jurnal fishew ii

doi: 10.1152/ajpregu.00228.2009297:R1647-R1659, 2009. First published 7 October 2009;Am J Physiol Regul Integr Comp Physiol

Takeru Nakazato, Hiroyuki Doi, Shigehisa Hirose and Michael F. RomeroAkira Kato, Min-Hwang Chang, Yukihiro Kurita, Tsutomu Nakada, Maho Ogoshi,excretion in marine teleost fishIdentification of renal transporters involved in sulfate

You might find this additional info useful...

for this article can be found at: Supplementary material

DC1.htmlhttp://ajpregu.physiology.org/http://ajpregu.physiology.org/content/suppl/2009/10/07/00228.2009.

56 articles, 35 of which you can access for free at: This article citeshttp://ajpregu.physiology.org/content/297/6/R1647.full#ref-list-1

6 other HighWire-hosted articles: This article has been cited by http://ajpregu.physiology.org/content/297/6/R1647#cited-by

including high resolution figures, can be found at: Updated information and serviceshttp://ajpregu.physiology.org/content/297/6/R1647.full

can be found at: and Comparative PhysiologyAmerican Journal of Physiology - Regulatory, Integrative about Additional material and information

http://www.the-aps.org/publications/ajpregu

This information is current as of April 13, 2013.

http://www.the-aps.org/. Copyright 2009 the American Physiological Society. ISSN: 0363-6119, ESSN: 1522-1490. Visit our website at12 times a year (monthly) by the American Physiological Society, 9650 Rockville Pike, Bethesda MD 20814-3991. levels of biological organization, ranging from molecules to humans, including clinical investigations. It is publishedinvestigations that illuminate normal or abnormal regulation and integration of physiological mechanisms at all

publishes originalAmerican Journal of Physiology - Regulatory, Integrative and Comparative Physiology

by guest on April 13, 2013http://ajpregu.physiology.org/

Dow

nloaded from

Identification of renal transporters involved in sulfate excretion in marineteleost fish

Akira Kato,1,2 Min-Hwang Chang,2 Yukihiro Kurita,1 Tsutomu Nakada,1 Maho Ogoshi,1Takeru Nakazato,1 Hiroyuki Doi,3 Shigehisa Hirose,1* and Michael F. Romero2*1Department of Biological Sciences, Tokyo Institute of Technology, Yokohama, Japan; 2Physiology and BiomedicalEngineering, Mayo Clinic College of Medicine, Rochester, Minnesota; and 3Shimonoseki Marine Science MuseumKaikyokan, Shimonoseki Academy of Marine Science, Shimonoseki, JapanSubmitted 27 April 2009; accepted in final form 3 October 2009

Kato A, Chang MH, Kurita Y, Nakada T, Ogoshi M, NakazatoT, Doi H, Hirose S, Romero MF. Identification of renal transportersinvolved in sulfate excretion in marine teleost fish. Am J PhysiolRegul Integr Comp Physiol 297: R1647R1659, 2009. First publishedOctober 7, 2009; doi:10.1152/ajpregu.00228.2009.Sulfate (SO42)is the second most abundant anion in seawater (SW), and excretion ofexcess SO42 from ingested SW is essential for marine fish to survive.Marine teleosts excrete SO42 via the urine produced in the kidney.The SO42 transporter that secretes and concentrates SO42 in the urinehas not previously been identified. Here, we have identified andcharacterized candidates for the long-sought transporters. Using se-quences from the fugu database, we have cloned cDNA fragments ofall transporters belonging to the Slc13 and Slc26 families frommefugu (Takifugu obscurus). We compared Slc13 and Slc26 mRNAexpression in the kidney between freshwater (FW) and SW mefugu.Among 14 clones examined, the expression of a Slc26a6 paralog(mfSlc26a6A) was the most upregulated (30-fold) in the kidney ofSW mefugu. Electrophysiological analyses of Xenopus oocytes ex-pressing mfSlc26a6A, mfSlc26a6B, and mouse Slc26a6 (mSlc26a6)demonstrated that all transporters mediate electrogenic Cl/SO42,Cl/oxalate2, and Cl/nHCO3 exchanges and electroneutral Cl/formate exchange. Two-electrode voltage-clamp experiments dem-onstrated that the SO42-elicited currents of mfSlc26a6A is quite large(35 A at 60 mV) and 50- to 200-fold higher than those ofmfSlc26a6B and mSlc26a6. Conversely, the currents elicited byoxalate and HCO3 are almost identical among mfSlc26a6A,mfSlc26a6B, and mSlc26a6. Kinetic analysis revealed thatmfSlc26a6A has the highest SO42 affinity as well as capacity.Immunohistochemical analyses demonstrated that mfSlc26a6A local-izes to the apical (brush-border) region of the proximal tubules.Together, these findings suggest that mfSlc26a6A is the most likelycandidate for the major apical SO42 transporter that mediates SO42secretion in the kidney of marine teleosts.

mefugu; proximal tubule; Slc13; Slc26; sulfate homeostasis; oxalate

SULFATE (SO42) IS ESSENTIAL for many biological processes.

Almost all vertebrate animals maintain plasma SO42 concen-tration at 0.21 mM, except the special case of the freshwatereel, which uses SO42 as a plasma osmolyte (35). In mammals,plasma [SO42] is maintained by the kidney, where SO42 isfreely filtered from the blood and then reabsorbed (29, 30). Theproximal tubule is the major site of active SO42 reabsorption,and the remaining SO42 (1030%) is excreted in urine. SO42uptake across the apical membrane is coupled to Na absorp-tion. This coupled transport is mediated by the Na-SO42

cotransporter (NaSi-1, Slc13a1) (8) The basolateral membraneof the proximal tubule exchanges SO42 for anions, such asOH and HCO3 (25), and this exchange seems to be mediatedby SO42 anion transporter 1 (Sat1, Slc26a1) (30). In teleosts(modern bony fishes), plasma [SO42] is maintained at levelssimilar to those in mammals. In contrast to most mammals,however, marine teleosts concentrate and excrete SO42 inurine (37, 41).

The plasma of marine teleosts has ionic composition andosmolarity similar to that found in mammals and freshwater(FW) fish, i.e., hypotonic to seawater (SW). To balance passivewater loss from the gills and skin, marine teleosts drink SW,absorb water, and eliminate salts. SW contains 53 mMMg2, 27 mM SO42, 10 mM Ca2, and 10 mM K as well as450 mM NaCl. Therefore, marine teleosts must excrete theexcess ions from the ingested SW: from the gill, Na, Cl, andK; from the intestine, Ca2 and Mg2; and from the kidney,Mg2 and SO42 (33). Urine of marine teleosts is isotonic to theplasma but rich in Mg2 and SO42, which are not secreted bythe gill. Consequently, renal SO42 excretion is essential forSO42 homeostasis in marine teleosts. SW ingestion has alsobeen reported in a number of marine mammals (36), indicatingthat they may have similar SO42 handling as marine teleosts.It has also been shown that the site of marine teleost SO42secretion is the renal proximal tubule (7, 9, 44). However, themolecular mechanisms by which SO42 is secreted and concen-trated in urine are not known.

To identify the transporters involved in SO42 secretion, wetook a similar approach as used to identify intestinal bicarbon-ate transporters essential for SW adaptation (27). Specifically,we cloned all candidate SO42 transporters from the Slc13 andSlc26 families from a euryhaline pufferfish, mefugu (Takifuguobscurus) (20), with a help of database mining. We thennarrowed the potential candidates by determining whether theirmRNA was induced in the kidney with SW conditions. Mefuguis a species closely related to tiger puffer (T. rubripes) (57),whose whole genome was sequenced in 2002 (1). Through thissystematic approach, we identified an Slc26a6 (CFEX/PAT-1)paralog (mfSlc26a6A), which exhibited the highest inductionin SW. The results of our functional characterization (electro-physiology) and protein localization (immunohistochemistry)lead us to propose that mfSlc26a6A, an electrogenic Cl/SO42exchanger, plays a central role in the excretion of excess SO42at the apical side of the renal proximal tubule cells of marineteleosts. This highly-efficient secretion mechanism allows ma-rine teleosts to maintain extremely low plasma [SO42] relativeto the surrounding SW.

* S. Hirose and M. F. Romero contributed equally to this work.Address for reprint requests and other correspondence: S. Hirose, Biological

Sciences, Tokyo Institute of Technology, 4259-B-19 Nagatsuta-cho, Midori-ku, Yokohama 226-8501, Japan (e-mail: [email protected]).

Am J Physiol Regul Integr Comp Physiol 297: R1647R1659, 2009.First published October 7, 2009; doi:10.1152/ajpregu.00228.2009.

0363-6119/09 $8.00 Copyright 2009 the American Physiological Societyhttp://www.ajpregu.org R1647


Dow

nloaded from

octopusHighlight

octopusHighlight

MATERIALS AND METHODS

Animals. Mefugu T. obscurus (200380 g) were purchased from alocal dealer and reared in tanks containing 150 liters brackish water(314% diluted SW) until use. For FW samples, mefugu were trans-ferred to 150-liter FW tanks and held for 89 days before samplecollection. For SW samples, mefugu in FW tanks were transferred to150-liter SW tanks and acclimated for 89 days. The water temper-ature was maintained at 1822C. All fugu were anesthetized byimmersion in 0.1% ethyl m-aminobenzoate (MS-222, tricaine) beforebeing killed by decapitation. The tissues required for RNA extractionwere dissected, snap-frozen in liquid nitrogen, and stored at 80Cuntil use. Artificial SW (Rohto-Marine) was obtained from Rei-Sea(Tokyo, Japan). The animal protocols and procedures were approvedby the Institutional Animal Care and Use Committee of TokyoInstitute of Technology (mefugu) or Mayo Clinic (Xenopus) andconform to the American Physiological Societys guiding principlesin the care and use of laboratory animals (1a).

RNA isolation. Total RNA was isolated from intestine by acidicguanidinium thiocyanate-phenol-chloroform extraction with Isogen(Nippon Gene, Tokyo, Japan). Briefly, tissues were homogenized inIsogen (1 g of tissue per 10 ml of Isogen) by using a Polytron tissuehomogenizer, followed by guanidinium thiocyanate-phenol-chloro-form extraction, isopropanol precipitation, and 75% (vol/vol) ethanolwashing of precipitated RNA. The RNA was dissolved in diethylpyrocarbonate-treated water, and its concentration calculated fromabsorbance at 260 nm.

Molecular cloning. Complementary DNA was reverse-transcribedusing random hexamers and the SuperScript III First-Strand SynthesisSystem (Invitrogen, Carlsbad, CA). Fragments of mefugu Slc26a6A andSlc26a6B were isolated by RT-PCR from fugu intestine RNA withprimers (Table 1 and S1) that were designed based on the fugu genomicdatabase (http://genome.jgi-psf.org/fugu6/fugu6.home.html). The PCRproducts were subcloned into pBluescript II SK() (Stratagene, La Jolla,CA) and sequenced. These clones were used as probes for Northern blotanalysis.

Northern blot analysis. Total RNA (20 g/lane) from a pool ofvarious tissues of FW and SW mefugu was electrophoresed onformaldehyde-agarose (1%) denaturing gels in 10 MOPS runningbuffer (20 mM MOPS, pH 7.0, 8 mM acetate, 1 mM EDTA) and thentransferred onto Hybond-N nylon membranes (GE Healthcare, Pis-cataway, NJ) by capillary blotting. After transfer, membranes werebaked for 2 h at 80C and prehybridized for 2 h at 65C in PerfectHybhybridization solution (Toyobo, Osaka, Japan). The probes werelabeled with [-32P]dCTP (3,000 Ci/mmol) with the use of a Ready-To-Go DNA labeling kit (GE Healthcare), and the unincorporatednucleotides were removed by passing the reaction mixture through aSephadex G-50 column (GE Healthcare). The membranes were thenhybridized separately with each 32P-labeled probe in the same bufferat 68C for 16 h. The blots were subsequently washed under increas-ingly stringent conditions (final wash: 1 SSC and 0.1% SDS for 30min at 60C). Membranes were exposed to an imaging plate (Fujifilm,Tokyo, Japan) in a cassette overnight. The results were analyzed usinga Fuji BAS2000 Bio-Image Analyzer (Fujifilm). A probe for mefugu-actin was used as a control to verify loading and RNA integrity.

Real-time PCR. Expression of mfSlc26a6A, mfSlc26a6B,mfSlc26a6C, mfSlc26a1, and mfSlc13a1 was quantified by real-timePCR. Total RNAs were extracted from the kidney of mefugu accli-mated to SW and FW (n 5 for each group) and reverse-transcribedinto cDNA using oligo(dT) primer and the SuperScript III First-StrandSynthesis System (Invitrogen). Multiplex real-time PCR was per-formed for quantitation of mfSlc26a6A, mfSlc26a6B, mfSlc26a6C,mfSlc26a1, and mfSlc13a1 mRNA expression, with amplification ofGAPDH as an endogenous control. Reactions were performed withthe SYBR Green method using SYBR Premix Ex Taq II Kit (TakaraBio, Otsu, Japan) on a Thermal Cycler Dice Real-Time System(Takara Bio) and calculated using the Relative Standard Curvemethod. mRNA concentrations of mfSlc26a6A, mfSlc26a6B, andmfSlc26a1 were normalized to GAPDH levels. Experiments wereperformed in duplicate. Data were expressed as the means SE.Significant differences at P 0.01 were determined by two-sampleStudents t-test, assuming unequal variance.

Immunohistochemistry. Kidneys from SW mefugu were fixed in0.1 M phosphate buffer, pH 7.4, containing 4% (wt/vol) paraformal-dehyde for 1 h at 4C. After incubation in 0.1 M phosphate buffer, pH7.4, containing 20% (wt/vol) sucrose for 16 h at 4C, specimens werefrozen in Tissue Tek OCT compound on a cryostat holder. Sections (6m) were prepared in a 20C cryostat, mounted on (3-aminopro-pyl)triethoxysilane-coated glass slides, and air-dried for 1 h. Afterbeing washed with PBS, sections were incubated for 2 h at roomtemperature with 2.5% (vol/vol) normal goat serum and then over-night at 4C with antisera and preimmune sera at a 1:1,000 (immu-nofluorescence method) dilution. After being incubated with antiseraand preimmune sera, sections were washed with PBS and thenincubated for 1 h at room temperature with a cocktail of Alexa Fluor488-conjugated anti-rabbit IgG (1:2,000; Invitrogen), Alexa Fluor546-conjugated anti-rat IgG (1:2,000; Invitrogen), and Hoechst 33342(100 ng/ml; Molecular Probes). Fluorescence was detected using afluorescence microscope equipped with a high-resolution digitalcharge-coupled device camera (Carl Zeiss, Oberkochen, Germany).

Expression of mfSlc26a6A, mfSlc26a6B, and mSlc26a6 in Xenopusoocytes and electrophysiology. The entire coding regions ofmfSlc26a6A, mfSlc26a6B, and mSlc26a6 cDNAs were inserted to thepGEMHE Xenopus laevis expression vector as described previously(27, 56). The plasmids were linearized with NotI or NheI, and cRNAswere transcribed in vitro using the T7 mMESSAGE mMACHINE kit(Ambion, Austin, TX). X. laevis oocytes were dissociated with col-lagenase as previously described (45) and injected with 25 nl of wateror a solution containing cRNA at 0.41 g/l (1025 ng/oocyte),using a Nanoject-II injector (Drummond Scientific, Broomall, PA).Oocytes were incubated at 16C in OR3 media (45), and studied 36days after injection.

Table 1. List of primers used for PCR amplificationGene Sequence Remarks

mfSlc26a6A GGGCTGCCAAGCATGTG qPCR (S)GCGTCGTGTACTGTGACAAACA qPCR (AS)

mfSlc26a6B CACCGTTCATGACGCAGTTC qPCR (S)ACGTTTCTGTGTTCTCCTGTTCAG qPCR (AS)

mfSlc26a6C TCCCAGCTTCCGCACACTCA Initial cloning(S)

AGCTCCTGGTTACTGTCCACCTT Initial cloning(AS)

CACACTCCCCACCATGATACTGAGC 5 RACE outerAGCCACCTGTATCCTGTATGAGTCT 5 RACE innerTCACTGGGGAAATGGACCTGGGACA 3 RACE outerAAAGGAAAAGGTCTGTCGTTCTCTA 3 RACE innerAAACTGAGAAAGACATAGAATTCTACCAGA ORF cloning (S)TATTTAATTTCAGCCACTGAACACAACAAG ORF cloning

(AS)GAGGACACACTGAGTCACGA qPCR (S)GGGCTTGACAACCAGCTATG qPCR (AS)

mfSlc26a1 GAGCCTCATGGTGGGACAGG Initial cloning(S)

ACACACTGGAGCTGTAGCGG Initial cloning(AS)

CAGATCAGCAGCGTTAACACAG qPCR (S)GCGTTTAACTTTCCTCTGATTGTCC qPCR (AS)

mfSlc13a1 AGTCGGCGGAGGATTCGCACTT qPCR (S)GCATGCGACAGTGATGGTGGCTAAC qPCR (AS)

GAPDH GGCCCAATGAAAGGCATTCT qPCR (S)TGGGTGTCGCCGTTGAA qPCR (AS)

S, sense primer; AS, antisense primer.

R1648 SULFATE EXCRETION TRANSPORTERS IN MARINE TELEOST

AJP-Regul Integr Comp Physiol VOL 297 DECEMBER 2009 www.ajpregu.org


Dow

nloaded from

Ion-selective microelectrode analysis. To measure the intracellularchloride concentration ([Cl]i,) of Xenopus oocytes, a Cl ion-selective microelectrode was prepared with Cl-ionophore I, cocktailA (cat. no. 24902; Fluka Chemicals, Buchs, Switzerland) and used aspreviously described (6, 46). [Cl]i was measured as the differencebetween the Cl electrode and a KCl voltage electrode impaled intothe oocyte, and membrane potential (Vm) was measured as thedifference between the KCl microelectrode and an extracellular cal-omel. [Cl]i electrodes were calibrated using 10 and 100 mM NaCl,followed by a test of the specificity by using 100 mM NaHCO3 and apoint calibration in ND96 (pH 7.5). ND96 contained 96 mM NaCl, 2mM KCl, 1 mM MgCl2, 1.8 mM CaCl2, and 5 mM HEPES (pH 7.5).In solutions with 0 mM Cl (0Cl-ND96), Cl was replaced withgluconate. For solutions containing SO42, 10 mM NaCl or sodiumgluconate was replaced with 5 mM disodium sulfate (Na2SO4) and2.5 mM choline chloride or choline gluconate. For solutionscontaining oxalate, 0.75 ml of 133 mM disodium oxalate(Na2C2O4) were mixed with 99.25 ml ND96 or 0Cl-ND96 justbefore use, because ND96-containing oxalate formed precipitates ofcalcium oxalate after storage of several days. For solutions containingformate, 5 mM NaCl or sodium gluconate was replaced with 5 mMsodium formate (NaHCOO). For CO2/HCO3-equilibrated solutions,33 mM NaHCO3 was replaced with 33 mM NaCl or sodium gluconateand the solutions were bubbled with 5% CO2/95% O2 during theexperiments. All solutions were titrated to pH 7.5 at room temperatureusing NaOH and had an osmolality of 195200 mosmol/kg H2O.

Two-electrode voltage clamp analyses. Current-voltage (I-V) rela-tionships of cRNA or water-injected oocytes in the presence of testanions were analyzed as previously described (50). In brief, an oocytewas perfused with ND96, clamped at a holding potential (Vh) of 60mV and then perfused with ND96 containing 70 mM Cl (70Cl-ND96). After that, the oocyte was perfused with 70Cl-ND96 contain-ing 0.2 mM SO42, 70Cl-ND96 containing 1 mM SO42, 70Cl-ND96containing 5 mM SO42, and 70Cl-ND96 containing 15 mM SO42. Ateach change of solution, oocyte was perfused in solution until thecurrent (I) was stabilized, and the I-V relation was then recorded. Inthis way, sulfate-elicited currents were measured by addition of 0.2, 1,5, and 15 mM SO42 in 70Cl-ND96 or addition of 0.2, 1, 5, 15, and 48mM SO42 in ND96 containing 20 mM Cl (20Cl-ND96), and werecalculated as I(sulfate) I(no sulfate). Oxalate currents were measured byaddition of 0.2 and 1 mM oxalate in 70Cl-ND96 or 20Cl-ND96 andcalculated as I(oxalate) I(no oxalate). Formate currents were measuredby addition of 1 and 5 mM formate in 70Cl-ND96 or 20Cl-ND96 andcalculated as I(formate) I(no formate). HCO3 currents were mea-sured by addition of 33 mM HCO3/5% CO2 in ND96 containing 67.8mM Cl or 20Cl-ND96 and calculated as I(bicarbonate) I(no bicarbonate).

To prepare 70Cl-ND96 containing 15 mM SO42, 33.6 mM NaClwas replaced with 15 mM Na2SO4, 3.6 mM sodium gluconate, and 7.5mM choline gluconate or N-methyl-D-glucamine gluconate. To pre-pare 20Cl-ND96 containing 48 mM SO42, 96 mM NaCl was replacedwith 48 mM Na2SO4, 12.4 mM choline chloride, and 11.6 mMcholine gluconate or N-methyl-D-glucamine gluconate. 0Cl-ND96was prepared by replacing Cl with gluconate, and 70Cl-ND96 and20Cl-ND96 were prepared by mixing 0Cl-ND96 with ND96 contain-ing 103.6 mM Cl. The test solutions with differing SO42 concen-trations were prepared by mixing 70Cl-ND96 with 70Cl-ND96 con-taining 15 mM SO42 or 20Cl-ND96 with 20Cl-ND96 containing 48mM SO42. Other solutions containing oxalate, formate, and HCO3were prepared as described above. All solutions were titrated to pH7.5 at room temperature using NaOH and had an osmolality of195200 mosmol/kg H2O.

The oocyte currents were recorded with an OC-720C voltage clamp(Warner Instruments, Hamden, CT), filtered at 25 kHz, digitized at10 kHz, and recorded using Pulse software (HEKA, Lambrecht,Germany) as previously described (10). Experiments involving low orno Cl used 3 M KCl-agar bridges. The data were analyzed using thePulseFit program (HEKA). For periods when I-V protocols were not

being run, oocytes were clamped at a Vh of 60 mV, and current wasconstantly monitored and recorded at 1 Hz. I-V protocols consisted of200-ms steps from Vh in 20 mV steps between 140 and 60 mV.Data were expressed as means SE. Significant differences at P

0.01 or P 0.05 were determined by two-sample Students t-testassuming unequal variance.

RESULTS

Identification of candidate sulfate transporters by databasemining. The database of The Human Genome OrganisationNomenclature Committee provides a list of 46 solute transporterfamilies and 360 transporter genes (http://www.genenames.org/and http://www.bioparadigms.org/slc/menu.asp) (14). Membersof the solute carrier families SLC13 (31) and SLC26 (34) havesulfate transport activities. We therefore searched the T. ru-bripes genome sequence for homologs of the human SLC13and SLC26 family members and identified 14 candidatesequences in the fugu genome (Table 2). Since the membersof the Slc26 family can also act as HCO3 transporters, theyhad already been characterized in our previous study thatidentified intestinal HCO3 transporters upregulated in SWmefugu (27). Thus, the present study extends this analysis tothe kidney and SO42 transport kinetics of these Slc26 familymembers.

Selection of candidate clones by Northern blot analysis.Partial cDNA clones for the 14 candidate transporters pre-dicted by database mining (5 Slc13 family members and 9Slc26 family members, Table 2 and Fig. 1A) were obtainedby RT-PCR by using RNA preparations from kidney of SWmefugu, sequenced, and used as probes for Northern blotanalysis. Among the candidates, eight clones were ex-pressed in the mefugu kidney: mfSlc13a1 (scaffold 3041),mfSlc13a5 (scaffold 1026), mfSlc26a1 (scaffold 281),mfSlc26a5 (scaffold 3467), mfSlc26a6A (scaffold 1951),mfSlc26a6B (scaffold 216), mfSlc26a6C (scaffold 1034),and mfSlc26a11 (scaffold 591). Notably, only the mRNAlevel of mfSlc26a6A was strongly induced by SW (Fig. 1, B

Table 2. Tiger puffer (Takifugu rubripes) cDNA clones thatare homologous to SLC13 and SLC26 family membersFamily Scaffold Number Name Protein ID

Slc13 3041 FRUP00000136782 17015(Slc13a1)

102 FRUP00000148450 526238 FRUP00000134070 13061154 FRUP00000162965 6429

1026 FRUP00000141271 641Slc26 1951 FRUP00000158198 9980

(Slc26a6A)216 FRUP00000149917 11617

(Slc26a6B)1034 FRUP00000131543 761

(Slc26a6C)3467 FRUP00000144973 192641679 FRUP00000133437 76294271 FRUP00000153559 22971281 FRUP00000138439 15611

(Slc26a1)1062 FRUP00000161459 1119591 FRUP00000137551 29167

The result of a BLAST search at the web site http://genome.jgi-psf.org/fugu6/fugu6.home.html showed that there are 5 Slc13 clones and 9 Slc26clones.

R1649SULFATE EXCRETION TRANSPORTERS IN MARINE TELEOST



Dow

nloaded from

and C), making it the most likely candidate for renal SO42excretion. This result was confirmed by quantitative real-time PCR, which demonstrated that the expression ofmfSlc26a6A in the kidney of SW mefugu is 30 2.9 timeshigher than those of FW mefugu (Fig. 1C, P 0.01, n 5).

mfSlc26a6A and mfSlc26a6B are electrogenic Cl/SO42exchangers with distinct activities. Oocytes were injectedwith mfSlc26a6A, mfSlc26a6B, and mouse Slc26a6(mSlc26a6) cRNAs, and their cytosolic chloride concentra-tion ([Cl]i) was monitored in response to exposure toCl-free medium (Fig. 2A). Mouse Slc26a6 (mSlc26a6) wasused as a positive control. Exposure to 5 mM SO42 eliciteda hyperpolarization (23.2 2.6 mV, n 3, formfSlc26a6A; 4.5 1.1 mV, n 3, for mfSlc26a6B; and5.3 1.4 mV, n 3, for mSlc26a6) but not in con-trol (water-injected) oocytes. In oocytes expressingmfSlc26a6A, mfSlc26a6B, and mSlc26a6, Cl removalcaused marked reduction of [Cl]i (29.6 5.1 M/s, n 3, for mfSlc26a6A; 10.6 3.3 M/s, n 3, formfSlc26a6B; and 10.3 4.1 M/s, n 3, for mSlc26a6)and a marked hyperpolarization (91.9 10.6 mV, n 3, for

mfSlc26a6A; 68.5 12.3 mV, n 3, for mfSlc26a6B; and81.2 9.0 mV, n 3, for mSlc26a6). Readdition of Clelicited depolarization and recovery of [Cl]i. Control oocytesdid not show these responses with sequential removal andreaddition of Cl. These results indicate that both Slc26a6Aand Slc26a6B mediate electrogenic Cl/SO42 exchange. Theelectrophysiological parameters determined here for the posi-tive control, mSlc26a6, are within ranges equivalent to thosereported previously (56).

To determine whether the activities of mfSlc26a6A,mfSlc26a6B and mSlc26a6 differed, we analyzed I-V rela-tionships using two-electrode voltage-clamp. SO42 (0.2, 1,5, 15, and 48 mM) elicited outwardly rectifying currents inoocytes expressing mfSlc26a6A, mfSlc26a6B, andmSlc26a6 (Fig. 2B and Fig. 3), and these data also supportthe electrogenic nature of Cl/SO42 exchange. Low Clconcentration (20 mM) reduced the rectification ofmfSlc26a6A and yielded nearly linear I-V curves. Remark-ably, the SO42 current of mfSlc26a6A oocytes were muchgreater than those of mfSlc26a6B and mSlc26a6 oocytes(Fig. 2B and Fig. 4). For example, the currents of

Fig. 1. Phylogenetic tree of SO42 transporters (Slc13 and Slc26) and their mRNA expression levels. A: scaffold numbers of sulfate transporters (Slc13 and Slc26)identified in the fugu genome sequences. Results of the Fugu BLAST search revealed that there are 5 Slc13 clones and 9 Slc26 clones. Neighbor-joining trees(47) were constructed based on the deduced amino acid sequences of Slc13 and Slc26 from mammals. The bootstrap values from a 5,000-replicate analysis aregiven as % at the nodes. Accession numbers (h, human) are as follows: hSLCA1, AF260824; hSLCA2, U26209; hSLCA3, AF154121; hSLCA4, AF169301;hSLCA5, AY151833; hSLC26A1 (Sat-1), AF297659; hSLC26A2 (DTDST), NM_000112; hSLC26A3 (DRA), NM_000111; hSLC26A4, NM_000441;hSLC26A5, AF523354; hSLC26A6, NM_022911; hSLC26A7, AF331521; hSLC26A8, AF331522; hSLC26A9, AF331525; hSLC26A11, AF345195. Phylo-genetic trees were constructed using the Clustal W computer program. The scale bar represents a genetic distance of 0.1 amino acid substitutions per site. B: themRNA expression levels of candidate transporters for SO42 secretion were examined by Northern blot analysis. Total RNA (20 g) was blotted for Northernanalysis. C: real-time PCR quantification of mRNA paralogs: mfSlc26a6A, mfSlc26a6B, mfSlc26a6C, mfSlc26a1, mfSlc13a1; and glutaraldehyde phosphatedehydrogenase (GAPDH). Values are means SE of relative expression compared with values of seawater (S) mefugu. Values in gray bars represent expressionlevels relative to that of GAPDH. F, freshwater. *P 0.01.




Dow

nloaded from

mfSlc26a6A oocytes were approximately 35 A at 60mV (50 to 200 times larger than those of mfSlc26a6B andmSlc26a6 oocytes; P 0.01, n 3 6 for each condition).SO42 steady-state kinetics were calculated from theMichaelis-Menten equation (Fig. 5). The Imax value ofmfSlc26a6A for SO42 (63.8 4.0 A) was 86 to 100 timeshigher than those of mfSlc26a6B and mSlc26a6 (0.63 0.18 A for mfSlc26a6B and 0.74 0.19 A for mSlc26a6)when [Cl]out is 70 mM (P 0.01, n 4 for eachcondition) and is 10 to 15 times greater than those of theothers when [Cl]out is 20 mM (47.6 5.0 A formfSlc26a6A; 4.9 0.37 A for mSlc26a6; and 3.2 0.71A for mSlc26a6; P 0.01, n 3 6 for each condition).mfSlc26a6A also showed approximately twofold higherSO42 affinity than mfSlc26a6B and mSlc26a6 when[Cl]out was 70 mM (Km 5.3 0.9 mM for mfSlc26a6A;11.7 6.6 mM for mSlc26a6; and 12.7 5.9 mM formSlc26a6). The SO42 affinity was 15-fold greater affinitythan mfSlc26a6B and mSlc26a6 when [Cl]out was 20 mM(Km 1.7 0.8 mM for mfSlc26a6A; 29.5 9.2 mM formSlc26a6; and 19.4 10.2 mM for mSlc26a6). However,reduction of [Cl]out from 70 mM to 20 mM did not change

Imax (mfSlc26a6A), did reduce Km (mfSlc26a6A) threefold,but increased both Imax and Km of mfSlc26a6B andmSlc26a6.

Other transport activities of mfSlc26a6A and mfSlc26a6B.Mammalian Slc26a6 transports several anions such asHCO3, SO42, formate, and oxalate (18, 23, 56). We haveshown that mfSlc26a6A and mfSlc26a6B are electrogenicCl/nHCO3 exchangers (27) and electrogenic Cl/SO42exchangers (above). Therefore, we next tested whethermfSlc26a6A and mfSlc26a6B transported oxalate and for-mate and compared their activities to those of mSlc26a6.[Cl]i was monitored in response to Cl-removal in thepresence of formate or oxalate.

Exposure of the oocytes to 1 mM oxalate in the presence ofnormal-bath Cl (104 mM) did not affect the [Cl]i; it didelicit a small hyperpolarization (6.1 1.2 mV, n 3, formfSlc26a6A; 4.5 1.4 mV, n 3, for mfSlc26a6B; and1.4 0.2 mV, n 3, for mSlc26a6) but not in controloocytes (Fig. 6A). In oocytes expressing mfSlc26a6A,mfSlc26a6B, and mSlc26a6, Cl removal in the presence of1 mM oxalate caused marked reduction of [Cl]i (18.2 6.0M/s, n 3, for mfSlc26a6A; 9.9 2.8 M/s, n 3, for

Fig. 2. SO42 transport mediated bymfSlc26a6A, mfSlc26a6B, and mouseSlc26a6 (mSlc26a6). A: representative tracesof intracellular Cl concentration ([Cl]i)and membrane potential (Vm) of oocytes in-jected with mfSlc26a6A (blue), mfSlc26a6B(red), mSlc26a6 (black), or water (gray) areshown. In the continuous presence of 5 mMSO42, the Cl/SO42 exchange activitieswere monitored as changes in [Cl]i and Vmwhen extracellular Cl was removed (greyshading) and readded. Results for solutionchanges from 70 mM Cl ND96 (70Cl-ND96) with 70Cl-ND96 containing 5 mMSO42 are indicated by white boxes; resultsfor solution changes to Cl-free solution (0Cl) are indicated by gray boxes. Numbersbelow [Cl]i traces are the initial rates ofchanges in [Cl]i (M/s). B: current-voltage(I-V) relationships of oocytes expressingmfSlc26a6A (blue), mfSlc26a6B (red), andmSlc26a6 (black), and control oocytes (gray)in the presence of 5 mM SO42 and 70 mMCl (solid line) or 5 mM SO42 and 20 mMCl (dotted line) (holding potential, 60mV). Right: modified version of the left axisin which the vertical axis has been expandedto show weak activities of mfSlc26a6B andmouse Slc26a6. Values are means SE, n 36. Sulfate-elicited currents were calculatedas I(sulfate) I(no sulfate).




Dow

nloaded from

mfSlc26a6B; and 27.5 7.6 M/s, n 3, for mSlc26a6)and a marked hyperpolarization (61.5 8.4 mV, n 3, formfSlc26a6A; 65.2 3.4 mV, n 3, for mfSlc26a6B; and59.9 6.1 mV, n 3, for mSlc26a6). Cl readdition eliciteda depolarization and recovery of [Cl]i. Control oocytes did notshow any of these responses with Cl removal and readdition.

These results indicate that the mefugu and mouse Slc26a6 para-logs mediate electrogenic Cl/oxalate2 exchange.

Likewise, exposure to 5 mM formate (normal-bath Cl) did notaffect either [Cl]i or Vm of oocytes expressing mfSlc26a6A,mfSlc26a6B, and mSlc26a6 (Fig. 6B). Cl removal (with bathformate) caused marked reduction of [Cl]i (121 14 M/s,

Fig. 3. SO42 dose response: I-V relationships. I-V curves from oocytes expressing mfSlc26a6A (A), mfSlc26a6B (B), and mouse Slc26a6 (C) and water-injectedoocytes (D) in the presence of various SO42 concentrations (holding potential, 60 mV) are shown. Results in the presence of 70 and 20 mM Cl are showntop and bottom, respectively. Values are means SE, n 36. Sulfate-elicited currents were calculated as I(sulfate) I(no sulfate).

Fig. 4. Comparison of currents elicited byHCO3, oxalate, and SO42 in oocytes ex-pressing mfSlc26a6A, mfSlc26a6B, andmSlc26a6. The relative currents at 60 mVcompared with the mean SE of the currentsof mfSlc26a6A oocytes at the same condi-tions were calculated and are shown, n 36. The solution conditions are indicated atthe bottom. *P 0.01; **P 0.05.




Dow

nloaded from

n 3, for mfSlc26a6A; 105 6.1 M/s, n 3, formfSlc26a6B; and 89.1 8.8 M/s, n 3, for mSlc26a6) butdid not show a corresponding hyperpolarization. Cl readditionresulted in recovery of [Cl]i. Again, control oocytes did not showthese responses with the same experimental manipulation. These

results indicate that mfSlc26a6A, mfSlc26a6B, and mSlc26a6mediate electroneutral Cl/formate exchange.

To compare the transport activities of mfSlc26a6A,mfSlc26a6B, and mSlc26a6 in more detail, we analyzed I-Vrelationships in the presence of formate or oxalate. In the

Fig. 5. Steady-state kinetics of SO42 trans-port. A: the Michaelis-Menten equation fittedto sulfate-elicited currents of oocytes express-ing mfSlc26a6A, mfSlc26a6B, and mSlc26a6at 60 mV. Sulfate-elicited currents weremeasured by addition of 0.2, 1, 5, and 15 mMSO42 in the presence of 70 mM Cl or addi-tion of 0.2, 1, 5, 15, and 48 mM SO42 in thepresence of 20 mM Cl and were calculated asI(sulfate) I(no sulfate). Maximum current (Imax)and Michaelis-Menten constant (Km) areshown. Values are means SE, n 36. Imaxand Km values as a function of Vm are shown inB and C, respectively.




Dow

nloaded from

Fig. 6. Formate and oxalate transport mediated bymfSlc26a6A, mfSlc26a6B, and mSlc26a6. A andB: representative traces of intracellular Cl concen-tration ([Cl]i) and Vm of oocytes injected withmfSlc26a6A (blue), mfslc26a6B (red), mSlc26a6(black), and water (gray) are shown. In the continu-ous presence of 1 mM oxalate (A) and 5 mM formate(B), the Cl/oxalate and Cl/formate exchange ac-tivities were monitored as changes in [Cl]i and Vmwhen extracellular Cl was removed (grey shading)and readded. Results for solution changes from 70mM-Cl ND96 (70Cl-ND96) to 70Cl-ND96 contain-ing 1 mM oxalate or 5 mM formate are indicated bywhite boxes, and results for solution changes toCl-free solution are indicated by gray boxes. CF: I-V relationships of oocytes in the presence of 1mM oxalate (C), 0.2 mM oxalate (D), 5 mM formate(E), or 33 mM HCO3/5% CO2 (F) (holding potential,60 mV). Values are means SE, n 34. Cur-rents elicited with oxalate, formate, or HCO3 weremeasured in the presence of 70 and 20 mM Cl (solidand dotted lines, respectively) and calculated asI(oxalate) I(no oxalate), I(formate) I(no formate), andI(bicarbonate) I(no bicarbonate).




Dow

nloaded from

presence of 1 mM (data not shown) or 5 mM (Fig. 6E) formate,oocytes expressing mfSlc26a6A, mfSlc26a6B, and mSlc26a6did not display currents different than water-injected oocytes.Moreover, these same Slc26a6 oocytes did have obvious I-Vresponses when tested for SO42 transport. These data furthersupport the electroneutral nature of Cl/formate exchange bythese Slc26a6-transporters. In contrast, oxalate (0.2 or 1 mM)elicited outwardly rectifying currents in oocytes expressingmfSlc26a6A, mfSlc26a6B, and mSlc26a6 (Fig. 6, C and D).Likewise, these data indicate the electrogenic nature of Cl/oxalate exchange of these Slc26a6-transporters. In all cases,the currents were enhanced at lower Cl concentration (20mM) and higher oxalate concentration (1 mM). The I-V curvesof oocyte expressing mfSlc26a6A, mfSlc26a6B, and mSlc26a6were almost the same, except for one exception. Only for thecase of 20 mM Cl and 1 mM oxalate at 60 mV did oocytesexpressing mfSlc26a6A show 1.4 to 2.0 times larger currentthan oocytes expressing mfSlc26a6B and mSlc26a6 (Fig. 4, P

0.05, n 3). I-V relationships in the presence of 5% CO2/33mM HCO3 were also analyzed; these are shown in Fig. 6F.

Functional analyses of mfSlc26a6C. Oocytes were injectedwith mfSlc26a6C cRNA, and their cytosolic chloride concen-trations and pH were monitored in response to exposure toCl-free medium in the presence of HCO3, SO42, formate,and oxalate. However, oocytes expressing mfSlc26a6C showedno changes in [Cl]i, pHi, or Vm (data not shown). Theseresults suggest that mfSlc26a6C is not an anion exchanger, andfurther analyses are necessary to determine the function of thisprotein.

Immunohistochemical localization of mfSlc26a6A in the SWmefugu kidney. Sections of the kidney of SW mefugu wereanalyzed by immunofluorescence. Three types of tubules(proximal tubule, distal tubule, and collecting duct) are presentin mefugu kidney (20), and each type of tubule is distinguishedby anti-Na-K-ATPase staining (20, 28). Costaining ofmfSlc26a6A and Na-K-ATPase showed that mfSlc26a6Aexists in the apical membrane of proximal tubule epithelialcells (Fig. 7, C and F), through which SO42 is thought to besecreted (40, 44). Additionally, mfSlc26a6A also localizes tothe brush-border region of the proximal tubules, which arestained with phalloidin (Fig. 7, G and H). Phalloidin binds toactin filaments, and strongly stains a well-developed apicalbrush border of proximal tubules (20). No such signals wereobserved when the tissues were stained with preimmune serumas a negative control. The specificity of these antibodies wasestablished by specific staining of mammalian culture cells(COS7) exogenously expressing the antigens (27).DISCUSSION

Marine teleosts maintain body fluid homeostasis by drinkingSW and eliminating excess ions. Sulfate (SO42) is the secondmost abundant anion in SW, present at an average of27 mM.It is estimated that the rate of SO42 ingestion through SWdrinking in marine fish is 30150 mol kg1 h1 (33). Thisingestion rate is much greater than the catabolic generation ofSO42 from the sulfur-containing amino acids (estimated to be4 to 13 mol kg1 h1 under fasting conditions) (22, 55).Marine teleosts must therefore continually eliminate this ex-

Fig. 7. Immunohistochemistry of mfSlc26a6A in the kidney of SW-acclimated mefugu. AF: sections of mefugu kidney were stained with anti-mfSlc26a6A(green), anti-rat Na-K-ATPase (red), and Hoechst 33258 (nucleus, blue). Scale bars: 50 m. P, proximal tubule; D, distal tubule. G and H: sections of kidneywere stained with anti-mfSlc26a6A (green), phalloidin (red), and Hoechst (blue). Bars: 50 m.




Dow

nloaded from

cess SO42 through the kidney to keep the plasma [SO42] at anormal physiological concentration (2 mM). Similar han-dling of sulfate may occur in other marine vertebrates thatdrink SW, including certain species of marine mammals (36).It is known that the bladder urine [SO42] is 4080 mM inmarine teleosts, which is created by SO42 secretion fromepithelial cells of the renal proximal tubules (33). However, thetransporter(s) involved in the epithelial secretion of SO42 havenot been determined. In this study, by using genome resourcesof Takifugu and its related euryhaline species mefugu, weidentified candidate transporters for SO42 in the kidney ofmarine teleosts.

Database mining demonstrated that fish have three paralogsfor Slc26a6: mfSlc26a6A, mfSlc26a6B, and mfSlc26a6C. Thecommonly studied mammals have a single gene for Slc6a6 thatgenerates two splice variants named Slc26a6a and Slac6a6b,and they are expressed in various tissues including the intestineand kidney. In vitro, Slc26a6 mediates exchange of variousanions such as sulfate (SO42), chloride (Cl), iodide (I),formate (HCOO), oxalate ([COO]2), hydroxyl ion (OH),and bicarbonate (HCO3). Comparative analyses between wild-type and Slc26a6/ mice have demonstrated that Slc26a6mediates oxalate-stimulated NaCl absorption and contributesto apical membrane Cl/base exchange in the kidney proximaltubule (53), to HCO3 secretion in the duodenum (53) andpancreatic duct (52), and to intestinal secretion of oxalate thatreduces the plasma [oxalate] and frequency of urinary stones

(17). In SW-acclimated mefugu, we found that the expressionof mfSlc26a6A is dramatically increased in the kidney (Fig. 1),as well as in the intestine (27). HCO3 secretion in the intestineis stimulated in marine teleosts; this facilitates the precipitationof Ca2 and Mg2 for rectal excretion (12, 13, 54). We haveproposed that mfSlc26a6A and mfSlc26a6B are the strongestcandidates for the transporters responsible for HCO3 secretion bythe intestine (27). In this study, we also propose that mfSlc26a6Ais the strongest candidate for SO42 secretion by the marine teleostkidney. Both results suggest that mfSlc26a6A is one of the keymolecules involved in SW acclimation of fish.

The mfSlc26a6A clone displayed extremely large SO42currents when expressed in Xenopus oocytes, i.e., the SO42-elicited current is 50100 times larger than those measuredfrom mfSlc26a6B or mSlc26a6. Immunohistochemical analy-ses demonstrated that the mfSlc26a6A protein localizes to theapical membrane of proximal tubules, where marine teleostssecrete SO42. Furthermore, among all SO42 transporters be-longing to the Slc13 and Slc26 families in the Takifugugenome, mfSlc26a6A exhibited the largest induction in the SWmefugu kidney. The mRNA expression level in the kidney ofSW mefugu is 2.3- and 140-fold greater than the other apicalSO42 transporters (mfSlc26a6B and mfSlc13a1), respectively.These findings strongly suggest that mfSlc26a6A mainly con-ducts SO42 at the apical proximal tubule membrane of marineteleosts and is the most likely candidate for the long-soughtrenal SO42 secretor of the marine teleost kidney (Fig. 8A).

Fig. 8. Hypothetical model for the epithelial secre-tion system for SO42 in SW fish kidney. A: in SWproximal tubular cells, Slc26a6A is localized to theapical membrane (Fig. 5). mfSlc26a6A acts as anelectrogenic Cl/SO42 exchanger, and the negativeVm may be the driving force for SO42 secretion.Brush-border membrane vesicles isolated from thekidney of SW fish have SO42/anion exchange activ-ities (37, 43, 44). The basolateral localization ofSlc26a1 in the proximal tubule of SW fish has notbeen directly demonstrated, but has been demon-strated in the kidney of FW fish (35) and mammals(19). The mode of action of Slc26a1 has also notyet been directly revealed, but studies of basolat-eral membranes isolated from SW fish (43) andmammals (26, 39) have proposed the electroneutralexchange of 2HCO3/SO42 or 2OH/SO42. B: hypo-thetical model of the SO42 reabsorption system inFW fish kidney based on the study of FW-acclimatedeel. In proximal tubular cells, Slc13a1 and Slc26a1are located in the apical and basolateral membranes,respectively (35). The model indicates that SO42reabsorption is driven by Na-K-ATPase. Stoichi-ometry of the ions transported by Slc13a1 is assumedto be the same as for mammalian orthologs (4). Nagradient dependent SO42 uptake has only been dem-onstrated by renal brush-border membrane (BBM)vesicles from avian and mammalian species (42, 49,51) but not by that of marine teleost (43), and theexpression of Slc13a1 disappeared in the kidney ofSW-acclimated eel (35). Therefore, the Na-dependent SO42 uptake is abolished in the proximaltubule of SW fish. TJ, tight junction.




Dow

nloaded from

For the secretion of SO42 into the primary urine, whichcontains high concentrations of SO42 (up to 80 mM), apowerful driving force is necessary. Since the exchange ofCl/SO42 causes a decrease in the intracellular negativecharge, the intracellular negative charge maintained by thesodium pump (Na-K-ATPase) will drive the electrogenicCl/SO42 exchange. Namely, as shown in Fig. 8A,mfSlc26a6A is an electrogenic Cl/SO42 exchanger, indirectlydriven by Na-K-ATPase. Because of the difficulty of mea-suring [SO42]in in oocytes, we were unable to determine thestoichiometry of Cl/SO42 exchange in the present study; if weassume a 1:1 stoichiometry, we can theoretically calculate themfSlc26a6A currents based on the following equation (Table 3).Slc26a6 ClSO4 Cl SO4

RT ln([Cl]in/[Cl]out) (1) FVm {RT ln([SO42]in/[SO42]out) (2) FVm}

where R is the gas constant, T is the absolute temperature, F isthe Faraday constant, ln is the natural log, Vm is the membranepotential, and ion is the electrochemical potential difference(Joules/mole). When we use this equation for the model of theproximal tubule of SW fish, we can estimate the ratio of[SO42] in the primary urine and the cytoplasm of the proximaltubule as [SO42]out/[SO42]in values. At the condition of equi-libria, the calculated [SO42]out/[SO42]in values are 167, 112,and 75 when Vm is 80, 70, and 60 mV, respectively,under the following assumptions: 1) [Cl]out is 140 mM, whichis similar to plasma [Cl] of SW-acclimated mefugu (20);2) [Cl]in is 20 mM, which is similar to cytosolic [Cl] ofmammalian proximal tubular cells (5, 16, 24); and 3) thetemperature is 293 K (20C). These thermodynamic calcula-tions suggest that mfSlc26a6A can concentrate SO42 in urineup to 40 mM when the [SO42]in is 0.24 to 0.53 mM. Theseresults of thermodynamic calculations fit well with the hypo-thetical model for the secretion of SO42 by the proximal tubule(Fig. 8A). In this calculation, the value of [SO42]out/[SO42]inincreases with higher values of [Cl]out/[Cl]in and lowervalues of Vm. Therefore 1) high Vm (negative inside) producedby Na-K-ATPase; 2) low cytoplasmic [Cl], which ispossibly secreted by chloride channel(s); and 3) high cytoplas-mic [SO42] of 1 mM, which is possibly supplied by baso-lateral Slc26a1 are sufficient for the apical secretion of SO42by mfSlc26a6A. To definitively establish its physiological role

in the renal sulfate secretion of marine teleosts, it will benecessary to demonstrate that the mfSlc26a6A can fulfill thenecessary function in vivo. It is worth mentioning, however,that our electrophysiological data obtained using the Xenopusoocyte expression system clearly demonstrate that mfSlc26a6Ahas the ability to excrete sulfate under conditions relevant tofluids in the renal tubules of teleost fish (sulfate being thedominant anion with Cl present).

In FW fish, SO42 is absorbed by the renal proximal tubulefor SO42 homeostasis. Not all SO42 is secreted, as low levelsof SO42 are necessary for biosyntheses of sulfated extracellu-lar matrix proteins such as chondroitin sulfate and keratansulfate. Recently, Nakada et al. (35) have demonstrated that theapical Na-SO42 cotransporter Slc13a1 (NaSi-1) and basolat-eral Cl/SO42 exchanger Slc26a1 (Sat-1) are upregulated inthe eel kidney during FW acclimation, and they proposed amodel of SO42 absorption by the FW teleosts kidney (35) (Fig.8B). However, this model has not been confirmed in mefugubecause the expression of mfSlc13a1 was relatively low andwas not induced in the kidney of FW-acclimated mefugu (Fig.1, B and C). In SW fish, we have proposed that mfSlc26a6A isthe apical Cl/SO42 exchanger for SO42 secretion by thekidney. Future studies should seek to identify the molecularentity that encodes the basolateral transporter mediating SO42entry to proximal tubule cells from blood vessels. The stron-gest candidate for this is Slc26a1; we base this claim on thefollowing observations. The expression of renal Slc26a1 is1) upregulated in FW eel but is detectable in SW eel atsignificant levels (35); 2) upregulated in rainbow trout whenNa2SO4 is injected (21); and 3) abundantly expressed in bothFW and SW mefugu (Fig. 1, B and C). These findings indicatethat Slc26a1 may have a role in basolateral, renal SO42transport in both FW and SW fish. Thus, it is likely that lowerintracellular SO42 concentrations are achieved by Slc26a6Afunction in SW (Fig. 8A), and higher intracellular SO42 con-centrations are achieved by Slc13a1 function in FW (Fig. 8B).The regulated action of these transporters creates a SO42concentration gradient across basolateral membranes, which inturn allows SO42 to move in opposite directions in SW andFW conditions, yet still using the same basolateral Slc26a1protein.

The striking SO42 activity differences between mfSlc26a6Aand mfSlc26a6B or mSlc26a6 are noteworthy, i.e., mfSlc26a6ASO42 currents are 10-fold higher than the other Slc26a6 trans-porters. In general, oocytes expressing ion transporters exhibitcurrents between several hundred nA to several A, and thoseexpressing ion channels exhibit currents between several dozen to100 A (6). Therefore, SO42-elicited current of mfSlc26a6A is ashigh as that of ion channels or a transporter with a very highturnover number such as ClC-4 or ClC-5 (38, 48). Interestingly,this high activity is specific for SO42 as the mfSlc26a6A currentselicited by other anions (HCO3 and oxalate) are much lower, i.e.,comparable to those of mfSlc26a6B and mSlc26a6. Further anal-yses on chimeric transporters of mfSlc26a6A, mfSlc26a6B, andmSlc26a6 could reveal a domain or motif that bears the SO42-specific activity of mfSlc26a6A.

Perspectives and SignificanceMarine teleosts avoid dehydration by continuously drinking

SW, which contains high concentrations of Ca2 and SO42.

Table 3. Calculations of [SO42]out/[SO42]in and [SO42]inunder various conditions of [Cl]in, [Cl]out, [SO42]out, andVm at the equilibria (slc26a6A 0) when the stoichiometryof Cl/SO42 exchange by mfSlc26a6a is supposed to be a 1:1

Vm, mV[Cl]out,

mM[Cl]in,

mM[SO42]out,

mM[SO42]in,

mM [SO42]out/[SO42]in

50 140 20 40 0.79 5160 140 20 40 0.53 7570 140 20 40 0.36 11280 140 20 40 0.24 16790 140 20 40 0.16 24770 140 5 40 0.09 44870 140 10 40 0.18 22470 140 20 40 0.36 11270 140 30 40 0.54 75

The temperature is supposed to be 293 K (20C). Vm, membrane potential.




Dow

nloaded from

The major portions of the Ca2 and SO42 burdens acquiredfrom drinking SW are eliminated by intestinal precipitation ofCa2 with bicarbonate and by renal excretion of sulfate,respectively, both of which involve Slc26a6A transport (27).Consistent with its broad ion specificity, Slc26a6A acts as abicarbonate transporter in the intestine, as demonstrated in ourprevious work (27), and a sulfate (SO42) transporter in thekidney (present study) depending on the surrounding ionicconditions. It therefore seems that the substrate promiscuity ofa single gene product, Slc26a6A, is an effective strategy formarine teleosts to perform different tasks in different tissues. Inthis context, determination of the mechanism by which theSlc26a6A gene expression is regulated in the intestine andkidney is an important issue to be addressed in future studies.The molecular mechanisms for the elimination of ionic burdensacquired by drinking SW, have been clarified at the molecularlevel for the following major ions: Na, Cl (for reviews, seeRefs. 11, 15, 32), Ca2 (27), SO42 (present study). The majorunresolved issues in euryhaline adaptation are the molecularidentification of Mg2 and borate transporters. SW contains53 mM Mg2, and therefore marine fish are exposed tocontinuous Mg2 influx. The kidney plays a major role inMg2 excretion (130 mM in the urine of SW fish) (2, 3, 33),and the identification of Mg2 transporters involved in thisprocess is essential. SW also contains 0.4 mM borate, whichwould exert deleterious effects on marine teleosts without anefficient eliminating system.

ACKNOWLEDGMENTSWe thank Heather L. Holmes and Elyse M. Scileppi for technical support;

Dr. Taku Hirata, Dr. Kentaro Miyamoto, and Manami Matsuura-Nakada fortheir contribution in the early stage of this work; and Setsuko Sato and TomokoOkada for secretarial assistance.

Present address of T. Nakada: Molecular Pharmacology, Shinshu Univer-sity School of Medicine, Nagano, Japan.

GRANTSThis work was supported by the Ministry of Education, Culture, Sports,

Science, and Technology of Japan (MEXT) Grants-in-Aid for ScientificResearch 14104002, 17570003, 18059010, and 19770057 and the 21st Centuryand Global Center of Excellence Program of MEXT. Work in the Romero labwas supported by National Eye Institute Grant EY-017732 and Cystic FibrosisFoundation Grant 06G0 (to M. F. Romero).

DISCLOSURESNo conflicts of interest are declared by the author(s).

REFERENCES

1. Aparicio S, Chapman J, Stupka E, Putnam N, Chia JM, Dehal P,Christoffels A, Rash S, Hoon S, Smit A, Gelpke MD, Roach J, OhT, Ho IY, Wong M, Detter C, Verhoef F, Predki P, Tay A, LucasS, Richardson P, Smith SF, Clark MS, Edwards YJ, Doggett N,Zharkikh A, Tavtigian SV, Pruss D, Barnstead M, Evans C, BadenH, Powell J, Glusman G, Rowen L, Hood L, Tan YH, Elgar G,Hawkins T, Venkatesh B, Rokhsar D, Brenner S. Whole-genomeshotgun assembly and analysis of the genome of Fugu rubripes.Science 297: 13011310, 2002.

1a.American Physiological Society. Guiding principles for research involv-ing animals and human beings. Am J Physiol Regul Integr Comp Physiol283: R281R283, 2002.

2. Beyenbach KW. Renal handling of magnesium in fish: from wholeanimal to brush border membrane vesicles. Front Biosci 5: D712D719,2000.

3. Beyenbach KW, Freire CA, Kinne RK, Kinne-Saffran E. Epithelialtransport of magnesium in the kidney of fish. Miner Electrolyte Metab 19:241249, 1993.

4. Busch AE, Waldegger S, Herzer T, Biber J, Markovich D, Murer H,Lang F. Electrogenic cotransport of Na and sulfate in Xenopus oocytesexpressing the cloned Na SO42 transport protein NaSi-1. J Biol Chem269: 1240712409, 1994.

5. Cassola AC, Mollenhauer M, Fromter E. The intracellular chlorideactivity of rat kidney proximal tubular cells. Pflugers Arch 399: 259265,1983.

6. Chang MH, Plata C, Zandi-Nejad K, Sindic A, Sussman CR, MercadoA, Broumand V, Raghuram V, Mount DB, Romero MF. Slc26a9-anionexchanger, channel and Na transporter. J Membr Biol 228: 125140,2009.

7. Cliff WH, Beyenbach KW. Secretory renal proximal tubules in seawater-and freshwater-adapted killifish. Am J Physiol Renal Fluid ElectrolytePhysiol 262: F108F116, 1992.

8. Dawson PA, Beck L, Markovich D. Hyposulfatemia, growth retardation,reduced fertility, and seizures in mice lacking a functional NaSi-1 gene.Proc Natl Acad Sci USA 100: 1370413709, 2003.

9. Dickman KG, Renfro JL. Primary culture of flounder renal tubule cells:transepithelial transport. Am J Physiol Renal Fluid Electrolyte Physiol251: F424F432, 1986.

10. Dinour D, Chang MH, Satoh J, Smith BL, Angle N, Knecht A,Serban I, Holtzman EJ, Romero MF. A novel missense mutation inthe sodium bicarbonate cotransporter (NBCe1/SLC4A4) causes prox-imal tubular acidosis and glaucoma through ion transport defects.J Biol Chem 279: 52238 52246, 2004.

11. Evans DH, Piermarini PM, Choe KP. The multifunctional fish gill:dominant site of gas exchange, osmoregulation, acid-base regulation, andexcretion of nitrogenous waste. Physiol Rev 85: 97177, 2005.

12. Grosell M. Intestinal anion exchange in marine fish osmoregulation. J ExpBiol 209: 28132827, 2006.

13. Grosell M, Taylor JR. Intestinal anion exchange in teleost water balance.Comp Biochem Physiol A Mol Integr Physiol 148: 1422, 2007.

14. Hediger MA, Romero MF, Peng JB, Rolfs A, Takanaga H, BrufordEA. The ABCs of solute carriers: physiological, pathological and thera-peutic implications of human membrane transport proteins introduction.Pflugers Arch 447: 465468, 2004.

15. Hirose S, Kaneko T, Naito N, Takei Y. Molecular biology of majorcomponents of chloride cells. Comp Biochem Physiol B Biochem Mol Biol136: 593620, 2003.

16. Ishibashi K, Sasaki S, Yoshiyama N. Intracellular chloride activity ofrabbit proximal straight tubule perfused in vitro. Am J Physiol Renal FluidElectrolyte Physiol 255: F49F56, 1988.

17. Jiang Z, Asplin JR, Evan AP, Rajendran VM, Velazquez H, NottoliTP, Binder HJ, Aronson PS. Calcium oxalate urolithiasis in mice lackinganion transporter Slc26a6. Nat Genet 38: 474478, 2006.

18. Jiang Z, Grichtchenko II, Boron WF, Aronson PS. Specificity of anionexchange mediated by mouse Slc26a6. J Biol Chem 277: 3396333967,2002.

19. Karniski LP, Lotscher M, Fucentese M, Hilfiker H, Biber J, Murer H.Immunolocalization of sat-1 sulfate/oxalate/bicarbonate anion exchangerin the rat kidney. Am J Physiol Renal Physiol 275: F79F87, 1998.

20. Kato A, Doi H, Nakada T, Sakai H, Hirose S. Takifugu obscurus is aeuryhaline fugu species very close to Takifugu rubripes and suitable forstudying osmoregulation. BMC Physiol 5: 18, 2005.

21. Katoh F, Tresguerres M, Lee KM, Kaneko T, Aida K, Goss GG.Cloning of rainbow trout SLC26A1: involvement in renal sulfate secre-tion. Am J Physiol Regul Integr Comp Physiol 290: R1468R1478, 2006.

22. Kaushik SJ. Whole body amino acid composition of European seabass(Dicentrarchus labrax), gilthead seabream (Sparus aurata) and turbot(Psetta maxima) with an estimation of their IAA requirement profiles.Aquat Living Resour 11: 355358, 1998.

23. Knauf F, Yang CL, Thomson RB, Mentone SA, Giebisch G, AronsonPS. Identification of a chloride-formate exchanger expressed on the brushborder membrane of renal proximal tubule cells. Proc Natl Acad Sci USA98: 94259430, 2001.

24. Krapf R, Berry CA, Verkman AS. Estimation of intracellular chlorideactivity in isolated perfused rabbit proximal convoluted tubules using afluorescent indicator. Biophys J 53: 955962, 1988.

25. Krick W, Schnedler N, Burckhardt G, Burckhardt BC. Ability of sat-1to transport sulfate, bicarbonate, or oxalate under physiological conditions.Am J Physiol Renal Physiol 297: F145F154, 2009.

26. Kuo SM, Aronson PS. Oxalate transport via the sulfate/HCO3 exchangerin rabbit renal basolateral membrane vesicles. J Biol Chem 263: 97109717, 1988.




Dow

nloaded from

27. Kurita Y, Nakada T, Kato A, Doi H, Mistry AC, Chang MH, RomeroMF, Hirose S. Identification of intestinal bicarbonate transporters in-volved in formation of carbonate precipitates to stimulate water absorptionin marine teleost fish. Am J Physiol Regul Integr Comp Physiol 294:R1402R1412, 2008.

28. Lin CH, Tsai RS, Lee TH. Expression and distribution of Na, K-ATPasein gill and kidney of the spotted green pufferfish, Tetraodon nigroviridis,in response to salinity challenge. Comp Biochem Physiol A Mol IntegrPhysiol 138: 287295, 2004.

29. Markovich D. Physiological roles and regulation of mammalian sulfatetransporters. Physiol Rev 81: 14991533, 2001.

30. Markovich D, Aronson PS. Specificity and regulation of renal sulfatetransporters. Annu Rev Physiol 69: 361375, 2007.

31. Markovich D, Murer H. The SLC13 gene family of sodium sulphate/carboxylate cotransporters. Pflugers Arch 447: 594602, 2004.

32. Marshall WS. Na, Cl, Ca2 and Zn2 transport by fish gills: retro-spective review and prospective synthesis. J Exp Zool 293: 264283,2002.

33. Marshall WS, Grosell M. Ion transport, osmoregulation, and acid-basebalance. In: The Physiology of Fishes (3rd ed.), edited by Evans DH andClaiborne JB. Boca Raton, FL: CRC, 2006, p. 177230.

34. Mount DB, Romero MF. The SLC26 gene family of multifunctionalanion exchangers. Pflugers Arch 447: 710721, 2004.

35. Nakada T, Zandi-Nejad K, Kurita Y, Kudo H, Broumand V, KwonCY, Mercado A, Mount DB, Hirose S. Roles of Slc13a1 and Slc26a1sulfate transporters of eel kidney in sulfate homeostasis and osmoregula-tion in freshwater. Am J Physiol Regul Integr Comp Physiol 289: R575R585, 2005.

36. Ortiz RM. Osmoregulation in marine mammals. J Exp Biol 204: 18311844, 2001.

37. Pelis RM, Renfro JL. Role of tubular secretion and carbonic anhydrasein vertebrate renal sulfate excretion. Am J Physiol Regul Integr CompPhysiol 287: R491R501, 2004.

38. Picollo A, Pusch M. Chloride/proton antiporter activity of mammalianCLC proteins ClC-4 and ClC-5. Nature 436: 420423, 2005.

39. Pritchard JB, Renfro JL. Renal sulfate transport at the basolateralmembrane is mediated by anion exchange. Proc Natl Acad Sci USA 80:26032607, 1983.

40. Renfro JL. Adaptability of marine teleost renal inorganic sulfate excre-tion: evidence for glucocorticoid involvement. Am J Physiol Regul IntegrComp Physiol 257: R511R516, 1989.

41. Renfro JL. Recent developments in teleost renal transport. J Exp Zool283: 653661, 1999.

42. Renfro JL, Clark NB, Metts RE, Lynch MA. Glucocorticoid inhibitionof Na-SO4 transport by chick renal brush-border membranes. Am J PhysiolRegul Integr Comp Physiol 256: R1176R1183, 1989.

43. Renfro JL, Pritchard JB. H-dependent sulfate secretion in the marineteleost renal tubule. Am J Physiol Renal Fluid Electrolyte Physiol 243:F150F159, 1982.

44. Renfro JL, Pritchard JB. Sulfate transport by flounder renal tubule brushborder: presence of anion exchange. Am J Physiol Renal Fluid ElectrolytePhysiol 244: F488F496, 1983.

45. Romero MF, Fong P, Berger UV, Hediger MA, Boron WF. Cloningand functional expression of rNBC, an electrogenic Na-HCO3 cotrans-porter from rat kidney. Am J Physiol Renal Physiol 274: F425F432,1998.

46. Romero MF, Henry D, Nelson S, Harte PJ, Dillon AK, Sciortino CM.Cloning and characterization of a Na-driven anion exchanger (NDAE1).A new bicarbonate transporter. J Biol Chem 275: 2455224559, 2000.

47. Saitou N, Nei M. The neighbor-joining method: a new method forreconstructing phylogenetic trees. Mol Biol Evol 4: 406425, 1987.

48. Scheel O, Zdebik AA, Lourdel S, Jentsch TJ. Voltage-dependentelectrogenic chloride/proton exchange by endosomal CLC proteins. Na-ture 436: 424427, 2005.

49. Schneider EG, Durham JC, Sacktor B. Sodium-dependent transport ofinorganic sulfate by rabbit renal brush-border membrane vesicles. Effectsof other ions. J Biol Chem 259: 1459114599, 1984.

50. Sciortino CM, Romero MF. Cation and voltage dependence of rat kidneyelectrogenic Na-HCO3 cotransporter, rkNBC, expressed in oocytes.Am J Physiol Renal Physiol 277: F611F623, 1999.

51. Turner RJ. Sodium-dependent sulfate transport in renal outer corticalbrush border membrane vesicles. Am J Physiol Renal Fluid ElectrolytePhysiol 247: F793F798, 1984.

52. Wang Y, Soyombo AA, Shcheynikov N, Zeng W, Dorwart M, MarinoCR, Thomas PJ, Muallem S. Slc26a6 regulates CFTR activity in vivo todetermine pancreatic duct HCO3 secretion: relevance to cystic fibrosis.EMBO J 25: 50495057, 2006.

53. Wang Z, Wang T, Petrovic S, Tuo B, Riederer B, Barone S, LorenzJN, Seidler U, Aronson PS, Soleimani M. Renal and intestinal transportdefects in Slc26a6-null mice. Am J Physiol Cell Physiol 288: C957C965,2005.

54. Wilson RW, Wilson JM, Grosell M. Intestinal bicarbonate secretion bymarine teleost fishwhy and how? Biochim Biophys Acta 1566: 182193,2002.

55. Wood CM. Ammonia and urea metabolism and excretion. In: The Phys-iology of Fishes, edited by Evans DH. Boca Raton, FL: CRC, 1993,p. 379426.

56. Xie Q, Welch R, Mercado A, Romero MF, Mount DB. Molecularcharacterization of the murine Slc26a6 anion exchanger: functional com-parison with Slc26a1. Am J Physiol Renal Physiol 283: F826F838, 2002.

57. Yamanoue Y, Miya M, Matsuura K, Miyazawa S, Tsukamoto N, DoiH, Takahashi H, Mabuchi K, Nishida M, Sakai H. Explosive speciationof Takifugu: another use of fugu as a model system for evolutionarybiology. Mol Biol Evol 26: 623629, 2009.




Dow

nloaded from

jurnal fishew ii

Documents