protected]


Article Citation: Jet S Mandey, Hendrawan Soetanto, Osfar Sjofjan and Bernat Tulung.

Genetics characterization, nutritional and phytochemicals potential of gedi leaves (Abelmoschus manihot (L.) Medik) growing in the North Sulawesi of Indonesia as a candidate of poultry feed. Journal of Research in Biology (2014) 4(2): 1276-1286

Jou

rn

al of R

esearch

in

Biology

Genetics characterization, nutritional and phytochemicals potential of gedi leaves

(Abelmoschus manihot (L.) Medik) growing in the North Sulawesi of Indonesia as a

candidate of poultry feed

Keywords: Abelmoschus manihot, genetic characterization, nutritional analysis, phytochemical constituents.

ABSTRACT: Gedi, local name of Abelmoschus manihot (L.) Medik was used by local people in Northern Sulawesi-Indonesia as vegetable, because of its medicinal properties. The potency of gedi leaves in broiler diet has not been reported in literatures. The objective of this research was to investigate a genetic diversity of gedi commonly consumed as a gourmet cuisine in the North Sulawesi of Indonesia, and exploring the potential of this plant as a herb plant for a candidate of poultry feedstuff. Eight morphologically different gedi leaves (GH1, GH2, GH3, GH4, GH5, GH6, GM1 and GM2) that grow in Manado area, North Sulawesi of Indonesia were collected and identified. The leaves were extracted for DNA isolation followed by PCR and DNA sequencing analysis. During DNA isolation, 3 of 6 GH (GH4, GH5, GH6) were discontinued because of difficulty in separating the mucilage properties. Following PCR analysis, GH2 and GH3 did not produce bands and consequently were excluded from further analysis. In addition to that, chemical analysis was also performed to determine the phytochemical and nutritional contents .The results indicated that all gedi leaf samples showed similarity (99%) to species member of Abelmoschus manihot, and tribe of Malvaceae. In terms of proximate analysis, gedi leaves showed high crude protein (18.76 - 24.16%) and calcium (2.92-3.70%) content. Also, showed high crude fibre (13.06-17.53%). Together with the presence of alkaloid and steroidal saponin gedi leaves may offer beneficial effects as poultry feedstuff to a special production trait such as cholesterol-less meat.

1276-1286 | JRB | 2014 | Vol 4 | No 2



An International


Authors:

Jet S Mandey1*,

Hendrawan Soetanto2,

Osfar Sjofjan2 and

Bernat Tulung1.

Institution:

1. Animal Husbandry

Faculty, Sam Ratulangi

University, Manado,

The North Sulawesi,

Indonesia .

2. Animal Nutrition

Department, Animal

Husbandry Faculty,

Brawijaya University,

Malang, The East Java,

Indonesia.


Jet S Mandey.

Email Id:



Dates: Received: 06 Mar 2014 Accepted: 22 Mar 2014 Published: 19 May 2014



Original Research


INTRODUCTION

Abelmoschus manihot (L.) Medik is a native

plant which is 1.2 – 1.8 m height and is widely

distributed in the tropical regions. This plant has various

local names such as aibika. It was hypothesized that the

origin of this plant from the survey of literature the local

names of Abelmoschus manihot (L.) Medik varies and

the data available were largely derived from studies

carried out in the polynesian-pacific regions (Preston,

1998). In North Sulawesi of Indonesia this plant is called

“gedi” and its leaves provide essential ingredient for

cooking porridge as a special gourmet food among the

North Sulawesi cuisine. According to Jain and Bari

(2010), gedi leaves contain polysaccharides and protein

containing mucilage (gum) that enables the porridge to

have a special viscosity. Morphologically, gedi plants

vary in shape, color and other properties regardless of

geographical differences suggesting some genetic

variation may occur after a long period of adaptation.

Gedi plants have been reported to posses

medicinal properties that may benefit to human health.

Puel et al., (2005) reported that the female wistar rat

which feeding 15 % of gedi leaves prevent osteopenia

that was attributable to the calcium content of gedi

leaves. Other authors, Jain et al., (2009) reported that

woody stem of gedi plant contain stigmasterol and

γ-sitosterol, and also contain isoquercitrin, hyperoside,

hibifolin, quercetin and isohamnetin that have anti

consulvant and anti depressant-like activity (Guo et al.,

2011; Wang et al., 1981; Wang et al., 2004). Gedi leaves

have active pharmacological properties against analgesic

effect (Jain et al., 2011). Sarwar et al., (2011) stated that

Abelmoschus manihot has a profound anti-inflammatory

and anti-diabetic effect. From these reports it can be

concluded that gedi plants posses herbal medicine

properties that can be used to manipulate the human and

animal health. In spite of its phytopharmaceutical

benefits there is paucity in information dealing with

genetic diversity of gedi plant in Indonesia. Most

information of Abelmoschus manihot derived from the

studies carried out in the polynesian pacific regions

(Preston, 1998).

Gedi as a culinary herb and medicinal herb may

have beneficial effects in animals. The phytochemical

and nutritional compounds of leaf material may affect to

poultry health and productivity. Cross et al., (2007)

reported that culinary herbs in diets affect chick

performance, gut health and endogenous secretions.

Al-Sultan and Gameel (2004) suggests that feeding

Curcuma longa (turmeric) to chicken through diet can

induce hepatic changes and that these changes are not

dose or time dependent. Windisch et al., (2008) cited

several research, i.e. that phytogenic product also

reduced activities of intestinal and fecal urease enzyme

in broilers.

Ashayerizadeh et al., (2009) reported that garlic

powder and turmeric powder in diet significantly reduced

abdominal fat percent, LDL and VLDL concentration in

serum of broiler. Moreover, Yang et al., (2003) reported

that green tea by product affect the reduction of body

weight gain and meat cholesterol in broilers. Khatun

et al., (2010) observed using in vitro model that viscous

water-soluble portion of the fruit of Abelmoschus

esculentus (L.) Moench has significant capacity to

reduce the glucose diffusion form the dietary fiber-

glucose systems.

The study was undertaken to investigate the

compositional characterization of gedi. The samples

were an alysed for the molecular characterization and

identification, the proximate composition of the leaf part,

energy content and the phytochemical composition, in

order to get some useful information to be used in the

preparation of poultry feed. Because there are no major

reports in the literature, this would be an information for

the detailed utilization of gedi to poultry feed.

Mandey et al., 2014


MATERIAL AND METHODS

Plant Identification

Eight accessions of gedi (Abelmoschus manihot)

collected from Manado, the North Sulawesi, Indonesia

were used for this study. Herbarium specimens were

identified for plant species at the Research Center for

Biology, Indonesian Institute of Sciences, Bogor,

Indonesia.

DNA extraction, quantification, and sequencing

DNA was extracted from 80-100 mg of fresh leaf

tissue from each of the 5 randomly selected samples

using a protocol of AxyPrep Multisource Genomic DNA

M i n i p r e p K i t ( A x y g e n B i o s c i e n c e s ,

www.axygenbio.com). Three samples were scored as

missing because of unable to isolate the mucilage. The

final DNA supernatant were diluted for DNA

quantifications with PCR technique. PCR analysis were

performed using a Thermocycler machine, and in 50 µl

reaction mixture containing 2 µl template of DNA, 2 x

master Mix Vivantis 25 µl (Vi Buffer A 1 x; Taq

Polimerase 1,25 unit), Primer F1 (10 pmol/µl) 1 µl (0,2

mM), Primer R1318 (10 pmol/µl) 1 µl (0,2 mM), MgCl2

(50 mM) 1,5 µl (3 mM dNTPs 0,4 mM), H2O 20,5 µl,

sample 1 µl.Initial trial was run on 5 samples and Taq

quantity was Taq Polimerase 1,25 unit. Two primers

were initially screened for amplification in PCR, they are

Primer ndhF-F1 with product description 5’-GAA-TAT-

GCA-TGG-ATC-ATA-CC-3’ (length 20) dan primer

ndhF-R1318 with product description 5’-CGA-AAC-

ATA-TAA-AAT-GCR-GTT-AAT-CC-3’ (length 26).

PCR conditions were pre-hot 94°C (5 minutes),

denaturation 94°C (45 seconds), annealing 54°C (45

seconds), primerization 72°C (1 minute 30 seconds) in

35 cycles and hold at 72°C (5 minutes). All PCR

products were separated by electrophoresis in 1%

agarose gel in 1 x TBE ran for 2 hours followed by

ethidium bromide staining (5 µg ethidium bromide/ml).

The gel was then stained and rinsed in water for about 10

minutes, and after that visualized under UV-light in trans

-illuminator.

All PCR products were sequenced. Sequence

data were identified at First Base Laboratories Sdn, Bhd

(1st base), Taman Serdang Perdana, Selangor, Malaysia.

Sequences were aligned using BLAST programme, and

the building of a phylogenetic tree was established by

Bioedit 7.19 and Mega 5 programme (http://

megasoftware.net).

Phytochemical Screening

Chemical tests were carried out to evaluate the

presence of the phytochemicals such as alkaloids,


Mandey et al., 2014

No Place of Collection Species Tribe

1 (1) (GH4) Abelmoschus manihot (L.) Medik Malvaceae



4 (4) (GM2) Abelmoschus manihot (L.) Medik Malvaceae


6 (8) (GM1) Abelmoschus manihot (L.) Medik Malvaceae



Table 1: Identification/Determination of Gedi Leaves from Manado, North Sulawesi

Notes: GH = green leaf; GM = reddish green leaf; GH1= Bumi Nyiur; GH2 = Wanea; GH3 = Bumi

Beringin; GH4 = Teling; GH5 = Bahu; GH6 = Kleak; GM1 = Tingkulu; GM2 = Wanea.

http://www.axygenbio.com

http://megasoftware.net

http://megasoftware.net

flavonoids, saponins, tannins, triterpenoids/steroids, and

hydroquinone in five selected samples; using standard

procedures described by Harborne (1987), and one of the

five samples was performed for total flavonoid analysis.

Test for alkaloids

One gram of sample was homogenized, added

with chloroform and then with 3 ml of ammonia.

Chloroform fraction was separated and acidified using

H2SO4 2M for two minutes. The filtrate was separated

and added with few drops of Mayer, Wagner, and

Dragendorff’s reagent. The sample was contained

alkaloid if produced white sediment using Mayer

reagent, orange sediment using Dragendorff reagent, and

brown sediment using Wagner reagent.

Test for phenolic

Approximately 5 g powder was shaken and then

heated to boil and filtered. For testing the presence of

flavonoids, filtrate was added with Mg powder,

HCl:EtOH (1:1) and amyl alcohol. A yellow solution that

turned colorless within few minutes indicated the

presence flavonoids. For the evaluation of saponins,

filtrate was shaken with distilled water. The presence of

saponins was indicated by the appearance of bubbles. For

the evaluation of tannins availability, filtrate was added

with three drops of FeCl3 10%. The dark green solution

indicated the presence of tannins.

Test for steroids/triterpenoids

Four grams of sample were added with 2 ml hot

ethanol. Filtered and heated, and homogenized with 1 ml

Mandey et al., 2014


Nutrients

Types of Gedi

GH1 GH2 GH3 GM1 GM2

Dry Matter (%) 81.72 87.33 87.14 86.70 84.76

Ash (%) 11.78 13.22 11.45 12.29 14.27

Crude Protein (%) 20.18 18.76 19.89 22.62 24.16

Crude Fiber (%) 17.53 14.37 15.68 14.37 13.06

Crude Fat (%) 1.06 3.80 2.96 1.63 4.51

N-free extract (%) 31.17 37.18 37.16 35.79 28.76

Ca (%) 3.29 3.70 2.92 3.33 3.36

P (%) 0.39 0.50 0.55 0.48 0.85

GE (Kkal/kg) 3419 3859 3850 3654 3699

Component of Fiber (%):

NDF 20.78 21.72 25.02 34.09 23.51

ADF 18.44 19.11 16.23 20.10 17.30

Hemicellulose 2.34 2.61 8.79 13.99 6.21

Cellulose 11.39 15.25 11.02 5.50 10.62

Lignin 5.88 3.02 4.54 13.17 6.50

Silica 1.15 0.84 0.66 1.18 0.16

Table 2: Nutrients composition and energy values of gedi leaf (dry weight basis)

Notes: GH = green leaf; GM = reddish green leaf

Mandey et al., 2014


Figure 1: Eight accessions of gedi leaf collected from Manado, North Sulawesi. GH1= Bumi Nyiur area, GH2 =

Wanea area, GH3 = Bumi Beringin area, GH4 = Teling area, GH5 = Bahu area, GH6 = Kleak area, GM1 = Ting-

kulu area, GM2 = Wanea area

GM1

GH4 GH3

GH2 GH1

GH6

GM2

GH5

diethyl ether. It is added with one drop of H2SO4 and one

drop of CH3COOH anhydrate. The presence of steroids

was indicated by the alteration of violet to blue or green

color. The formation of reddish violet color to the

interface was formed that indicating positive sign for

triterpenoids.

Test for hydroquinons

One gram sample was boiled with methanol for

few minutes. The filtrate was allowed to cool and then

added with 3 drops of NaOH 10%. The appearance of

red color indicated the presence of hydroquinone.

Nutritional Analysis

The proximate analysis were carried out in

duplicates and the results obtained were the average

values. The proximate analysis (protein, crude fiber,

crude fat, carbohydrate and ash) of five types of gedi leaf

were determined by using the Association of Official of

Analytical Chemists (AOAC) methods (1980). Nutrient

contents were valued in percentage. The energy value

was determined by bomb calorie meter.

RESULTS AND DISCUSSION

Plant Identification

Two typical colors of gedi leaves (green and

reddish green leaves) growing at eight locations in

Manado area were presented in Figure 1. All leaves of

this plant do not have the same size or even appearance.

They vary in size, color, and even shape. The results of

plant identification of eight accessions of gedi leaf were

summarized in Table 1. Those have been recognized that

all of eight accessions of gedi leaf in this research were

species of Abelmoschus manihot (L.) Medik, tribe

Malvaceae. Breen (2012) reported that leaves are often

the basis for identifying plants since they are so easily

observed.

The boundaries of the eight accessions of gedi

from the different locations of Manado area were based

on morphological features of the species. The

phylogenetic hypotheses were tested using chloroplast

DNA sequence of ndhF. Total genomic DNA were

extracted from eight accessions of fresh leaf material,

and the ndhF gene was amplified in PCR using primer.

In this research, DNA fragments of the expected

size were amplified from five samples to obtain the

isolation product of electrophoresis, as shown

at Figure 2. Based on DNA fragments, according to their

molecular weights those products indicated that there

were no different chloroplast type of gedi leaf color

characteristics between green leaf (GH) and reddish

green leaf (GM) with bands of 1.3 kb (Figure 2).

Moreover, profile (external shape) of gedi leaf from the

two color types were analysed as shown in Figure 2. Two

samples of reddish green leaf (GM) and one sample of

green leaf (GH) were used in the analysis of gedi leaf

profile (Figure 3).

Mandey et al., 2014


Figure 2: Electrophoresis of 5 samples of gedi

leaf isolation product

Figure 3: PCR amplification and electrophoresis product

for profiles of gedi leaf obtained from 3 samples

Mandey et al., 2014


Query 29 CTACTTTTTCCGACGGCAACAAAAAATCTTCGTCGTAGGTGGGCTTTTCCCAATATTTTA 88

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 1 CTACTTTTTCCGACGGCAACAAAAAATCTTCGTCGTAGGTGGGCTTTTCCCAATATTTTA 60

Query 89 TTGTTAAGTATAGTTATGATTTTTTCGGTCGATCTGTCTATTCAACAAATAAATGGAAGT 148

||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 61 TTGTTAAGTATAGNTATGATTTTTTCGGTCGATCTGTCTATTCAACAAATAAATGGAAGT 120

Query 149 TCTATCTATCAATATGTATGGTCTTGGACCATCAATAATGATTTTTCTTTCGAGTTTGGC 208

|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||

Sbjct 121 TCTATCTATCAATATGTATGGTCTTGGACCATCAATAATGATTTTTCTTTCGAGNTTGGC 180

Query 209 TACTTTATTGATTCACTTACCTCTATTATGTCAATATTAATCACTACTGTTGGAATTTTT 268

|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||

Sbjct 181 TACTTTATTGATTCACTTACCTCTATTATGNCAATATTAATCACTACTGTTGGAATTTTT 240

Query 269 GTTCTTATTTATAGTGACAATTATATGTCTCATGATCAAGGCTATTTGAGATTTTTTGCT 328

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 241 GTTCTTATTTATAGTGACAATTATATGTCTCATGATCAAGGCTATTTGAGATTTTTTGCT 300

Query 329 TATATGAGTTTGTTCAATACTTCAATGTTGGGATTAGTTACTAGTTCGAATTTGATACAA 388

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 301 TATATGAGTTTGTTCAATACTTCAATGTTGGGATTAGTTACTAGTTCGAATTTGATACAA 360

Query 389 ATTTATATTTTTTGGGAATTAGTTGGAATGTGTTCTTATCTATTAATAGGGTTTTGGTTC 448

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 361 ATTTATATTTTTTGGGAATTAGTTGGAATGTGTTCTTATCTATTAATAGGGTTTTGGTTC 420

Query 449 ACACGACCCGCTGCGGCAAACGCTTGTCAAAAAGCGTTTGTAACTAATCGGATAGGCGAT 508

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 421 ACACGACCCGCTGCGGCAAACGCTTGTCAAAAAGCGTTTGTAACTAATCGGATAGGCGAT 480

Query 509 TTTGGTTTATTATTAGGAATTTTAGGTTTTTATTGGATAACGGGAAGTTTCGAATTTCAA 568

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 481 TTTGGTTTATTATTAGGAATTTTAGGTTTTTATTGGATAACGGGAAGTTTCGAATTTCAA 540

Query 569 GATTTGTTCGAAATATTTAATAACTTGATTTATAATAATGAGGTTCATTTTTTATTTGTT 628

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 541 GATTTGTTCGAAATATTTAATAACTTGATTTATAATAATGAGGTTCATTTTTTATTTGTT 600

Query 629 ACTTTATGTGCCTCTTTATTATTTGCCGGCGCCGTTGCTAAATCTGCGCAATTTCCTCTT 688

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 601 ACTTTATGTGCCTCTTTATTATTTGCCGGCGCCGTTGCTAAATCTGCGCAATTTCCTCTT 660

Query 689 CATGTATGGTTACCTGATGCCATGGAGGGGCCTACTCCTATTTCGGCTCTTATACATGCT 748

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 661 CATGTATGGTTACCTGATGCCATGGAGGGGCCTACTCCTATTTCGGCTCTTATACATGCT 720

Query 749 GCCACTATGGTAGCAGCGGGAATTTTTCTTGTAGCCCGCCTTCTTCCTCTTTTCATAGTT 808

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

> gb|AF384639.1| Abelmoschus manihot NADH dehydrogenase component NdhF (ndhF)gene, partial cds;

chloroplast gene for chloroplast product

Length=1257

Score = 2242 bits (1214), Expect = 0.0

Identities = 1223/1229 (99%), Gaps = 2/1229 (0%)

Strand=Plus/Plus

http://www.ncbi.nlm.nih.gov/nucleotide/21388992?report=genbank&log$=nuclalign&blast_rank=1&RID=HCVZN3PA01S

Based on DNA bands, the gedi leaf color type of

GH and GM had the same positions of bands of 1.3 bp

indicating the similar profiles. By sequencing the PCR

product, additional useful taxonomic and genome

information were successfully obtained from three

samples. The ndhF data sets have aligned lengths

of 1257 bases, and the sequence data were shown in

Figure 4.

Comparisons were done with a few selected

DNA sequences, using closest relationship in a BLAST

search. Analysis showed that this sequence was very

similar to Abelmoschus manihot (L.) Medik (99%), as

shown in Figure 4. The phylogenetic analysis was done

based on ndhF sequences from each of the available

three sample accessions of gedi (Figure 5). The three

samples were clearly obtained asa member of the species

Abelmoschus manihot (L.) Medik, tribe Malvaceae, and

the sample GH1 was 96% similar to Abelmoschus

manihot.(L.) Medik.

Nutritional Analysis

The proximate concentration of five samples of

gedi were expressed on dry basis listed in Table 2. The

proximate analysis showed that the gedi leaves contained

ash (11.45-14.27%), crude protein (18.76-24.16%), crude

fibre (13.06-17.53%), crude fat (1.06-4.51), N-free

extract (28.76-37.18%) and gross energy (3419-3859

Kkal/kg), and minerals were calcium (2.92-3.70%) and

phosphorous (0.39-0.85%). In terms of proximate

analysis, gedi leaves showed high crude protein (18.76 -

24.16 %) and calcium (2.92-3.70%) content. Also, it

showed high crude fiber (13.06-17.53%). In addition, the

component of fiber were NDF (20.78-34.09), ADF

Mandey et al., 2014


Sbjct 721 GCCACTATGGTAGCAGCGGGAATTTTTCTTGTAGCCCGCCTTCTTCCTCTTTTCATAGTT 780

Query 809 ATACCTTACATAATGAATCTAATATCTTTGATAGGTATAATAACGGTATTATTAGGGGCT 868

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 781 ATACCTTACATAATGAATCTAATATCTTTGATAGGTATAATAACGGTATTATTAGGGGCT 840

Query 869 ACTTTAGCTCTTGCTCAAAAAGATATTAAGAGGGGGTTAGCCTATTCTACAATGTCCCAA 928

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 841 ACTTTAGCTCTTGCTCAAAAAGATATTAAGAGGGGGTTAGCCTATTCTACAATGTCCCAA 900

Query 929 CTGGGTTATATGATGTTAGCTTTAGGTATGGGGTCTTATCGAACCGCTTTATTTCATTTG 988

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 901 CTGGGTTATATGATGTTAGCTTTAGGTATGGGGTCTTATCGAACCGCTTTATTTCATTTG 960

Query 989 ATTACTCATGCTTATTCGAAAGCATTGTTGTTTTTAGGATCCGGATCAATTATTCATTCC 1048

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 961 ATTACTCATGCTTATTCGAAAGCATTGTTGTTTTTAGGATCCGGATCAATTATTCATTCC 1020

Query 1049 ATGGAAGCTGTTGTTGGGTATTCCCCAGAGAAAAGCCAGAATATGGTTTTGATGGGCGGT 1108

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 1021 ATGGAAGCTGTTGTTGGGTATTCCCCAGAGAAAAGCCAGAATATGGTTTTGATGGGCGGT 1080

Query 1109 TTAAGAAAGCATGCACCTATTACACAAATTGCTTTTTTAATAGGTACGCTTTCTCTTTGT 1168

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 1081 TTAAGAAAGCATGCACCTATTACACAAATTGCTTTTTTAATAGGTACGCTTTCTCTTTGT 1140

Query 1169 GGTATTCCACCCCTTGCTTGTTTTTGGTCCAAAGATGAAATTCTTAGTGACAGTTGGCTG 1228

||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||

Sbjct 1141 GGTATTCCACCCCTTGCTTGTTTTTGGTCCAAAGATGAAATTCTTAGTGACAGNTGGCTG 1200

Query 1229 TATTCACCGATTT--GCAATAATAGCTTG 1255

||||||||||||| ||||||||||||||

Sbjct 1201 TATTCACCGATTTTTGCAATAATAGCTTG 1229

Figure 4: DNA Sequence Alignment with BLAST Method

(16.23-20.10%), hemicellulose (2.34-13.99%), cellulose

(5.50-15.25%), lignin (3.02-13.17%), and silica (0.16-

1.18%). Prasad, et al., (2010) reported that the

biological effects of estimated proximate components

(moisture, protein, fiber, fat, ash, and energy) in living

system strongly depend on their concentration.

Therefore, it should be carefully controlled when herbs

are used as food component. Energy and nutrient values

of herb plant samples are mainly used to translate herb

samples intakes as intakes of food components.The result

of this study indicated that Abelmoschus manihot (L.)

Medik from The North Sulawesi might be the best

alternative source of nutrient. High protein and fiber

obtained in this study confirms that Abelmoschus

manihot can be used as good alternative source of protein

and crude fiber.

These results recommended high rank for the

leaves of Abelmoschus manihot as the best in terms of

essential nutrients composition if compared with those of

other edible leaves in the literature.

The results of phytochemical screening of five

types of gedi leaf were summarized in Table 3. Result

depicted that all samples had rich steroid but had no

tannin. Four samples contained saponin and flavonoid,

while three samples contained alkaloid. The result of this

study indicated that Abelmoschus manihot (L.) Medik

from Manado is a good alternative source of

phychemical steroid, flavonoid and saponin.

The phytochemical steroid was detected in all

types of gedi leaf, and this phytochemical was found in

maximum content. Alkaloids were detected with Wagner

reagent only in green leaves GH1, GH2, and GH3.

Flavonoids were found at the adequate amount in green

leaf GH1 and GH2 while flavonoids in reddish green leaf

were at the minimum amount. Quantification of total

phenolic content from sample GH1 showed its phenolic

content as 0.48% (w/w). The results suggested that all

samples of gedi had the potential in steroid, flavonoid

and saponin, and free of anti nutritional tannin.

Flavonoids had been reported in rat brain, and might

represent the potential bioactive component of

A. manihot and contributed to its anticonsulvant and anti

depressant-like activity in vivo (Guo et al., 2011). Jain

et al., (2011) reported that the phytochemical analysis

Mandey et al., 2014


Phytochemicals

Qualitative Quantitative (%)

(w/w) (n=3) Green Reddish

green

GH1 GH2 GH3 GM1 GM2 GH1

Alkaloid

Wagner + + + - -

Meyer + - + - -

Dragendorf - + - - ++

Hidroquinon - - - - -

Tannin - - - - -

Flavonoid ++ ++ - + + 0.48

Saponin + ++ + - +

Steroid +++ +++ +++ +++ +++

Triterpenoid - - - - -

Table 3: Phytochemical screening of gedi leaf

Notes: - = nothing; + = weak positive; ++ = positive; +++ = strong positive

showed the presence of steroids, triterpenoids and

flavonoids in petroleum ether and methanol extract,

respectively which possesses analgesic, antioxidant and

anti-inflammatory activity. Saponins that were steroid or

triterpenoid glycosides are important in animal nutrition.

Some saponins increase the permeability of intestinal

mucosal cells in vitro, inhibit active mucosal transport

and facilitate uptake of substances that are normally not

absorbed (Francis et al., 2002).

CONCLUSION

The characterization, nutritional analysis and

phytochemical analysis of Abelmoschus manihot leaf by

genetical and chemical analysis recommended the

potential value of these feedstuff to those populations

who rely upon them as poultry feed or supplements to

poultry diet. The next step is to assess the bioavailability

of the essential nutrients and phytochemicals in these

plants. Further study have to focus on the digestibility of

protein, fibre, and lipid, and phytochemicals.

REFERENCES

Association of Official of Analytical Chemist

(AOAC). 1980. Official methods of analysis of the

Association of Official Analytical Chemists. 13th Ed.

Washington DC., USA.

Al-Sultan SI and Gameel AA. 2004. Histopathological

changes in the livers of broiler chicken supplemented

with Turmeric (Curcuma longa).Intern. J. of Poult. Sci.,

3(5):333-336.

Ashayerizadeh O, Dastar B, Shams Shargh M,

Rahmatnejad E and Ashayerizadeh A. 2009. Influence

of prebiotic and two herbal additives on interior organs

and hematological indices of broilers. J. of Animal and

Veterinary Advances. 8(9):1851-1855.

Breen P. 2012. Plant Identification: Examining Leaves.

Oregon Sta te Universi ty Department of

Horticulture.http://oregonstate.edu/dept/Idplants/PlantID

-leaves.htm.

Cross DE, McDevitt RM, Hillman K and Acamovic T.

2007. The effect of herbs and their associated essential

oils on performance, dietary digestibility and gut

microflora in chickens from 7 to 28 days of age. British

P o u l t . S c i . , 4 8 ( 4 ) : 4 9 6 - 5 0 6 . U R L : h t t p : / /

mc.manuscriptcentral.co./cbps.

Francis G, Kerem Z, Makkar HPS, Becker K. 2002.

The biological action of saponins in animal systems: a

review. British J. of Nutrition. 88(6):587-605. DOI:

10.1079/BJN2002725.

Guo J, Xue C, Duan Jin-ao, Qian D, Tang Y and

You Y. 2011. Anticonvulsant, antidepressant-like

activity of Abelmoschus manihot ethanol extract and its

potential active components in vivo. Phytomedicine:

Intern. J. of Phytotherapy & Phytopharmacology.

18(14):1250-1254.DOI: 10.1016/ j. phymed.

2011.06.012.

Mandey et al., 2014

Figure 5: The phylogenetic tree of gedi leaves based

on ndhF-gen with Kimura-2 model parameter. Data

on the branch are bootstrap maximum likelihood

values


http://oregonstate.edu/dept/Idplants/PlantID-leaves.htm

http://oregonstate.edu/dept/Idplants/PlantID-leaves.htm

http://mc.manuscriptcentral.co./cbps

Harborne JB. 1987. Metode Fitokimia, Penuntun Cara

Modern Menganalisis Tumbuhan.Translater:

Padmawinata K dan I. Sudiro I. Institut Teknologi

Bandung, Bandung.

Jain PS, Bari SB and Surana SJ. 2009. Isolation of

stigmasterol and ý-sitosterol from petroleum ether

extract of woody stem of Abelmoschus manihot.Asian J.

of Biological Sci. 2(4):112-117, from http://

w w w . s c i a l e r t . n e t / q d i r e c t . p h p ? /

doi=ajbs.2009.112.117&linkid=pdf.

Jain PS and Bari SB. 2010. Anti-inflammatory activity

of Abelmoschus manihot extracts. Intern. J.

ofPharmacology. 6 (4):505-509. http://www.scialert.net/

qdirect.php?.doi=ijp. 2010.505.509&linkid=pdf.

Jain PS, Todarwal AA.Bari SB, Sanjay JS. 2011..

Analgesic activity of Abelmoschus manihot extracts.

Intern. J. of Pharmacology. 7(6):716-720.http://

w w w . s c i a l e r t . n e t / f u l l t e x t / ?

doi=ijp.2011.716.720&org=11.

Khatun MH, Rahman MA, Biswas M, Ul Islam MA.

2010. In vitro study of the effects of viscous soluble

dietary fibers of Abelmoschus esculentus L in lowering

intestinal glucose absorption. Bangladesh Pharmaceutical

J., 13(2):35-40.

Prasad K, Janve B, Sharma RK, Prasad KK. 2010.

Compositional characterization of traditional medicinal

plants: Chemo-metric approach. Archives of Applied

Sci. Research. 2(5):1-10.

Preston SR. 1998. Aibika/Bele. Abelmoschus manihot

(L.) Medik. International Plant Genetic Resources

Institute. Rome, Italy.97 pages.

Puel C, Mathey J, Kati-Coulibaly S, Davicco MJ,

Lebecque P, Chanteranne B, Horcajada MN,

Coxam V. 2005. Preventive effect of Abelmoschus

manihot (L.) Medik. on bone loss in the ovariectomised

rats. J. Ethnobotanical. 99(1):55-60.

Sarwar M, Attitallia IH, Abdollahi M. 2011. A review

on the recent advances in pharmacological studies on

medicinal plants; animal studies are done but clinical

studies needs completing. Asian J. of Animal and

Veterinary Advances. 6(8):867-883.

Wang XR, Wang ZQ, Li Y. 1981. Studies on the

chemical constituents of Abelmoschus manihot L. Medic.

Acta Bot. Sin., 23(3):222-227.

Wang XR, Zhou ZH, Du AQ, Huang ZM. 2004.

Studies on the flavonol constituents of

Abelmoschusmanihot L. Medic. Chin. J. Nat. Med.,

2(2):91-93.

Windisch W, Schedle K, Plitzner C, Kroismayr A.

2008. Use of phytogenic products as feed additives for

swine and poultry. J. of Animal Sci.86(14Suppl.):E140-

E148 .ht tp : / / www.jo urna lofanima lsc ience .org/

content/86/14Suppl/E140.

Yang CJ, Yang IY, Oh DH, Bae IH, Cho SG, Kong

IG, Uuganbayar D , Nou IS, Choi KS. 2003. Effect of

green tea by-product on performance and body

composition in broiler chicks. Asian-Australian J. of

Anim. Sci., 16(6):867-872. From http://www.ajas.info/

Editor/manuscript/upload/16_128.pdf.

Mandey et al., 2014



Advantages


[email protected]


http://www.scialert.net/qdirect.php?/doi=ajbs.2009.112.117&linkid=pdf

http://www.scialert.net/qdirect.php?/doi=ajbs.2009.112.117&linkid=pdf

http://www.scialert.net/qdirect.php?.doi=ijp.%202010.505.509&linkid=pdf

http://www.scialert.net/fulltext/?doi=ijp.2011.716.720&org=11

http://www.scialert.net/fulltext/?doi=ijp.2011.716.720&org=11

http://www.journalofanimalscience.org/content/86/14Suppl/E140

http://www.journalofanimalscience.org/content/86/14Suppl/E140

http://www.ajas.info/Editor/manuscript/upload/16_128.pdf

Article Citation: Ekokotu Paterson Adogbaji and Nwachi Oster Francis. The growth performance of Clarias gariepinus fries raised in varying coloured receptacles. Journal of Research in Biology (2014) 4(2): 1287-1292 Jou

rn

al of R

esearch

in

Biology

The growth performance of Clarias gariepinus fries raised in varying

coloured receptacles.

Keywords: Receptacle, growth coloured, cultured, vessel and Clarias gariepinus.

ABSTRACT: This study was conducted to access the effect of various background colors of cultured vessel on growth performance and response in the production of Clarias gariepinus fry. A total of two female (800 g) and one male (1 kg) of test fish was used. During the eight weeks of the experimental period, the C. gariepinus fry were reared in three tanks in duplicates with different background colors (green, blue and white). Body weight and total length of C. gariepinus were recorded for the eight weeks and mean variance of the collected data were analyzed for significant difference. Mean weight and Mean length values were separated using Duncan multiple range test (DMRTS). Background color did not significantly affect the growth performance of C. gariepinus fry. The length and weight of the sample were measured weekly. Data collected were used to determine the specific growth rate. at week one green tank was 0.19 g with a length of 1.02 cm with a survival rate, mean weight and length of 86%, 0.56 g and 4.26 cm, blue tank was 0.14 g with a length of 1.02 cm with a survival rate, mean weight and length of 84%, 0.64 g and 4.38 cm and white tank 0.16 g with a length of 1.02 with a survival rate, mean weight and length of 82%, 0.53 g and 3.38 cm and general hatchability rate 82% respectively. At the final week (8) of the experiment blue tank had the highest weight and length 0.78 g and 5.9 cm respectively while green tank has 0.74 g and 5.2 cm, white tank has the least 0.69 g and 4.4 cm at a significant difference of 0.05.

1287-1292 | JRB | 2014 | Vol 4 | No 2



An International


Authors:

Ekokotu Paterson1

Adogbaji and Nwachi

Oster Francis2.

Institution:

Department of Fisheries,

Delta State University,

Asaba Campus, Nigeria.


Nwachi Oster Francis.

Email Id:

[email protected]



Dates: Received: 29 Nov 2013 Accepted: 17 Dec 2013 Published: 20 May 2014



Original Research

ISSN No: Print: 2231 – 6280; Online: 2231 - 6299

INTRODUCTION

Fresh water fishes have the ability to vary their

growth rate in the present of changing environmental

conditions (Dahle et al., 2000). This suggests that

characteristics pattern of growth exist whose analysis

may provide a better understanding of their adaptation to

the environment. An analysis of this kind must be

accompanied by an appreciation of the fact that growth

pattern may change throughout the life history of the fish

Light acting through photoperiodicity is becoming

accepted as playing a major role in influencing the

timing of seasonal reproductive activating, feeding body

coloration, survival and specific growth rate rather than

other factors such as temperature, pH etc. The African

catfish, Clarias gariepinus is one of the most important

species of the family Clariidae which is commonly

farmed in Nigeria. Clarias gariepinus is a native of

tropical and sub-tropical waters outside its natural range

(Hecht and Appelbaum, 1988). Clarias gariepinus is a

well sort fish for the people of tropical and subtropical

region it has the ability to live and thrive in fresh water

lakes and tropical swamp, it has the ability to take in air

from the atmosphere with a remarkable ability to resist

endemic disease prevailing in the region, its ability to

reproduce in confine water with the aid of insemination

increases the ease in which the fingerlings can be made

available (Van de Nieuwegiessen et al., 2009). Catfishes

also have the unique characteristics of consuming both

plant and animal matter. They can feed on insects

plankton and even snail found in the water, they can also

cannibalize on smaller fishes depending on its ability

hence is known to feed on any available palatable feed.

The reproductive activity of Clarias gariepinus

in its natural environment increases during the period of

heavy rains in West Africa (June and July) again in

October and November produces deeper and more turbid

water which has the effect of reducing illumination

breeding activity. Also due to flooding of the lowland

coastal areas, the fish spread into waters with dense

vegetation which again diminishes light intensity.

Lam and Soh (1995) carried out experiment on

the effect of photoperiod on gonadal maturation in the

rabbit fish Siganus canaliculates and discovered that a

long photoperiod of 18 hours light alternation with

6 hours darkness (18L, 6D), retarded gonadal

development in contrast with the normal photoperiod of

12 hours light and 12 hours darkness (12L, 12D). Thus a

long photoperiod may be used to delay the breeding

season of this fish. Histophysiological studies linking

external factor with gonadal development have been

reported by Hyder (1990) that light intensity are

probably the primary cause of the great intensity of

reproductive activity. According to Lofts (1970) light

can affect the reproductive organs of fishes in terms of

ability to reproduce and the size of the organ it can

course degeneration of the organ on continuous exposure

of gonads. The main purpose of every culturist is to

produce fingerlings that would attract farmers;

experience has shown that farmers sometimes based the

choice of fish seed to be purchased on the colour of the

seed which is mainly influenced by the colour of the

receptacle used in raising the fish. This work is aimed at

examining the effect of different type of colour on the

fries cum fingerlings of Clarias gariepinus.

MATERIAL AND METHODS

This research work was conducted at the wet

laboratory of the Teaching and Research farm of Delta

State University Abraka Asaba campus, between the

months of October and January, 2013. Data was

collected for a period of eight weeks.

Spawning of fish

Spawning refers to the natural procedure the

fishes go through in order to give birth to their fry. The

broodstock used for the spawning was procured from a

well-established farm. After the procurement, the

broodstock was disinfected using saline solution (30 g of

Nacl per 10 liters of water). The sexes were kept

Ekokotu and Nwachi, 2014


separately to avoid indiscriminate spawning, and were

allowed to acclimatize for 24 hours

Broodstock Selection

The male broodstock selected weigh 1.5-2 kg at

the age of 13-15 months, the reproductive organ of the

male extend to the anterior papilla and the fish shows

element of aggressiveness. The female fish selected

weigh 2-2.5 kg at the age of 13-15 months of age, the

female fish has swollen soft stomach, reddish to pinkish

reproductive organ with the ability to release egg on

slight touch.

Administration of Hormone

Reproductive hormone (ovaprim) was injected

intramuscularly above the lateral line just below the

dorsal fin at the rate of 0.5 ml to 1 kg of body weight of

test fish. All the broodstock were returned to solitary

confinement for a latency period of 9 hrs at a room

temperature (25°)

Stripping

The male fish was sacrificed and dissected to get

the milt. After a latency period of nine hours and at a

time egg were freely oozing out on slight touch. The

eggs were stripped into a clean receptacle and care was

taken while stripping to guard the egg and the milt that

not to get contact with water.

Fertilization

Milt solution was prepared by macerating milt

with mortar and pestle, and mixing the extract with

saline solution (0.09% salt). The milt solution was mixed

with the eggs and mechanically shaken for a minute. The

eggs were then spread on the hatching mat

Hatching

Hatching involve breaking the eggs shell and the

releasing of the larvae. Hatchings of the eggs occurred

after a fertilization process of about 26 hours after

incubation. The hatchling has the yolk sac attached to it

for a period of 4 days when they became swim up fry.

They were kept for 10 days in the nursery and fed with

artemia

Experimental design

The already acclimatized fish were counted (200) and

stocked in duplicates in colored receptacles of 100 litres

capacity of color blue, white and green (B1, B2, W1,

W2, G1 and G2). The fishes were fed with artemia for

7 days.



Table 1: Mean variation of weekly Body Weight of

(twenty) Clarias gariepinus species per tank

reared under different colour.

Week Green Blue White

Week 1 0.19±0.00a 0.14±0.00a 0.16±0.00a

Week 2 0.05±0.01a 0.07±0.01a 0.06±0.01a

Week 3 0.06±0.01a 0.07±0.01a 0.11±0.00a

Week 4 1.90±0.00a 1.98±0.00a 2.01±0.01a

Week 5 0.68±0.01b 0.12±0.01a 0.72±0.00a

Week 6 0.68±0.00a 0.67±0.00a 0.50±0.00a

Week 7 0.65±0.00a 0.89±0.01a 0.66±0.00a

Week 8 0.74±0.00a 0.78±0.01a 0.69±0.01a

Mean: Mean ± SE (standard Error of mean)

X = 0.05 (95% level of significant)

Week Green Tank Blue Tank White Tank

Week 1 1.02±0.00a 1.02±0.00a 1.02±0.01a

Week 2 2.00±0.00a 1.82±0.00a 2.44±0.00b

Week 3 1.96±0.00a 1.99±0.01a 1.91±0.01a

Week 4 1.91±0.00a 1.98±0.00a 2.01±0.01a

Week 5 4.50±0.01b 2.40±0.00a 2.57±0.00a

Week 6 5.12±0.00b 4.66±0.00ab 4.30±0.00a

Week 7 5.01±0.00ab 5.14±0.00b 4.55±0.01ab

Week 8 5.280.00b 5.90±0.01b 4.40±0.01a

Table 2: Mean variation of weekly Total Length of

twenty Clarias gariepinus species per tank under

different tank colour

Mean: Mean ± SE (standard Error of mean)

X = 0.05 (95% level of significant)

Fish sampling

The initial mean weight and total length of the

fry were taken using a sensitive analytical balance and

meter rule before commencement of feeding.

Subsequently, weight and total length of experimental

fishes were observed at weekly basis throughout the

culture period of two weeks.

Weight determination

Samples to be weighed were randomly removed

from each experimental bowls and kept alive in a small

plastic bowl and weighed collectively on weighing days,

fish were not fed until the whole exercise was completed.

After measurements, the fish were put in fresh water and

then returned to the rearing bowls while subsequent

weighing were done individually and mean weight gain

were determined.

Where:

Wf = final mean weight gain (mg)

W1 = initial mean weight gain (mg)

d = nursing period in days.

Specific Growth Rate.

The logarithm of difference in final and initial

mean weights test fish was determined by:

Where;

W2 = Final weight of fry

W1 = Initial weight of fry

T2 = Final time

T1 = Initial time

Survival rate

At the end of each trial (14 days), all the survived

fish were harvested totally, counted and divided by the

total number stocked.

Determination of water quality parameters.

Water quality data collected during the study

include temperature, dissolved oxygen (DO) hydrogen

concentration (pH) and other physiochemical

requirement were monitored and stabilized. These were

observed routinely, Water temperature was maintained at

28 – 30°C, pH at 7.5 – 7.8 and dissolved oxygen (DO) at

7.5 – 8.8 mg\l.

Statistical Analysis

One-way ANOVA was used to compute

collected data while Duncan Multiple Range Test

(DMRT) was used to separate the mean the at 5% level

of significance.

A total of twenty fish was sample from the

culture tank on a weekly basis.

The effect of fish environment is important in

fish culture fish react positively or negatively to its the

natural habitats of fish may negatively affect fish also on

fish response under the effect of acute or feeding

activity, health, welfare and growth. (Papoutsoglou et al.,

2000, and Green and Baker et al., 1991) The effect of

this stressors may affect the performance of the fish.

According Strand et al., (2007). Fishes maintained in the

blue tanks shows a positive increase in both size and

weight this opinion was expressed by Sumner and


Treatment Initial weight (g) Final weight (g) Survival rate (%) Mean weight (g)

Green (T1) 0.19 0.74 86 0.56

Blue (T2) 0.14 0.78 84 0.64

White (T3) 0.16 0.69 82 0.53

Table 3: Mean Weight

W1—Wf

Weight gain (WG) =

d

LogW2/T2 - Log W1

SGR =

T1.100

No of fish harvested

Percentage survival =

No of fish stocked. 100


Doudoroff (1938). In the present study, no contrast was

observed as there was no specific significant disparities

in the growth reaction to background colour.

Performance was observed for three colors and the

mean growth rate of fish in the three treatment was

obtained as 0.78 ± 0.01 (g) for blue tank, 0.74 (g) ± 0.0

for Green tank and 0.69 ± 0.01 for white tank. (Table-1).

This finding was similar to the study of Martinez

and Purser, (2007). In clear, white, green tanks expressed

no Support for the latter metabolic effect of background

color differences in growth performance of fry Clarias

gariepinus, as the length of fish ranges from 4.00 to

7.50 cm for blue tank, 4.00 to 6.50 cm for Green tank

and 2.80 to 6.50 cm for White tank. (Table-2).

The hatchability rate was uniform for the three

colure tanks due to the fact that the incubator was in one

receptacle the hatching rate of 82% (Table-4) was

observed for the three tanks but there was significance

difference in the survival rate of fish across the three

tank as 86% was observed in green tank and 84% rate

was observed in Blue tank and 82% rate in white Tank.

(Table-3). The high survival rate of Clarias gariepinus

fry could be due to proper water management during the

period of study.

REFERENCES

Dahle R, Taranger GL and Norberg B. 2000. Sexual

maturation and Growth of Atlantic cod (Gadus morhua

L) reared at different light intensities. In Norberg B;

Kjesbu OS; Taranger GL; Anderson E; Stefansson SO.

(Eds)(2000) proceeding of the sixth International

Symposium on the Reproductive Physiology of Fish.

Institute of Marine Research and University of Bergen.

Norway, July 4-9 1999. P 336.

Green JA and Baker BI. 1991. The influence of

repeated stress on the release of melanin-concentrating

hormone in the rainbow trout. J Endocrinol., 128(2):

261-266.

Hecht T and Appelbaum S. 1988. Observations on

intra-specific aggression and coeval sibling cannibalism

by larval and juvenile Clarias gariepinus (Clariidae

pisces) under controlled conditions. Journal of zoology.

214(1): 21-44.

Hyder M. 1990. Endocrine regulation of reproduction

in Tilapia. Gen comp: Endocine 3(Supplement):729-740.

Lam TJ and Soh CL. 1995. Effect of photoperiod on

gonadal maturation in the rabbit fish. Signanus

canaliculatus, park 1797. aquaculture. 5 (4): 407-4 10.

Lofts B. 1970. Animal photoperiodism; Edward Arnold

publishers limited p. 62

Martinez-Cardenas L and Purser GJ. 2007. Effect of

tank colour on Artemia ingestion, growth and survival in

cultured early juvenile pot-bellied seahorses

(Hippocampus abdominalis). Aquaculture. 264(1-4):

92-100.

Papoutsoglou SE, Mylonakis G, Miliou H,

KaraKatsouli NP and Chadio S. 2000. Effects of

background color on growth performances and

physiological responses of scaled carp (Cyprinus carpio

L.) reared in a closed circulated system. Aquacult. Eng.


Treatment Initial length (g) Final length (g) Hatchability (%) Mean lenght (g)

Green (T1) 1.02 5.3 82 4.26

Blue (T2) 1.02 5.4 82 4.38

White (T3) 1.02 4.4 82 3.38

Table 4: Mean Length


22(4): 309-318.

Strand A, Alanara A, Staffan F and Magnhagen C.

2007. Effects of tank colour and light intensity on feed

intake, growth rate and energy expenditure of juvenile

Eurasian perch, Perca fluviatilis L. Aquaculture.

272(1-4): 312-318.

Sumner FB and Doudoroff P. 1938. The effects of light

and dark backgrounds upon the incidence of a seemingly

infectious disease in fishes. Proceedings of National

Academy of Science of the United States of America. 24

(10): 463-466.

Van de Nieuwegiessen PG, Olwo J, Khong S, Verreth

JAJ and Schrama JW. 2009. Effects of age and

stocking density on the welfare of African catfish

Clarias gariepinus. Burchell aquaculture. 288(1-2):69-

75.



Advantages


[email protected]



Article Citation: Purushottam Lal, Sher Mohammed and Pawan K. Kasera. High adaptability of Blepharis sindica T. Anders seeds towards moisture scarcity: A possible reason for the vulnerability of this medicinal plant from the Indian Thar desert Journal of Research in Biology (2014) 4(2): 1293-1300 Jou

rn

al of R

esearch

in

Biology

High adaptability of Blepharis sindica T. Anders seeds towards moisture scarcity: A

possible reason for the vulnerability of this medicinal plant from the

Indian Thar desert

Keywords: Thar desert, medicinal plant, vulnerable, hygroscopic hairs, moisture, seedling collapse.

ABSTRACT: The seeds of Blepharis sindica T. Anders (Acanthaceae) are the official part of the plant for its medicinal values and also as the promise of its future. Dunes of the Thar desert with high percolation capabilities are the most preferred habitat of this vulnerable medicinal plant. It produces 1337.26 seeds/plant as an average and shows high viability and germination percentage under in-vitro conditions, but efficiency of seedling establishment was observed poor at natural sites. Occurrence of seed coat layers as sheath of hygroscopic hairs is a sign of its extreme capabilities to initiate life under lesser soil moisture availabilities in desert. Seeds with 0.5 to 1.0 ml distilled water were observed most suitable for the production of maximum shoot and root lengths under controlled conditions. Maximum biomass of shoot and root modules were observed in 0.5 ml distilled water. Maximum amount of non-soluble sugar was found in intact seeds devoid of any imbibition. Seeds with 0.5 ml distilled water produced maximum amount of shoot biomass and soluble sugar, while seedlings with 1.0 ml had maximum root biomass. Seedlings treated with >1.5 ml of distilled water showed a decreasing trend in all parameters. Excessive water always found to cause seedling collapse and failure of its establishment.

1293-1300 | JRB | 2014 | Vol 4 | No 2



An International


Authors:

Purushottam Lal1,

Sher Mohammed2* and

Pawan K. Kasera3.

Institution:

1,2. Department of Botany,

Government Lohia PG

College, Churu-331001,

Rajasthan, India.

3. Department of Botany,

J.N.V. University, Jodhpur-

342 033, Rajasthan, India.


Sher Mohammed.

Email Id:



Dates: Received: 02 Jan 2014 Accepted: 04 Feb 2014 Published: 22 May 2014



Original Research


INTRODUCTION:

Indian Thar desert is characterised by scanty

rainfall and long dry periods throughout the year, which

pushes the typical scrub vegetation to firm adopt specific

life sustaining adaptabilities (Sen, 1982). In desert

ecosystems, long dry periods and scanty rainfall impose

severe water deficit in natural vegetation (Sen, 1982;

Raghav and Kasera, 2012). Biodiversity of desert areas is

a better reflection of highly synchronised life patterns of

living beings against the environmental entities which

always restrict the life to express beyond their biotic

potentials. The Indian Thar desert has a unique

vegetation cover as compared to other deserts around the

world. Besides harsh climatic conditions and much

constrains on growth potentials, the plant species of arid

zone synthesise and accumulate a variety of bioactive

compounds which have different values to serve

mankind. Due to their medicinal as well as economic

importance, the medicinal plants and their different parts

are being exploited largely from natural habitats. Habitat

destruction, unscientific collection, ecological

limitations, etc. are crucial factors to push valuable

medicinal plants under verge of extinction. UNDP

(2010) have published Red List Categories for 39

medicinal plants of Rajasthan State, of which Blepharis

sindica is considered as “Vulnerable”. Thus, it is quite

important to know its adaptability to conserve in natural

habitat.

B. sindica is a lignified annual plant with

characteristically dichotomously branching habit. It is

locally known as Billi khojio, Bhangara and Unt-katalo

(Bhandari, 1990). It grows on loose soils, along the crop

fencings and much especially on dune slopes. Sandy soil

with heavy percolation is much preferred by this plant.

After a successful completion of life cycle (July to

December), capsules loaded spikes remain attached to

the dried plant and provide a special distinguishable

appearance to the species. Seeds within capsules remain

open to face the extreme of winter and summer

temperatures till their first imbibition. Habitat limitation

plays an excellent role for this species as sand shifting

and eolian deposition cause to bury the spikes which

trigger microbial decomposition of lignified bracts. The

plant emerge through seeds after first rain as soon as fruit

wall split explosively from distal tapered end and release

seeds to imbibe (Fig. 1).

Compressed seeds with densely clothed

hygroscopic hairs are used in the preparation of herbal

medicines and it is used as aphrodisiac (Shekhawat,

1986; Singh et al., 1996; Mathur, 2012). Its roots are

used for urinary discharge and dysmenorrhoea.

Powdered plant is applied locally on the infections of

genitals and on the burns (Khare, 2007). Seeds contain

flavonoides (apigenin, blepharin, prunine-6″-O-

coumarate, and terniflorin), steroid (β-sitosterol) and

triterpinoide-oleanolic acid (Ahmad et al., 1984).

Lal et al., 2014


a b c d

Fig. 1: Blepharis sindica: One-year-old plant after first rains, showing spreading of seeds to initiate

germination (a), freshly fallen seed after moisture uptake by hygroscopic hairs at sandy surface of

dune (b), single young seedling (c), and seedlings in association (d).

Hence in the present study, an attempt has been

made to identify a correlation between availed moisture

and seedling establishment in B. sindica germplasm

collected from different localities of the Churu district, a

part of Indian Thar desert.

MATERIALS AND METHODS:

The germplasm of this species was collected

during 2011-2012 from two different sites, viz.,

Shyampura village (Site-I; 12 km away towards west-

south direction from the College Campus) and Buntia

village (Site-II; 10 km towards north-east), a part of the

Indian Thar desert. The seed size was measured with the

help of vernier caliper and graph paper. Seed volume and

density estimations were based on water displacement

method (Misra, 1968). Values were calculated for 100

seeds in triplicate and confirmed twice. Arithmetic mean

and standard deviation were computed for each

parameter. Seed viability was tested by T.T.C. method

(Porter et al., 1947). The seed germination experiments

were performed in seed germinator at 28°C. Seeds were

placed in the sterilized petri dishes lined with single layer

of filter paper to evaluate germination behaviour. To

evaluate moisture response, the filter paper in each

experiment was moistened with 0.5, 1.0, 1.5, 2.0, 5.0 and

10.0 ml volume of distilled water separately. Each petri

dish containing 10 seeds in triplicate was used and

experiment was repeated for two times for the

confirmation of results. After one week of setting the

experiments, germination percentage (%) and root &

shoot lengths of seedlings were measured with the help

of a graph paper. Shoot and root biomass values of

seedlings against different moisture regimes were

estimated by oven-dried weight basis. Amount of sugars

in seedlings after varied doses of distilled water was

estimated by using anthrone reagent method (Plummer,

1971). Differences in biomass & sugar contents of

seedlings from various moisture regimes were compared

with the values for intact seeds and measured in

percentage basis. The relation between total biomass %

and total sugars % in comparison to intact seeds were

expressed as metabolic efficiencies of seedlings at

particular moisture regime. The pooled data of entire

season were analyzed statistically as per the methods of

Gomez and Gomez (1984), presented in tabular and

figure forms.

RESULTS:

The data on various morphological parameters,

viz. weight, size, volume, density and viability of seeds

collected from different sites are given in Table 1.

Morphological variations provide understanding about

germplasm variability, which is an important adaptation

skill of desert plants. Seed length and density values

were observed higher at site-I, whereas other parameters

at site-II.

Morphological parameters revealed that higher

(5.73 x 4.13 x 0.10 mm) values of seed size were

observed at site-II, while lower (5.75 x 4.11 x 0.07 mm)

at site-I. Weight of 100 seeds was greater (1.33 g) at site-

II than site-I (1.16 g). Volume of 100 seeds was more

(1.57 ml) at site-II, whereas less (1.13 ml) at site-I.

Lal et al., 2014


Table 1. Variation in morphological parameters of B. sindica seeds collected from sites- I & II.

Parameters

Sites

Weight of

100 seeds (g)

Seed size (mm) Volume of

100 seeds

(ml)

Density (g ml-1)

Viability (%) Length Breadth Thickness

I 1.16±0.015 5.75±0.010 4.11±0.006 0.07±0.0004 1.13±0.028 1.02±0.057 100.00±0.00

II 1.33±0.022 5.73±0.010 4.13±0.006 0.10±0.0004 1.57±0.028 0.85±0.021 100.00±0.00

± = Standard deviation

Freshly collected seeds from both sites exhibited cent

percent viability.

To evaluate the significance of moisture regimes

on germination process, 0.5 ml to 10.0 ml range of

distilled water was provided to seeds. Under controlled

laboratory conditions, cent percent germination was

observed in 0.5, 1.0, 1.5 and 2.0 ml moisture regimes for

both sites. 5.0 and 10.0 ml moisture regimes caused

deterioration for seed germination.

Shoot length parameter was found to have

increasing trend from 0.5 ml to 2.0 ml range, afterwards

it gets decreased (Table 2). Maximum shoot length

(10.47 mm) was observed at 2.0 ml moisture for site-II,

while at 0.5 ml moisture slight expansion in cotyledons

was occured without shoot development for both sites.

Higher values of root length were observed at 1.0 ml

moisture for both sites, being maximum (61.97 mm) for

site-I.

At 0.5 ml level, only radicle emerged out

without any shoot elongation; whereas at 5.0 & 10.0 ml

levels shoot and root axies collapsed after a short growth

(Fig. 2). The expression of comparative relation between

shoot and root lengths as R/S ratio was found significant

at 1.0, 1.5 & 2.0 ml regimes. It was observed maximum

(45.23) at 1.0 ml moisture for both sites, while minimum

(0.82) at 10.0 ml for site-I. Seedlings from site-I showed

a rapid decline in R/S ratio along with increasing

moisture levels as compared to site-II.

Anabolic efficacy of germinating seeds was

measured in the form of over-dried biomass of seedlings.

Shoot biomass was found more as compared to root

ones. Maximum (0.28 g d. wt.) shoot biomass was

estimated at 0.5 ml moisture for site-II, while minimum

(0.09 g d. wt.) at 10.0 ml for site-II. Maximum extension

of root axis was observed at 1.0 ml levels, while

maximum (0.05 g d. wt.) root biomass were found at 1.0,

1.5 & 2.0 ml levels for site-II. Total biomass was

increased after seeds were permitted to imbibing and

found maximum (0.31 g d. wt.) with 0.5 ml and 1.0 ml

moisture for site-II. Total biomass values exhibited

declining trend along with increasing moisture regimes

(Fig. 3).

Lal et al., 2014


Table 2. Effect of different amount of distilled water on seed germination (%), seedling growth (mm), seedling biomass

(g) and sugar contents (mg g-1 d. wt.) during seedling establishment in B. sindica seeds under laboratory conditions at

sites- I & II (Observations taken after 7 days).

Site-I

Amount of distilled water provided (moisture regime)

CD Seed 0.5 ml 1.0 ml 1.5 ml 2.0 ml 5.0 ml 10.0 ml

Germination - 100.00 100.00 100.00 100.00 36.67 6.67 1.4684 ns

Shoot length - 0.00 1.37 4.60 8.20 2.53 1.67 0.1457ns

Root length - 8.73 61.97 44.53 50.73 5.90 1.37 0.7204*

R/S ratio - # 45.23 9.68 6.19 2.33 0.82 1.3604ns

Shoot biomass - 0.26 0.23 0.23 0.22 0.13 0.11 0.0071ns

Root biomass - 0.02 0.04 0.04 0.04 0.01 0.01 0.0021ns

Total biomass 0.12 0.28 0.27 0.27 0.26 0.14 0.12 0.0047ns

Soluble sugar 28.87 29.12 28.87 28.25 27.08 18.61 5.62 0.6669*

Non-soluble sugar 2.34 1.91 1.92 1.78 1.91 1.59 1.21 0.1132*

Site-II

Germination - 100.00 100.00 100.00 100.00 50.00 50.00 1.5604ns

Shoot length - 0.00 1.50 8.77 10.47 7.53 6.27 0.0092ns

Root length - 13.77 51.03 50.93 46.60 11.63 8.60 0.4439 ns

R/S ratio - # 34.02 5.81 4.45 1.54 1.37 1.2667ns

Shoot biomass - 0.28 0.26 0.25 0.25 0.17 0.09 0.0054ns

Root biomass - 0.03 0.05 0.05 0.05 0.02 0.01 0.0026ns

Total biomass 0.13 0.31 0.31 0.30 0.30 0.19 0.10 0.0065ns

Soluble sugar 29.12 29.75 29.27 28.42 26.42 17.87 7.87 0.1553ns

Non-soluble sugar 2.41 2.03 2.02 1.81 2.06 1.81 1.38 0.1307ns

- = Values are not applicable, # = Values are infinitive, *= Significant at (P < 0.05) level, and ns = non-significant

Amounts of soluble and non-soluble sugars were

estimated in oven-dried seedlings obtained after response

of varied moisture regimes. Soluble sugar was maximum

(29.75 mg g-1 d. wt.) at 0.5 ml moisture level for site-II,

while minimum (5.62 mg g-1 d. wt.) at 10.0 ml for site-I.

Amount of non-soluble sugar was more in intact seeds as

compared to seedlings. Its maximum (2.41 mg g-1 d. wt.)

value was estimated in seeds from site-II. Seedlings with

10.0 ml moisture exhibited minimum values for site-I. In

this species, intact seeds were found to have maximum

amount of total sugars (soluble & non-soluble) and

showed a decreasing trend with increasing moisture

regime. On using intact seeds as reference, the total

sugars loss occurred on different moisture regimes are

expressed on percentage basis (Fig. 3). As compared to

site-I, seedlings from site-II exhibited more sugar loss

percentage at all moisture regimes, except in 10.0 ml.

Maximum (78.12 %) sugar loss was occurred at 0.5 ml

moisture for site-II, whereas minimum (0.58 %) at 10.0

ml for site-I. Production of total biomass (g d. wt.) in

relation to total sugars loss (% mg g-1 d. wt.) can be used

to express the metabolic efficiency (% d. wt. / % mg g-1

d. wt.) of seedling establishment (Fig. 4). Highest (229)

value for metabolic efficiency of germinating seeds were

observed at 0.5 ml moisture level for site-I, whereas

minimum (-0.32) at 10.0 ml for site-II. A decline in

metabolic efficiency was observed on increasing

moisture regimes during seed germination. Metabolic

fluctuations (percentage sugar loss & percentage biomass

growth in comparison to intact seeds) and metabolic

efficiency values against various moisture regimes were

found non-significant (P > 0.05) for both sites.

DISCUSSION:

Seed germination is a crucial step of life cycle in

higher plants as it determines the future of the species as

well as it offers the availability of plant resources for all

living beings. Most of arid plants produce seeds with

hard seed coats that enable the species to cope drought

constrains (Sen et al., 1988). In this species, seeds

completely lacking of hard coverings and embryos found

directly encapsulated within hygroscopic membrane

which further extends in hygroscopic hairs. The seeds

collected from both sites showed morphological

variability, which influenced the response of seeds

against different moisture regimes during in-vitro

germination. Freshly collected seeds exhibited cent

percent viability without any dormancy barrier.

Germplasm tolerance against extreme aridity of

the area is solely paid by its hard capsule (fruit)

coverings whereas the hygroscopic sheath (seed coat

layer) has the most prominent contribution for rapid

uptake of soil moisture and subsequent imbibitions. The

present investigation reveals that this part,

Lal et al., 2014


Fig.2: In-vitro seedlings of B. sindica after 07 days response against varied amount of moisture

regimes (0.5 to 10.0 ml distilled water per petridish) from site-I (a) and site-II (b). Fully expand

hygroscopic hairs at 0.5 & 1.0 ml and collapsed seedlings at 5.0 & 10.0 ml.

i.e. hygroscopic sheath has some short of limitations in

sense of its carrying capacity of soil moisture contents.

Field study of the area revealed that in spite of

having cent percent viability and germination percentage,

a limited number of seedlings develop in-vivo at its

preferred sand dune surfaces during early monsoon

period. Observations are in the record that mucilaginous

sheathing on seeds and its other parts which provide

adequate water, leds to improved germination in Cactus

(Bregman and Graven, 1997; Gorai et al., 2014).

Excessive moisture was found to inhibit seed

germination in B. sindica, as observed by Mathur (2012)

but the present investigations point out that at particular

stage of early seed germination physiology, water

amount works as a master factor but interestingly it is

positive for a very short range, i.e. 0.5 to 1.0 ml. The

amount of first rain fall over detached seeds and the rate

by which rain water get percolated through inter-particle

spaces, which determine the value of availed moisture

for seeds to imbibe. For better understanding the role of

moisture amount in seed germination process; this

unique experiment was designed and the results illustrate

the comparative effect of different levels of moisture in

sense of seedling growth, biomass production,

consumption rate of reserve food contents and

comparative efficiency of seedling establishment.

Higher values of seedling length and biomass

production (shoot & root modules) were observed in 0.5

to 2.0 ml moisture regimes. Seed germination percentage

as well as seedling vigour (length & biomass) values

showed a clear decline on excessive moisture contents

(5.0 & 10.0 ml). The values for biomass growth (%) in

comparison to dry weight of intact seeds were found

highest at minimum moisture level, i.e. 0.5 ml. Amount

of soluble sugars, a part of nourishment ready to

consume during germinating seedlings; also estimated

maximum at 0.5 ml moisture level. Metabolic efficiency

of germinating seeds (dry weight increase per unit

reserve food loss) was also estimated highest at

minimum moisture regimes, while its negative value was

estimated at highest regimes of the performed

experiment.

CONCLUSIONS:

Seeds of B. sindica are highly adjusted structures

toward moisture limitations in arid habitat. The seeds

exhibited absolute requirement of 0.5 ml moisture level

Lal et al., 2014


a

b

Fig. 3: Total sugar loss (a) and total biomass growth

(b) in seedlings against varied amount of moisture

regimes as compared to intact seeds for sites- I & II.

Fig. 4: Metabolic efficiency of germinating seeds under

varied amount of availed moisture levels (% d. wt.

total biomass / % total sugar loss) from sites- I & II

(Data are average of three replicates).

for the better establishment of in-vitro seedlings.

Primarily, the species has high biotic potential (1337.26

seeds / plant with 100 percent viability and germination

efficiencies) and secondly the species has absolutely free

from any type of grazing & fruit collection pressures. In

spite of this, the number of well established seedlings

and consequent mature plants were found restricted at

both sites. This condition marks a clear threat at the point

when its life moulds from seed to seedling phase.

Metabolic diagnosis of germinating seeds, i.e. total sugar

loss (%), total biomass growth (%) and the rate of

metabolic efficiency (% d. wt. total biomass /% total

sugars loss) provides ample insight into compensation

efficacy of germinating seeds against a particular

moisture level. Seedling collapsing at 5.0 & 10.0 ml

regimes indicates the seed tissue incompatibility at

excessive moisture regimes. Our results could make an

excellent way to define this natural problem with this

species and assessment of threat in the arid habitats of

Indian desert. The entire cascade of this pioneer work

justifies the esteem love of B. sindica seeds with that of

Thar desert aridity. Such type of findings may also be

helpful for conservation strategies related to different

plant species of the area.

ACKNOWLEDGEMENTS:

Financial assistance received from CSIR, New

Delhi in the form of SRF-NET (File No.: 08/544

(0001)/2009-EMR-I, 27.06.2009) to first author is

gratefully acknowledged. Thanks are due to the

Principal, Govt. Lohia PG College, Churu for providing

necessary facilities. The authors are also thankful to Dr.

David N. Sen (Retd. Professor & Head), Department of

Botany, J.N.V. University, Jodhpur for valuable

suggestions in improvement of this paper.

REFERENCES:

Ahmad VU, Burki AM, Mahmood I and Smith DL.

1984. Chemical constituents of Blepharis sindica seeds.

Chem. Soc. Pak., 6(4): 217-223.

Bhandari MM. 1990. Flora of the Indian Desert. MPS

REPROS, Jodhpur, p. 435.

Bregman R and Graven P. 1997. Subcuticular secretion

by cactus seeds improves germination by means of rapid

uptake and distribution of water. Annals of Botany. 80

(4): 525-531.

Gomez KA and Gomez AA. 1984. Statistical

Procedures for Agricultural Research, 2nd ed. John Wiley

& Sons, New York, p. 294.

Gorai M, El Aloui W, Yang X and Neffati M. 2014.

Toward understanding the ecological role of mucilage in

seed germination of desert shrub Henophyton deserti:

interactive effects of temperature, salinity and osmotic

stress. Plant Soil 374 (1-2): 727-738.

Khare CP. 2007. Indian Medicinal Plants - An

Illustrated Dictionary. Springer-Verlag, Berlin, New

York, USA, p. 812.

Mathur M. 2012. Phytosterol composition in seeds of

Blepharis sindica and its relation with bottom up, top

down and plant metabolites factors. Medicinal plants -

International Journal of Phytomedicines and Related

Industries 4(3): 126-132.

Mathur M and Sundaramoorthy S. 2012. Studies on

distribution patterns for an endangered semi-arid plant-

Blepharis sindica. Vegetos 25(2): 66-75.

Misra R. 1968. Ecology Work Book. IBH Publishing

Company, Oxford, New Delhi, p. 242.

Plummer DT. 1971. An Introduction to Practical

Biochemistry. Tata McGraw Hill Publishing Co Ltd,

New Delhi, p. 369.

Porter RH, Durrell M and Romm HJ. 1947. The use

of 2, 3, 5-triphenyl tetrazolium chloride as a measure of

seed germinability. Plant Physiol., 22(2): 149-159.

Lal et al., 2014


Raghav A and Kasera PK. 2012. Seed germination

behaviour of Asparagus racemosus (Shatavari) under in-

vivo and in-vitro conditions. Asian Journal of Plant

Science & Research. 2 (4): 409-413.

Sen DN. 1982. Environment and Plant Life in Indian

Desert. Geobios International, Jodhpur, p. 249.

Sen DN, Mohammed S and Kasera PK. 1988. Report

on weed seed longevity in arid zone-Test of seed bank.

Geobios new Reports. 7: 98-100.

Shekhawat GS. 1986. Ethnobotanical survey of desert

area of Rajasthan. Ph D Thesis, University of Jodhpur,

Jodhpur, India.

Singh U, Wadhwani AM and Johri BM. 1996.

Dictionary of Economic Plants in India. ICAR, New

Delhi, p. 288.

UNDP 2010. Rajasthan Red Listed Medicinal Plants,

http://envis.frlht.org/documents/rajasthan-medicinal-

plants-conservation.pdf


Advantages


[email protected]



Lal et al., 2014

Guidelines for Authors

The article should be addressed to "The Editor".

Submission of an article implies that it has never been published in any other journals and if accepted, it will not be published

elsewhere.

All papers are first reviewed by the editor. Papers found lacking will not be considered. Others will be sent for a detailed peer-review

process.

Journal Manuscript Format

The manuscript should be typed in “Times new Roman” font with font size 11 and 1.5 line spacing. The page size should be strictly A4. All images should be in JPEG format. The article is to be submitted should accompany a covering letter with name and complete address

(including Telephone Number and e-mail ID) of the author/s. The completed article should be sent to [email protected]

Title

The title should briefly identify the subject and indicate the purpose of the document. The title should supply enough information for the reader to make a reliable decision on probable interest. Do not use all caps; instead use caps only at the first word of the title and/or at

scientific names, abbreviations etc., Center the authors' initials and last names directly below the title.

Abstract

The abstract should include a hypothesis or rationale for the work, a brief description of the methods, a summary of the results, and a conclusion: The abstract should be less than 250 words. Do not include literature citations or references to tables, figures or equations.

Keywords

A short list of keywords or phrases should be included immediately after the abstract as index words. Choose keywords that reflect the content of your article. Note that words in the title are not searchable as keywords unless they are also included in the keyword list.

Body of the Article

The introductory section of the text should include a brief statement of why the research was conducted. It should also define the

problem and present objectives along with a plan of development of the subject matter. The introductory section also usually includes a brief

survey of the relevant literature on the topic.

Materials and Methods

Provide sufficient detail so that the work may be repeated. Do not give details of methods described in readily available sources.

Instead, refer to the source and describe any modification. Figures that illustrate test apparatus and tables of treatment parameters or equipment specifications are appropriate here.

Results and Discussion

This section describes the solution to the problem stated in the introductory section. Use figures and tables to visually supplement the

presentation of your results. The text must refer explicitly to all visuals, and you must interpret the visual elements to emphasize the evidence on which your conclusions are based. Do not omit important negative results.

In addition, relate your findings to previous findings by identifying how and why there are differences and where there is agreement. Speculation

is encouraged, but it must be identified.

Conclusion

This is a summary of your results. In this section, state any conclusions that can be drawn from your data. You may also include

suggestions for future research. The conclusion may be a subsection of the Results and Discussion section, or it may be a separate section. Data

or statements cited in your conclusion must have been stated previously in the article. Do not introduce new information in the conclusion.

Acknowledgement

Acknowledgements are optional. Use them to thank individuals or organizations that provided assistance in materials, expertise, or

financing. The acknowledgements will appear at the end of the text and should be limited to one or two sentences.

References

All sources cited in the text must be listed in the References, and all documents listed in the References must be cited in the text. Accuracy of citation is the author's responsibility.

mailto:[email protected]

Reference Style

References should be cited in the text in the form (Author et al, 1987) and listed in alphabetical order at the end of the article as follows:

Schernewski G, Neumann T. The trophic state of the Baltic Sea a century ago: a model simulation study. J Mar Sys., 2005;53:109–124.

Kaufman PD, Cseke LJ, Warber S, Duke JA and Brielman HL. Natural Products from plants. CRC press, Bocaralon, Florida. 1999; 15-16.

Kala CP. Ecology and Conservation of alphine meadows in the valley of flowers national park, Garhwal Himalaya. Ph.D Thesis, Dehradun: Forest Research Institute, 1998; 75-76.

http://www.ethnobiomed.com/content/pdf/1746-4269-1-11.pdf.

Appendix

Use an appendix for material that is too long to include in the text of the article.

Manuscript Charges

Journal of Research in Biology is an International Research Journal. This Journal provides immediate access to all published full-text

articles to interested readers from all around the world. The availability of the author’s paper makes the scientific community to understand and develop an impact in the concerned research field. It also increases the chance of more citations of the published work, which in turn can be

translated into more recognition of research. This journal also accelerates research and knowledge building worldwide.

Publishing an article in Journal of Research in Biology requires payment of the manuscript processing charges, once the manuscript is

accepted for publication. The payment is to be made by one of the authors, their university/organization, or funding entity. The manuscript

processing charges are fixed so as to allow publishers to recover manuscript processing expenses and the cost of making the full-text available on the Internet to all interested researchers.

For Indians

The charges for submission of a Research article is Rs 2100, up to 8 pages and for more pages, each page costs Rs 250.

For Foreign nationals

The charges for submission of a Research article is USD 100, up to 8 pages and for more pages, each page costs 15 USD.

Copyright

Authors who publish in Journal of Research in Biology retain the copyright of their work which allows the unrestricted use,

distribution, and reproduction of an article in any medium, provided that the original work is properly cited.

If you have any queries kindly contact us at [email protected]

mailto:[email protected]

journal of research in biology volume 4 issue 2

Documents

ujire dakshina kannada

mycorrhizal spore population

mycorrhizal spore count

paper mill effluents

kisan pg college

lip pearl oyster

editorial board members

plant tissue culture