kobe university repository : thesispres2 pres1 reverse transcriptase lipid bilayer hbcag dna...

Kobe University Repository : Thesis

学位論文題目Tit le

Hepat it is B virus derived carriers to effect ively express pharmaceut icalact ivity in target cancer cells(標的癌細胞において効果的な薬剤活性を発現するB型肝炎ウイルス由来キャリア)

氏名Author Nishimura, Yuya

専攻分野Degree 博士（工学）

学位授与の日付Date of Degree 2013-03-25

資源タイプResource Type Thesis or Dissertat ion / 学位論文

報告番号Report Number 甲5767

権利Rights

JaLCDOI

URL http://www.lib.kobe-u.ac.jp/handle_kernel/D1005767※当コンテンツは神戸大学の学術成果です。無断複製・不正使用等を禁じます。著作権法で認められている範囲内で、適切にご利用ください。

PDF issue: 2020-09-06

博士論文

Hepatitis B virus derived carriers to effectively express

pharmaceutical activity in target cancer cells

標的癌細胞において効果的な薬剤活性を発現する

B 型肝炎ウイルス由来キャリア

平成 25 年 1 月

神戸大学大学院

工学研究科応用化学専攻

西村勇哉

1

CONTENTS

Introduction

Synopsis

Part I.

Protein-encapsulated bio-nanocapsules production with ER

membrane localization sequences

Part II.

Complex carriers of affibody-displaying bio-nanocapsules and

composition-varied liposomes for HER2-expressing breast

cancer cell-specific protein delivery

Part III.

Targeting cancer cell-specific RNA interference by siRNA

delivery using a complex carrier of affibody-displaying

bio-nanocapsules and liposomes

Part IV.

An affinity chromatography method used to purify

His-tag-displaying bio-nanocapsules

Part V.

Granting specificity for breast cancer cells using a Hepatitis B

core particle with a HER2-targeted affibody molecule

General conclusion

Ackowledgments

Publication lists

1

16

21

44

74

95

109

131

134

136

1

INTRODUCTION

[Cancer treatment]

The cancer is the world’s third-biggest killer after heart and infectious

diseases, and about 7.5 million people die every year (Kievit, 2011). Although the

mechanism and treatments of the cancer have been studied over a long period, there

remain many unclear points due to its system complexity. In the drug treatment of the

cancer, major problems are described below (Kievit, 2011).

1) inability to bypass biological barriers

2) non-specific delivery and poor biological distribution of drug

3) ineffectiveness against metastatic disease

4) drug resistance of cancer

5) lack of an effective modality for treatment monitoring

To solve some of these problems, it is expected to apply nanotechnology as the

innovative treatment of the cancer (Galvin, 2012).

[Nanotechnology]

A nanotechnology is the multidisciplinary field to design nanodevices based

on the principles of chemistry, biology, physics and engineering. In the medicine field, it

is expected to benefit tremendously from a nanotechnology, and the study has already

progressed and is most progressive in oncology area. The benefits include the advances

of detection, imaging and treatment for diseases. In the nanotechnology fields,

nanoparticles (NPs) have the great potential to lead to paradigm shift of detection,

2

treatment and prevention especially for the treatment of cancer. Since NPs enable to

deliver drugs to the cancer stably and safely, it is expected to drastically improve the

effect of cancer treatment. Therefore, both universities and companies have focused on

the development of a novel NPs toward medical anti-cancer application (Siddiqui, 2012;

Tiwari, 2012).

NPs are the vesicular system to encapsulate drugs, and their sizes are 10

-1000 nm. However, >200 nm NPs are too heavy as the carrier, <200 nm NPs have been

frequently utilized. These <200 nm NPs are also expected to accumulate in tumor and

inflamed area selectively by enhanced permeability and retention (EPR) effect.

Therefore, this system can be available to deliver the drugs into specific tumor, improve

bioavailability and enable to the sustained release. Accordingly, the advantages of NPs

for drug delivery are provided through the characters of small sized and biodegradable

materials (Singh, 2009; Galvin, 2012; Tiwari, 2012).

[Drug delivery system]

It is important to optimize effects of medication and to reduce side effects for

the cancer in drug delivery system (DDS). Therefore, NPs have been developed as

carriers to deliver drugs effectively in a target-cell-specific manner. To use NPs as drug

carriers, mainly three functions are required as below (Fig. 1) (Nagai, 2005; Tabata,

2006).

1) Stabilization of drugs

To prevent the degradation and to keep the activity of drugs, various drugs

3

including low-molecular compounds, genes and proteins are incorporated into the

carriers.

2) Specificity to target cells

To minimize side effects and to maximize the effects of drugs, the carriers should

specifically recognize target tumors.

3) Expression of pharmaceutical activity

To express the activity of drugs effectively, it is required that the carriers arrive

in cell interior and release the drugs into cytoplasm or localize at nucleus.

The carrier with these functions is thought to be essential for effective cancer treatment.

[Bio-nanocapsule]

To establish efficient carrier system for drug delivery, a novel carrier based on

a hepatitis B surface antigen (HBsAg) derived from a hepatitis B virus (HBV) had been

developed. The HBV is an enveloped DNA virus of Hepadnaviridae. The HBV genome

encodes three envelope proteins: the S protein, the major constituent (226 amino acid

residues) of the HBV envelope protein and empty surface antigen (HBsAg) particles;

the M protein, containing 55 additional amino acid residues (pre-S2 peptide) at the

N-terminus of the S protein; and the L protein, containing 108 (subtype y) or 119

(subtype d) additional amino acid residues (pre-S1 peptide) at the N-terminus of the M

protein (Heermann, 1984; Tiollais, 1985; Neurath, 1998). The HBV specifically infects

only human and chimpanzee hepatocytes. It was reported that an attachment site of

HBV to the hepatocyte is located within the pre-S region (Fig. 2) (Neurath, 1989;

Pontisso, 1989; De Meyer, 1997).

4

Fig. 1. The main functions required for carriers of drug delivery system.

Release of drug

Endosome


drug


ligand Receptor


Nucleus

Cellular uptake

cytoplasm

Release of drug

Endosome


drug


ligand Receptor


Nucleus

Cellular uptake

cytoplasm

5

Fig. 2. Diagramatic illustration of Hepatitis B virus and Bio-nanocapsule. HBV is a

human liver-specific DNA virus, the 3.2-kbp genome of which harbors three

overlapping envelope genes in a single open reading frame. Depending on the three

translation initiation codons, three related transmembrane proteins are produced,

designated small (S), middle (M), and large (L). Bio-nanocapsule is hollow nano-sized

particle consisting of the L protein and a lipid bilayer. The L protein contains pre-S1,

pre-S2, and S regions. The S region is a transmembrane protein indispensable for the

formation of the particles. The pre-S1 region on the surface of an L particle is

responsible for the specific infection of human hepatocytes.

S

preS2

preS1

Reverse transcriptase

Lipid bilayerHBcAg

DNA

Hepatitis B Virus (HBV)

HBsAg

Bio-nanocapsule (BNC)

L protein

Lipid bilayer

PreS1 PreS2 SL protein

M protein

S protein

1 108 163 389 aa

S

preS2

preS1

Reverse transcriptase

Lipid bilayerHBcAg

DNA

Hepatitis B Virus (HBV)

HBsAg

Bio-nanocapsule (BNC)

L protein

Lipid bilayer

PreS1 PreS2 SL protein

M protein

S protein

1 108 163 389 aa

6

Bio-nanocapsules (BNCs) are hollow nanoparticles consisting of the L protein

and phospholipids derived from endoplasmic reticulum (ER) membrane with an average

diameter of approximately 100 nm (Fig. 2). BNCs can be formed in yeast, insect and

mammal cells through aggregation of L protein to ER membrane and the following

budding process (Kuroda, 1992; Yamada, 2001). We previously reported a novel

efficient gene and drug delivery using the BNC (Yamada, 2003; Yu, 2005; Iwasaki,

2007). The BNC has many advantages compared with conventional carriers. First, the

BNC shows a high transfection efficiency consistent with an original HBV. Second, the

BNC is very safe because it is free from viral genome. Third, relatively large materials

can be enclosed efficiently by using complex of BNC and liposome; therefore, BNCs

can deliver low-weight chemical compounds as well as 100 nm fluorescent beads and >

30 kbp plasmids (Jung, 2008). Furthermore, BNC possesses the specificity for human

hepatocytes. The in vitro and in vivo transfection experiments have demonstrated that

genes and drugs were specifically transferred into human hepatocytes with BNC.

To target other types of cells, further approaches to engineer specificity of

BNC have been developed. The pre-S region which has specific affinity for human

hepatocytes was genetically eliminated from the L-protein region. Then, the ZZ domain

derived from protein A, which has the affinity for the Fc region of immunoglobulin G

(IgG), was inserted and the ZZ domain-displaying BNC (ZZ-BNC) was prepared.

Because the antibodies can be immobilized on the BNC through binding to the ZZ

domain, the produced antibody-fusing BNC successfully presented the specific

recognition ability to the variety of target cells (Tsutsui, 2007). Furthermore, pre-S

region was genetically substituted with affibody molecule which is an altered Z domain

7

derived from Staphylococcal protein A (Fig. 3). The ZHER2, a type of affibody, has high

specificity to HER2 receptor (Nygren, 2008), which is a member of human epidermal

growth factor tyrosine kinase receptor family. Because HER2 is associated with

resistance to therapy and poor prognosis, it has been an attractive target for molecular

therapy (Witton, 2003; Chen, 2003). Therefore, the ZHER2-displaying BNC (ZHER2-BNC)

is expected to be available for in vivo and in vitro medical application.

[Research objective]

In this study, we developed the new types of engineered BNCs and the

methodologies to realize an oncoming generation anti-cancer therapy. For this, we

mainly focused on the specific delivery of the proteins and nucleotides to the target

cancer cells, and the expression of their functions inside the cells.

In Part 1, we tried to incorporate proteins into BNCs. Although it has

previously succeeded to incorporate low-molecular drugs and genes into BNCs, it is still

difficult to incorporate proteins into BNCs after particle formation due to their

higher-order structures. By focusing attention on the mechanism of particle formation

during the budding processes in the fungus body, we tried to incorporate target proteins

into BNCs. To do this, we used the green fluorescent protein (GFP) as model protein

and fused it to membrane localization sequence (MLS) of N-Ras, which can localize

protein on endoplasmic reticulum (ER) membrane. The MLS-fused GFP was

co-expressed with HBsAg in insect cells to establish the method for producing

protein-encapsulated BNCs.

8

Fig. 3. Genetic alteration of specificity for human hepatocytes on Bio-nanocapsule. The

engineered BNC was prepared by genetically substituted pre-S region with Affibody

(Affibody-BNC).

Affibody-displaying BNC

S

Affibody

S

49 160

Affibody

S

preS2

preS1

L protein

Affibody-displaying BNC

S

Affibody

S

49 160

Affibody

S

49 160

Affibody

S

preS2

preS1

L protein

9

While it is attractive to develop the method for encapsulating proteins into

BNCs, it is also important to demonstrate the abilities of BNCs for specifically

delivering various types of drugs and expressing their functions in target cells.

Therefore, we tried to deliver proteins (Part 2) and nucleic acids (Part 3) with

pharmaceutical activity and express their function in the target cells. To target breast

cancer carcinoma, which expresses excess amount of HER2 receptors, we chose

ZHER2-BNC as the carrier. Furthermore, we used the BNC/liposome (LP) conjugation

method that has been developed by Jung et al to incorporate not only proteins but also

nucleic acids into BNC effectively (Fig. 4).

In Part 2, we tried to deliver the cell cytotoxic exotoxin A as protein drugs to

HER2-expressing breast cancer cells and kill them. First, we evaluated the influence of

electric charge of LPs on this method. Next, we tried to escape ZHER2-BNC/LP from

endosome by mixing helper lipid, which is pH-sensitive phospholipid with the ability to

endosomal escape, to LP. And then, we demonstrated that the ZHER2-BNC/LP complex

carrier permitted cell-specific delivery and effective pharmaceutical activity.

Although the therapeutic effect of small interfering RNA (siRNA) as nucleic

acid medicine is greatly expected, inability to specifically reach target cells and to cross

the cell membrane limits its in vivo applications. In Part 3, therefore, we tried to lead to

the cell-specific RNA interference (RNAi) by delivering siRNA with the ZHER2-BNC/LP

complex carrier to HER2-expressing breast cancer cells. To facilitate evaluation of

RNAi, the siRNA for inhibiting the GFP expression was selected.

10

Fig. 4. Diagramatic illustration of Bio-nanocapsule/Liposome conjugation method. In

this method, target materials are pre-encapsulated to liposome, and then BNCs are fused

to the surface of the LP.

Complex carrier (BNC/LP)

Liposome formulationDrug solution injection

Dried lipid

materials

Liposome incorporating materials

Freeze-dried BNCs

Conjugation


Complex carrier (BNC/LP)

Liposome formulationDrug solution injection

Dried lipid

materials


Freeze-dried BNCs

Conjugation


11

Furthermore, we improved the purification method of BNCs. The purification

of BNC is laborious, and the yield and degree of purification are often not high enough

for commercial applications. Actually, although the conventional ultracentrifugation

method is available to purify various types of BNC, it has a serious problem with

moderate yield for cumbersome protocol. On the other hand, the affinity

chromatography method generally can offer high-yield purification but lacks versatility

to purifying BNCs, because it requires the optimal column suited to the antigens. In Part

4, therefore, we tried to establish the purification method of BNCs with affinity

chromatography by using histidine-tag (His-tag). We evaluated to permit simply and

high-yield purification of ZHER2-BNC by genetically fusing His-tag to ZHER2-BNC.

Finally, we developed a new type of carrier particle, which allows the

large-scale production in Escherichia coli and the purification with His-tag affinity

chromatography. The developed carrier is based on the capsid-like particle consisting of

a hepatitis B core protein (HBc). Generally, the hollow HBc particle, which is formed

by the self-assembly of HBc, has the ability to bind to various cells non-specifically via

the action of an arginine-rich domain. In Part 5, we therefore developed an engineered

HBc particle that specifically recognizes and targets HER2-expressing breast cancer

cells by despoiling the non-specific binding property and granting the target-cell

specific recognition ability to the HBc particle with ZHER2 affibody. By adapting a

variety of useful approaches in the establishment of engineered BNCs, the newly

engineered capsid-like HBc particle would become to more highly-sophisticated carrier

for DDS in near future.

12

REFERENCES

Chen, J.S., Lan, K., Hung, M.C., 2003. Strategies of target HER2/neu overexpression

for cancer therapy, Drug Resist Updat. 6, 129–136.

De Meyer, S., Gong, Z.J., Suwandhi, W., van Pelt, J., Soumillion, A., Yap, S.H., 1997.

Organ and species specificity of hepatitis B virus (HBV) infection: a review of literature

with a special reference to preferential attachment of HBV to human hepatocytes. J

Viral Hepat. 4, 145-153.

Galvin, P., Thompson, D., Ryan, K.B., McCarthy, A., Moore, A.C., Burke, C.S., Dyson,

M., Maccraith, B.D., Gun'ko, Y.K., Byrne, M.T., Volkov, Y., Keely, C., Keehan, E.,

Howe, M., Duffy, C., MacLoughlin, R., 2012. Nanoparticle-based drug delivery: case

studies for cancer and cardiovascular applications. Cell Mol Life Sci. 69(3), 389-404.

Heermann, K.H., Goldmann, U., Schwartz, W., Seyffarth, T., Baumgarten, H., Gerlich,

W.H., 1984. Large surface proteins of hepatitis B virus containing the pre-S sequence. J

Virol. 52, 396-402.

Iwasaki, Y., Ueda, M., Yamada, T., Kondo, A., Seno, M., Tanizawa, K., Kuroda, S.,

Sakamoto, M., Kitajima, M., 2007. Gene therapy of liver tumors with human

liver-specific nanoparticles. Cancer Gene Ther. 14, 74-81.

Jung, J., Matsuzaki, T., Tatematsu, K., Okajima, T., Tanizawa, K., Kuroda, S., 2008.

13

Bio-nanocapsule conjugated with liposomes for in vivo pinpoint delivery of various

materials. J Control Release. 126, 255-264.

Kievit, F.M., Zhang, M., 2011. Cancer nanotheranostics: improving imaging and

therapy by targeted delivery across biological barriers. Adv Mater. 23(36), 217-247.

Kuroda, S., Otaka, S., Miyazaki, T., Nakao, M., Fujisawa, Y., 1992. Hepatitis B virus

envelope L protein particles. Synthesis and assembly in Saccharomyces cerevisiae,

purification and characterization. J Biol Chem. 267, 1953-1961.

Nagai, T., 2005. Drug discovery and innovative drug delivery research in new drug

development. Pharm Tech Japan. 21, 1949-1951.

Neurath, A.R., Kent, S.B., Stick, N., Parker, K., 1986. Identification and chemical

synthesis of a host cell receptor binding site on hepatitis B virus. Cell. 46, 429-436.

Neurath, A.R., Kent, S.B., 1998. The pre-S region of hepadnavirus envelope proteins.

Adv Virus Res. 34, 65-142.

Nygren, P.A., 2008. Alternative binding proteins: affibody binding proteins developed

from a small three-helix bundle scaffold. FEBS J. 275, 2668–2676.

Pontisso, P., Ruvoletto, M.G., Gerlich, W.H., Heermann, K.H., Bardini, R., Alberti, A.,

1989. Identification of an attachment site for human liver plasma membranes on

14

hepatitis B virus particles. Virology. 173, 522-530.

Siddiqui, I.A., Adhami, V.M., Chamcheu, J.C., Mukhtar, H., 2012. Impact of

nanotechnology in cancer: emphasis on nanochemoprevention. Int J Nanomedicine. 7,

591-605.

Singh, R., Lillard, J.W. Jr., 2009. Nanoparticle-based targeted drug delivery. Exp Mol

Pathol. 86(3), 215-223.

Tabata, T., 2006. Drug delivery system: Basic technology for biomedical research,

medical treatment and health care. Biotechnology-Journal. 6, 553-555.

Tiollais, P., Pourcel, C., Dejean, A., 1985. The hepatitis B virus. Nature. 317, 489-495.

Tiwari, M., 2012. Nano cancer therapy strategies. J Cancer Res Ther. 8(1), 19-22.

Tsutsui, Y., Tomizawa, K., Nagita, M., Michiue, H., Nishiki, T., Ohmori, I., Seno, M.,

Matsui, H., 2007. Development of bionanocapsules targeting brain tumors. J Control

Release. 122, 159-164.

Witton, C.J., Reeves, J.R., Going, J.J., Cooke, T.G., Bartlett, J.M., 2003. Expression of

the HER1-4 familiy of receptor tyrosin kinase in breast cancer. J Pathol. 200, 290-297.

Yamada, T., Iwabuki, H., Kannno, T., Tanaka, H., Kawai, T., Fukuda, H., Kondo, A.,

15

Seno, M., Tanizawa, K., Kuroda, S., 2001. Physicochemical and immunological

characterization of hepatitis B virus envelope particles exclusively consisting of the

entire L (pre-S1 + pre-S2 + S) protein. Vaccine. 19, 3154-3163.

Yamada, T., Iwasaki, Y., Tada, H., Iwabuki, H., Chuah, M.K., VandenDriessche, T.,

Fukuda, H., Kondo, A., Ueda, M., Seno, M., Tanizawa, K., Kuroda, S., 2003.

Nanoparticles for the delivery of genes and drugs to human hepatocytes. Nat Biotechnol.

21, 885-890.

Yu, D., Amano, C., Fukuda, T., Yamada, T., Kuroda, S., Tanizawa, K., Kondo, A., Ueda,

M., Yamada, H., Tada, H., Seno, M., 2005. The specific delivery of proteins to human

liver cells by engineered bio-nanocapsules. FEBS J. 272, 3651-3660.

16

SYNOPSIS

PART I.

Protein-encapsulated bio-nanocapsules production with ER membrane localization

sequences

Bio-nanocapsules (BNCs) are hollow nanoparticles composed of the L

protein of hepatitis B virus (HBV) surface antigen (HBsAg), which can specifically

introduce genes and drugs into various kinds of target cells. Although the classic

electroporation method has typically been used to introduce highly charged molecules

such as DNA, it is rarely adopted for proteins due to its very low efficiency. In this study,

a novel approach to the preparation of BNC was established whereby a target protein

was pre-encapsulated during the course of nanoparticle formation. Briefly, because of

the process of BNC formation in a budding manner on the endoplasmic reticulum (ER)

membrane, the association of target proteins to the ER membrane with lipidation

sequences (ER membrane localization sequences) could directly generate

protein-encapsulating BNC in collaboration with co-expression of the L proteins. Since

the membrane-localized proteins are automatically enveloped into BNCs during the

budding event, this method can be protect the proteins and BNCs from damage caused

by electroporation and obviate the need for laborious consideration to study the optimal

conditions for protein encapsulation. This approach would be a useful method for

encapsulating therapeutic candidate proteins into BNCs.

17

PART II.

Complex carriers of affibody-displaying bio-nanocapsules and composition-varied

liposomes for HER2-expressing breast cancer cell-specific protein delivery

A bio-nanocapsule (BNC), a hollow particle composed of hepatitis B virus

(HBV) surface antigen (HBsAg), and liposome (LP) conjugation method (BNC/LP) has

been recently developed by Jung et al. (2008). The BNC/LP complex carrier could

successfully deliver fluorescence-labeled beads (100 nm) into liver cells. In this study,

we report the promising delivery of proteins incorporated in the complex carriers, which

were prepared by the BNC/LP conjugation method with specificity-altered BNC and

composition-varied LPs. The specificity-altered BNC, ZHER2-BNC was developed by

replacing the hepatocyte recognition site of BNC with ZHER2 binding to HER2 receptor

specifically. Using green fluorescent protein (GFP; 27 kDa) and cellular cytotoxic

protein (exotoxin A; 66 kDa) for the delivery, we herein present the impact of different

charges attributed to the composition of the LP on specific cell targeting and cellular

uptake of the complex carriers. In addition, we demonstrate that the mixture prepared by

mixing LPs with helper lipid possessing endosomal escaping ability boosts the

functional expression of the cellular cytotoxic exotoxin A activity specifically. Finally,

we further show the blending ratio of the LP mixture and ZHER2-BNC is a critical factor

in determining the highly-efficient expression of the cytotoxic activity of exotoxin A.

18

PART III.

Targeting cancer cell-specific RNA interference by siRNA delivery using a complex

carrier of affibody-displaying bio-nanocapsules and liposomes

Small interfering RNA (siRNA) has attracted attention in the field of nucleic

acid medicine as a RNA interference (RNAi) application that leads to gene silencing

due to specific messenger RNA (mRNA) destruction. However, since siRNA is unstable

in blood and unable to cross the cell membrane, encapsulation of siRNA into a carrier is

required. In this study, we used a carrier that combined ZHER2-displaying

bio-nanocapsule (derived from hepatitis B virus surface antigen) and liposomes in a

complex in order to investigate the feasibility of effective and target-cell-specific RNAi

applications. As a result, by observing RNAi only in HER2-expressing breast cancer

cells, using our proposed methodology, we successfully demonstrated

target-cell-specific delivery and effective function expression of siRNA.

19

PART IV.

An affinity chromatography method used to purify His-tag-displaying

bio-nanocapsules

A bio-nanocapsule (BNC) derived from hepatitis B virus (HBV) is expected

to be useful as a drug delivery system (DDS) carrier. Because various types of BNCs

have been developed, a simple and versatile purification method for BNCs would be

useful. Therefore, we planned to establish a simple purification method using affinity

chromatography by inserting a histidine tag (His-tag) into a BNC. The method achieved

a simple, one-step purification with a yield that was 2.5-fold higher than conventional

ultracentrifugation, and thus would be a desirable alternative method for BNC

purification.

20

PART V.

Granting specificity for breast cancer cells using a Hepatitis B core particle with a

HER2-targeted affibody molecule

Capsid-like particles consisting of a hepatitis B core protein (HBc) have

been studied for their potential as carriers for drug delivery systems (DDS). The hollow

HBc particle, which is formed by the self-assembly of core proteins comprising 183

amino acid residues, has the ability to bind to various cells non-specifically via the

action of an arginine-rich domain. In this study, we developed an engineered HBc

particle that specifically recognizes and targets HER2-expressing breast cancer cells. To

despoil the non-specific binding property of an HBc particle, we genetically deleted the

C-terminal 150-183 aa part of the core protein that encodes the arginine-rich domain (Δ

HBc). Then, we genetically inserted a ZHER2 affibody molecule into the 78-81 aa

position of the core protein to confer the ability of target-cell specific recognition. The

constructed a ZHER2-displaying HBc (ZHER2-ΔHBc) particle that specifically recognized

HER2-expressing SKBR3 and MCF-7 breast cancer cells. In addition, the ZHER2-ΔHBc

particle exhibited different binding amounts in accordance with the HER2 expression

levels of cancer cells. These results show that the display of other types of affibody

molecules on HBc particles would be an expandable strategy for targeting several kinds

of cancer cells that would help enable a pinpoint drug delivery system.

21

PART I.

Protein-encapsulated bio-nanocapsules production

with ER membrane localization sequences

22

INTRODUCTION

Over the past couple of decades, drug delivery systems (DDS) have been

intensively studied in order to improve the efficacy of chemotherapy and reduce its

adverse effects. The delivery of bioactive molecules such as genes, chemical

compounds and proteins to target cells is very significant for medical and biological

applications (Nagai, 2005; Tabata, 2006). For this reason, it is necessary to establish an

efficient carrier that ensures the internal stability of bioactive molecules, as well as their

delivery into the targeted cells.

The bio-nanocapsule (BNC) is an attractive carrier for the delivery of

bioactive molecules (Yamada et al., 2003). BNCs are hollow particles composed of the

L protein of the hepatitis B virus (HBV), surface antigen (HBsAg), and the lipid bilayer

derived from host cells (Kuroda et al., 1992). As carriers for drug delivery, these

virus-like particles have many advantages, as follows: high specificity for human

hepatocytes; high transfection efficiency, equivalent to the original HBV; reliable safety

arising from the absence of the viral genome; high stability in the blood; and, a high

capacity for encapsulation of genes and drugs (Yamada et al., 2003; Iwasaki et al., 2007;

Jung et al., 2008).

To target cells other than hepatocytes, the specificity of BNC can be altered

by genetic modifications. Varieties of specificity-altered BNCs have been produced by

deleting the preS region having specificity for hepatocytes in the L protein, and

inserting binding molecules targeting other cells (Kasuya et al., 2008; Kasuya et al.,

2009). Antibodies and peptides have often been selected as such affinity molecules. To

confer specificity for various kinds of cell surface receptors, antibody-mediated

23

targeting with the ZZ domain (derived from protein A) or with biotin, which binds to the

Fc region of immunoglobulin G (IgG) or streptavidin, has been developed as a practical

and versatile technique (Iijima et al., 2011; Shishido et al., 2009a). Similarly, affibody

molecules, which comprise a new class of affinity ligands derived from the Z domain

and bind a range of different proteins, e.g. insulin, HER2 and EGFR, were used as a

substitute for antibodies, while an arginine-rich peptide was displayed on BNC to

permit the delivery into various types of cells (Nygren, 2008; Shishido et al., 2009b).

As described above, BNCs are useful carriers to deliver drugs specifically to

different cell types. However, methods to encapsulate drugs into BNC have not been

studied extensively. Therefore, the classic electroporation method is commonly used for

this purpose (Yamada et al., 2003). Besides expensive equipment, this method requires

consideration of the appropriate conditions that affect the encapsulation efficiency

through various factors such as the intensity of electric voltage and pulse, temperature,

concentration of particles and drugs, and composition of buffers (Yamada et al., 2003).

Although electroporation has typically been used to introduce highly charged molecules

such as DNA, it is rarely adopted for proteins due to its very low efficiency.

Furthermore, many proteins, including pharmaceutical proteins, might suffer serious

damage from high voltage, because they have a tendency to be denatured and

agglutinated under severe conditions such as pH, heat and concentration (Chi et al.,

2003). Thus, a simple and effective method for encapsulating proteins into BNC without

using electroporation is needed.

In the present study, a novel approach to the preparation of BNC was

established, in which a target protein is pre-encapsulated in the course of particle

formation. We focused on the following mechanism for the formation of BNC (Fig.

24

1A): 1) L proteins localize and accumulate on the ER membrane; 2) aggregation of the

L proteins is initiated by the accumulated L proteins on the ER; 3) intermolecular

interactions trigger budding of the L particles; and, 4) hollow particles are formed

within the ER lumen by a nucleocapsid-independent extrusion process and then

exported from the cells via the vesicular transport pathway (Kuroda et al., 1992). BNC

is thus produced when budding forms on the ER membrane. Therefore, the working

assumption in the present study was that co-expression of the target proteins with the L

proteins that associate with the outer leaflet of the ER membrane (cytoplasm side) by

lipid modification could encapsulate the target proteins into the BNC, and would be

accompanied by the formation of particles (Fig. 1B). As a means for this approach,

lipidation sequences (membrane localization sequences; MLSs) derived from N-Ras,

which cause prenylation in the CAAX motif (Choy et al., 1999), were added to the

C-terminal of the target proteins. Since the ER membrane-localized target proteins were

automatically embedded in the BNC during the formation process, this approach never

required laborious consideration of the electroporation conditions after the preparation

of hollow BNC particles, despite procedures identical to the previous process for the

production and purification of BNC. We verified the feasibility of this strategy to

encapsulate the target proteins into the BNC with lipidation motifs.

25

Fig. 1. Schematic illustration for the process of BNC formation in insect cells. (A) A

common process of BNC formation. Translated L proteins are accumulated on the ER

membrane and aggregated by intermolecular interaction. Hollow particles are released

via budding events by self-assembly into the side of the ER lumen. (B) A strategy for

direct production of protein-encapsulating BNC. Since target proteins are localized on

the ER membrane by lipid modification, they are easily encapsulated inside BNC

through the same process of common particle formation.

26

MATERIALS AND METHODS

Construction of plasmids for the expression of membrane-localized proteins in insect

cells

MLS1 and MLS2 derived from N-Ras were selected as the lipidation

sequences (Sato et al., 2006). The plasmids for expression of the enhanced green

fluorescent protein (EGFP), attached with MLS1 or MLS2 in insect cells, were

constructed as described below (Fig. 2A). The fragments encoding the EGFP-MLS1 or

EGFP-MLS2 fusion gene were amplified by polymerase chain reaction (PCR) from

pEGFP (Takara Bio, Shiga, Japan) with the following primers: EGFP-MLS1

(5’-GGGGGATCCATGGTGAGCAAGGGCGAGGA-3’ and 5’-

GGGCCGCGGTTACATCACCACGCAGGGCAGGCCCATGCAGCCCTGCTTGTAC

AGCTCGTCCATGC-3’) and EGFP-MLS2

(5’-GGGGGATCCATGGTGAGCAAGGGCGAGGA-3’ and 5’-

GGGCCGCGGTTACATCACCACGCAGGGCAGGCCCATGGAGCCCTGCTTGTAC

AGCTCGTCCATGC-3’). The amplified fragments were digested with BamHI/SacII

and ligated into the pXIHAbla (Shishido et al., 2009c) (Fig. 2B). The resulting plasmids

were designated as pXIHAbla-EGFP-MLS1 and pXIHAbla-EGFP-MLS2. The

previously constructed plasmid pXIHAbla-EGFP (Shishido et al., 2009c) was used for

the expression of cytosolic EGFP in a comparative expression manner. In contrast,

plasmid pX-ML (Shishido et al., 2006) was used for the co-expression of BNC with

these plasmids in insect cells (Fig. 2C).

27

Fig. 2. Schematic representation of constructs to localize target proteins on the ER

membrane of insect cells. ER membrane-localized proteins would be easily

encapsulated into BNCs. (A) EGFP was used as a model for the target proteins. MLS1

and MLS2 derived from N-Ras were reported to localize on plasma or on the ER

membrane in mammalian cells. Gray characters indicate the amino acid residues

involved in lipid modifications. (B) Insect cell shuttle vector for expression of EGFP,

EGFP-MLS1 and EGFP-MLS2. (C) Expression vector for secretion of BNC in insect

cells.

28

Transfection of plasmids for the expression of EGFP-MLSs and/or BNC

A Trichoplusia ni BTI-TN-5B1-4 insect cell line (High Five) (Invitrogen,

Carlsbad, CA, USA) was maintained in a serum-free medium (Express Five SFM)

(Invitrogen) supplemented with 0.26 g/L L-glutamine and 10 mg/L gentamicin

(Invitrogen) at 27 °C. High Five cells were seeded on a 35 mm dish at a density of

2×105 cells/ml for 24 h before transfection, and the cells were then used for transfection.

For observation by confocal laser scanning microscopy, the EGFP expression

plasmid (pXIHAbla-EGFP, pXIHAbla-EGFP-MLS1 or pXIHAbla-EGFP-MLS2) was

transfected into the High Five cells using FuGENE HD transfection reagent (Roche,

Basel, Switzerland), following the manufacturer's procedure.

For purification of BNCs, pX-ML and EGFP expression plasmid

(pXIHAbla-EGFP, pXIHAbla-EGFP-MLS1 or pXIHAbla-EGFP-MLS2) were

co-transfected into High Five cells using FuGENE HD transfection reagent.

Confocal laser scanning microscopy observation of EGFP localization in insect cells

At 72 h after transfection, the cells were observed with a laser-scanning

confocal microscope (Carl Zeiss, Oberkochen, Germany), following the manufacturer's

procedure. Fluorescence images were acquired using the 488 nm line of an Ar laser for

excitation and a 505 nm band pass filter for emission. The specimens were viewed using

a 63-fold oil immersion objective.

Expression and Purification of BNCs co-expressed with EGFP-MLSs

At 72 h after transfection, the culture supernatant (20 ml) of transfected insect

cells was collected and mixed with polyethylene glycol (PEG) 6000 solution (33%, w/v).

29

After 2 h incubation, the mixture was centrifuged at 10,000 g for 30 min at 4 °C and the

precipitate was dissolved in 2.8 ml of phosphate-buffered saline (PBS). The solution

was layered onto a discontinuous cesium chloride (CsCl) gradient (11 ml, concentration:

10-40% (w/v) in buffer A [0.1 M sodium phosphate, 15 mM ethylene diamine

tetraacetic acid (EDTA)]) and centrifuged at 24,000 rpm for 16 h at 15 °C in a himac

CP70MXX centrifuge equipped with swing roter P40ST (Hitachi, Tokyo, Japan). The

amount of BNC in each fraction was analyzed using an IMx enzyme immunoassay

(EIA) kit (Abbott Laboratories, Abbott Park, IL, USA), following the manufacturer's

procedure, and BNC was dialyzed against PBS. After dialysis, the BNC solution was

layered onto a discontinuous sucrose gradient (11 ml, concentration: 10-50% (w/v) in

buffer A) and centrifuged at 24,000 rpm for 10 h at 4 °C. The amount of BNC in each

fraction was determined using the IMx EIA kit, and the expression of EGFP was

confirmed by western blotting. Fractions containing BNC were dialyzed against PBS

and stored at 4 °C.

SDS-PAGE and western blotting

The expression of EGFP in each fraction was confirmed by western blotting.

The supernatant was fractionated by sodium dodecyl sulphate-polyacrylamide gel

electrophoresis (SDS-PAGE) and electrotransferred onto a polyvinilidene fluoride

(PVDF) membrane. Rabbit anti-EGFP antibodies (Medical Biological Laboratories,

Nagoya, Japan) were used for immunoblotting, followed by anti-rabbit antibodies

conjugated with alkaline phosphatase (AP) (Promega, Madison, WI, USA). The

membrane was stained with 5-bromo-4-chloro-3-indolyl phosphate (BCIP) and nitro

blue tetrazolium (NBT) (Promega).

30

Dynamic Light Scattering Analysis of Purified BNCs co-expressed with EGFP-MLSs

The size of the purified BNCs co-expressed with EGFP-MLSs was determined

by dynamic light scattering (DLS) using a Zetasizer Nano particle size analyzer

(Malvern Instruments Ltd., Worcestershire, UK), following the manufacturer's

procedure.

RESULTS AND DISCUSSION

Strategy for direct production of protein-encapsulating BNC

The aim of the present study was to establish a novel approach that would

enable the simple preparation of protein-encapsulating BNC. Because BNC is produced

by a bioprocess, we hypothesized that BNC that inherently encapsulated the protein

drug candidates could be prepared with genetic modifications. If protein-encapsulating

BNC could be produced by the same process that is commonly used for preparing

hollow BNC particles, this would permit the protection of BNC and proteins from

damage caused by electroporation and obviate the need for laborious efforts to study the

optimal conditions for protein encapsulation.

For these reasons, we focused on the formation mechanism of BNC, that is,

budding on the ER membrane, as shown in Fig. 1A (Kuroda et al., 1992). We assumed

that the co-expression of target proteins on the ER membrane might directly generate

protein-encapsulating BNC by enveloping the membrane-localized proteins during the

budding event (Fig. 1B). The strategy used to test the feasibility of this approach was to

31

introduce MLSs into the C-terminus of the target proteins. Two types of peptide motifs,

11-amino-acid sequences derived from N-Ras including the CAAX motif, were selected

as the MLSs for the lipidation. MLS1 (QGCMGLPCVVM) is lipidated through both

prenylation at the cysteine residue on the CAAX motif and palmitoylation at the

upstream cysteine residue (Choy et al., 1999) (Fig. 2A). However, MLS2

(QGSMGLPCVVM) is lipidated by only prenylation at the cysteine residue on the

CAAX motif, since the Cys3 of MLS1 is replaced with a serine residue (Choy et al.,

1999) (Fig. 2A). According to the literature, MLS1 was localized to the plasma

membrane, and MLS2 was localized to the ER membrane and golgi membrane

apparatus in mammal cells (Sato et al., 2006). For the present study, an insect cell

allowing secretory production of BNC (Shishido et al., 2006) was used as the host cell,

and EGFP was used as the model target protein, which facilitated the evaluation of both

localization and encapsulation of BNC.

Localization of target proteins with membrane localization sequences (MLSs) in

insect cells

To confirm whether MLSs have ER membrane localization abilities in insect

cells, plasmids were constructed expressing EGFP, EGFP-MLS1, and EGFP-MLS2 (Fig.

2A). These three types of plasmids were transfected into insect cells (High Five)

without the plasmid producing BNC, and their localization was observed with a

confocal laser-scanning microscope (Fig. 3).

Because of its lack of membrane localization ability, EGFP without MLS was

observed in the cytoplasm of insect cells. EGFP-MLS1 was evenly localized on the

plasma and ER membranes in insect cells, although MLS1 reportedly locates on the

32

Fig. 3. Fluorescence images for observation of the localization of EGFP in insect cells

with confocal microscopy. ER-tracker (Invitrogen) was used as the localization marker.

The upper images are the cells transfected with EGFP expression plasmid. The middle

images are the cells transfected with EGFP-MLS1 expression plasmid. The lower

images are the cells transfected with EGFP-MLS2 expression plasmid. Scale bars; 20

m.

33

plasma membrane in mammal cells. In contrast, EGFP-MLS2 was strongly but partially

localized to the ER membrane. Thus, in the present study, both MLS1 and MLS2

functioned as membrane localization sequences in insect cells and had the capacity to

localize EGFP on ER membranes, even though they varied in their ER localization

ability. This result indicates that both MLS1 and MLS2 are capable of localizing target

proteins on an ER membrane as therapeutic candidates in a similar fashion.

Production and purification of EGFP-encapsulating BNC

To investigate the validity of our approach, the three types of plasmids (for

expression of EGFP, EGFP-MLS1 and EGFP-MLS2) were co-transfected, with the

plasmid producing BNC, into insect cells (High Five). After 72 h of cultivation, the

supernatants were harvested and the BNCs were purified by gradient ultracentrifugation,

as described in materials and methods. The resultant fractions were analyzed by EIA to

measure the amount of BNC and by western blotting to evaluate whether the BNCs

encapsulated EGFP (Fig. 4). After dialysis, about 25 g of purified EGFP-MLS1/BNC

and EGFP-MLS2/BNC were obtained from 20 ml of culture medium supernatant (Table

1).

First, in the case of co-transfection of EGFP and BNC, although the main

peaks of BNCs appeared in 10-12 fractions, the bands of EGFP were not detected in the

same fractions (Fig. 4A). This result indicates that EGFP was not encapsulated in BNC,

although BNC was produced uneventfully in the insect cells. Second, in the case of

co-transfection of EGFP-MLS1 and BNC, the thick bands of EGFP were detected in

9-12 fractions, which displayed the main peaks of BNC (Fig. 4B). This suggests that

EGFP-encapsulating BNC was successfully produced by introduction of the MLS1

34

Fig. 4. Examination for encapsulation of EGFP into the purified BNCs. After sucrose

gradient centrifugation, the amount of BNC including each fraction was measured with

a IMx EIA kit (S/N value of EIA). The same fractions were tested for the presence of

EGFP by western blotting with anti-EGFP antibody. Co-expression of (A) BNC and

EGFP, (B) BNC and EGFP-MLS1, and (C) BNC and EGFP-MLS2.

35

24.9 35.5 0.7 after concentration

38.7 6.5 6.0 after Sucrose ultracentrifugal method

174.3 58.1 3.0 after CsCl ultracentrifugal method

2033.3 726.2 2.8 pellet after PEG settling method

53672.3 2683.6 20.0 culture medium supernatant

EGFP-MLS2/BNC






EGFP-MLS1/BNC

mass (g)concentration (g/ml)

volume (ml)stepSample name






EGFP-MLS2/BNC






EGFP-MLS1/BNC

mass (g)concentration (g/ml)

volume (ml)stepSample name

Table 1. Purification summary of EGFP-MLS1/BNC and EGFP-MLS2/BNC.

36

motif. In the third case, co-transfection of EGFP-MLS2 and BNC displayed a result

similar to the case of EGFP-MLS1 and BNC (Fig. 4C), suggesting that the introduction

of MLS2 also allowed the production of EGFP-encapsulating BNC. The smaller

amounts of EGFP in the BNC with MLS2 might be attributed to partial localization on

the ER. However, since the EGFP-encapsulating BNC with MLS2 produced almost

twice the amount of particles as that with MLS1, this suggests that MLS2 might be a

better expression system for protein-encapsulating BNC (Fig. 4B and 4C). These

differences might be due to the presence or absence of the palmitoylation site between

MLS1 and MLS2.

Finally, the diameters of the BNC particles were evaluated using the DLS

method (Fig. 5). The diameters of the three types of particles were almost equivalent, at

150 nm, indicating that the diameter of EGFP-encapsulating BNCs was similar to that

of hollow BNC particles produced in insect cells (Kurata et al., 2008). In addition, it

was also confirmed that the EGFP-encapsulating BNCs kept the targeting abilities to

human hepatocytes (Fig. 6).

37

Fig. 5. DLS analyses of purified BNCs. Co-expression of (A) BNC and EGFP, (B) BNC

and EGFP-MLS1, and (C) BNC and EGFP-MLS2.

38

Fig. 6. Surviving the targeting abilities of EGFP-MLS1/BNC (left) and

EGFP-MLS2/BNC (right) into HeLa (human cervical carcinoma) (upper) and HepG2

(human hepatic carcinoma) (lower) cells. Cells were incubated with 1 M

Alexa488-labeled BNCs for 3 h. After incubation, cells were washed 3 times then

observed by confocal microscopy.

EGFP-MLS1/BNC EGFP-MLS2/BNC

HeL

aH

epG

2


HeL

aH

epG

2

50 m


HeL

aH

epG

2


HeL

aH

epG

2

50 m

39

CONCLUSION

The feasibility of this approach to the direct production of

protein-encapsulating BNC by localizing the target proteins on the ER membrane was

successfully demonstrated. In this study, MLS1 and MLS2 of N-Ras were used to

localize the target proteins on the ER membrane either by prenylation or by

palmitoylation. While MLS1 and MLS2 could incorporate our approach, other ER

membrane localization sequences with different modification mechanisms might also be

utilized to produce protein-encapsulating BNCs. In addition, whereas therapeutic

candidate proteins might be encapsulated in BNC in the same manner as EGFP, this

should be demonstrated in the near future. This approach would be a useful tool for

encapsulating target proteins into BNCs.

ABBREVIATIONS

drug delivery system, DDS; bio-nanocapsule, BNC; hepatitis B virus, HBV; hepatitis B

virus surface antigen, HBsAg; endoplasmic reticulum, ER; immunoglobulin G, IgG;

human EGFR-related 2, HER2; epidermal growth factor receptor, EGFR; membrane

localization sequence, MLS; enhanced green fluorescent protein, EGFP; polymerase

chain reaction, PCR; polyethylene glycol, PEG; phosphate-buffered saline, PBS;

discontinuous cesium chloride, CsCl; ethylene diamine tetraacetic acid, EDTA; enzyme

immunoassay, EIA; sodium dodecyl sulphate-polyacrylamide gel electrophoresis,

40

SDS-PAGE; electrotransferred onto a polyvinilidene fluoride, PVDF; alkaline

phosphatase, AP; 5-bromo-4-chloro-3-indolyl phosphate, BCIP; nitro blue tetrazolium,

NBT; dynamic light scattering, DLS

REFERENCES

Chi, E.Y., Krishnan, S., Randolph, T.W., Carpenter, J.F., 2003. Physical stability of

proteins in aqueous solution: mechanism and driving forces in nonnative protein

aggregation. Pharm Res. 20, 1325-1336.

Choy, E., Chiu, V.K., Silletti, J., Feoktistov, M., Morimoto, T., Michaelson, D., Ivanov,

I.E., Philips, M.R., 1999. Endomembrane trafficking of ras: the CAAX motif targets

proteins to the ER and Golgi. Cell. 98, 69–80.

Iijima, M., Kadoya, H., Hatahira, S., Hiramatsu, S., Jung, G., Martin, A., Quinn, J., Jung,

J., Jeong, S.Y., Choi, E.K., Arakawa, T., Hinako, F., Kusunoki, M., Yoshimoto, N.,

Niimi, T., Tanizawa, K., Kuroda, S., 2011. Nanocapsules incorporating IgG Fc-binding

domain derived from Staphylococcus aureus protein A for displaying IgGs on

immunosensor chips. Biomaterials. 32, 1455-1464.

Iwasaki, Y., Ueda, M., Yamada, T., Kondo, A., Seno, M., Tanizawa, K., Kuroda, S.,

Sakamoto, M., Kitajima, M., 2007. Gene therapy of liver tumors with human

41

liver-specific nanoparticles. Cancer Gene Ther. 14, 74-81.




Kasuya, T., Jung, J., Kadoya, H., Matsuzaki, T., Tatematsu, K., Okajima, T., Miyoshi,

E., Tanizawa, K., Kuroda, S., 2008. In Vivo Delivery of Bionanocapsules

Displaying Phaseolus vulgarisAgglutinin-L4 Isolectin to Malignant Tumors

Overexpressing N-Acetylglucosaminyltransferase V. Human Gene Therapy. 887-895.

Kasuya, T., Jung, J., Kinoshita, R., Goh, Y., Matsuzaki, T., Iijima, M., Yoshimoto, N.,

Tanizawa, K., Kuroda, S., 2009. Bio-Nanocapsule–Liposome Conjugates for In Vivo

Pinpoint Drug and Gene Delivery. Methods in Enzymology. 464, 147-166.

Kurata, N., Shishido, T., Muraoka, M., Tanaka, T., Ogino, C., Fukuda, H., Kondo, A.,

2008. Specific protein delivery to target cells by antibody-displaying bionanocapsules. J

Biochem. 144, 701-707.





42


Nygren, P.A., 2008. Alternative binding proteins: affibody binding proteins developed

from a small three-helix bundle scaffold. FEBS J. 275, 2668-2676.

Sato, M., Ueda, Y., Umezawa, Y., 2006. Imaging diacylglycerol dynamics at organelle

membranes. Nat Methods. 3, 797-799.

Shishido, T., Muraoka, M., Ueda, M., Seno, M., Tanizawa, K., Kuroda, S., Fukuda, H.,

Kondo, A., 2006. Secretory production system of bionanocapsules using a stably

transfected insect cell line. Appl Microbiol Biotechnol. 73, 505-511.

Shishido, T., Azumi, Y., Nakanishi, T., Umetsu, M., Tanaka, T., Ogino, C., Fukuda, H.,

Kondo, A., 2009a. Biotinylated bionanocapsules for displaying diverse ligands toward

cell-specific delivery. J Biochem. 146, 867-874.

Shishido, T., Yonezawa, D., Iwata, K., Tanaka, T., Ogino, C., Fukuda, H., Kondo, A.,

2009b. Construction of arginine-rich peptide displaying bionanocapsules. Bioorg Med

Chem Lett. 19, 1473-1476.

Shishido, T., Kurata, N., Yoon, M.E., Tanaka, T., Yamaji, H., Fukuda, H., Kondo, A.,

2009c. A high-level expression vector containing selectable marker for continuous

production of recombinant protein in insect cells. Biotechnol Lett. 31, 623-627.


43

medical treatment and health care. Biotechnol J. 6, 553-555.




21, 885-890.

44

PART II.

Complex carriers of affibody-displaying bio-nanocapsules and

composition-varied liposomes for HER2-expressing

breast cancer cell-specific protein delivery

45

INTRODUCTION

A drug delivery system (DDS) is a technology that enables control of drug

distributions in the body on the basis of quantitative, spatial and temporal aspects. If the

delivery of biological active molecules (ex. DNA, RNA, medicinal chemicals and

pharmaceutical proteins) universally becomes available, improvements in therapeutic

effects and reductions in side effects should follow (Nagai, 2005; Tabata, 2006). The

development of a variety of tools and carriers for DDS is an area of emerging research.

As the carrier, a bio-nanocapsule (BNC) that is composed of the L protein of

the hepatitis B virus (HBV) surface antigen (HBsAg) and the lipid bilayer has many

attractive features (Kuroda, 1992). The original BNC shows high specificity for human

hepatocytes and high transfection efficiency equivalent to the original HBV. Moreover,

BNC exhibits a reliable safety profile and can incorporate drugs and genes by an

electroporation method since it is a viral-genome-free hollow nanoparticle (Yamada,

2003).

Previously, we and other researchers succeeded in altering the cell-specificity

of BNC by genetic modifications (Kasuya, 2008; Shishido, 2009a; Shishido, 2009b).

Several varieties of specificity-altered BNCs could be generated by deleting the

hepatocyte-specific recognition site (located in the preS region) in the L protein and

inserting binding molecules with the ability to target other cells. Using this technique

and an affibody molecule, a new class of affinity ligands derived from the Z domain of

staphylococcal protein A (Orlova, 2006; Lee, 2008), we have constructed the ZHER2

affibody molecule displaying BNC on its surface (ZHER2-BNC) whose specificity was

successfully altered from hepatocytes to HER2 receptor expressing cells such as breast

46

cancer and ovarian cancer cells (Shishido, 2010). In our previous study, we reported the

specificity alteration of BNC by using the small and easily detectable molecule

fluorescein, although further characterizations and applications of ZHER2-BNC are still

needed. For example, since the original HBV possesses the unique infectious entry

mechanism of hepadnaviruses via receptor-mediated endocytosis followed by

processing of a surface protein including the preS region in endosomes (Stoeckl, 2006),

the specificity-altered ZHER2-BNC in which the preS region is partly deleted, might

result in the problematic trapping of medicinal agents within the endosomes.

Alternatively, a new method to conjugate BNCs with the liposome (LP) by

first incorporating the materials together (BNC/LP conjugation method) was recently

developed by Jung et al (Jung, 2008) as an alternative to the conventional

electroporation method. They successfully demonstrated that the conjugated BNC/LP

complex could incorporate large materials including fluorescence-labeled beads (100

nm). They also succeeded in delivering a GFP expression plasmid (>30 kbp) and

specifically imparting green fluorescence to human hepatocytes both ex vivo and in vivo

using the original BNC. This suggested that a new type of complex carrier based on the

original BNC could release a gene into the cytoplasm by escaping from the endocytic

pathway because of the unique endocytosis mechanism derived from original HBV

(Jung, 2008). However, complex carriers prepared by conjugating the specificity-altered

BNCs with LPs, in addition to preparation of complexes incorporating proteins that are

comparatively large biomolecules have not been reported. Furthermore, the

characteristics of LPs have not been reported as the features of the lipids used for the

BNC/LP conjugation have never been evaluated closely.

In this study, we attempted for the first time to incorporate comparatively

47

large proteins into the complex carriers prepared by the BNC/LP conjugation method

with the specificity-altered BNC and also aimed to determine the impacts of

characteristic lipids on the protein delivery. To confer the specificity for HER2

expressing cells on the complex carriers, we selected ZHER2-BNC (ZHER2-displaying

BNC) for the conjugation with LPs. Moreover, we investigated the impact of LPs with

different charges on the cell targeting specificities of the complexes and cellular uptake

of the proteins when using three types of LPs, anionic-LP (ALP), nonionic-LP (NLP)

and cationic-LP (CLP) for conjugating ZHER2-BNC. Based on the obtained results, we

investigated boosting the expression efficiency of the incorporated protein activity by

using helper lipids with endosomal escaping abilities.


Materials

BNCs were prepared from Saccharomyces cerevisiae AH22R- harboring the

plasmid pGLDsLd50-ZHER2 (Shishido, 2010) as described previously (Kuroda, 1992).

Briefly, yeast cells transformed with pGLDsLd50-ZHER2 by the spheroplast method were

cultured and disrupted with glass beads, the crude extract was precipitated with

polyethylene glycol (PEG) 6000 and subjected to cesium chloride (CsCl) isopycnic

ultracentrifugation and sucrose density gradient ultracentrifugation, and then the

purified ZHER2-BNC was obtained after freeze-drying in the presence of 5% sucrose.

Green fluorescent protein (GFP) was obtained from One Shot® TOP10 ElectrocompTM

48

Escherichia coli (Invitrogen Life Technologies, Carlsbad, CA, USA) harboring the

plasmid to express the enhanced GFP containing His tag (pBAD, unpublished plasmid)

by purifying the soluble fraction of the lysate using TALON metal affinity resins

(Clontech Laboratories / Takara Bio, Shiga, Japan). Liposomes (LPs) were purchased

from NOF (Tokyo, Japan). COATSOME EL-01-A (dipalmitoyl-phosphatidylcholine

(DPPC) : cholesterol (CHOL) : dipalmitoyl-phosphatidylglycerol (DPPG) = 30 : 40 : 30

(mol/vial)), COATSOME EL-01-N (DPPC : CHOL : DPPG = 54 : 40 : 6 (mol/vial))

and COATSOME EL-01-C (DPPC : CHOL : stearyl-amine = 52 : 40 : 8 (mol/vial))

were respectively selected as ALP, NLP and CLP. COATSOME EL-01-D

(1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) : CHOL :

O,O’-ditetradecanoyl-N-(-trimethylammonioacetyl) diethanolamine chloride (DC6-14)

= 0.75 : 0.75 : 1.00 (mol/vial)) was selected as the helper lipid. Pseudomonas exotoxin

A from Pseudomonas aeruginosa was purchased from Sigma-Aldrich (St. Louis, MO,

USA). Gibco® Fetal bovine serum (FBS), L-glutamine and Molecular Probes®

LIVE/DEAD® viability/cytotoxicity assay kit were purchased from Invitrogen Life

Technologies. RPMI 1640 medium and Dulbecco’s modified Eagle medium (DMEM)

were purchased from Nacalai Tesque (Kyoto, Japan). Leibovitz L-15 medium was

purchased from MP Biomedicals (Irvine, CA, USA). Sephacryl™ S-500 HR column

was purchased from GE Healthcare (Buckinghamshire, England).

Preparation of ZHER2-BNC/ALP, NLP and CLP complexes incorporating GFP or

exotoxin A

Complex carriers of ZHER2-BNC and LPs (ALP, NLP and CLP), in which GFP

or exotoxin A was incorporated, were prepared by referring to the previously described

49

BNC/LP conjugation method with some modifications (Jung, 2008). Freeze-dried LPs

(COATSOME EL-01-A, 61 mg; EL-01-N, 61 mg; and EL-01-C, 57 mg) were dissolved

in distilled water (2 ml) containing 2 mg/ml of GFP or 100 g/ml of exotoxin A. After

incubation for 1 h at room temperature, gel-filtration chromatography was performed

only for the LPs containing GFP using a Sephacryl™ S-500 HR column with an AKTA

system. The obtained LPs incorporating GFP or exotoxin A (100 l) were added to

freeze-dried ZHER2-BNC (100 g as protein) and incubated at room temperature for 1 h

to form BNC/LP complexes incorporating GFP or exotoxin A. The resultant complex

carriers were named ZHER2-BNC/ALP, ZHER2-BNC/NLP and ZHER2-BNC/CLP.

Preparation of ZHER2-BNC/DLP (DOPE-containing LP) complexes incorporating

exotoxin A

Complex carriers of ZHER2-BNC and DOPE-containing LP mixtures, in which

exotoxin A was incorporated, were prepared according to the above-described method

with the following modifications. To generate DOPE-containing LP mixtures (DLPs;

ADLP or NDLP), 2.2 mg of COATSOME EL-01-A (ALP) or COATSOME EL-01-N

(NLP) was added to 1 vial (1.5 mg) of COATSOME EL-01-D (DOPE-containing

cationic helper lipid). By mixing various amounts of COATSOME EL-01-A (ALP) into

a certain amount (1.5 mg) of COATSOME EL-01-D (DLP), the mixture ratio was

determined to give the negative zeta potential (Table 1). The generated LP mixture

(ADLP or NDLP; 3.7 mg) was used as a substitute for the freeze-dried LPs in the

previous section and dissolved in distilled water (1 ml). The amount of ZHER2-BNC was

varied from 0 g to 100 g (in terms of protein). The resultant complex carriers were

named as ZHER2-BNC/ADLP and ZHER2-BNC/NDLP.

50

Table 1. The sizes and zeta potentials of DOPE-containing LP mixtures.

51

Cell culture

SKBR3 cells (human breast carcinoma, approximately 106 HER2 molecules

expressed per cell (McLarty, 2009)) were maintained in RPMI 1640 medium

supplemented with 10% (v/v) FBS at 37°C in 5% CO2. MDA-MB-231 cells (human

breast carcinoma) were maintained in Leibovitz L-15 medium supplemented with 15%

FBS and 2 mM L-glutamine at 37°C without CO2. HeLa cells (human cervical

carcinoma) and MCF-7 cells (human breast carcinoma) were maintained in DMEM

medium supplemented with 10% FBS at 37°C in 5% CO2.

Microscopic observation of GFP delivery

Approximately 5×104 SKBR3 or MDA-MB-231 cells were seeded in 35 mm

glass bottom dishes. After washing with serum-free medium, 20 l of the complex

carriers and LPs containing GFP were added to 980 l of the medium and then the cells

were cultured for 1 h. After washing with serum-free medium twice, cells were

incubated with FBS-containing medium for 2 h. Cells were observed by a LSM 5

PASCAL laser scanning confocal microscope (Carl Zeiss, Oberkochen, Germany) using

a 63-fold oil immersion objective lens with excitation using the 488-nm line of an argon

laser and emission collection using a 505-nm long pass filter.

Microscopic observation of exotoxin A delivery

Approximately 2×105 SKBR3, MCF-7 or HeLa cells were seeded in 12-well

plates. After washing with serum-free medium, the required volumes of the complex

carriers and LPs containing exotoxin A were added to the medium and the volume was

adjusted to 1 ml and then cells were cultured for 1 h. After washing with serum-free

52

medium twice, the cells were incubated with FBS-containing medium for 47 h. Dead

cells were stained with ethidium homodimer-1 (EthD-1) from the LIVE/DEAD®

viability/cytotoxicity assay kit according to the manufacturer’s instructions. Cells were

observed by laser scanning confocal microscope using the same procedure described in

the previous section except for employing excitation using the 543-nm line of an He-Ne

laser and emission collection using a 560-nm long pass filter.

Flow cytometric evaluation of exotoxin A delivery

The cells were treated with the complex carriers and LPs containing exotoxin A

in the same manner as described in the previous section. Live cells were stained with

calcein AM from the LIVE/DEAD® viability/cytotoxicity assay kit according to the

manufacturer’s instructions. Cells were suspended into sheath solution and subjected to

a BD FACSCanto II flow cytometer equipped with a 488-nm blue laser (BD

Biosciences, San Jose, CA, USA). The green fluorescence signals were collected

through a 530/30-nm band-pass filter. The data were analyzed using the BD FACSDiva

software v5.0 (BD Biosciences). Dead cell numbers were estimated by subtracting the

viable cell counts from total cell counts.

Measuring the sizes and zeta potentials of particles.

The sizes and zeta potentials of the LPs and BNC-LP complexes were

determined by a Zetasizer Nano ZS (Malvern Instruments, Worcestershire, UK),

following the manufacturer's procedure.

53


The main purpose of this study was to investigate how cancer cell-specific

drug delivery is affected by the type of LP which is used to prepare the complex carriers

that incorporate the medicinal agents by the BNC/LP conjugation method (Jung, 2008).

Additionally, we also investigated target-cell-specific protein delivery since there have

been no reports regarding complex carriers using specificity-altered BNCs and the

incorporation of proteins. By conjugating various kinds of LPs with ZHER2-displaying

BNC (ZHER2-BNC) in which the hepatocyte-specific recognition site of original BNC

was genetically altered to the HER2-specific binding molecule ZHER2 (Shishido, 2010),

we evaluated the specificity of the complexes to target HER2-expressing SKBR3 breast

cancer cells and the expression efficiency of the incorporated protein activity. At the

same time, we used three types of HER2-negative cells (MDA-MB-231, HeLa and

MCF-7) to show clearly HER2-specific binding ability of the complexes. First, we

visually observed the targeting specificities and cellular uptakes of the BNC/LP

complexes incorporating the fluorescent protein GFP (27 kDa). Subsequently, we

examined the expression efficiencies of cell cytotoxicity with the variety of

composition-altered BNC/LP complexes, which incorporate the cytotoxic protein,

Pseudomonas exotoxin A (66 kDa), that can kill cells by inhibiting protein synthesis via

the ADP ribosylation of elongation factor 2 (Allured, 1986).

Influence of different charges of LPs with varied lipid compositions on cell targeting

specificities and cellular uptakes of ZHER2-displaying BNC/LP complexes

To examine the influence of different charges of LPs with varied lipid

54

compositions on the cell targeting specificities and cellular uptakes of ZHER2-displaying

BNC/LP complexes, we conjugated ZHER2-BNC with three kinds of LPs: anionic ALP,

nonionic NLP and cationic CLP (COATSOME EL-01-A, EL-01-N and EL-01-C),

respectively. The resultant complex carriers were named ZHER2-BNC/ALP,

ZHER2-BNC/NLP and ZHER2-BNC/CLP. Through the conjugations, GFP was

incorporated into each ZHER2-BNC/LP complex so that its cellular localization could be

visualized. All three types of LPs incorporating GFP without the conjugation to the

ZHER2-BNC were also used for comparison purposes. After 1 h of incubation with the

LPs or the ZHER2-BNC/LP complexes, HER2-positive SKBR3 cells (Davison, 2011) and

HER2-negative MDA-MB-231 cells (Davison, 2011) were washed twice and

additionally incubated for 2 h, and then observed by the confocal laser scanning

microscope (Fig. 1).

Both types of cells treated with the ALP and the NLP lacking the ZHER2-BNC

conjugations did not show fluorescence (Fig. 1). MDA-MB-231 cells also exhibited no

fluorescence after treatment with the ZHER2-BNC/ALP and ZHER2-BNC/NLP complexes,

whereas after treatment, SKBR3 cells exhibited the green fluorescence inside the cells

(Fig. 1). These results indicate that the LPs with an anionic or nonionic charge could

obtain the HER2-specific targeting ability by conjugation with the ZHER2-displaying

BNC, thereby permitting cellular uptake of the BNC/LP complexes incorporating GFP.

Both SKBR3 and MDA-MB-231 cells treated with the CLP and the

ZHER2-BNC/CLP complex showed green fluorescence on the periphery of the cell

membranes (Fig. 1). Due to the cationic charge of CLP, it would be presumed that even

the conjugated complex with ZHER2-BNC has non-specifically bound to the

negatively-charged cell membrane through electrostatic interactions. Indeed, the

55

Fig. 1. Fluorescence images of HER2-positive SKBR3 and HER2-negative

MDA-MB-231 cells treated with ZHER2-BNC/LP complexes incorporating GFP. ALP,

NLP and CLP with different (anionic, nonionic and cationic) charges were dissolved in

distilled water containing 2 mg/ml of GFP, and then were used to prepare the

ZHER2-BNC/LP complexes as described in materials and methods. All three types of LPs

incorporating GFP without conjugation to the ZHER2-BNC were also used as the carriers

for comparison. Cells were incubated for 1 h in the media adjusted to 1 ml by adding 20

l of the complex carriers and LPs, respectively. After washing twice, cells were

additionally incubated for 2 h and then observed by a confocal laser scanning

microscope. Scale bar, 50 m.

56

ZHER2-BNC/CLP complex showed the positively-charged zeta potential (Table 2). These

results suggest that the LPs with anionic or nonionic charges are favorable for the

preparation of the BNC/LP complex by conjugation because the cell targeting

specificity of BNC can be maintained.

Incorporation of cytotoxic protein, exotoxin A, into ZHER2-displaying BNC/LP

complexes prepared by using LPs with different charges

To investigate whether the ZHER2-BNC/LP complexes prepared by using the

LPs with different charges are able to express the incorporated protein activity in

keeping with the specificity towards HER2-expressing target cells, we prepared the LPs

and ZHER2-BNC/LP complexes incorporating the cell cytotoxic exotoxin A with ALP,

NLP and CLP. After 1 h of incubation with the obtained LPs or ZHER2-BNC/LP

complexes, HER2-positive SKBR3 cells and HER2-negative MCF-7 cells (Davison,

2011) were washed twice and additionally incubated for 47 h, and then stained with

EthD-1, which displays red fluorescence via a dead-cell-specific uptake mechanism.

Then, the stained cells were observed by confocal laser scanning microscopy to check

the expression of cell killing activity resulting from the effectiveness of exotoxin A (Fig.

2).

Both the SKBR3 (target cells) and MCF-7 (control cells) treated with the CLP

and ZHER2-BNC/CLP complexes incorporating exotoxin A exhibited red fluorescence,

showing that both carriers non-specifically caused cell death regardless of whether or

not the cells were expressing the HER2 receptor (Fig. 2). It is thought that the carriers

containing the LPs with cationic charges bound to the cell surface in a non-specific

fashion and then released the exotoxin A into the cytoplasm by membrane fusion in both

57

Table 2. The sizes and zeta potentials of LPs, LP mixtures and ZHER2-BNC/LP

complexes.

58

Fig. 2. Fluorescence images of HER2-positive SKBR3 and HER2-negative MCF-7 cells

treated with ZHER2-BNC/LP complexes incorporating exotoxin A. ALP, NLP and CLP

with different (anionic, nonionic and cationic) charges were dissolved in distilled water

containing 100 g/ml of exotoxin A, and then were used to prepare the ZHER2-BNC/LP

complexes as described in materials and methods. All three types of LPs incorporating

exotoxin A without conjugation to the ZHER2-BNC were also used as the carriers for

comparison. Cells were incubated for 1 h in the media adjusted to 1 ml by adding 20 l

of the complex carriers and LPs, respectively. After washing twice, cells were

additionally incubated for 47 h and then stained with EthD-1. Then, the stained cells

were observed by a confocal laser scanning microscope. Scale bar, 50 m.

59

target and non-target cells.

Both cells treated with the ZHER2-BNC/ALP and ZHER2-BNC/NLP complexes

never displayed red fluorescence (Fig. 2). As expected, both cells treated with the ALP

and NLP lacking the ZHER2-BNC also showed nearly no fluorescence (Fig. 2). These

results indicated that the ZHER2-BNC/LP complexes composed of the LPs with anionic

and nonionic charges did not lead to the death of MCF-7 control cells or SKBR3 target

cells since they were probably unable to effectively express the cytotoxic activity of

exotoxin A inside the cells. This was also supported by the results of quantitative FACS

analysis used to measure the fatality rates of target cells (SKBR3) and non-target cells

(HeLa) (Jia, 2003) with the same complexes containing exotoxin A (Fig. 3A and 3B;

white bars). Because SKBR3 cells treated with the ZHER2-dispalying BNC/LP

complexes incorporating GFP by the conjugation with ALP and NLP showed locally

punctate fluorescence patterns (Fig. 1), it was expected that the exotoxin A would be

introduced into HER2-expressing SKBR3 cells via receptor-mediated endocytosis but

remain within the endosome without being released into cytoplasm, resulting in no

expression of cell killing activity. This seemed to be different from the result obtained

for the plasmid incorporated complex carrier prepared by using the original BNC (Jung,

2008). Previously it had been elucidated that the endosomal escape of original HBV is

induced by the unmasked cell-permeable peptide [translocation motif (TLM); located in

the preS region] that is exposed on the surface of mature viral particles across the

conformational changes in surface proteins arising from processing by endosomal

proteases (Stoeckl, 2006). However, since the TLM sequence was deleted when

constructing the ZHER2-BNC with the aim to minimize the preS region in order to reduce

the antigenic region and the possibility of protease degradation (Shishido, 2009a;

60

Fig. 3. Fatality rates of HER2-positive SKBR3 and HER2-negative HeLa cells treated

by the exotoxin A containing ZHER2-BNC/LP complexes with and without helper lipid.

DOPE-containing cationic LP was selected as the helper lipid and mixed with ALP or

NLP to generate DOPE-containing LP mixtures (ADLP or NDLP). The LP mixtures

(ADLP or NDLP) or LPs (ALP or NLP) were dissolved in distilled water containing

100g/ml of exotoxin A, and then used to prepare the ZHER2-BNC/LP complexes as

described in materials and methods. Cells were incubated for 1 h in the media adjusted

to 1 ml by adding the indicated volumes of the complex carriers. After washing twice,

cells were additionally incubated for 47 h and then stained with calcein AM. Then, the

stained cells were analyzed using a flow cytometer. Dead cell numbers were estimated

by subtracting the viable cell counts from total cell counts.

61

Shishido, 2009b), the unique endocytosis mechanism of the original BNC might be

attenuated (Oess, 2000).

These results suggest that the target-cell-specific expression of the cell-killing

activity of exotoxin A with the ZHER2-displaying BNC/LP complex containing anionic or

nonionic LP requires a mechanism to release the incorporated proteins from the

endosome into the cytoplasm.

Expression of exotoxin A activity specifically in HER2-expressing cells with

ZHER2-BNC/LP complex prepared by mixing helper lipid

In order to improve the ability of the ZHER2-BNC/ALP or ZHER2-BNC/NLP

complex to escape the endosome, we conceived the use of a helper lipid. We chose a

pH-sensitive DOPE contained cationic LP (COATSOME EL-01-D) as the helper lipid to

assist the escape from the endosome through the destabilization of the endosomal

membrane via a conformational change in acidic conditions. We incorporated exotoxin

A into the LP mixtures which were prepared by mixing the DOPE contained cationic LP

with the anionic and nonionic ALP and NLP, respectively. The obtained LP mixtures

(ADLP and NDLP) were conjugated with ZHER2-BNC to produce the DOPE and

exotoxin A contained complex carriers (ZHER2-BNC/ADLP and ZHER2-BNC/NDLP).

After 1 h of incubation with the various amounts of ZHER2-BNC/ADLP and

ZHER2-BNC/NDLP complexes containing exotoxin A, HER2-positive SKBR3 cells and

HER2-negative HeLa cells were washed twice and incubated for an additional 47 h, and

then stained with calcein AM, which displays green fluorescence via live-cell-specific

uptake. Then the fatality rates of the cells were measured by subtracting the

live-cell-counts from the total-cell-counts obtained from the quantitative FACS analysis

62

(Fig. 3A and 3B; gray bars).

HER2-positive SKBR3 target cells added to more than 20 l of the

DOPE-containing ZHER2-BNC/ADLP complex (Fig. 3A; gray bars) showed higher

fatality rates than the DOPE-free ZHER2-BNC/ALP (Fig. 3A; white bars). As the

addition of 50 l of the ZHER2-BNC/ADLP complex rarely led to the death of non-target

cells (HeLa; Fig. 3A), it confirmed that displaying ZHER2 on the BNC/ADLP complex

functionally provided the HER2 positive SKBR3-specific cytotoxic effect. These results

suggest that the DOPE-containing LP in the ZHER2-BNC/ADLP complex successfully

functioned as a helper lipid to assist the endosomal escape and express the cell cytotoxic

activity of the incorporated exotoxin A, although the fatality rates of SKBR3 cells were

still not very high.

The DOPE and exotoxin A contained ZHER2-BNC/NDLP complex produced

high fatality rates in target SKBR3 cells (Fig. 3B; gray bars). However, the complex

also produced a high fatality rate even in non-target HeLa cells (Fig. 3B; HeLa, gray

bar). The ZHER2-BNC/NDLP complex, which was prepared with the mixture of the

nonionic LP (NLP) and the DOPE contained cationic LP was introduced into both target

and non-target cells non-specifically perhaps because of a shift of surface charge in the

complex to cationic. Indeed, the zeta potential was a negative value for the

ZHER2-BNC/ADLP complex and a positive value for the ZHER2-BNC/NDLP complex

(Table 2). The LP mixtures (ADLP and NDLP) also showed the same tendencies (Table

2). In addition, the sizes of ZHER2-BNC/ADLP and ZHER2-BNC/NDLP complexes were

almost unchanged (Table 2). These results demonstrated that the conjugation of

ZHER2-displaying BNC with the LP mixture (ADLP) obtained by mixing the anionic LP

(ALP; COATSOME EL-01-A) and the DOPE containing cationic LP (COATSOME

63

EL-01-D) could functionally confer the ability to enable the endosomal escape of the

incorporated protein as well as the ability to specifically target the HER2-expressing

cells.

Effective expression of exotoxin A activity using the complex carrier with the

optimized blended ratio of ZHER2-BNC and DOPE-containing anionic LP mixture

(ADLP)

Next, we considered an approach to enrich the expression efficiency of the

cytotoxic effect of the ZHER2-BNC/ADLP complex incorporating exotoxin A. We

assumed that the reason for the low fatality rates of the target SKBR3 cells (Fig. 3A)

was that the ratio of the ADLP to the ZHER2-BNC was linked to the expression of the

cell-killing activity of the incorporated exotoxin A. A relatively higher amount of

ZHER2-BNC conjugated to the ADLP might disturb the expression of the endosomal

escaping function by obscuring the efficacy of DOPE.

On the basis of this idea, we examined the cell-killing activity by modifying

the amounts of ZHER2-BNC available to conjugate with a certain amount of ADLP

incorporating exotoxin A (Fig. 4A). The sizes and zeta potentials of the complexes were

measured and shown in Table 3. The amounts of ZHER2-BNC had a large impact on the

fatality rates of SKBR3 cells as was expected. Surprisingly, the fatality rates fluctuated

dramatically depending on the amounts of ZHER2-BNC, and reached approximately

100% when the additive ZHER2-BNC was reduced to half of the original amount (from

100 g to 50 g as protein against 100 l-ADLP (3.7 mg/ml)) (Fig. 4A). It was inferred

that the dramatic decrease of the fatality rates was probably caused by attenuation of the

HER2-specific binding ability when the amount of additive

64

Table 3. The sizes and zeta potentials of ZHER2-BNC/ADLP complex carriers.

65

Fig. 4. Modification of the amounts of ZHER2-BNC for conjugation with the DOPE

contained LP mixture (ADLP). The LP mixture was dissolved in distilled water

containing 100g/ml of exotoxin A, and then used to prepare the complex carriers with

varied amounts of ZHER2-BNC as described in materials and methods. Cells were

incubated for 1 h in the media adjusted to 1 ml by adding the indicated volumes of the

complex carriers. After washing twice, cells were additionally incubated for 47 h. (A)

Fatality rates of HER2-positive SKBR3 cells treated with the complex carriers

containing varied amounts of ZHER2-BNC. The abscissa axis shows relative amounts of

the added ZHER2-BNC against 100 l-ADLP (3.7 mg/ml); For 0, x1, x1/2, x1/3, x1/4 and

x1/6, 0, 100, 50, 33, 25 and 16 g of ZHER2-BNC (as protein) were used, respectively.

Cells were stained with calcein AM and then analyzed using a flow cytometer. Dead cell

numbers were estimated by subtracting the viable cell counts from total cell counts. (B)

Fluorescence images of HER2-positive SKBR3 and HER2-negative HeLa cells treated

with LP mixture (ADLP) or the optimized blended ZHER2-BNC/ADLP complex (x1/2).

Cells were stained with EthD-1 and then observed by a confocal laser scanning

microscope. Scale bar, 50 m.

66

ZHER2-BNC was reduced to less than 1/3. When the ZHER2-BNC-halved complex was

added to SKBR3 and HeLa, cell death was specific to only the target SKBR3 cells (Fig.

4B). The anionic LP mixture (ADLP) containing exotoxin A never showed the

cell-killing activity in both cells (Fig. 4B). These results indicated that we could express

the function of the incorporated protein into the ZHER2-BNC/ADLP complex by

determining the optimized blending ratio of ZHER2-BNC and anionic LP mixture

(ZHER2-BNC : ADLP = 50 g as protein : 100 l (3.7 mg/ml)). Thus, we succeeded in

developing the specificity-altered BNC/LP complex containing the bifunctional

properties of cell-specificity and endosomal escape.

Evaluation of cell-killing activity when adding various amounts of the optimized

blended ZHER2-BNC/ADLP complexes containing exotoxin A

Finally, we evaluated the cell-killing activities when adding various amounts

of the optimized blended complexes containing exotoxin A (Fig. 5). Even when adding

5 l of the optimized blended ZHER2-BNC/ADLP complex, the fatality rate of SKBR3

cells was over 50%. The fatality rates were enriched in a dose-dependent manner,

producing approximately 100% cell death when 20 l of the complex was added. The

ADLP lacking ZHER2-BNC containing exotoxin A could not kill the SKBR3 cells

efficiently despite increasing the addition volume up to 50 l. Direct addition of 50 l

of exotoxin A (100 g/ml) without any carriers also never produced the death of SKBR3

cells. These results indicate that cellular uptake and release into the cytoplasm of

exotoxin A were surely attributed to the ZHER2-BNC/ADLP complex carrier. In addition,

the ZHER2-BNC/ADLP complex without exotoxin A rarely affected the fatality rate of

SKBR3 cells, suggesting that the complex itself displayed low cellular toxicity.

67

Fig. 5. Fatality rates of HER2-positive SKBR3 and HER2-negative HeLa cells treated

by the indicated carriers with and without exotoxin A. The DOPE-containing LP

mixture (ADLP) was dissolved in distilled water containing 100g/ml of exotoxin A,

and then was used to prepare the optimized blended ZHER2-BNC/ADLP complex shown

in Fig. 4. Cells were incubated for 1 h in the media adjusted to 1 ml by adding the

indicated volumes of carriers. After washing twice, cells were additionally incubated for

47 h and then stained with calcein AM. Then, the stained cells were analyzed using a

flow cytometer. Dead cell numbers were estimated by subtracting the viable cell counts

from total cell counts.

68

Furthermore, high specificity to HER2-expressing cells was exhibited by the low

fatality rate of non-target HeLa cells even when adding 50 l of the ZHER2-BNC/ADLP

complex. The complex carrier prepared with the BNC displaying wild-type Z domain

(ZWT-BNC/ADLP) never exhibited cellular toxicity to HER2-expressing SKBR3 cells

(Fig. 6). These results successfully demonstrate that the optimized blended

ZHER2-BNC/ADLP complex could be a potential carrier to provide protein therapy for

HER2 positive breast cancer cells.

CONCLUSION

As previously reported, the results presented herein confirm the

HER2-specific targeting ability of ZHER2-BNC. However, the delivery capacity of

ZHER2-BNC for protein therapy has remained obscure. We report here the design of an

advanced complex carrier for protein delivery by blending the DOPE contained cationic

helper lipid with the anionic LP that was used for the conjugation to the ZHER2-BNC.

The DOPE contained helper lipid successfully assisted the endosomal escape of the

incorporated protein, exotoxin A. The charge of LP was a critical factor in designing the

DOPE-containing BNC/LP complex in order to maintain the specificity to HER2

positive breast cancer cells. The optimized blending ratio of the ZHER2-BNC to the

DOPE-containing LP mixture dramatically improved the cell-killing activity of the

exotoxin A incorporated complex carrier. The conjugation of the LP mixture with the

helper lipid should prove to be a useful method for also incorporating virus-like

69

Fig. 6. Fatality rates of HER2-positive SKBR3 treated with the ZWT-BNC/ADLP

complex (optimized blended ratio, x1/2). Wild-type Z domain (ZWT)-displaying BNC

(ZWT-BNC) was conjugated with ADLP incorporating exotoxine A (ZWT-BNC/ADLP).

The LP mixture (ADLP) was dissolved in distilled water containing 100g/ml of

exotoxin A, and then used to prepare the ZWT-BNC/ADLP complexes along with the

materials and methods of the optimized blended ZHER2-BNC/ADLP complex (x1/2).

Cells were incubated for 1 h in the media adjusted to 1 ml by adding the indicated

volumes of the complex carriers. After washing twice, cells were additionally incubated

for 47 h and then stained with calcein AM. Then, the stained cells were analyzed using a

flow cytometer. Dead cell numbers were estimated by subtracting the viable cell counts

from total cell counts.

70

particles to take advantage of their various functions.

ABBREVIATIONS

DDS, drug delivery system; BNC, bio-nanocapsule; HBV, hepatitis B virus; HBsAg, hepatitis B

virus surface antigen; HER2, human EGFR-related 2; EGFR, epidermal growth factor receptor;

LP, liposome; GFP, green fluorescent protein; PEG, polyethylene glycol; CsCl, cesium chloride;

DPPC, dipalmitoyl-phosphatidylcholine; CHOL, cholesterol; DPPG,

dipalmitoyl-phosphatidylglycerol; DOPE, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine;

DC6-14, O,O’-ditetradecanoyl-N-(-trimethylammonioacetyl) diethanolamine chloride; FBS,

Fetal bovine serum; DMEM, Dulbecco’s modified Eagle medium; LSM, laser scanning

microscope; EthD-1, ethidium homodimer-1; TLM, translocation motif;

REFERENCES

Allured, V.S., Collier, R.J., Carroll, S.F., McKay, D.B., 1986. Structure of exotoxin A

of Pseudomonas aeruginosa at 3.0-Angstrom resolution. Proc Natl Acad Sci USA. 83

(5), 1320-1324.

Davison, Z., Blacquiere, G.E., Westley, B.R., May, F.E.B., 2011. Insulin-like Growth

71

Factor-Dependent Proliferation and Survival of Triple-Negative Breast Cancer Cells:

Implication for Therapy. Neoplasia. 13, 504-515.

Jia, L.T., Zhang, L.H., Yu, C.J., Zhao, J., Xu, Y.M., Gui, J.H., Jin, M., Ji, Z.L., Wen,

W.H., Wang, C.J., Chen, S.Y., Yang, A.G., 2003. Specific Tumoricidal Activity of a

Secreted Proapototic Protein Consisting of HER2 Antibody and Constitutively Active

Caspase-3. Cancer Res. 63, 3257-3262.











Lee, S.B., Hassan, M., Fisher, R., Chertov, O., Chernomordik, V., Kramer-Marek, G.,

Gandjbakhche, A., Capala, J., 2008. Affibody molecules for in vivo characterization of

HER2-positive tumors by near-infrared imaging. Clin Cancer Res. 14, 3840-3849.

72

McLarty, K., Cornelissen, B., Scollard, D.A., Done, S.J., Chun, K., Reilly, R.M., 2009.

Associations between the uptake of 111In-DTPA-trastuzumab, HER2 density and

response to trastuzumab (Herceptin) in athymic mice bearing subcutaneous human

tumour xenografts. Eur J Nucl Med Mol Imaging. 36, 81-93.



Oess, S., Hidt, E., 2000. Novel cell permeable motif derived from the PreS2-domain of

hepatitis-B virus surface antigens. Gene Therapy. 7, 750-758.

Orlova, A., Magnusson, M., Eriksson, T.L., Nilsson, M., Larsson, B.,

Hoiden-Guthenberg, I., Widstrom, C., Carlsson, J., Tolmachev, V., Stahl, S., Nilsson,

F.Y., 2006. Tumor imaging using a picomolar affinity HER2 binding affibody molecule.

Cancer Res. 66, 4339–4348.






Chem Lett. 19, 1473-1476.

73

Shishido, T., Mieda, H., Hwang S.Y., Nishimura, Y., Tanaka, T., Ogino, C., Fukuda, H.,

Kondo, A., 2010. Affibody-displaying bionanocapsules for specific drug delivery to

HER2-expressing cancer cells. Bioorg Med Chem Lett. 20, 5726-5731.

Stoeckl, L., Funk, A., Kopitzki, A., Brandenburg, B., Oess, S., Will, H., Sirma, H., Hildt,

E., 2006. Identification of a structural motif crucial for infectivity of hepatitis B viruses.

PNAS. 103 (17), 6730-6734.


medical treatment and health care. Biotechnol J. 6, 553-555.




21, 885-890.

74

PART III.

Targeting cancer cell-specific RNA interference

by siRNA delivery using a complex carrier of

affibody-displaying bio-nanocapsules and liposomes

75

INTRODUCTION

RNA interference (RNAi) is expected to become a new approach in treating a

variety of diseases, such as virus infection, cancer and neurodegenerative diseases,

owing to specific and effective gene silencing (Cardoso, 2009; Tseng, 2009). The

mechanism of RNAi involves double-stranded RNA injected into cells that are first cut

into short RNA (small interfering RNA (siRNA)), 21–23 bp long, using ribonuclease

(RNase) III enzyme that is referred to as the Dicer. The duplex siRNA forms a

RNA-induced silencing complex (RISC), which contains an endonuclease and an

Argonaute protein. The siRNA duplex is dissociated into unwound single-stranded RNA

using ATP-dependent helicase; therefore, the RISC with antisense strand against target

mRNA leads to RNA destruction and results in a downregulation of gene expression

(Lundberg, 2007; Chang, 2011; Miele, 2012; Spagnou, 2004). Although the use of

siRNA is a promising approach for nucleic acid medicine, several problems remain with

respect to in vivo use, such as an inability to cross membranes, an instability in the

blood, and a lack of ability to specifically target abnormal cells (Cardoso, 2009; Wirth,

2011).

A bio-nanocapsule (BNC) is a hollow nano particle composed of the L protein

of the hepatitis B virus (HBV), surface antigen (HBsAg), and a lipid bilayer. The BNC

exhibits a reliable safety profile due to being viral-genome-free and shows high

specificity for human hepatocytes and a high transfection efficiency that is equivalent to

the original HBV (Kuroda, 1992). Therefore, the BNC has been studied as a carrier for

the delivery of drugs and genes (Yamada, 2003).

76

Previously, we and other researchers succeeded in altering the cell-specificity

of BNCs by deleting the hepatocyte-specific recognition site (located in the preS region)

in the L protein and inserting binding molecules with the ability to target other cells

(Kasuya, 2008). For example, among an affibody molecule which is a new class of

binding proteins derived from the Z domain of staphylococcal protein A (Orlova, 2006),

we displayed the ZHER2 affibody molecule on the surface of BNC (ZHER2-BNC). Thus,

we succeeded in altering the specificity of a BNC from hepatocytes to HER2 receptor

expressing cells such as those found in breast and ovarian cancer (Shishido, 2010).

Additionally, the fusion of medicinal proteins (Kurata, 2008) and an

electroporation (Yamada, 2003) and a BNC/liposome (BNC/LP) conjugation (Jung,

2008) have been previously reported as methods used for encapsulating drugs and genes

into BNCs. In particular, the BNC/LP conjugation method has succeeded in

encapsulating various-sized materials including low-molecular compounds, genes and

proteins into BNC/LP complex carriers (Kasuya, 2009; Nishimura, 2012). The complex

carriers are formed by fusing BNCs to the surface of LPs, in which target materials have

been pre-encapsulated. By changing the phospholipid composition of LPs or the types

of BNCs, a variety of characteristic features are granted to the BNC/LP complex

carriers. For example, anionic phospholipid can avoid non-specific binding to non-target

cells (Nishimura, 2012); pH-responsive phospholipids

(1,2-dioleoyl-sn-glycero-3-phosphoethanolamine; DOPE) provide the ability for

endosomal escape (Nishimura, 2012); and, affibody-displaying BNCs can alter

cell-specificity (Shishido, 2010). By using this method, we previously constructed

ZHER2-BNC/LP complex carriers and succeeded in the specific and functional delivery

of proteins for HER2-expressing breast cancer cells (Nishimura, 2012).

77

In the present study, to overcome the problems in siRNA therapy, we tried the

specific delivery of siRNA into target cancer cells by using the BNC/LP complex as the

carrier. To facilitate the evaluation of RNAi, an siRNA that would inhibit GFP

expression was selected. We describe how the ZHER2-BNC/LP complex can specifically

deliver siRNA into HER2-expressing breast cancer cells and effectively lead to the

cell-specific targeting of RNAi.


Materials

BNCs were prepared from Saccharomyces cerevisiae AH22R- harboring the

plasmid pGLDsLd50-ZHER2 or pGLDsLd50-ZWT (Shishido, 2010) as described

previously (Kuroda, 1992). Briefly, yeast cells transformed with pGLDsLd50-ZHER2 or

pGLDsLd50-ZWT by the spheroplast method were cultured and disrupted with glass

beads, the crude extract was precipitated with polyethylene glycol (PEG) 6000 and

subjected to cesium chloride (CsCl) isopycnic ultracentrifugation and sucrose density

gradient ultracentrifugation, and then the purified BNCs were obtained after

freeze-drying in the presence of 5% sucrose. Liposome (LP), COATSOME EL-01-D

(1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) : CHOL :

O,O’-ditetradecanoyl-N-(-trimethylammonioacetyl) diethanolamine chloride

(DC6-14) = 0.75 : 0.75 : 1.00 (mol/vial)) was purchased from NOF (Tokyo, Japan).

Silencer® GFP (eGFP) siRNA and LipofectaminTM RNAiMAX Reagent was purchased

78

from Invitrogen Life Technologies (Carlsbad, CA, USA). Gibco® Fetal bovine serum

(FBS) and an L-glutamine and Molecular Probes® LIVE/DEAD® viability/cytotoxicity

assay kit were purchased from Invitrogen Life Technologies. RPMI 1640 medium and

Dulbecco’s modified Eagle medium (DMEM) were purchased from Nacalai Tesque

(Kyoto, Japan). Blasticidin was purchased from InvivoGen (San Diego, CA, USA).

Preparation of BNC/LP complex and incorporation of siRNA

Complex carriers of ZHER2-BNC and ZWT-BNC and LP, in which siRNA was

incorporated, were prepared by referring to the previously described BNC/LP

conjugation method with some modifications (Jung, 2008). Freeze-dried LP

(COATSOME EL-01-D, 1.5 mg) were dissolved in distilled water (1 ml) containing 200

nM of siRNA. After incubation for 1 h at room temperature, LP-mixing siRNA (100 l)

was added to freeze-dried ZHER2-BNC or ZWT-BNC (50 g as protein) and incubated at

room temperature for 1 h to form BNC/LP complexes. The resultant complex carriers

were named ZHER2-BNC/LP and ZWT-BNC/LP.

Cell culture

To evaluate and quantify the RNAi efficacy, we used the cells constantly

expressing the chromosomally-integrated GFP. SKBR3 cells (human breast carcinoma)

were maintained in RPMI 1640 medium supplemented with 10% (v/v) FBS and 5 g/ml

Blasticidin at 37°C in 5% CO2. HeLa cells (human cervical carcinoma) were maintained

in DMEM medium supplemented with 10% FBS and 5 g/ml Blasticidin at 37°C in 5%

CO2.

79

Measuring the zeta potential and diameter of particles

The zeta potentials of the LPs and a BNC/LP complex were determined using

a Zetasizer Nano ZS (Malvern Instruments, Worcestershire, UK), following the

manufacturer's procedure.

Flow cytometric evaluation of RNAi and cell viability

Approximately 1×105 SKBR3 and HeLa cells were seeded in 12-well plates

and incubated 37°C for 24 h. After washing with serum-free medium, the required

volumes of the complex carriers and LPs containing siRNA were added to the medium

and the volume was adjusted to 1 ml. Cells were incubated for 4 h, and then were

washed twice with serum-free medium and cultured with FBS-containing medium for

44 h.

siRNA was also directly transfected to cells with RNAiMAX, following the

manufacturer's procedure. Briefly, the required volumes of 50 mM siRNA and 2 l of

RNAiMAX were added to 200 l of serum-free medium in 12-well plates, and the

medium was incubated for 20 min at room temperature. Then, 1 ml of serum-free

medium containing cells (1×105) was added to the 12-well plates. Cells were incubated

for 4 h, washed twice with serum-free medium and cultured with FBS-containing

medium for 44 h.

To quantify RNAi efficacy, green fluorescence was detected and the

decrement of GFP-expressing cells was counted. To quantify cell viability, red

fluorescence was detected and the dead cells stained with EthD-1 were counted. The

EthD-1 staining was performed using a LIVE/DEAD® viability/cytotoxicity assay kit

according to the manufacturer’s instructions. Cells were suspended into a sheath

80

solution and subjected to a BD FACSCanto II flow cytometer equipped with a 488-nm

blue laser (BD Biosciences, San Jose, CA, USA). The green and red fluorescence

signals were collected through 530/30 and 585/42-nm band-pass filter, respectively. The

data were analyzed using BD FACSDiva software v5.0 (BD Biosciences).

Microscopic observation of GFP-expressing cells treated with siRNA

The introduction of siRNA basically followed the above-described procedure

with some modifications as follows: 12-well plates were changed to 35 mm glass

bottom dishes; the final concentration of siRNA in the medium was fixed to 25 nM; and

the total volume of medium was adjusted to 2 ml.

Cells were observed using a LSM 5 PASCAL laser scanning confocal

microscope (Carl Zeiss, Oberkochen, Germany) equipped with a 63-fold oil immersion

objective lens with excitation using the 488-nm line of an argon laser and emission

collection using a 505-nm long pass filter.


Target cell-specific RNAi with ZHER2-BNC/LP

First, to examine the specific delivery of siRNA, we used HER2-expresing

SKBR3 cells (human breast carcinoma) as target cells (Davison, 2011).

HER2-non-expressing HeLa cells (human cervical carcinoma) were used as the

non-target cells (Jia, 2003). To evaluate and quantify the RNAi efficacy, we used the

81

cells constantly expressing the chromosomally-integrated GFP. RNAiMAX, LP and

ZHER2-BNC/LP were tested to deliver siRNA. After 48 h of incubation, the efficacies of

RNAi depending on the additive concentration of siRNA were determined by measuring

the cell population rates missing GFP fluorescence.

The efficacies of RNAi for HER2-expressing SKBR3 cells and

HER2-non-expressing HeLa cells are shown in Fig. 1A and 1B, respectively. In the

case of using RNAiMAX (white bars), RNAi was observed even at lower concentration

of siRNA (1 nM~) in both SKBR3 and HeLa cells. This indicated that the transfection

reagent never showed the specificity to the target cells although it has the ability for

high transfection efficiency. The LPs without ZHER2-BNC (gray bars) also triggered

RNAi in both cells as similar to the case of RNAiMAX. The zeta potential of the LPs

encapsulating siRNA showed a positive charge (Table 1), suggesting that it was bound

to cells non-specifically due to an electrostatic interaction. However, the ZHER2-BNC/LP

complex displayed the specific effect of RNAi only for HER2-expressing SKBR3 cells

(Fig. 1A and 1B; black bars). Furthermore, the RNAi efficacies of ZHER2-BNC/LP that

were >10 nM were equal to that of RNAiMAX. This result indicates that the siRNA

delivery with ZHER2-BNC/LP was HER2-expressing breast cancer cell-specific siRNA

delivery and that it led to an effective expression of the RNAi function.

Viability of cells treated with ZHER2-BNC/LP

To evaluate the biocompatibility of each carrier containing siRNA, we

measured cell survival rates with a type of EthD-1 that permits the detection of dead

cells under the progression of RNAi. The cell viabilities of SKBR3 (Fig. 2A) and HeLa

(Fig. 2B) were similar, but slightly different in each carrier. The slight decrease in

82

Fig. 1. Quantification of RNAi in HER2-positive SKBR3 (A) and HER2-negative HeLa

(B) cells treated by siRNA combined with RNAiMAX (white bars), LPs (gray bars) and

ZHER2-BNC/LP complex (black bars). The GFP expressions of the cells were analyzed

using a flow cytometer and results are expressed as a percentage of the GFP-expressing

cellular quantity in untreated controls. The x-axis represents the final concentration of

siRNA in the medium adjusted to 2 ml.

0

20

40

60

80

100

1 2.5 5 10 12.5 15 20 25

0

20

40

60

80

100

1 2.5 5 10 12.5 15 20 25

Concentrations of additive siRNA [nM]

% o

f R

NA

inte

rfer

ence


% o

f R

NA

inte

rfer

ence

A. SKBR3 cell

B. HeLa cell

RNAiMAXLPZHER2-BNC/LP


0

20

40

60

80

100

1 2.5 5 10 12.5 15 20 25

0

20

40

60

80

100

1 2.5 5 10 12.5 15 20 25


% o

f R

NA

inte

rfer

ence


% o

f R

NA

inte

rfer

ence

A. SKBR3 cell

B. HeLa cell







83

Table. 1. The sizes and zeta potentials of LPs only, LPs with siRNA and ZHER2-BNC/LP

complex with siRNA.

-5.1 ± 1.2 229 ± 27.0ZHER2-BNC/LP containing siRNA

1.4 ± 2.9 167 ± 14.2LP containing siRNA

3.9 ± 1.8 187 ± 3.8LP

Zeta potential [mV]Diameter [nm]carrier

-5.1 ± 1.2 229 ± 27.0ZHER2-BNC/LP containing siRNA

1.4 ± 2.9 167 ± 14.2LP containing siRNA

3.9 ± 1.8 187 ± 3.8LP

Zeta potential [mV]Diameter [nm]carrier

84

Fig. 2. Cell survival rates of HER2-positive SKBR3 (A) and HER2-negative HeLa (B)

cells treated by siRNA combined with RNAiMAX (white bars), LPs (gray bars) and

ZHER2-BNC/LP complex (black bars). The fluorescence of cells stained with EthD-1 was

analyzed using a flow cytometer. Cell survival rates were calculated by subtracting the

dead cell counts from total cell counts.

0

20

40

60

80

100

1 2.5 5 10 12.5 15 20 25

0

20

40

60

80

100

1 2.5 5 10 12.5 15 20 25

Cel

l via

bilit

y[%

]


Cel

l via

bilit

y[%

]


A. SKBR3 cell



B. HeLa cell

0

20

40

60

80

100

1 2.5 5 10 12.5 15 20 25

0

20

40

60

80

100

1 2.5 5 10 12.5 15 20 25

Cel

l via

bilit

y[%

]


Cel

l via

bilit

y[%

]


A. SKBR3 cell







B. HeLa cell

85

viability in the case of LPs (gray bars) might have been due to the excess non-specific

binding of phospholipids to the cell membrane. A significant decrease in viability was

not observed in the case of ZHER2-BNC/LP (black bars). This result suggests that

ZHER2-BNC/LP was non-toxic to cells.

Confirmation of the occurrence of siRNA-specific and affibody-dependent RNAi

To confirm whether the inhibition of protein synthesis was really led by the

action of siRNA, we used the siRNA that never inhibits GFP expression (negative

siRNA) (Fig. 3). We added 25 nM carriers containing negative siRNA to SKBR3 and

HeLa cells. As a result, RNAi was never detected in the presence of any of these carriers

(Fig. 3A and 3B). This result clearly shows that the decrement of GFP-expressing cells

in Fig. 1 was surely guided by siRNA-specific action.

To establish the validity of using ZHER2-BNC to grant cell-specificity, we

compared the ZHER2-BNC/LP with ZWT-BNC/LP using the ZWT (Z domain)-displaying

BNC without HER2 recognition ability to form the BNC/LP complex (Fig. 4). Each

complex carrier with siRNA was added to SKBR3 and HeLa cells (final conc. 25 nM as

siRNA), and the rates of RNAi and cell viability were evaluated after 48 h of incubation.

As a result, ZHER2-BNC/LP triggered SKBR3-specific RNAi, whereas ZWT-BNC/LP did

not invoke RNAi in either cell. Thus, the importance of the affibody-displaying BNC

for specific siRNA delivery was confirmed.

Microscopic observation of GFP interference

To visually confirm the inhibition of GFP synthesis by RNAi, we treated

SKBR3 and HeLa cells with RNAiMAX, LPs and ZHER2-BNC/LP containing siRNA

86

Fig. 3. Quantification of RNAi (black bars) and cell survival rates (gray bars) of

HER2-positive SKBR3 (A) and HER2-negative HeLa (B) cells treated by negative

siRNA combined with RNAiMAX, LPs and ZHER2-BNC/LP complex (final conc. 25 nM

as siRNA).

0

20

40

60

80

100

0

20

40

60

80

100

ZHER2-BNC/LP

[%]

[%]A. SKBR3 cell

B. HeLa cell

RNAiCell viability

RNAiCell viability

RNAiMAX LP

ZHER2-BNC/LPRNAiMAX LP0

20

40

60

80

100

0

20

40

60

80

100

ZHER2-BNC/LP

[%]

[%]A. SKBR3 cell

B. HeLa cell

RNAiCell viability

RNAiCell viability

RNAiMAX LP

ZHER2-BNC/LPRNAiMAX LP

87

Fig. 4. Quantification of RNAi (black bars) and cell survival rates (gray bars) of

HER2-positive SKBR3 and HER2-negative HeLa cells treated by siRNA combined

with ZHER2-BNC/LP (left side) and ZWT-BNC/LP (right side) (final conc. 25 nM as

siRNA).

0

20

40

60

80

100[%]

ZHER2-BNC/LP ZWT-BNC/LP

SKBR3 HeLa SKBR3 HeLa

RNAi

Cell viability

0

20

40

60

80

100[%]

ZHER2-BNC/LP ZWT-BNC/LP

SKBR3 HeLa SKBR3 HeLa

RNAi

Cell viability

88

(final conc. 25 nM) and observed the cells using a confocal laser scanning microscope

(CLSM) following 24 and 48 h of incubation (Fig. 5A and Fig. 5B). In the case of

RNAiMAX, green fluorescence was rarely observed in either cell, and the non-specific

inhibition of GFP synthesis was confirmed. In the case of LP, inhibition of GFP

synthesis was scarcely provoked after 24 h but was confirmed after 48 h in both cells.

This indicated that LPs would bind to cells in a non-specific manner, and it took longer

to induce RNAi than with the transfection reagent. However, ZHER2-BNC/LP had no

impact on the expression of GFP in HeLa cells, while the inhibition of GFP synthesis

was clearly confirmed in SKBR3 cells during 48 h of incubation. Furthermore,

diminished GFP fluorescence was observed even after 24 h, indicating that

ZHER2-BNC/LP had fast-acting properties that were equivalent to with the transfection

reagent. These results demonstrated that ZHER2-BNC/LP can stabilize siRNA via the

formulation of a complex carrier to efficiently deliver siRNA inside specific

HER2-expressing cells through endosomal escape, which would allow RNAi to

effectively inhibit protein expression.

CONCLUSION

Although the therapeutic effect of siRNA has been highly anticipated, its

inability to specifically target cells and to cross the cell membrane has limited its in vivo

application (Cardoso, 2009). In this study, we succeeded in delivering and introducing

siRNA into targeted breast carcinoma cells, which led to the effective use of RNAi by

89

24 h 48 h

control

RNAiMAX

LP

ZHER2-BNC/LP

A. SKBR3 cell 24 h 48 h

control

RNAiMAX

LP

ZHER2-BNC/LP

A. SKBR3 cell

90

Fig. 5. Fluorescence images of HER2-positive SKBR3 (A) and HER2-negative HeLa

(B) cells treated by siRNA combined with RNAiMAX, LPs and ZHER2-BNC/LP

complex (final conc. 25 nM as siRNA). The cells were incubated for 24 and 48 h, and

then observed using a confocal laser scanning microscope. Scale bars, 50 m.

control

RNAiMAX

LP

ZHER2-BNC/LP

24 h 48 hB. HeLa cell

control

RNAiMAX

LP

ZHER2-BNC/LP

24 h 48 hB. HeLa cell

91

using ZHER2-BNC/LP as the carrier. Thus, in the field of nucleic acid medicine,

ZHER2-BNC/LP can be a useful carrier for siRNA delivery, and could also become a

useful tool for gene silencing and to accomplish protein knock-down.

REFERENCES

Cardoso, A., Trabulo, S., Moreira, J.N., Düzgüneş, N., de Lima, M.C., 2009. Targeted

lipoplexes for siRNA delivery. Methods Enzymol. 465, 267-287.

Chang, C.I., Kim, H.A., Dua, P., Kim, S., Li, C.J., Lee, D.K., 2011. Structural diversity

repertoire of gene silencing small interfering RNAs. Nucleic Acid Ther. 21(3), 125-131.









92




E., Tanizawa, K., Kuroda, S., 2008. In Vivo Delivery of Bionanocapsules Displaying Phaseolus

vulgarisAgglutinin-L4 Isolectin to Malignant Tumors Overexpressing

N-Acetylglucosaminyltransferase V. Human Gene Therapy. 887-895.

Kasuya, T., Jung. J., Kinoshita. R., Goh. Y., Matsuzaki. T., Iijima. M., Yoshimoto. N.,

Tanizawa. K., Kuroda. S., 2009. Bio-nanocapsule-liposome conjugates for in vivo

pinpoint drug and gene delivery. Methods Enzymol. 464, 147-166.

Kurata, N., Shishido, T., Muraoka, M., Tanaka, T., Ogino, C., Fukuda, H., Kondo, A.,

2008. Specific protein delivery to target cells by antibody-displaying bionanocapsules. J

Biochem. 144(6), 701-707.




Lundberg, P., El-Andaloussi, S., Sütlü, T., Johansson, H., Langel, U., 2007. Delivery of

short interfering RNA using endosomolytic cell-penetrating peptides. FASEB J. 21(11),

2664-2671.

93

Miele, E., Spinelli, G.P., Miele, E., Di, Fabrizio, E., Ferretti, E., Tomao, S., Gulino, A.,

2012. Nanoparticle-based delivery of small interfering RNA: challenges for cancer

therapy. Int J Nanomedicine. 7, 3637-3657.

Nishimura, Y., Ishii, J., Okazaki, F., Ogino, C., Kondo, A., 2012. Complex carriers of

affibody-displaying bio-nanocapsules and composition-varied liposomes for

HER2-expressing breast cancer cell-specific protein delivery. J Drug Target. 20(10),

897-905.




Cancer Res. 66, 4339–4348.




Spagnou, S., Miller, A.D., Keller, M., 2004. Lipidic carriers of siRNA: differences in

the formulation, cellular uptake, and delivery with plasmid DNA. Biochemistry. 43(42),

13348-13356.

Tseng, Y.C., Mozumdar, S., Huang, L., 2009. Lipid-based systemic delivery of siRNA.

Adv Drug Deliv Rev. 61(9), 721-731.

94

Wirth, M., Fritsche, P., Stojanovic, N., Brandl, M., Jaeckel, S., Schmid, R.M., Saur, D.,

Schneider, G., 2011. A simple and cost-effective method to transfect small interfering

RNAs into pancreatic cancer cell lines using polyethylenimine. Pancreas. 40(1),

144-150.




21, 885-890.

95

PART IV.

An affinity chromatography method

used to purify His-tag-displaying bio-nanocapsules

96

INTRODUCTION

A bio-nanocapsule (BNC) consisting of a hepatitis B surface antigen (HBsAg)

and a lipid bilayer is a hollow virus-like particle (Kuroda et al., 1992) that has been

studied as a carrier for drug delivery systems (DDS) (Yamada et al., 2003). Since wild

type (WT) BNCs specifically recognize hepatic cells, they are used as carriers to deliver

drugs to hepatocarcinomas (Yamada et al., 2003). In the past, WT BNCs have also been

altered into modified BNCs that recognize other types of cells by replacing the

hepatocyte recognition site in the pre-S region with other targeting molecules (Kasuya

et al., 2008; Shishido et al., 2009a, 2009b). For example, a ZHER2-displaying BNC

(ZHER2-BNC) specifically recognizes HER2-expressing cells that include breast cancer

cells and ovarian cancer cells (Shishido et al., 2010). The ZHER2 is one of a type of

affibodies that are the mutant proteins derived from the Z domain of Staphylococcal

protein A and function as affinity ligands (Orlova et al., 2006; Lee et al., 2008). These

WT and altered BNCs can be mass-produced in yeast cells (Kuroda et al., 1992;

Shishido et al., 2010). Approaches using ultracentrifugation (Kuroda et al., 1992) or

affinity chromatography combined with gel filtration (Kasuya et al., 2009) have been

reported as methods for purification of the BNCs from crude yeast extract. The

advantage of the ultracentrifugation method is a general versatility, which is available to

purify both WT BNC and altered BNCs; and, therefore, it is used conventionally for the

purification of BNCs. However, the yield and degree of purification are often not high

enough because the density gradient methods are laborious for the complete removal of

foreign substances, and relatively many purification steps lead to a loss in target

proteins and time consumption. However, the affinity chromatography method can

97

provide high-yield, high-degree purification using procedures that are simple and brief.

However, these methods have not been frequently used to purify BNCs, because it was

believed they were not applicable. This procedure commonly requires appropriate

purification columns that depend on the types of produced BNCs, such as a sulfated

cellulofine column (for WT BNC; Kasuya et al., 2009) or a porcine IgG column (for Z

domain-displaying BNC; Kasuya et al., 2009), and often there is a failure to find a

suitable affinity column. Thus, since both methods have advantages and disadvantages,

a simple, versatile and high-recovery purification method that would be applicable to

any BNC would be useful. Therefore, we attempted to establish an affinity

chromatography method to purify BNCs using the His-tag that is a gold standard for

protein purification (Sakamoto et al., 2010). In the present study, we tried to develop

affinity purification by genetically fusing hexahistidine sequences (His6) to a targeting

molecule substituted for the pre-S region within the BNC. This simple method of only

inserting an His6-tag is expected to apply only to WT and altered BNCs. Therefore, we

investigated whether we could successfully purify ZHER2-BNCs using an His6-tag and

compared the effectiveness with the conventional ultracentrifugation purification

method.


To purify BNCs by His6 affinity chromatography, we constructed a plasmid

that would express the His6-tagged ZHER2-BNC in which His6 was fused to the

98

N-terminus of a ZHER2 fragment (Fig. 1). The plasmid for expression of the His6-tagged

ZHER2-BNC was constructed to replace the pre-S region in the L protein with a

His6-ZHER2 molecule, as described below. The fragment encoding His6-fused ZHER2

(His6-ZHER2) was amplified by polymerase chain reaction (PCR) using

pGLDsLd50-ZHER2 (Shishido et al., 2010) as a template with the following primers: (5’-

GGG GGA TCC CAC CAC CAC CAC CAC CAC GCG CAA CAC GAT GAA GCC

GTA GAC AAC AAA TTC AAC AA -3’ and 5’- GGG GCG GCC GCC TTT CGG

CGC CTA AGC ATC AT -3’). The amplified fragment was digested with BamHI/NotI

and ligated into the BamHI/NotI sites of pGLDsLd50-ZHER2. The resultant plasmid was

designated as a pGLDsLd50-His6-ZHER2. A Saccharomyces cerevisiae AH22R- yeast

strain was transformed with the constructed plasmid using the spheroplast method, and

was cultured and disrupted with glass beads (Kuroda et al., 1992). Then we examined

whether the crude extract contained the His6-ZHER2 fusion proteins by western blotting

using anti-His6 antibody and anti-protein A antibody (data not shown). We detected the

same sized bands in both lanes, which indicated that the produced BNCs contained His6

and ZHER2 as a fusion protein.

A crude yeast extract was purified by each of the purification methods listed

below. We evaluated the degree of the purified samples collected in each step of

purification via silver staining using Sil-Best stain One (Nacalai Tesque, Kyoto, Japan)

(Fig. 2). For the ultracentrifugation purification method, we followed the previous

specified procedures (Kuroda et al., 1992). The objective bands were shown through

five steps of purification, which contained polyethylene glycol (PEG) precipitation for 2

h (lane 4), dialysis for 6 h after CsCl ultracentrifugation for 16 h (lane 5), dialysis for 6

99

Fig. 1. Schematic representations of constructed BNCs (WT BNC, ZHER2-BNC and

His6-ZHER2-BNC).

100

Fig. 2. Analysis of the degree of purification by silver staining. Lanes 1–2, His6 affinity

chromatography purification; lanes 3–8, ultracentrifugation purification. Sample was

subjected to SDS-PAGE followed by crude yeast extract (lane 1 and lane 3) into an

affinity column and dialyzed for 6 h (lane 2), PEG precipitation for 2 h (lane 4), dialysis

for 6 h after CsCl ultracentrifugation for 16 h (lane 5), dialysis for 6 h after CsCl

ultracentrifugation for 14 h (lane 6), dialysis for 6 h after sucrose ultracentrifugation for

10 h (lane 7) and condensation (lane 8).

101

h after CsCl ultracentrifugation for 14 h (lane 6), dialysis for 6 h after sucrose

ultracentrifugation for 10 h (lane 7), and condensation (lane 8). However, it was thought

that the purified samples contained unnecessary proteins, because other thin bands and a

smear band were also detected throughout the lanes.

Next, a His6 affinity chromatography method was performed as described

below. The crude extract was prepared by disrupting the cultured yeast cells with glass

beads in 75 ml of dissociation buffer [7.5 M Urea, 170 mM Na2HPO4, 40 mM NaH2PO4,

15 mM disodium ethylene diamine tetraacetic acid (EDTA/2Na), 2 mM

phenylmethylsulfonyl fluoride (PMSF), and 0.01% sorbitan polyoxyethylene

monooleate (Tween 80)]. The pellet was removed by centrifugation at 14,000×g and

4 °C for 10 min. The His6-ZHER2-BNC was separated from the crude extract using Ni2＋

-chelate affinity chromatography. A column with 5 ml of Ni2＋-chelate agarose (Nacalai

Tesque) was pre-equilibrated with a 5-fold volume of dissociation buffer. The crude

extract was loaded into the column and washed with 15 ml of dissociation buffer. Then,

bound proteins were eluted with 15 ml of elution buffer (dissociation buffer with 1 M

imidazole). The eluate was fractionated in 1 ml aliquots. The aliquots of each fraction

were analyzed by silver staining to select the fractions containing proteins. The proteins

of purified fractions were finally dialyzed in phosphate-buffered saline (PBS) to remove

the urea. The method was very simple, and amounted to simply applying crude yeast

extract into the affinity column and dialyzing it for 6 h (lane 2). Two objective, albeit

different, bands were observed near 44 kDa that were produced by the presence and

absence of N-glycosylation, as previously reported (Shishido et al., 2010). The thin

band observed at near 25 kDa was a degraded His6-fused protein. This useless protein

102

should be omitted by optimizing the process (e.g., changing the cultivation and/or

extraction conditions) when the BNCs are used for commercial purposes. Nevertheless,

clear, objective bands were obtained without the smear bands produced by

ultracentrifugation purification, demonstrating a high purity for the His6 affinity

chromatography.

We measured the collateral concentrations of proteins contained within each

step of purification using a Lowry protein assay and then calculated the yields. In the

case of the ultracentrifugation method (Table 1B), we eventually obtained 1.3 mg

protein (yield, 0.61%). When combined with the results of silver staining, however, the

actual yield would be less than 0.61%. In the case of the His6 affinity chromatography

method, we eventually obtained 2.9 mg protein (yield, 1.52%). From the results of the

silver staining, these values would be almost the same as the actual amount and yield of

the His6-tagged target protein, because the useless proteins were rarely contaminated.

As a result, the His6 affinity chromatography method achieved a yield that was almost

2.5-fold higher than that achieved with ultracentrifugation, despite being a simple

one-step purification (Table 1A).

To evaluate the quality of purified His6-ZHER2-BNCs, we measured the

diameter by DLS using a Zetasizer Nano particle size analyzer (Malvern Instruments

Ltd., Worcestershire, UK). The His6-ZHER2-BNCs purified by His6 affinity

chromatography were about 100 nm in diameter, and were similar to the

His6-ZHER2-BNCs that were purified via the ultracentrifugation method. Since both

diameters were almost equal to that of the ZHER2-BNCs (without His6-tag) purified by

103

Table. 1. The yield of purified protein for each step of (A) affinity chromatography

method and (B) ultracentrifugation method. The number of steps was compatible with

each lane of Fig. 2.

100.00191.162.52940.11. Crude extract

1.522.915.0189.92. After affinity purification

(A) Step of affinitychromatography method

Concentration[g/ml]

Liquid measure[ml]

Mass[mg]

Yield[%]

100.00191.162.52940.11. Crude extract

1.522.915.0189.92. After affinity purification

(A) Step of affinitychromatography method

Concentration[g/ml]

Liquid measure[ml]

Mass[mg]

Yield[%]

Yield[%]

Mass[mg]

Liquid measure[ml]

Concentration[g/ml]

(B) Step of ultracentrifugation method

0.611.310.0133.18. After condensation

1.362.9103.828.07. After ultracentrifugation 3


13.4128.755.0522.1 5. After ultracentrifugation 1

43.6993.527.03461.84. After PEG precipitation

100.00214.060.03566.93. Crude extract

Yield[%]

Mass[mg]

Liquid measure[ml]

Concentration[g/ml]

(B) Step of ultracentrifugation method

0.611.310.0133.18. After condensation



13.4128.755.0522.1 5. After ultracentrifugation 1

43.6993.527.03461.84. After PEG precipitation

100.00214.060.03566.93. Crude extract

104

the ultracentrifugation method (Shishido et al., 2010), this indicated that the insertion of

a His6-tag into the ZHER2-BNC had no influence on particle formation.

Finally, to determine the ability of cell specificity, we reacted the purified

BNCs with Alexa Fluor 488 succinimidyl esters (Invitrogen Life Technologies,

Carlsbad, CA, USA) (2.6 mol equivalent) in PBS for 1 h at room temperature and

dialyzed the mixture against PBS overnight to remove the free Alexa Fluor 488. Then,

we added them to HER2-positive SKBR3 cells (human breast carcinoma) (Davison et

al., 2011) and HER2-negative HeLa cells (human cervical carcinoma) (Jia et al., 2003).

The fluorescence of the cells was observed using a confocal laser scanning microscope

(CLSM) (Fig. 3). We observed fluorescence in both SKBR3 cells treated with

His6-ZHER2-BNCs purified by ultracentrifugation and the His6 affinity chromatography

also with ZHER2-BNCs (without a His6-tag) purified by ultracentrifugation, which

indicated that the His6-fused ZHER2-BNCs had no adverse effect on cell specificity. This

result showed that the insertion of a His6-tag into the BNCs is a successful alternate for

the previously reported BNC purification techniques.

CONCLUSION

We successfully developed a simple, versatile and high-recovery purification

method using His6 affinity chromatography. This method permits the basic purification

of altered BNCs, and would be useful for large-scale purification in commercial

105

Fig. 3. Fluorescence images of HER2-positive SKBR3 and HER2-negative HeLa cells

treated with Alexa Fluor 488 labeled His6-ZHER2-BNC purified by ultracentrifugation or

His6 affinity chromatography and ZHER2-BNC (without His6) purified by

ultracentrifugation. Cells were incubated for 1 h in the media adjusted to 10 g/ml as

protein. After washing twice, cells were additionally incubated for 2 h and then

observed by a confocal laser scanning microscope. Scale bar, 50 m.

106

applications.

REFERENCES












Kasuya, T., Jung. J., Kinoshita. R., Goh. Y., Matsuzaki. T., Iijima. M., Yoshimoto. N.,

Tanizawa. K., Kuroda. S., 2009. Bio-nanocapsule-liposome conjugates for in vivo

pinpoint drug and gene delivery. Methods Enzymol. 464, 147-166.

107










Cancer Res. 66, 4339–4348.

Sakamoto. T., Sawamoto. S., Tanaka. T., Fukuda. H., Kondo. A., 2010.

Enzyme-mediated site-specific antibody-protein modification using a ZZ domain as a

linker. Bioconjug Chem. 21 (12), 2227-2233.






Chem Lett. 19, 1473-1476.

108



HER2-expressing cancer cells. Bioorg Med Chem Lett. 20, 5726-5731




21, 885-890.

109

PART V.

Granting specificity for breast cancer cells using a Hepatitis B

core particle with a HER2-targeted affibody molecule

110

INTRODUCTION

Anticancer drugs act against abnormal proteins in cancer cells and present a

large treatment effect. However, they are often limited by their systemic toxicities and

side effects (Wang, 2012). Therefore, targeting ability is an important factor for the

development of drug delivery systems (DDS). To attain pinpoint delivery to target cells,

studies have extensively focused on fusing targeting molecules with the drug itself

(Lorberboum-Galski, 2011) or on modifying the surface of the DDS carrier (Liong,

2008; Nie, 2007). As the targeting molecules, binding molecules such as antibodies (Ma,

2011), peptides (Accardo, 2012) and aptamers (Zhang, 2012) are often used.

As a binding protein, the affibody is an attractive molecule. An affibody is a

small molecule that is based on the Z domain derived from Staphylococcus aureus

protein A (Nygren, 2008). As a type of affibody, ZHER2 has the ability to bind to HER2

that is a type 2 epidermal growth factor receptor (EGFR) and is expressed on the surface

of breast cancer cells and ovarian cancer cells (Orlova, 2006; Lee, 2008). Since natural

ligands against HER2 have yet to be found in nature (Shojaei, 2012), ZHER2 has been

used as an alternative molecular probe to diagnose (Gao, 2011) or target HER2

expressing cells (Puri, 2008). In addition, various other types of affibodies such as ZWT,

Z440 and Z955 can be used as the binding molecules to the Fc regions of immunoglobulin

G, IGF1R and EGFR, respectively (Nygren, 2008; Li, 2010; Nordberga, 2007).

Hepatitis B virus (HBV) core protein (HBc) has been studied for developing

viral genome-free particles as DDS carriers. The HBc is a 183 amino acid (aa) protein

and assembles spontaneously into icosahedral capsid-like particles comprising 180~240

subunits (Cooper, 2005). The important feature of HBc is to transiently dissociate and

111

re-associate in the presence or absence of denaturants, thereby enabling it to enclose

molecules such as drugs (Leea, 2008). In addition, the HBc can be produced in large

quantities, because it can be expressed in Escherichia coli (Wizemann, 1999). The

original HBc has been used as a permeable particle because it has the ability to bind to

every cell (Cooper, 2005), which is caused by an arginine-rich domain (150~183 aa)

that recognizes the cell surface heparan sulfate proteoglycan with an electrostatic

interaction (Cooper, 2006). Additionally, foreign molecules (e.g. GFP) have been

successfully displayed on the surface of a HBc particle without drastically altering its

structure via insertion into the 78~81 aa position of the original HBc core protein (Kratz,

1999).

ΔHBc consisting of the first 149 aa residues of a core protein was developed

as a deletion mutant lacking a non-specific binding ability (Birnbaum, 1990). The ΔHBc

particle is far more suitable for a DDS capsule than the original HBc because of the

particle’s capacity to incorporate drugs (Beteramsa, 2000) and the avoidance of

host-derived RNA/DNA binding functions (Birnbaum, 1990). However, despite the

successful development of the ΔHBc particle, there have been no reports of a

binding-molecule-fused ΔHBc.

In the present study, we developed a concept for constructing a DDS carrier

that is based on the ΔHBc particle and that can specifically recognize target cancer cells.

By genetically inserting a ZHER2 affibody between the 78~81 aa of a ΔHBc core protein,

the engineered particle (ZHER2-ΔHBc) specifically binded to HER2-expressing breast

cancer cells.

112


Construction of plasmids for the expression of core particles

The plasmids for expression of HBc, ΔHBc and ZHER2-ΔHBc were

constructed as described below. Fragment 1 and fragment 2 encoding HBc were

amplified by polymerase chain reaction (PCR) with the following primers: fragment 1

(5’- GGG GCT AGC AAT AAT TTT GTT TAA CTT TAA GAA GGA GAT ATA CAT

ATG ATG GAC ATT GAC CCG TAT AA -3’ and 5’- ATT CTC TAG ACT CGA GAT

TAC TTC CCA CCC AGG TGG -3’) and fragment 2 (5’- TAA TCT CGA GTC TAG

AGA ATT AGT AGT CAG CTA TGT -3’ and 5’- CCC GTC GAC TTA GTG GTG

GTG GTG GTG GTG ACA TTG AGA TTC CCG AGA TT -3’). Then, the whole-length

fragment encoding of HBc was amplified from fragment 1 and fragment 2 with the

following primers: (5’- GGG GCT AGC AAT AAT TTT GTT TAA CTT TAA GAA

GGA GAT ATA CAT ATG ATG GAC ATT GAC CCG TAT AA -3’ and 5’- CCC GTC

GAC TTA GTG GTG GTG GTG GTG GTG ACA TTG AGA TTC CCG AGA TT -3’).

The amplified fragment was digested with NheI/SalI and ligated into the XbaI/SalI sites

of pET-22b (+) (Novagen). The resultant plasmid was designated as pET-22b-HBc.

Fragment encoding of ΔHBc was amplified from pET-22b-HBc with the following

primers: (5’- TAA TCT CGA GTC TAG AGA ATT AGT AGT CAG CTA TGT -3’ and

5’- GGG GTC GAC AAG CTT TTA GTG GTG GTG GTG GTG GTG AAC AAC AGT

AGT TTC CGG AA -3’). The amplified fragment was digested with XbaI/SalI and

ligated into the same sites of pET-22b-HBc. The resultant plasmid was designated as

pET-22b-ΔHBc. A fragment encoding ZHER2 was amplified from pGLDsLd50-ZHER2

113

(Shishido, 2010) with the following primers: (5’- GGG CTC GAG GAC GGT GGT

GGT GGT TCT GCG CAA CAC GAT GAA GCC GT -3’ and 5’- GGG TCT AGA ACC

ACC ACC ACC TTT CGG CGC CTG AGC ATC AT -3’). The amplified fragment was

digested with XhoI/XbaI and ligated into the same sites of pET-22b-ΔHBc. The resultant

plasmid was designated as pET-22b-ZHER2-ΔHBc.

Expression of core particles in E. coli

The plasmids for expression of HBc, ΔHBc and ZHER2-ΔHBc were transformed

into E. coli BL21. The culture of E. coli BL21 carrying each plasmid was diluted with 1

L of fresh LB-medium (1% tryptone, 0.5% yeast extract, 0.5% NaCl) in the presence of

100 g/ml ampicillin and grown to OD600 = 0.7 at 37 °C and a shaking speed of 150

rpm. The culture was induced by adding isopropyl-β-thiogalactopyranoside (IPTG) to a

final concentration of 0.1 mM at 25 °C overnight. Cells were then collected at 3,000

rpm and 4 °C for 15 min.

Purification of core particles

To purify core particles fused with a His6-tag, we followed the procedure

described by H. Wizemann and A. von Brunn (1999) with minor modifications. Briefly,

the cell pellet was resuspended in 50 ml of lysis buffer (pH 8.0)(50 mM Tris-HCl, 100

mM NaCl, 5 mM EDTA, 0.2% Triton X-100, 10 mM β-mercaptethanol). The cells were

lysed on ice by 3 cycles of sonication for 1 min each with 2 min intervals to avoid

heating of the material. The supernatant was removed by centrifugation at 15,000 rpm

and 4 °C for 30 min. The core particles in the pellet were washed in 50 ml of lysis

buffer and collected by centrifugation at 12,000 rpm and 4 °C for 15 min twice. The

114

pellet containing E. coli proteins was dissolved in 50 ml of dissociation buffer (pH

9.5)(4 M Urea, 200 mM NaCl, 50 mM Sodium Carbonate, 10 mM β-mercaptethanol) by

overnight incubation in an ice-cold water bath. Then, the soluble fraction was separated

by centrifugation at 15,000 rpm and 4 °C for 20 min.

Contaminating proteins were separated from the core particle proteins using

Ni2＋-chelate affinity chromatography. A column with 10 ml of Ni2＋-chelate agarose

(Nacalai Tesque, Kyoto, Japan) was pre-equilibrated with a 5-fold volume of

dissociation buffer. The prepared sample was loaded into a column and washed with 30

ml of dissociation buffer. Then, bound proteins were eluted with 30 ml of elution buffer

(pH 9.5) (4 M Urea, 200 mM NaCl, 50 mM sodium Carbonate, 10 mM

β-mercaptethanol, 1 M Imidazole). The eluate was fractionated in 1 ml aliquots. The

aliquots of each fraction were subjected to sodium dodecyl sulphate-polyacrylamide gel

electrophoresis (SDS-PAGE) and stained with Coomassie Brilliant Blue (CBB) to

analyze their purity. The proteins of purified fractions were polymerized to core

particles by the removal of the urea in a polymerization buffer (pH 7.0)(500 mM NaCl,

50 mM Tris-HCl, 0.5 mM EDTA).

SDS-PAGE and western blotting

The expression of each core monomer was confirmed by western blotting. The

purified core particles were analyzed by SDS-PAGE and electrotransferred onto a

polyvinilidene fluoride (PVDF) membrane. For the detection of the His6 tag, Rabbit

anti-6-His antibodies (Bethyl Laboratories, Montgomery, TX, USA) were used as a

primary antibody for immunoblotting, followed by anti-rabbit antibodies conjugated

with alkaline phosphatase (AP) (Promega, Madison, WI, USA) used as a second

115

antibody. For the detection of Z protein, Goat anti-protein A antibodies (Rockland

Immunochemicals Inc, Gilbertsville, PA, USA) were used as the primary antibody for

immunoblotting, followed by anti-goat antibodies conjugated with alkaline phosphatase

(AP) (Promega) used as the second antibody. The membrane was stained with

5-bromo-4-chloro-3-indolyl phosphate (BCIP) and nitro blue tetrazolium (NBT)

(Promega).

AFM Analysis of Purified core particles

A gold chip (100 nm thickness of Au wafer, KST world, Fukui, Japan) was

covered with 200 l of solution containing core particles at room temperature for 1 h.

The gold chip was then washed with 10 ml of polymerization buffer. After washing, the

core particles adsorbed onto the surface of the gold chip were measured using an

SPA400-Nanonavi atomic force microscopy (AFM) unit (SII Nanotechnology Inc,

Chiba, Japan) with a cantilever (BL-RC150VB-C1 from Olympus; Tokyo, Japan) at 0.8

kHz scan speed according to the manufacturer's procedure.

Dynamic light scattering analysis of purified core particles

The size of the purified core particles was determined by dynamic light

scattering (DLS) using a Zetasizer Nano ZS (Malvern Instruments Ltd., Worcestershire,

UK), following the manufacturer's procedure.

Cell culture

SKBR3 cells (human breast carcinoma) were maintained in RPMI 1640

medium supplemented with 10% (v/v) FBS at 37 °C in 5% CO2. MCF-7 cells (human

116

breast carcinoma) and HeLa cells (human cervical carcinoma) were maintained in

DMEM medium supplemented with 10% FBS at 37 °C in 5% CO2.

Flow cytometric evaluation

Purified core particles were reacted with Alexa Fluor 488 Succinimidyl Esters

(Invitrogen Life Technologies, Carlsbad, CA, USA) (2.6 mol equiv) in PBS for 1 h at

room temperature. The mixture then was dialyzed against polymerization buffer

overnight to remove free Alexa Fluor 488. Approximately 2×105 of SKBR3, MCF-7 and

HeLa cells were seeded in individual 12-well plates. After washing with serum-free

medium, indicated volumes of Alexa Fluore 488-labeled core particles were added to

the medium, each of which was adjusted to a volume of 1 ml, followed by culturing of

the cells for 1 h. After washing with serum-free medium twice, the cells were incubated

with FBS-containing medium for 2 h. Cells were suspended into a sheath solution and

subjected to a BD FACSCanto II flow cytometer equipped with a 488-nm blue laser

(BD Biosciences, San Jose, CA, USA). The green fluorescence signal was collected

through a 530/30-nm band-pass filter. The data were analyzed using the BD FACSDiva

software v5.0 (BD Biosciences).

Confocal laser scanning microscopy observation

Approximately 5×104 of SKBR3, MCF-7 and HeLa cells were seeded in

individual 35 mm glass-bottom dishes. After washing with serum-free medium, Alexa

Fluore 488-labeled core particles (10 g/ml) were added and then cells were cultured

for 1 h. After washing with serum-free medium twice, the cells were incubated with

FBS-containing medium for 2 h. The cells were observed using a LSM 5 PASCAL laser

117

scanning confocal microscope (Carl Zeiss, Oberkochen, Germany) equipped with a

63-fold oil immersion objective lens with excitation by the 488-nm line of an argon

laser and emission collection by a 505-nm long pass filter.


Expression of core proteins and formation of particles

As shown in Fig. 1, we first constructed the plasmid to express the His6 tag

fused HBc, which consisted of 183 amino acid residues of full-length core proteins. To

eliminate the non-specific binding property of a core protein, we constructed the

plasmid to express a ΔHBc consisting of 149 amino acid residues by deleting the

corresponding sequence to the C-terminal arginine-rich domain (Fig. 1). Finally, we

constructed the expression plasmid for ZHER2-ΔHBc, in which a ZHER2 affibody

molecule was inserted between the 78~81 amino acid positions of the ΔHBc (Fig. 1). As

described in the materials and methods section, we introduced these plasmids into E.

coli and produced each kind of HBc particle.

First, to check the expression and purification of each core protein, we

performed western blot analysis with anti-His6 antibody. Since three His6-specific

bands appeared at each desired position (HBc, 21 kDa; ΔHBc, 17 kDa; and,

ZHER2-ΔHBc, 24 kDa, respectively), successful expression and purification of the core

proteins was confirmed (Fig. 2, left). When using anti-protein A antibody that can

specifically bind to the Z-derived affibodies, we detected the single band only for

118

Fig. 1. Schematic representations of constructed core proteins (HBc, ΔHBc and

ZHER2-ΔHBc). Wild-type HBc core protein consisted of an assembly domain (gray

prismatic body) and an arginine-rich domain (white prismatic body). For ΔHBc core

protein, the arginine-rich domain (150-183 aa) was deleted. For the ZHER2-ΔHBc core

protein, ZHER2 affibody (diagonal prismatic body) was inserted at the XhoI and XbaI

sites between 78 and 81 aa. For all constructs, His6-tag (black prismatic body) was

fused to the C-termini.

119

ZHER2-ΔHBc (24 kDa), as expected (Fig. 2, right). Furthermore, secondary structural

formation of each core protein was confirmed by circular dichroism (CD) spectra

analysis (data not shown).

Second, to examine whether each core protein-formed particle could be

attributed to the capsid-like structure, we analyzed the purified core proteins by DLS

(Fig. 3) and AFM (Fig. 4). Two measurement analysis suggested similar results, and it

was strongly supported that every core protein showed same particle-like structure that

was approximately 50 nm in diameter. According to previously reported for wild-type

HBc particles analysis [20, 21], it was assumed that the deletion of the arginine-rich

domain and the insertion of the ZHER2 affibody did not affect the self-assembly of the

engineered core proteins.

Examination of the ability of a ZHER2-ΔHBc particle to recognize HER2-expressing

breast cancer cells

Next, to evaluate the binding ability to HER2-expressing breast cancer cells,

we labeled the particles with Alexa Fluor 488. Then, each kind of particle was added to

two types of HER2 positive human breast cancer cells (SKBR3, expressing an abundant

amount of HER2; and, MCF-7, expressing a tiny amount of HER2) and a HER2

negative human cervical cancer cell (HeLa) at several concentrations. After 3 hours of

incubation, we measured the fluorescence intensity of these cells by FACS.

As shown in Fig. 5A, the addition of a wild-type HBc particle caused a

dose-dependent increase in fluorescence for all three kinds of cancer cells (SKBR3,

MCF-7 and HeLa), indicating that the original HBc particle binds to the cells in a

non-specific manner. The addition of a ΔHBc particle didn’t exhibit fluorescence for all

120

Fig. 2. Western blotting analyses of purified core particles. Purified samples (HBc,

ΔHBc and ZHER2-ΔHBc) were subjected to SDS-PAGE followed by immune blotting

using anti-His6 antibody (for His6 tag; left image) and anti-protein A antibody (for

ZHER2 affibody; right image).

121

Fig. 3. Particle size distribution analysis by DLS. The average sizes of (A) HBc, (B)

ΔHBc and (C) ZHER2-ΔHBc are 55.38±10.84 nm, 47.41±10.07 nm and 45.05±1.50

nm, respectively.

0

10

20

30

40

0.1 1 10 100 1000 10000

0

10

20

30

40

0.1 1 10 100 1000 10000

0

10

20

30

40

0.1 1 10 100 1000 10000

A. HBc

B. ΔHBc

C. ZHER2-ΔHBc

Inte

nsity

Inte

nsity

Inte

nsity

Diameter

Diameter

Diameter

0

10

20

30

40

0.1 1 10 100 1000 10000

0

10

20

30

40

0.1 1 10 100 1000 10000

0

10

20

30

40

0.1 1 10 100 1000 10000

A. HBc

B. ΔHBc

C. ZHER2-ΔHBc

Inte

nsity

Inte

nsity

Inte

nsity

Diameter

Diameter

Diameter

122

Fig. 4. AFM analyses of purified core particles. The macro and micro photographs

show 2D and 3D images, respectively. HBc core particles were analyzed on the surface

of the gold chip. (A) HBc, (B) ΔHBc and (C) ZHER2-ΔHBc. Scale bars, 50 m.

A. HBc B. ΔHBc

C. ZHER2-ΔHBc

A. HBc B. ΔHBc

C. ZHER2-ΔHBc

123

three cells, supporting the theory that the deletion of the arginine-rich domain can

cancel the non-specific binding ability of the original HBc (Fig. 5B). By contrast, the

addition of a ZHER2-ΔHBc particle promoted an apparent fluorescence for SKBR3 cells

in a dose-dependent manner (white bars), whereas it never exhibited fluorescence for

the HeLa cells (black bars) (Fig. 5C). Additionally, the addition of ZHER2-ΔHBc to

MCF-7 showed a weaker fluorescence than in the case of SKBR3 (Fig. 5C, gray bars).

These results indicate that ZHER2-ΔHBc specifically recognized HER2-expressing breast

cancer cells, and that the binding amount of ZHER2-ΔHBc differed in accordance with

the HER2 expression levels in the cells.

Finally, to visually observe the binding ability of these particles to the cells,

Alexa Fluor 488-labeled core particles were added into the cell cultures (SKBR3,

MCF-7 and HeLa) to give a final concentration of 10 g/ml. After 3 hours of incubation,

the cells were observed using a confocal laser scanning microscope (CLSM) (Fig. 6).

These results were consistent with the results of the FACS analyses (Fig. 5),

demonstrating that the ZHER2-ΔHBc particle has the ability to specifically bind to

HER2-expressing breast cancer cells.

CONCLUSION

We developed a HBc particle displaying a ZHER2 affibody that specifically

recognizes HER2-expressing breast cancer cells. It would be possible to incorporate

drugs into ZHER2-HBc particles by using the dissociation and association mechanism

124

Fig. 5. Relative fluorescence units (RFU) of HER2 positive and negative cells

treated with several concentrations of Alexa Fluor 488 labeled HBc core particles.

RFUs were determined by FACS measurement. (A) HBc, (B) ΔHBc and (C)

ZHER2-ΔHBc. White bars, SKBR3 (HER2, +++); gray bars, MCF-7 (HER2, +); and,

black bars, HeLa (HER2, –).

Concentration of core particles [g/ml]

0 1 2.5 5.0 7.5 10

0 1 2.5 5.0 7.5 10

0 1 2.5 5.0 7.5 10

6

5

4

3

2

1

0

16

14

12

10

8

6

0

4

2

RF

U [

-]


RF

U [

-]


RF

U [

-]

A. HBc

B. ΔHBc

C. ZHER2-ΔHBc

6

5

4

3

2

1

0


0 1 2.5 5.0 7.5 10

0 1 2.5 5.0 7.5 10

0 1 2.5 5.0 7.5 10

6

5

4

3

2

1

0

16

14

12

10

8

6

0

4

2

RF

U [

-]


RF

U [

-]


RF

U [

-]

A. HBc

B. ΔHBc

C. ZHER2-ΔHBc

6

5

4

3

2

1

0

125

Fig. 6. Fluorescence images of SKBR3 (HER2, +++), MCF-7 (HER2, +) and HeLa

(HER2, –) treated with Alexa Fluor 488 labeled HBc core particles (10 g/ml). Cells

were observed on a confocal laser scanning microscope. Scale bars, 50 m.

MCF-7 HeLaSKBR3

HB

cΔ

HB

cZ

HE

R2-Δ

HB

c

MCF-7 HeLaSKBR3

HB

cΔ

HB

cZ

HE

R2-Δ

HB

c

126

regulated by salt concentration (Kann, 1994) or urea denaturant (Wizemann, 1999), or

by fusing peptidic drugs to C-terminal tail of core protein (Beteramsa, 2000). By

inserting other types of affibody molecules to the ΔHBc, these engineered HBc core

particles could be used as pinpoint carriers to target various kinds of cancer cells.

ABBREVIATIONS

DDS, drug delivery system; HER2, human EGFR-related 2; EGFR, epidermal growth

factor receptor; IGF1R, insulin-like growth factor-1 receptor ; HBV, hepatitis B virus;

HBc, hepatitis B core; GFP, green fluorescence protein; OD, overdose; IPTG,

isopropyl-β-thiogalactopyranoside; SDS-PAFE, sodium dodecyl

sulphate-polyacrylamide gel electrophoresis; CBB, Coomassie Brilliant Blue; RVDF,

polyvinilidene fluoride; AP, phosphatase; BCIP, 5-bromo-4-chloro-3-indolyl phosphate;

NBT, nitro blue tetrazolium; AFM, atomic force microscopy; FBS, Fetal bovine serum;

DMEM, Dulbecco’s modified Eagle medium; CLSM, confocal laser scanning

microscope; CD, circular dichroism; ΔHBc, HBc deletion mutant lacking arginine-rich

domain

REFERENCES

127

Accardo, A., Salsano, G., Morisco, A., Aurilio, M., Parisi, A., Maione, F., Cicala, C.,

Tesauro, D., Aloj, L., Rosa, G.D., Morelli, G., 2012. Peptide-modified liposomes for

selective targeting of bombesin receptors overexpressed by cancer cells: a potential

theranostic agent. Int J Nanomed. 7, 2007-2017.

Beteramsa, G., Bottcher, B., Nassal, M., 2000. Packaging of up to 240 subunits of a 17

kDa nuclease into the interior of recombinant hepatitis B virus capsids. FEBS Letters.

481, 169-176.

Birnbaum, F., Nassal, M., 1990. Hepatitis B Virus Nucleocapsid Assembly: Primary

Structure Requirements in the Core Protein. J Virol. 64 (7), 3319-3330.

Cooper, A., Shaul, Y., 2005. Recombinant viral capsids as an efficient vehicle of

oligonucleotide delivery into cells. BBRC. 327, 1094-1099.

Cooper, A., Shaul1, Y., 2006. Clathrin-mediated Endocytosis and Lysosomal Cleavage

of Hepatitis B Virus Capsid-like Core Particles. JBC. 281 (24), 16563-16569.

Gao, J., Chen, K., Miao, Z., Ren, G., Chen, X., Gambhir, S.S., Cheng, Z., 2011.

Affibody-based nanoprobes for HER2-expressing cell and tumor imaging. Biomaterials.

32 (8), 2141-2148.

Kann, M., Gerlich, W., 1994. Effect of Core Protein Phosphorylation by Protein Kinase

C on Encapsidation of RNA within Core Particles of Hepatitis B Virus. J Virol. 68 (12),

128

7993-8000.

Kratz, P.A., Bottcher, B., Nassal, M., 1999. Native display of complete foreign protein

domains on the surface of hepatitis B virus capsids. PNAS. 96, 1915-1920.




Leea, K.W., Tana, W.S., 2008. Recombinant hepatitis B virus core particles: Association,

dissociation and encapsidation of green fluorescent protein. J Virol Meth. 151, 172-180.

Li, J., Lundberg, E., Vernet, E., Larsson, B., Hoiden-Guthenberg, I., Graslund, T., 2010.

Selection of affibody molecules to the ligand-binding site of the insulin-like growth

factor-1 receptor. Biotechnol Appl Biochem. 55, 99-109.

Liong, M., Lu, J., Kovochich, M., Xia, T., Ruehm, S.G., Nel, A.E., Tamanoi, F., Zink,

J.I., 2008. Multifunctional Inorganic Nanoparticles for Imaging, Targeting, and Drug

Delivery. ACS Nano. 2 (5), 889-896.

Lorberboum-Galski, H., 2011. Human toxin-based recombinant immunotoxins/chimeric

proteins as a drug delivery system for targeted treatment of human diseases. Epert Opin

Drug Deliv. 5, 605-621.

129

Ma, L.L., Tam, J.O., Willsey, B.W., Rigdon, D., Ramesh, R., Sokolov, K., Johnston,

K.P., 2011. Selective Targeting of Antibody Conjugated Multifunctional Nanoclusters

(Nanoroses) to Epidermal Growth Factor Receptors in Cancer Cells. Langmuir. 27 (12),

7681-7690.

Nie, S., Xing, Y., Kim, G.J., Simons, J.W., 2007. Nanotechnology applications in cancer.

Annu Rev Biomed Eng. 9, 257-288.

Nordberga, E., Friedmanb, M., Gostringa, L., Adamsd, G.P., Brismare, H., Nilssona, F.Y.,

Stahlb, S., Glimeliusf, B., Carlssona, J., 2007. Cellular studies of binding,

internalization and retention of a radiolabeled EGFR-binding affibody molecule. Nuc

Med Bio. 34, 609-618.

Nygren, P.-A., 2008. Alternative binding proteins: Affibody binding proteins developed

from a small three-helix bundle scaffold. FEBS J. 275, 2668-2676.

Orlova, A., Magnusson, M., Eriksson, T.L.J., Nilsson, M., Larsson, B.,


F.Y., 2006. Tumor Imaging Using a Picomolar Affinity HER2 Binding Affibody

Molecule. Cancer Res. 66, 4339-4348.

Puri, A., Kramer-Marek, G., Campbell-Massa, R., Yavlovich, A., Tele, S.C., Lee, S.B.,

Clogston, J.D., Patri, A.K., Blumenthal, R., Capala, J., 2008. HER2-specific

affibody-conjugated thermosensitive liposomes (Affisomes) for improved delivery of

130

anticancer agents. J Liposome Res. 18 (4), 293-307.

Shishido, T., Mieda, H., Hwang, S.Y., Nishimura, Y., Tanaka, T., Ogino, C., Fukuda,

H., Kondo, A., 2010. Affibody-displaying bionanocapsules for specific drug delivery to


Shojaei, S., Gardaneh, M., Shamabadi, A.R., 2012. Target Points in Trastuzumab

Resistance. Int J Breast Cancer.

Wang, S., Placzek, W.J., Stebbins, J.L., Mitra, S., Noberini, R., Koolpe, M., Zhang, Z.,

Dahl, R., Pasquale, E.B., Pellecchia, M., 2012. Novel Targeted System To Deliver

Chemotherapeutic Drugs to EphA2-Expressing Cancer Cells. J Med Chem. 55,

2427-2436.

Wizemann, H., von Brunn, A., 1999. Purification of E. coli-expressed HIS-tagged

hepatitis B core antigen by Ni2+-chelate affinity chromatography. J Virol Meth. 77,

189-197.

Zhang, K., Sefah, K., Tang, L., Zhao, Z., Zhu, G., Ye, M., Sun, W., Goodison, S., Tan,

W., 2012. A Novel Aptamer Developed for Breast Cancer Cell Internalization, Chem

Med Chem. 7, 79-84.

131

GENERAL CONCLUSION

In the cancer therapy, effective medicinal treatments without significant side

effects are required. Since nanoparticles (NPs) are attracted attention as a mean of

achieving the goal, various types of drug carriers have been developed. However,

optimal carriers have not yet been established, because a variety of characteristics

including safety, stability, specificity, high transfection efficiency and controlled release

of drugs are needed. Hence, we have used hollow NPs, bio-nanocapsules (BNCs) that

are composed of lipids bilayer and L proteins derived from Hepatitis B virus (HBV)

surface antigen (HBsAg). BNCs are very safe without viral genome and show the

ability for high transfection and the specificity to hepatocyte due to the action of HBsAg.

It was demonstrated that BNCs encapsulating drugs and genes could be delivered to

target hepatocyte cancer effectively; therefore, BNCs would be expected to become

effective carriers for drug delivery. In this study, we evaluated the in vitro delivery of

protein and siRNA with BNCs and the large scale purification of them toward in vivo

applications.

First, to apply BNCs for protein therapy, we established the method for

encapsulating proteins into BNCs. In this method, we tried to encapsulate proteins at the

same time as BNC formation, since it is difficult to encapsulate proteins into BNCs after

particle formation. We succeeded to encapsulate proteins into BNCs by fusing

membrane localization sequence (MLS) to target proteins and co-expressing the

proteins with L protein in insect cells. This result indicated that we could encapsulate

pharmaceutical proteins into BNCs by using this method.

132

Next, to develop more efficient protein delivery, we used the BNC/LP

conjugation method to fuse BNCs on the surface of LP encapsulating proteins. We used

Affibody; ZHER2, which binds to HER2 specifically, displaying BNC (ZHER2-BNC) and

tried to target HER2-expressing breast cancer cells. It has been indicated that the

conjugation of BNC with anionic LP permitted target-cell-specific delivery and the

mixing of helper lipids possessing the endosome escaping ability with anionic LP

allowed to express effective activity of pharmaceutical protein. These results

successfully showed target-cell-specific protein therapy in vitro. Thus, ZHER2-BNC/LP

complex carrier would be a useful tool for protein delivery in vivo.

Additionally, we tried to deliver siRNA which has now drawn attention as

nucleic acid medicine. Although siRNA is greatly specific and effective, there is a

problem for instability in the blood and inability to specifically reach target cells and to

cross the cell membrane. Therefore, we used ZHER2-BNC/LP to deliver siRNA,

confirming effective RNAi specifically in target breast cancer cells. This result indicated

that ZHER2-BNC/LP complex would be permitted as a carrier for nucleic acid medicine

as well as protein therapy.

Although the availability of BNC has been shown as described above,

large-scale production is required for in vivo application. Therefore, we established the

new purification method alternative to conventional ultracentrifugation method. We

genetically fused His-tag to ZHER2-BNC to carry out affinity chromatography. As a

result, we succeeded to simplify laborious purification process and to achieve 2.5-fold

higher yields than ultracentrifugation method. Since this method could purify BNCs in

133

large scale in one-step, it would be able to apply not only to in vivo application but also

to commercial production.

Finally, to develop a new type of carrier particle, we used a hepatitis B core

protein (HBc) which allows the large-scale production and the purification with His-tag

affinity chromatography. Since HBc has abilities to self-assembly formation and bind to

various cells non-specifically, we tried to develop an engineered HBc particle that

specifically recognizes and targets HER2-expressing breast cancer cells by despoiling

the non-specific binding property and granting the target-cell specific recognition ability

to the HBc particle with ZHER2 affibody. As a result, we could add the ability of

specificity for HER2-expressing cells to HBc.

In summary, BNCs have a variety of attractive abilities such as, safety,

specificity to target cells and high transfection efficiency. Furthermore, since stability

and controlled release are improved by conjugating BNCs with LP, it would be

indicated that BNCs acquire the abilities required for drug delivery carrier. Therefore, it

is expected to apply BNCs as nanotechnology for innovative cancer treatment in vivo.

Additionally, HBc particle would become to more highly-sophisticated carrier for DDS

in near future.

134

ACKOWLEDGMENTS

This is a thesis submitted by the author to Kobe University for the degree of

Doctor of Engineering. The studies reported here were carried out between from 2007 to

2013 under the direction of Professor Akihiko Kondo in the Laboratory of Biochemical

Engineering, Department of Chemical Science and Engineering, Graduate School of

Engineering, Kobe University.

First of all, the author would like to express his sincerest gratitude to his

research advisor, Professor Akihiko Kondo, for continuous guidance and invaluable

suggestions during the course of his studies. Next, the author would like to express his

hearty gratitude to Professor Hideki Fukuda for invaluable discussion and kind

support throughout this research. The author is also deeply grateful to Associate

Professor Chiaki Ogino and Toshinobu Fujiwara, Assistant Professor Fumiyoshi

Okazaki, Kazunori Nakashima and Tomohisa Hasunuma for their valuable advice

and hearty encouragement.

The author further wishes to acknowledge the contributions of Professor

Shun-ichi Kuroda (Nagoya University) for invaluable strategic and technical advice on

Bio-nanocapsules.

I wish to express my gratitude to the official reviewer, Professor Hideki

Yamaji and Atsunori Mori, who had time to take interest in the manuscript and to give

constructive criticism at the final stage of preparation.

135

The helpful discussions and advice of Assistant Professor Jun Ishii and Dr.

Takuya Shishido (Nitto Denko Co., Ltd.) and the technical assistance and

encouragement of, Mr. Naoya Kurata (Chugai Pharmaceutical Co., Ltd.), Mr. Daisaku

Yonezawa (Suntory Co., Ltd), Ms. Yuki Azumi (Nissha Printing Co., Ltd.), Mr.

Hiroaki Mieda (Canon Co., Ltd.), Ms. Wakiko Mimura (Canon Co., Ltd.), Mr.

Koichi Takeda, Mr. Izzat fahimuddin Mohamed sufflan, Mr. Ryosuke Ezawa, Mr.

Takayuki Sakamoto and all the members of Professor Kondo’s laboratory are also

sincerely acknowledged.

This work was, in partially, supported by Grants-in-aid for Research on

Advanced Medical Technology from the Ministry of Health, Labour and Welfare, Japan.

Last but not least, the author expresses my deep appreciation to my parents,

Hidetaka and Chieko Nishimura for continuous moral and financial support.

Yuya Nishimura

Department of Chemical Science and Engineering

Graduate School of Engineering

Kobe University

136

PUBLICATION LISTS

PART I.

Nishimura, Y., Shishido, T., Ishii, J., Tanaka, T., Ogino, C., Kondo, A., 2012.

Protein-encapsulated bio-nanocapsules production with ER membrane localization

sequences. J Biotechnol. 157(1), 124-129.

PART II.

Nishimura, Y., Ishii, J., Okazaki, F., Ogino, C., Kondo, A., 2012. Complex carriers of

affibody-displaying bio-nanocapsules and composition-varied liposomes for

HER2-expressing breast cancer cell-specific protein delivery. J Drug Target. 20(10),

897-905.

PART III.

Nishimura, Y., Mieda, H., Ishii, J., Ogino, C., Fujiwara, T., Kondo, A., Targeting cancer

cell-specific RNA interference by siRNA delivery using a complex carrier of

affibody-displaying bio-nanocapsules and liposomes. In revision.

PART IV.

Nishimura, Y., Takeda, K., Ishii, J., Ogino, C., Kondo, A., 2013. An affinity

chromatography method used to purify His-tag-displaying bio-nanocapsules. J Virol

Methods. 189(2), 393-396.

PART V.

Nishimura, Y., Mimura, W., Mohamed suffian, I.F., Amino, T., Ishii, J., Ogino, C.,

Kondo, A., 2013. Granting specificity for breast cancer cells using a Hepatitis B core

particle with a HER2-targeted affibody molecule. J Biochem. 153(3), 251-256.

OTHER PUBLICATIONS




kobe university repository : thesispres2 pres1 reverse transcriptase lipid bilayer hbcag dna...

Documents