jr. genius gr 11 chemistry university prep

8/10/2019 Jr. Genius Gr 11 Chemistry University Prep

http://slidepdf.com/reader/full/jr-genius-gr-11-chemistry-university-prep 1/36

JR. GENIUS EDUCATIONAL SERVICES INC.

Mock ExamChemistry Gr 11 University Prep Final Exam

Duration – 3 hours

Non-Programmable calculator allowed

Answer all questions on the question paperUse blank side of the sheets for rough work, if needed.

Name: Date :

Part A: Multiple choice 43 marks

Part B: Short Answer 26 marks Part C: Lab Questions 20 marks Part D: Problem Solving 39 marks Total 128 marks

Good Luck!

1-866-9-Way To A JRGenius.com Chemistry Gr 11 University Prep Final Exam 1




Part A: Multiple choice (43 marks)

1. A white solid which has a sharp constant melting point is decomposed by electrolysis to give a greenish gaswhich has a silvery solid. Attempts to decompose these two products were unsuccessful. The silvery solid andgreenish gas are:

a) Elements from a compound b) The components of a homogeneous mixturec) Elements from a homogeneous mixtured) Elements from a heterogeneous mixturee) Indestructible compounds

2. A scientific model is:

a) Never altered b) Alte red to fit new obs ervat ionsc) A set of scientific lawsd) Altered to produce new lawse) An important experiment

3. How many significant digits are there in the number 0.002060?

a) 6 b) 2c) 3d) 4

4. Which one of the following represents a quantitative observation?

a) The reactant was orange in colour b) The product was very densec) The orange colour disappearedd) The temperature reached 250° C

5. Which of the following statements about oxygen best describes physical properties of oxygen:

I. oxygen has density of 1.43 g/L at STPII. oxygen supports the burning of magnesiumIII. the melting point of oxygen is about -218° CIV. oxygen reacts with iron to form rustV. oxygen supports oxidation with many metals

a) I only b) I and IIIc) I, II and IIId) II, IV and V

6. An Ontario sample of the compound NaCl is found to contain 39.3% sodium and 60.7% chlorine by mass. Asample of NaCl in Florida, at an altitude of 3000 m is found to contain:

a) 19.7% sodium and 80.3% chlorine b) 39.3% sodium and 60.7% c hlorinec) 30.5% sodium and 69.5% chlorined) 50% sodium and 50% chlorinee) cannot tell, depends on the air pressure

7. Fluorine, chlorine, bromine, etc. are very reactive gases and liquids. They are usually called the ________elements:

a) Alkaline earth b) Alkal ic) Halogend) Noble gas

8. Which sub-atomic particles are involved in bond forming and bond breaking:

a) Electrons and protons




JR. GENIUS EDUCATIONAL SERVICES INC. b) Elec trons and nucleonsc) Protons onlyd) Electrons onlye) Protons and neutrons

9. Ionic bonds forms when:

a) Atoms tend to equally share the electrons b) Atoms t end to unequally share the e lect ronsc) Atoms tend to gain opposite chargesd) Atoms tend to attract to each other due to their nucleus

10. Which of the following has PURE covalent bonding?

a) HCl b) NO 2 c) Cl 2 d) MgF 2 e) CH 4

11. Iso-electronic means having the same number of electrons. Which of the following is isoelectronic with the noblegas elements?

a) F –2

b) S – c) Al 2+ d) Ca 2+ e) N –2

12. A certain element combines with hydrogen in a one to one atomic ratio, is a solid at room temperature, reactsvigorously with water and has the third smallest atomic ratio in its family on the Periodic Table. The element is:

a) F b) Frc) Nad) Pe) As

13. The following table sets out information about some common substances.

Substance Melting Point(C)

Electrical SOLID Conductivity LIQUID Solution in Water

Xylene -25 Poor Poor InsolubleHydrogeniodide

-51 Poor Poor Good

PotassiumBromide

730 Poor Good Excellent

MagnesiumIodide

712 poor Good excellent

The substance which does not form ions when dissolved in water is:

a) Xylene b) Hydrogen Iodidec) Potassium Bromided) Magnesium Iodide

14. The reason for resemblance among elements of a given family in the Periodic Table is the:

a) Similarity in the inner shell electrons b) Simil arity in the valence shell elec tronsc) Fact that they all have the same number of protonsd) Fact that they all have the same number of neutronse) Fact that they all have a homologous reasonating structure in the atomic nuclei

15. First ionization energies exhibit a decrease in energy as you go down a family. The best explanation of this is:

a) There is an increase in nuclear charge as you travel down a family b) Dista nce of valence e lect rons f rom the nucle us is furthe r as you go down a familyc) Electrons of elements near the bottom of a family have a lighter mass and therefore less attraction




JR. GENIUS EDUCATIONAL SERVICES INC. d) Nucleus becomes larger as you travel down the familye) Elements tend to have a stronger neutron/proton attraction and therefore hold electrons weakly

16. What is the correct formula for Calcium Peroxide:

a) CaO b) Ca 2O

c) Ca 2O2 d) CaO 2 e) Ca 3O

17. Which element has a multiple valence?

a) Ca b) Alc) Snd) Age) O

18. Which element usually has an oxidation state of –1 with a metal ?

a) C b) Hc) Kd) Oe) Ne

19. When a substance gains electrons it gets:

a) Reduced b) Oxidizedc) Reactedd) Used upe) excited

20. What is the name of Hg 2SO 4:

a) Mercury (II) sulphate b) Mercury (I) sulpha tec) Mercury (I) sulphited) Mercury (II) sulphite

21. What is the correct formula for tin (IV) oxide:

a) SnO b) SnO 4 c) SN 4Od) SNO 2 e) SN 2O

22. Which one of the following represents a molecule ?

a) CS 2 b) PO 4

3- c) CO 3

2- d) SO 3

2- e) Ca

23. When aluminum bromide is mixed with potassium sulphate, one product is:

a) AlBr 3 b) KBr 2 c) AlSO 4 d) KBre) Al 3SO 4

24. How many moles are there in 40 grams of NaOH?

a) 80 b) 1c) 2




JR. GENIUS EDUCATIONAL SERVICES INC. d) 6.023 X 10 23 e) Need more info

25. In the reaction CuS + H 2 Cu + H 2S. the mass of copper obtained from 14 grams of CuS is:

a) 63.5 b) 0.1466

c) 4.98d) 9.31e) 95.5g

26. How many atoms in one molecule of Ca 3(PO 4) 2

a) 1 b) 9c) 7d) 10e) 13

27. A supersaturated solution has _________ solute than it can normally hold in the solvent:

a) Less b) Morec) The samed) An unknown amount

28. When copper (II) sulphate is a hydrated molecule there are usually ______ water molecules attached to it:

a) 1 b) 2c) 3d) 4e) 5

29. The solvent is defined as:

a) A type of solution b) The pa rt of a solution that gets disso lvedc) The part of a solution that does the dissolvingd) A mechanical mixture

30. You are provided with a 0.24 M solution of sodium hydroxide. How many moles of this solution do you have ina 25mL solution?

a) 6 moles b) 0.0006 molesc) 0.003 molesd) 0.024 molese) need more info

31. How many grams of calcium chloride dehydrate are required to prepare 50 mL of a 0.05 M solution?

a) 0.3225 b) 0.2775c) 0.3675d) 0.2879e) 0.5838

32. When phenolphthalein is in a base, it turns:

a) White b) Clearc) Pinkd) Orangee) blue

33. When naming acids, hypo means:

a) One less oxygen b) Two le ss oxygensc) Three less oxygens




JR. GENIUS EDUCATIONAL SERVICES INC. d) One extra oxygen

34. When an acid dissolves into solution, the part that makes it acidic is:

a) The acid

b) The hydrogen ionc) The hydroxided) nothing

35. According to the Arrhenius theory, bases:

a) Accept electrons b) Donate prot onsc) Accept hydroxide ionsd) Donate hydroxide ions

36. Which one of the following is a strong acid:

a) HCl b) Vinegarc) Dranod) Acid in lemon juice

37. If 670 mL of gas at 200 kPa has its pressure changed to 100 kPa, then the new volume will be:

a) 335 ml b) 134 mlc) 0.0355 mld) 1.34 mle) 1.34 L

38. Which of the following units may be used to measure the pressure of a gas?

a) Atmospheres, mm of mercury and kilograms b) Atmospheres, kilograms and ki lopascalsc) Atmospheres, mm of mercury and kilopascalsd) Atmospheres, mm of mercury and mm of aire) Atmospheres, mm of air and kilopascals

39. When a balloon is at 190 kPa and 50 C, it has a volume of 2.5 L. What is the new volume at STP?

a) 3.97 L b) 0.5 Lc) 401 Ld) 25.7 Le) none of the above

40. If 5 L of oxygen gas are mixed with 4 L of nitrogen gas, the total pressure is 1200 kPA. What is the partial pressure of the n itrogen gas?

a) 133.3 kPa b) 240 kPac) 300 kPad) 533.3 kPae) 666.6 kPa

41. How many moles are there in 22.4 L of water vapour at STP?

a) 1 b) 3.022 X 10 23 c) 6.022 X 10 23 d) Billionse) Need more info

42. What is the temperature of 1.10 g of CO 2 that occupies 600 mL of 99.0 kPa?

a) 286 °C b) 25 °Cc) 13 °C




JR. GENIUS EDUCATIONAL SERVICES INC. d) 20 °Ce) need more info

43. What is the density of nitrogen gas at STP?

a) 1.25 g/L b) 0.63 g/ Lc) 1.08 g/Ld) 1.35 g/Le) 2.99 g/L

Part B: Short Answer (26 marks)

1. Our present model of the atom is due to the scientific contributions of many people. Give an illustration for each

of these models and the experimental result or discovery which led to this modification of the earlier model (for

example: What did Thomson discover that led to major changes in Daltons model of the atom) ( 4 marks)

Rutherford

Quantum/Wave Mechanical Model

2. Write the energy level diagram for Magnesium. (2 marks)

3. Fill out the following chart. (6 marks)

A 152 84

Z 84

e 52

P 26

4. Write the correct names of each of the following substances. (4 marks)

a) FeO ___________________________




JR. GENIUS EDUCATIONAL SERVICES INC. b) P 2O5 ___________________________

c) PtBr 4 ___________________________

d) K 2SO 4 ___________________________

5. Write the correct formula for each of the following substances: (4 marks)

a) Hydrochloric acid ___________________________

b) Aluminiu, c yanide ___________________________

c) Nickel (III) oxide ___________________________

d) Ammonium perphosphate ___________________________

6. Why do aerosol cans used for hair spray and deodorants have a warning sign on them not to throw them into a

fire or leave them near a high temperature source? Explain in terms of molecules and the Gas Laws. (2 marks)

7. Define the following terms: (4 marks)

a) Acid

b) Indicator

c) pH Scale

d) Molarity

Part C: Lab Questions (20 marks)

1. What is a physical property? Describe an experiment/procedure that you could do to test two physical properties

of Ionic and Covalent substances. Please indicate what results you would expect to see. ( 5 marks)

2. Describe an experiment where you would identify and test for the presence of the following ions:

barium ions, zinc ions and lead ions. They must all precipitate out of solution . ( 5 marks)





3. Label each of the following pieces of equipment commonly found in the lab. (5 marks)

*** Insert Scanned Diagram of Objects***

4. Describe an experiment that you could do to determine the strength of Tums or Rolaids. Remember that these

two products are bases used to neutralize your excess stomach acid (which is HCl). Please include a diagram

and data table. (5 marks)

Part D: Problem Solving (39 marks)

1. For each of the following compounds, predict the bond type and sketch the Lewis Dot Diagram. ( 6 marks)

CO 2 AlF 3

2. When an aqueous solution of barium chloride reacts with an aqueous solution of potassium sulphate a solid

precipitat e occurs. Write the balanced equati on for this react ions. Be sure to include the state of al l of t he

substances. ( 4 marks)




JR. GENIUS EDUCATIONAL SERVICES INC. 3. For the compound CaSO 4H2O find:

a) the number of atoms in one molecule of calcium sulphate monohydrate (1 mark)

b) the number of molecules in 200 grams of calcium sulphate monohydrate (2 marks)

c) the percent by mass of calcium sulphate monohydrate (2 marks)

d) the number of grams of calcium sulphate monohydrate in 67 X 10 23 molecules (2 mark)

4. How many grams of Fe 2O3 are produced when 31. 9 grams of FeS react wth 28.0 g of oxygen gas according to

the following unbalanced equation: (6 marks)

FeS (s) + O 2 (g) Fe 2O3 (s) + SO 2 (g)

5. What is the molecular formula of a compound whose molecular mass is 238 u and has a percent composition of

19.3% sodium, 26.9% sulphur and the rest oxygen? (4 marks)

6. A student carried out a titration in which 18.5 mL of 0.5M HCl is used to neutralize 36.5 mL of NaOH. What is

the concentration of the sodium, hydroxide? (3 marks)

7. What is the concentration of a solution that contains 3.78 grams of KmnO4 dissolved in 500mL of water? (3

marks)





8. What volume would 14 grams of Nitrogen gas at 25 degrees Celcius and 101.03 kPa occupy? R= 8.314 (3

marks)

9. 45 Kpa of helium gas at 34 degrees celcius is heated to 224 degress with the pressure increasing to 55 kPa. What

was the original volume, if the final volume is 15 litres? (3 marks)

10. List the most enjoyable part of this course and the most distasteful part of this course. (1 mark)




JR. GENIUS EDUCATIONAL SERVICES INC. OAC Chemistry Exam Review Name: ___ ___________


The following three questions (1, 2, 3) refer to the formulae below:

I. C3H6 II. C3H6O III. C3H8O IV. C4H8O2

1. The formula for propanol is:

a) I b) IIc) IIId) IV

2. Which pair of compounds above could combine in the presence of concentrated sulfuric acid to produce an ester:

a) I and II b) II and IIIc) II and IVd) III and IV

3. Which formula could represent an acid?:

a) I b) IIc) IIId) IV

4. Which of the following compounds causes a bromine gas in water solution to become colourless:

a) C2H6 b) C6H6 c) C2H4 d) C2H4Br 2

5. The following sequence of reactions should be described as (in the correct order):

CH 3 – CH 2OH CH 2=CH 2 CH 3 – CH 3 CH 3-CH 2Br(I) (II) (III)

a) Dehydration (I) /hydrogenation (II) /halogenation (III) b) Dehydra tion (I)/halogenation (II) /hydrogenat ion (I II)c) Hydrogenation (I)/dehydration (II)/halogenation (III)d) Hydrogenation (I)/halogenation (II)/dehydration (III)

6. Select the compound that is an isomer of propanol:

a) H3CCH 2CHO b) H3CCH 2CH 2Br c) H3COCH 2CH 3 d) H3CCOCH 2CH 3

7. A substance Q is determined to be composed of discrete molecules, and has a melting point of -135°C and a boili ng point of –0.5°C. X is solubl e in methyl benzene. From these da ta, i t may be concluded tha t X i s likely t o:

I – have weak intermolecular forcesII – solidify to form a molecular crystal when cooled below -135°CIII – be a gas at room temperature and pressureIV – have weak bonds between atoms within the molecule

a) I, II and IV only b) II, III I and IV onlyc) I, II and III onlyd) I, II, III and IV





8. In modern chemical theory an occupied orbital is pictured to be :

a) A spherical or dumbbell-shaped pattern traced by the electron in its rapid movement b) A reg ion in space having a precise shape , whic h is comple tely fill ed by a dense elec tron c loudc) A region in space in which the probability of finding an electron is highd) An elliptical pathway, which an electron follows outside the nucleus

9. Select the sequence of formulae which matches these molecular shapes:

Bent Triagonal Pyramid Planar Triangular Tetrahedral a) PCl 3 CCl 4 H2O BF 3

b) H 2O PCl 3 BF 3 CCl 4 c) H 2O BF 3 PCl 3 CCl 4 d) CCl 4 PCl 3 BF 3 H2O

10. Element X exists in three isotopic forms. The isotopic mixture is:

15.1 % X – 45 35.1% X – 46 50.1% X – 47

The relative atomic mass for this element is:

a) 45.7 µ

b) 46.5 µc) 46.9 µd) 47.6 µ

11. One allowed set of quantum numbers (n,l,m,s) for a “3d” electron would be:

a) 3,2,-2,+1/2 b) 2,1,1, -1/2c) 3,1,0,-1/2d) 3,3,-2,+1/2

12. U-235 emits an alpha particle producing a radioactive substance X. X disintegrates emitting a beta particle and produce s element Y. Subs tance Y is :

a) Al b) Pac) Np

d) Pa

13. Consider the following reactions:

(1) C 6H6 (l) +15/2 O 2 (g) 6 CO 2 (g) + 3H 2O (l) ▲ H1 (2) 6 C (s) +3 H 2 (g) 6 C 6H6 (l) ▲ H2

(3) H 2 (g) +1/2 O 2 (g) H 2O (l) ▲ H3

(4) C (s) + O 2 (g) CO 2 (g) ▲ H4

The enthalpy for this reaction (1) ▲ H1 can be obtained using Hess’s Law by combining the ▲ H’s for the otherreactions in which of the following sequences?

a) 6 ( ▲ H4) + 3 ( ▲ H3) + ( ▲ H2) b) 6 ( ▲ H4) - 3 ( ▲ H3) - (▲ H2) c) -6 ( ▲ H4) - 3 ( ▲ H3) + ( ▲ H2) d) 6 ( ▲ H

4) + 3 ( ▲ H

3) - (▲ H

2)

14. For the following reaction… 4 NH 3 (g) +5 O 2 (g) 4 NO (g) + 6H 2O (g) the K eq expression would be:

a) [NH 3] [O 2] --------------------

[NO ] [H 2O]

b) [NH 3]4 [O 2] 5 --------------------

[NO ] 4 [H 2O] 6

c) [NO ]4 [H 2O] 6

1-866-9-Way To A JRGenius.com Chemistry Gr 11 University Prep Final Exam 13 --------------------



JR. GENIUS EDUCATIONAL SERVICES INC. [NH 3] 4 [O 2] 5

d) [NO ]6 [H 2O] 4 --------------------

[NH 3] 5 [O 2] 4

15. The reaction mechanism for nitric oxide is the following:

NO (g) +NO (g) N 2O2 (g) rate = 300 mol/Ls N 2O2 (g) NO (g) + NO (g) rate = 320 mol/Ls

N2O2 (g) + O 2 (g) 2 NO 2 (g) rate = 22 mol/Ls

The appropriate Potential Energy diagram for this reaction is:

a)

(kJ)

Progress of the reaction

b)

(kJ)


c)

(kJ)


d)

(kJ)


16. With reference to the following potential energy diagram for a chemical reaction, which of the followingstatement are correct:

(kJ)


I – the forward reaction is endothermicII – the activation energy for the forward reaction is larger than the activation energy of the reverse reactionIII – addition of a catalyst will increase the activation energy

a) I and II b) I and IIIc) II and III




JR. GENIUS EDUCATIONAL SERVICES INC. d) I, II, IIIe) None

17. The heat of formation of magnesium oxide is –603 kJ/mol. How much heat is required to decompose 24.0 g ofmagnesium oxide?

a) 181 kJ

b) 362 kJc) 723 kJd) 846 kJ

18. 7.28 kJ of heat are released when 40.0 g of Br 2 vapour at 332K condense to a liquid. What is the molar head ofvapourization of bromine?

a) 3.64 kJ/mol b) 7.28 kJ /molc) 1.82 kJ/mold) 29.1 kJ/mol

19. Which of the following reactions at equilibrium would be least affected by an increase in pressure:

a) CaCO 3 (s) CaO (s) + CO 2 (g) b) C6H 12O6 (s) + 6 O 2 (g) 6 C (g) + 6H 2O (g) c) N2 (g) + O 2 (g) 2 NO (g) d) 2 NO 2 (g) N2O4 (g)

20. Given the following reaction at equilibrium:

A (g) + 3B (g) 2 C (g) + 2D (g) ▲ H = 21 kJ/mol

The amount of C in the system can be increased by:

a) Decreasing the concentration of B at constant T and P b) Increa sing t he T at constan t Pc) Adding a catalyst at constant T and Pd) Increasing the pressure at constant T

21. Consider the following reaction:

3 X + Y 2 W + Z

At 298 K the [eq] of X, Y, W and Z were found to be:

X = 7.0 mol/L Y = 6.0 mol/L W = 5.0 mol/L Z = 7.0 mol/L

When the temperature was raised to 313 K the new [eq] of Z was found to be 6.0 mol/L. What are the new [eq] for theother three substances?

a) X = 8.0 mol/L Y = 7.0 mol/L W = 4.0 mol/L b) X = 4 .0 mol/ L Y = 5.0 mol/L W = 7.0 mol/Lc) X = 10.0 mol/L Y = 7.0 mol/L W = 3.0 mol/Ld) X = 10.0 mol/L Y = 5.0 mol/L W = 4.0 mol/L

22. Calculate the solubility of CaCO 3 in water if the K sp = 5.23 x 10 -8 :

a) 5.43 x 10 -8 mol/L

b) 2.75 x 10-8

mol/Lc) 2.3 x 10 -4 mol/Ld) 5.43 x 10 -5 mol/L

23. For the new reaction { HCN + H 2O H3O+ + CN - } the conjugate acid of water is:

a) HCN b) H 2Oc) H 3O+ d) CN -

24. The Bronsted-Lowry definition of an acid is a substance which…

a) Donates electron pairs




JR. GENIUS EDUCATIONAL SERVICES INC. b) Donates pro tonsc) Accepts protonsd) Accepts electron pairs

25. The Lewis concept of acids and bases defines a base as a substance which…

a) Donates protons b) Accepts el ectrons

c) Accepts proton pairsd) Donates electron pairs

26. What is the pH of a 0.150 M CH 3COOH solution K a = 1.8 x 10 –5

a) 4.76 b) 5.56c) 7.41d) 2.78

27. In the following reaction Fe +2 (aq) + Ag +1 (aq) Fe +3 (aq) + Ag (s)

a) Fe +2 (aq) is an oxidizing agent b) Ag +1 (aq) is a reducing agentc) Fe +2 (aq) is a stronger oxidizing agent than Ag +1 (aq) d) Ag (s) is a product as a result of reduction

28. What is the oxidation number of S in (S 2O3) –2 ?

a) –2 b) +2c) –4d) +4

29. If the solubility of Pb(OH) 2 is 4.0 x 10 –4 mol/L, then K sp of Pb(OH) 2 is:

a) 2.56 x 10 –10 b) 3.2 x 10 –7 c) 6.4 x 10 –11 d) 1.6 x 10 –8

30. What volume of 4.00 x 10 –4 mol/L HCl soloution is needed to completely react with 2.00 x 10 2 mL of 1.00 x 10 -2 mol/L LiOH solution:

a) 50.0 mL b) 1.00 x 10 2 mLc) 2.00 x 10 2 mLd) 5.0 x 10 2 mL

31. Which of the following occur does not represent an oxidation-reduction reaction?

a) Xylem b) Spongy mesophyl l ce llc) Palisade mesophyll celld) Guard cell

32. The tissue responsible for secondary growth in plants is the:

a) Pith b) Vascular c ambium

c) Xylemd) phloem

33. A scientist trying to induce a dwarf variety of Arctic willow to grow to a normal height would most likely choosethe plant growth regulator:

a) Cytokinin b) Auxinc) Ethylened) gibberellin

34. The part of the root tip which is characterized by the presence of root pairs is the:

a) Zone of elongation




JR. GENIUS EDUCATIONAL SERVICES INC. b) Merist emati c regi onc) Root capd) Zone of maturation

35. Companion cells and sleeve tube cells are associated with which kind of plant tissue:

a) Meristematic

b) Xylemc) Phloemd) cambium

36. Which of the following is not true for monocot plants?

a) Vascular bundles are scattered randomly across the stem in cross section b) Veins are a rranged in a paral lel fashi onc) The seed has one cotyledond) Flower parts come in multiples of 4 or 5

37. This part of the plant embryo develops into the stem:

a) Epicoty b) Hypocot ylsc) Radicled) cotyledon

38. The cortex of a root, because it plays a role in storing extra food is composed of:

a) Sclerenchyma cells b) Meris temat ic ce llsc) Parenchyma cellsd) Collenchyma cells

39. Match one of the numbered parts of the leaf diagram with each of the statements below and write its number beside the s tatement. What is the cor rect sequence of numbers?

***insert leaf diagram here****

i. the principal region of photosynthesisii. where oxygen leaves the leafiii. the structure that carries water to the leafiv. the cells which regulate the size of the stomachv. tissue containing many air spaces

b) 2, 7, 3 , 4, 5c) 2, 7, 4, 3, 5d) 2, 7, 3, 6, 5e) 1, 5, 6, 3, 7

Part B: Matching Columns (10 marks)

40. antibiotics ________41. bronchitis ________

42. conjugation ________

43. diabetes ________

44. Down syndrome ________

45. emphysema ________

46. stroke ________

47. synapsis ________




JR. GENIUS EDUCATIONAL SERVICES INC. 48. ulcer ________

49. XO ________

a. An inflammation of the upper respiratory tract

b. The pairing of homologous chromosome s

c. The trisomy at the 21 st chromosome

d. A condition where the lungs lose their elasticit y

e. Results from lack of blood flow to the heart

f. Substance produced that inhibits the growth of bacteria

g. Process where bacterial DNA is transferred from one bacterium to

another bacterium through a sex pilus

h. Turner’s syndrome genotype

i. Trisomy at the 18 th chromosome

j. A sore in ei ther the s tomach or duodenum

k. A substance produced by the body for defense against disease causing

micro-organisms

l. Disorder caused by an insufficient or lack of production of insulin

m. Klinefiter’s syndrome genotype

n. Process by which a virus transfers bacterial DNA from one bacterium

to another

o. Results from the lack of blood from to any area of the brain.




JR. GENIUS EDUCATIONAL SERVICES INC. Grade 11 Biology Exam Review #3 Name: ________ ___________


1. Which of the following branches of biology is the study of heredity:

a. Botany b. Anatomyc. Geneticsd. Pathologye. paleontology

2. In which solution should a plasmolysed cell be placed for a quick recovery?

a. Aqueous b. Hypertonicc. Hypotonicd. Isotonice. acid

3. A student wishes to obtain higher magnification under the microscope. Which part should he use?

a. Eyepiece b. Nosepi ecec. Body tubed. Diaphragme. condenser

4. Which organelle would be most active when a cell is old and begins to malfunction:

a. Golgi body b. Ribosomec. Vacuoled. Lysosomee. nucleolus

5. Which of the following would be used in a bacterial count:

a. Microtome b. Homogeni zerc. Centrifuged. Spectrophotometere. Electron microscope

6. Which of the following is not part of a virus:

a. Cytoplasm b. Nucle ic acidc. Taild. Heade. capsid

7. Which statement is true of prokaryotes?

a. Divide by mitosis b. Single chromosome presentc. Nuclear membrane presentd. Move by cytoplasmic streaminge. Chloroplasts present

8. What kind of conditions does an acidophile prefer?

a. Hot conditions b. High pH conditionsc. Salty conditionsd. Humid conditionse. Low pH conditions

9. What is the process by which a virus transfers bacterial DNA from one cell to another:





a. Transformation b. Recombi nationc. Sporulationd. Immunizatione. transduction

10. Which of the following does not apply to viruses:

a. Reproduce by transduction b. Are calle d bact eriophages when they break down bat eriac. Are composed of particles of DNA and RNAd. Are extremely small in sizee. Can stay dormant for a long period of time

11. What is the purpose of a test cross?

a. To show whether two genes are located in the same chromosome b. To work out the genotype of the offspr ingc. To reveal the number of alleles possessed by both parentsd. To show whether a trait is dominant or recessivee. To work out of the genotype of the unknown parent

12. A woman of blood type A has a son with a blood type O. What must her genotype be?

a. AA b. ABc. AOd. OOe. BO

13. How many chromosomes are present in the karyotype of a person with Turner’s syndrome?

a. 23 b. 43c. 45d. 46e. 47

14. How many chromosomes are there in the nucleus of a human egg cell?

a. 23 b. 43c. 45d. 46e. 47

15. If a person’s system can only break down starch to the disaccharide stage, what important chemical is missing?

a. Carbohydrate b. Fatc. Lactased. Maltasee. sucrase

16. If a food particle traveled through the digestive system, what structures, substances or transformations would it

encounter (select the correct order)?

a. Saliva, pepsin, hydrochloric acid, cardiac sphincter, chyme b. Saliva, esophagus, pharynz, cardiac sphinct er, epiglo ttisc. Bolus, peristalsis, chyme, large intestine, small intestined. Bolus, cardiac sphincter, chyme, small intestine, colone. Salivary glands, epiglottis, trachea, small intestine, colon

17. Which of the following would digest fat:

a. Amylase b. Lipasec. Trypsind. Maltase




JR. GENIUS EDUCATIONAL SERVICES INC. e. Pepsin

18. What is the function of mesentery?

a. To permit easier gas exchange b. To al low oxygen to enter the lungsc. To hold the intestines in place

d. To destroy bacteriae. To produce hemoglobin

19. Where would oxygen be released from oxyhemoglobin?

a. In the trachea b. In the arte riesc. In the veinsd. In the tissuese. In the alveoli

20. Which of the following does not occur in inspiration:

a. Diaphragm relaxes b. Air en ters the lungsc. Chest volume increasesd. Pressure in chest cavity decreasese. Rib cage comes up and out

21. The air you inhale is about 21% oxygen and 0.03% carbon dioxide. Which one of the following is most likely to be the composi tion of the air you exhale:

a. 24% oxygen and 4% carbon dioxide b. 24% oxygen and 0.010% ca rbon di oxidec. 16% oxygen and 4% carbon dioxided. 16% oxygen and 0.010% carbon dioxidee. 0% oxygen and 4% carbon dioxide

22. In which of the following does blood travel through the body cells?

a. Systemic circulation b. Excret ory sys temc. Pulmonary systemd. Cardiac systeme. Digestive system

23. In blood circulation, what causes the ‘dub’ or second sound?

a. A leaking valve b. The A-V val ves c losingc. Blood entering the top left chamberd. The valves in the vessels leaving the heart closinge. The contraction of the muscle of the heart

24. Which vessel does not carry deoxygenated blood?

a. Hepatic vein b. Renal veinc. Pulmonary veind. Hepatic portal vein

e. Venule

25. The basketball player Hakeem Olajuwon experienced arrhythmia last year. What is it?

a. Severe dehydration b. Irregular heartbeatc. Muscle crampd. Blockage of an arterye. stroke





Part B: Matching Columns (10 marks). Match each item in Column A with the appropriateitem in column B. Answers may be used more than once.

COLUMN A COLUMN B

26. Involves production of gametes a. sexual reproduction

27. rod-shaped bacterium b. asexual reproduction

28. contains digestive enzymes c. bacillus

29. attracted to water d. coccus

30. formation of a narrow channel e. virus

31. leucocyte engulfing a bacterium f. hydrophobic

32. involves a pursuit phase g. hydrophilic

33. the genetic condition of a gamete h. mitochondrion

34. the pairing of homologous chromosomes i. lysosome

35. often leads to crossing over j. chloroplast

i. homeostasis

ii. pinocytosis

iii. phagocytosis

iv. plasmolysis

v. osmosis

vi. chiasmata

vii. haploid

viii. diploid

ix. cytokinesis

x. synapsis

Part C: Short Answer Questions (35 marks)

1. By referring to their function in a cell, explain why ribosomes and endoplasmic reticulum

often occur together. (2 marks)

2. Using examples for both, distinguish between incomplete dominance and codiminance. (4

marks)




JR. GENIUS EDUCATIONAL SERVICES INC. 3. In humans, the gene for normal colour vision is dominant over the gene for colour blindness.

Each of these genes is X-linked. A woman with normal vision has three colourblind daughters.

a) What is the genotype of the mother? (1 mark)

b) What is the genotype of the father? (1 mark)

c) What is the phenotype of the father? (1 mark)

d) What is the phenotype of the daughters? (1 mark)

4. In a paternity law suit, a woman with type AB blood sues a man with type O blood. The child

has the same blood as the mother. Could this male be the father? Use a Punnet swaure to work

out your answer. Describe any symbols you use. (4 marks)

5. For 2 marks…

a) Describe the work of Louis Pasteur with chickens that lead to the first vaccine

OR

b) Describe how Fleming discovered penicillin and its impact on society

6. Look at the diagram below and answer the question that follows it.

***insert scanned image here***

What kind of immunity is involved? Give a full explanation of your answer. (2 marks)

7. About 1 cm 3 sample of food was placed in a test tube with 5% amylase solution. After 24

hours, the food had broken down into its simplest form.

a) Explain what process had taken place in the test tube. (2 marks)




JR. GENIUS EDUCATIONAL SERVICES INC. b) Describe a test you can carry out to confirm your answer, with the expected results.

(2 marks)

8. Distinguish between the following:

a) malnutrition and undernutrition (2 marks)

b) essential and necessary nutrients (2 marks)

9. How does the Catholic faith influence our attitude and behaviour towards food in Canada as

well as hunger and starvation in less developed countries? (3 marks)

10. Explain 2 effects of tobacco smoke on the respiratory system. Your answer must include

specific components of the system. (2 marks)

11. Draw and fully label a spirometer trace that includes tidal volume and vital capacity. (4

marks)





Part D: Diagram Identification (10 marks)

***Insert Scanned Images Here***

1. ________________________

2. ________________________

3. ________________________

4. ________________________

5. ________________________

6. ________________________

7. ________________________

8. ________________________

9. ________________________

10. ________________________





Part E: Extended Response (20 marks). This section requires the completion of 1 essay froma choice of two questions. The essay must be grammatically sound, logical and coherent. Writeyour answer in the space provided. (Content – 16 marks; Style – 4 marks).

1. Describe some of the poor eating habits common among teenagers, and their dangerous medicalconsequences. From your knowledge of biology, suggest a sensible eating plan (a menu) for one day.Explain your food choices by referring to 3 main food groups.

OR

2. We are living in the Genetic Age, which promises hope for some, and causes concern for others.

Two important areas are genetic engineering and genetic testing.

a) Give a critical account of the genetic engineering of plants, animals and humans.

b) Discuss, from a Catholic point of view, the moral and ethical issues that arise from knowing

the results of genetic testing for specific diseases.




JR. GENIUS EDUCATIONAL SERVICES INC. Grade 11 Biology Exam Review #4 Name: ________ ___________


1. Glucose and galactose are:

a. disaccharides b. polymersc. isomersd. polypeptidese. isotopes

2. The Hardy-Weinberg law maintains that:

a. Slight genetic variations occur from generation to generation even in a genetically stable population b. The second genera tion will not ha ve the same phenotypes as the first generationc. The addition of new genes to the gene pool has little effect on succeeding generationsd. The original genetic variability of a gene pool will remain the same for generations in a large,

randomly breeding populatione. None of the above

3. Variations among individuals of a population are produced by:

a. Environmental influence b. Genet ic makeupc. Nurtritiond. A, b, and c are all truee. Only a and b are true

4. In which of the following situations would genetic drift most likely occur:

a. In a well-populated area b. Among migrati ng populati onsc. In the Pacific Oceand. On an isolated islande. Genetic drift would not occur in any of the above

5. The following molecules occur at different stages of the release of energy during cellular respiration:

i. Acetyl co-enzyme Aii. Carbon dioxideiii. Glucoseiv. PGALv. Pyruvic acid

If the above molecules are arranged in proper order as they occur in the sequence of events that is called cellularrespiration, which of the following sequences is correct:

a. iv, iii, ii, i, v b. iii, i, v, iv, i ic. iii, iv, i, v, iid. iii, iv, v, i, iie. ii, i, v, iv, iii

6. Which of the following is a bond that breaks when a DNA molecule unwinds before DNA replication:

a. The bond between a ribose and a phosphate b. The bond bet ween A and Tc. The bond between A and Ud. The bond between deoxyribose and phosphatee. The bond between deoxyribose and T

7. A disease in humans, called Vitamin D-resistant rickets, is an X-linked dominant trait. If a man with this traitmarries a woman with the normal trait, what proportion of their sons is likely to have Vitamin D-resistantrickets?

a. None b. ¼c. ½




JR. GENIUS EDUCATIONAL SERVICES INC. d. ¾e. all

8. White-fruited plans (WW) are crossed with yellow-fruited plants (ww). What kind of plans are most likely to be produced?

a. All homozygous white-fruited plants

b. All homozygous yel low-f ruited plantsc. All heterozygous white-fruited plantsd. All heterozygous yellow-fruited plantse. Half white-fruited plants and half yellow-fruited plants

9. In crossing of homozygous dominant and homozygous recessive garden pea plants, Mendel notes that the presence of ____ phenotypes was not appare nt in the F1 gene ration and was apparent in only 25% of the F2generation. The word that best fits the blank is:

a. Dominant b. Epist aticc. Lethald. Incomplete dominante. Recessive

10. Each strand of a replicated chromosome is called a:

a. Centromere b. Centri olec. Chromatind. Chromatide. microtube

11. Cell membranes are not composed of:

a. Lipids b. Intrinsic prote insc. Amphoteric moleculesd. Glycolipidse. Nucleic acid

12. Which of the following is true of facilitated diffusion:

a. It pumps material against the concentration gradient b. It requires special prote ins in the cell membranec. It uses energy to change ATP to NADHd. All of the abovee. None of the above

13. Pyruvate can be thought of as the final product of:

a. Lactic acid fermentation b. Cellu lar respirationc. The citric acid cycled. Glycolysise. photosynthesis

14. In cell respiration, the function of cytochromes is to pass:

a. Water to ATP

b. Phospha tes t o PGALc. Electrons to O 2 d. Oxaloacetic acid to citric acide. ADP to ATP

15. The formula H 3O+ represents the:

a. Hydroxyl ion b. Hydronium ionc. Amino terminald. Carboxyl ione. None of the above

16. A solution of pH 5 has ____ the concentration of hydrogen ion s as a solution of pH 6:





a. One-half b. Twicec. One-tenthd. 10 timese. one-fifth

17. Chlorophyll absorbs light least efficiently from:

a. The orange portion of the spectrum b. The green portion of the spectrumc. The ultraviolet portion of the spectrumd. The blue portion of the spectrume. The yellow portion of the spectrum

18. During which phase of mitosis do the homologous chromosomes separate?

a. Anaphase b. Telophasec. Interphased. Prophasee. None of the above

19. During the synthesis of protein in cells, coded information is carried from the nucleus to the organelles in thecytoplasm by:

a. Transfer RNA b. SnRNAc. Amino acidsd. Ribosomal RNAe. mRNA

20. Cyclic phosphorylation is called ‘cyclic’ because:

a. No outside source of electrons is required b. The photons of li ght are rec ycledc. The ATP is used over and over againd. The light causes the ATP to assume a cyclic structuree. Enzymes are used over and over again

21. Which of the following carry on phosphorylation by means of light absorption:

a. clover b. Insec tsc. Mammalsd. Amoebae. Bioluminescent bacteria

22. Which of the following is/are necessary for the non-cyclic electron transport system?:

a. Light b. Waterc. Cholorophylld. All of the abovee. Only a and c

23. Which of the following best describes homologous structures? They have similar:

a. Function but no common ancestry b. Struc ture and embryonic originc. Function but different structured. Appearance and embryonic origine. Structure but different embryonic origin

24. The gradual increase in a population of a phenotype due to more successful reproduction is called:

a. Genetic drift b. Natural se lect ionc. Mutationd. Polyploidye. Speciation





25. Which of these statements is/are part of Darwin’s concept of evolution?

a. Offspring inherit 2 genes for each trait b. Genes segregate during meios isc. Inherited variation allows some organisms to survive in greater numbers than othersd. Gene frequencies remain constant in randomly breeding populations

e. All of the above

26. A population of 2 million field mice obeying the Hardy-Weinberg law with respect to two alleles (A, a) would beexpected to:

a. Increase the frequency of the dominant phenotype b. Increase t he fre quency of the recessive phenot ypec. Eliminate heterozygosityd. Maintain a constant ratio of the dominant and recessive allelee. Increase the proportion of heterozygotes

27. The author of “An Essay on the Principle of Population” was:

a. Malthus b. Walla cec. Darwind. Lyelle. Lamarck

28. The extinction of a species is most likely due to:

a. The effect of the ice ages b. The fa ilure to in terbreed with bette r adapted s peciesc. The inability to adapt to changing environmentsd. The inability to cross geographical barrierse. Alterations in genetic code

29. When glucose and fructose unite they yield sucrose which is a(n):

a. polypeptide b. Starchc. Disaccharided. Amino acide. nucleotide

30. Fats consist of:

a. Amino acids linked together in a chain b. Glucos e rings linked t ogetherc. Glycerol and fatty acids linked togetherd. Glycogen molecules linked togethere. Purines and pyrimidines linked together

31. How many different kinds of amino acids are used to make up our body tissues?

a. 2 b. 4c. thousandsd. 20e. 64

32. Polysaccharides are broken down into simple sugars during the process of:

a. Active transport b. Hydrolysisc. Condensationd. Neutralizatione. emulsification

33. The amount of adenine in the DNA molecule is:

a. Half the amount of guanine b. Double the a mount of cytosinec. Equal to the amount of thymine




JR. GENIUS EDUCATIONAL SERVICES INC. d. Equal to the amount of uricile. Equal to the amount of guanine

34. Unlike bacteria, the cells of humans are ___________, with a defined nucleus and specialized organelles:

a. Eukaryotic b. Schlerenchyma

c. Parenchymad. Pycnotice. prokaryotic

35. Ribosomes are the site of:

a. Cellular respiration b. Photosynthesisc. Protein synthesisd. Mitosise. Cellular reproduction

36. If the end products of a particular metabolic process in an organism are carbon dioxide and alcohol, then theorganism is most likely a:

a. Type of yeast b. type of algaec. green palntd. type of animale. type of virus

37. The major function of the nucleolus appears to be:

a. Controlling cellular respiration b. Synthesis of phos pholipidsc. Intracellular digestiond. Bioluminescence in some bacteriae. Synthesis of rRNA

38. Which of the following affect the rate of diffusion in a cell:

a. Temperature b. Molecular sizec. Concentrationd. Both a and c are correcte. All of the above are correct

39. A major improvement that vascular plants have over liverworts is the presence of:

a. Air pockets b. Cutinc. Stomatesd. Storage cellse. Chloroplasts

40. The energy released as an electron moves along a series of cytochromes is used to synthesize:

a. ADP b. Oxygenc. ATP

d. None of thesee. Chlorophyll

41. Glycolysis produces:

a. 36 ATP molecules b. a 6-ca rbon mol eculec. a glucose moleculed. citric acide. two pyruvic acid molecules

42. The oxygen which is released as a result of photosynthesis came from:

a. Carbon dioxide




JR. GENIUS EDUCATIONAL SERVICES INC. b. Chlorophyllc. Glucosed. Watere. cytochromes





Part B: Short Answer Questions (52 marks)

1. Proteins are perhaps the most versatile constituents of the cell that we studied this year.

Explain four of the many functions of proteins in the cell.

2. Draw any two amino acids (the R groups can be shown as R1 and R2) to show how the two

can react to form a dipeptide. Draw this dipeptide and circle the peptide bond that is formed in

the reaction.

3. a) Outline at least 5 key points to present fluid mosaic model of the cell membrane.

b) Explain how the fluid mosaic model can be used to explain the following observations:

i. Molecules A is labeled with radioactive nitrogen and molecule B is labeled withradioactive carbon so that you can trace their relative movements. Both moleculesare known to be components of cell membranes. After two hours, molecule A is

found to be a part of both the external and internal sides of the membrane, butmolecule B is only found on the external side of the membrane.

ii. An oily substance will pass through the membrane faster than a watery substanceeven if the two are similar in particle size.

4. As an accomplished biology student you are given a sample of a substance taken from a

living organism. You are told that this sample is either a sugar or a triglyceride. Discuss the

structural characteristics of each of these molecules and then describe how you would

determine whether your sample was a sugar or a triglyceride.




JR. GENIUS EDUCATIONAL SERVICES INC. 5. Complete the following chart comparing the light dependent reactions of photosynthesis with

the electron transport chain of cellular respiration.

Light dependent reaction ofphotosynthesis

Electron transport chain ofcellular respiration

Organelle

Location with organelle

Reactants

Time when active

Energy source

End products

6. The following series of letters represent the bases of a portion of a DNA strand:

GCTGCCATAGCAGCGAGATGATGA

A) Calculate the corresponding complementary strand

B) Calculate the polypeptide chain that would result if this complementary strand

underwent transcription and translation. Assume that initiation has already occurred

earlier in the sequence. Show all your work. Use the table below to aid your answer.

***insert scanned image here***

7. a) Make up a specific example using toads found along the grassy strip between the east and

west lanes of Highway 407 in Markham to illustrate how and why the genetic drift could

influence the evolution of this particular population.




JR. GENIUS EDUCATIONAL SERVICES INC. b) One famous biology teacher (who also happened to own chocolate labs) was heard to say

“Without mutations, there could be no organic evolution.” Do you agree with this statement?

Explain your reasoning.

8. a) Discuss and explain at least two distinct ways that the fossil record favours the idea of

organic evolution over the idea that all species remain relatively unchanged.

b) Discuss and explain at least two distinct ways that the geographical distribution of

species on earth lends support to the idea of organic evolution.

9. a) Draw a typical chloroplast and a typical mitochondrion and label four important parts

that are found in both and four important parts that are unique to one or the other.

b) The process of photosynthesis can be divided into three major steps, one of which is

carbon fixation. Outline how this occurs using both a diagram and a written explanation.





Part C: Compare and Contrast (10 marks)

1. Listed below are seven pairs of biological terms we encountered this year. Compare and contrast any fivepairs only .

a) Condensation reaction and hydrolysis reaction

b) Citric acid cycle and Calvin cycle

c) tRNA and mRNA

d) CAP and repressor

e) Gene pool and genome

f) Essentialism and uniformitarianism

g) Gene flow and genetic drift

Part D: Essay (12 marks)

1.

a) State and explain, in paragraph form, the major points of the Darwin-Wallace theory of

Natural Selection.

b) In the time that has passed since Darwin and Wallace first presented their idea of Natural

Selection, much evidence has been gathered which supports their theory, but, as often

happens in science, some evidence has caused their theory to be modified in recent times.Discuss modern modifications to the Darwinian view of Natural Selection.

c) Natural Selection predicts that the earth is many millions of years old, yet the Holy Bible

would suggest that the earth is between 4000 and 5000 years old. Explain how it is that a

person can be Roman Catholic and a believer in Natural Selection at the same time.

jr. genius gr 11 chemistry university prep

Documents