Induction of genetic varibilty

1.Mutation 2.recombination

INTRODUCTION

The term mutation refers to a heritable change in the genetic material

Mutations provide allelic variations On the positive side, mutations are the foundation for

evolutionary change E.g. Light skin in high latitude human populations

On the negative side, mutations are the cause of many diseases

E.g. Hemophilia

DNA Maintenance

Mutation rate are extremely low

1 mutation out of 109 nucleotides per generation

Mutations can be divided into three main types 1. Chromosome mutations

Changes in chromosome structure 2. Genome mutations

Changes in chromosome number 3. Single-gene mutations

Relatively small changes in DNA structure that occur within a particular gene

Types 1 and Type 2 had discussed in aberration Type 3 will be discussed in this set of lecture notes

16.1 CONSEQUENCES OF MUTATIONS

A point mutation is a change in a single base pair It involves a base substitution

Gene Mutations Change the DNA Sequence

5’ AACGCTAGATC 3’3’ TTGCGATCTAG 5’

5’ AACGCGAGATC 3’3’ TTGCGCTCTAG 5’

A transition is a change of a pyrimidine (C, T) to another pyrimidine or a purine (A, G) to another purine

A transversion is a change of a pyrimidine to a purine or vice versa

Transitions are more common than transversions

Mutations may also involve the addition or deletion of short sequences of DNA

Gene Mutations Change the DNA Sequence

5’ AACGCTAGATC 3’3’ TTGCGATCTAG 5’

5’ AACGCTC 3’3’ TTGCGAG 5’

5’ AACGCTAGATC 3’3’ TTGCGATCTAG 5’

5’ AACAGTCGCTAGATC 3’3’ TTGTCAGCGATCTAG 5’

Deletion of four base pairs

Addition of four base pairs

Mutations in the coding sequence of a structural gene can have various effects on the polypeptide Silent mutations are those base substitutions that do

not alter the amino acid sequence of the polypeptide Due to the degeneracy of the genetic code

Missense mutations are those base substitutions in which an amino acid change does occur

Example: Sickle-cell anemia If the substituted amino acid does not affect protein function (as

measured by phenotype), the mutation is said to be neutral

Gene Mutations Can Alter the Coding Sequence Within a Gene

Mutations in the coding sequence of a structural gene can have various effects on the polypeptide

Gene Mutations Can Alter the Coding Sequence Within a Gene

Nonsense mutations are those base substitutions that change a normal codon to a termination codon

Frameshift mutations involve the addition or deletion of nucleotides in multiples of one or two

This shifts the reading frame so that a completely different amino acid sequence occurs downstream from the mutation

Table 16.1 describes all of the above mutations

In a natural population, the wild-type is the most common genotype (may be encoded by a dominant or recessive allele)

A forward mutation changes the wild-type genotype into some new variation If it is beneficial, it may move evolution forward Otherwise, it will be probably eliminated from a

population A reverse mutation has the opposite effect

It is also termed a reversion

Gene Mutations and Their Effects on Genotype and Phenotype

Mutations can also be described based on their effects on the wild-type phenotype When a mutation alters an organism’s phenotypic

characteristics, it is said to be a variant Variants are often characterized by their differential

ability to survive Deleterious mutations decrease the chances of survival

The most extreme are lethal mutations E.g. Homozygous polydactyly in cats

Beneficial mutations enhance the survival or reproductive success of an organism

Some mutations are called conditional mutants They affect the phenotype only under a defined set of

conditions

A second mutation will sometimes affect the phenotypic expression of another

These second-site mutations are called suppressor mutations or simply suppressors

Suppressor mutations are classified into two types Intragenic suppressors

The second mutant site is within the same gene as the first mutation

Intergenic suppressors The second mutant site is in a different gene from the first

mutation

Several human genetic diseases are caused by an unusual form of mutation called trinucleotide repeat expansion (TNRE) The term refers to the phenomenon that a sequence of 3

nucleotides can increase from one generation to the next

Mutations Due to Trinucleotide Repeats

Certain regions of the chromosome contain trinucleotide sequences repeated in tandem In normal individuals, these sequences are transmitted

from parent to offspring without mutation However, in persons with TRNE disorders, the length of a

trinucleotide repeat increases above a certain critical size It also becomes prone to frequent expansion This phenomenon is shown here with the trinucleotide repeat

CAG

CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

n = 11

n = 18

In some cases, the expansion is within the coding sequence of the gene Typically the trinucleotide expansion is CAG (glutamine) Therefore, the encoded protein will contain long tracks of

glutamine This causes the proteins to aggregate with each other This aggregation is correlated with the progression of the disease

In other cases, the expansions are located in noncoding regions of genes These expansions are hypothesized to cause abnormal

changes in RNA structure Thereby producing disease symptoms

A chromosomal rearrangement may affect a gene because the break occurred in the gene itself

A gene may be left intact, but its expression may be altered because of its new location This is termed a position effect

There are two common reasons for position effects: 1. Movement to a position next to regulatory sequences

Refer to Figure 16.2a 2. Movement to a position in a heterochromatic region

Refer to Figure 16.2b AND 16.3

Changes in Chromosome Structure Can Affect Gene Expression

Figure 16.2

Regulatory sequences are often

bidirectional

Geneticists classify the animal cells into two types Germ-line cells

Cells that give rise to gametes such as eggs and sperm Somatic cells

All other cells Germ-line mutations are those that occur directly in a

sperm or egg cell, or in one of their precursor cells Refer to Figure 16.4a

Somatic mutations are those that occur directly in a body cell, or in one of its precursor cells

Refer to Figure 16.4b AND 16.5

Mutations Can Occur in Germ-Line or Somatic Cells

Figure 16.4

Therefore, the mutation can be

passed on to future generations

The size of the patch will depend on the timing of the mutation

The earlier the mutation, the larger the patch

An individual who has somatic regions that are genotypically different

from each other is called a genetic mosaic

Therefore, the mutation cannot be passed on to future generations

Mutations can occur spontaneously or be induced

Spontaneous mutations Result from abnormalities in cellular/biological processes

Errors in DNA replication, for example

Induced mutations Caused by environmental agents Agents that are known to alter DNA structure are termed

mutagens These can be chemical or physical agents

Refer to Table 16.4

16.2 OCCURRENCE AND CAUSES OF MUTATION

Are mutations spontaneous occurrences or causally related to environmental conditions? This is a question that biologists have asked

themselves for a long time

Jean Baptiste Lamarck Proposed that physiological events (e.g. use and disuse)

determine whether traits are passed along to offspring Charles Darwin

Proposed that genetic variation occurs by chance Natural selection results in better-adapted organisms

Spontaneous Mutations Are Random Events

These two opposing theories of the 19th century were tested in bacteria in the 1940s and 1950s

Salvadore Luria and Max Delbruck studied the resistance of E. coli to bacteriophage T1 tonr (T one resistance) They wondered if tonr is due to spontaneous mutations

or to a physiological adaptation that occurs at a low rate?

The physiological adaptation theory predicts that the number of tonr bacteria is essentially constant in different bacterial populations

The spontaneous mutation theory predicts that the number of tonr bacteria will fluctuate in different bacterial populations

Their test therefore became known as the fluctuation test

Joshua and Ester Lederberg were also interested in the relation between mutations and the environment

At that time (1950s), there were two new theories Directed mutation theory

Selected conditions could promote the formation of specific mutations allowing the organism to survive

This was consistent with Lamarck’s viewpoint

Random mutation theory Environmental factors simply select for the survival of those

individuals that happen to possess beneficial mutations This was consistent with Darwin’s viewpoint

Random Mutations Can Give an Organism a Survival Advantage

Figure 16.7 Replica plating

A few tonr colonies were observed at the same location on both plates!!!

This indicates that mutations conferring tonr occurred randomly on the primary (nonselective plate)

The presence of T1 in the secondary plates simply selected for previously occurring tonr mutants

This supports the random mutation theory

The Lederbergs developed a technique to distinguish between these two theories

Spontaneous mutations can arise by three types of chemical changes

1. Depurination

2. Deamination

3. Tautomeric shift

Causes of Spontaneous Mutations

The most common

Depurination involves the removal of a purine (guanine or adenine) from the DNA The covalent bond between deoxyribose and a purine

base is somewhat unstable It occasionally undergoes a spontaneous reaction with water

that releases the base from the sugar This is termed an apurinic site Fortunately, apurinic sites can be repaired

However, if the repair system fails, a mutation may result during subsequent rounds of DNA replication

Causes of Spontaneous Mutations

Spontaneous depurinationFigure 16.8

Three out of four (A, T and G) are the incorrect nucleotideThere’s a 75% chance

of a mutation

Deamination involves the removal of an amino group from the cytosine base The other bases are not readily deaminated

Figure 16.9

DNA repair enzymes can recognize uracil as an inappropriate base in DNA and remove it

However, if the repair system fails, a C-G to A-T mutation will result during subsequent rounds of DNA replication

Deamination of 5-methyl cytosine can also occur

Thymine is a normal constituent of DNA This poses a problem for repair enzymes

They cannot determine which of the two bases on the two DNA strands is the incorrect base

For this reason, methylated cytosine bases tend to create hot spots for mutation

Figure 16.9

A tautomeric shift involves a temporary change in base structure (Figure 16.10a) The common, stable form of thymine and guanine is the

keto form At a low rate, T and G can interconvert to an enol form

The common, stable form of adenine and cytosine is the amino form

At a low rate, A and C can interconvert to an imino form

These rare forms promote AC and GT base pairs Refer to Figure 16.10b

For a tautomeric shift to cause a mutation it must occur immediately prior to DNA replication Refer to Figure 16.10c

Figure 16.10

RareCommon

Figure 16.10

16-42Figure 16.10

Temporary tautomeric shift

Shifted back to its normal fom

An enormous array of agents can act as mutagens to permanently alter the structure of DNA

The public is concerned about mutagens for two main reasons: 1. Somatic mutagens are often involved in the

development of human cancers 2. Germ-line mutations may have harmful effects in

future generations Mutagenic agents are usually classified as

chemical or physical mutagens Refer to Table 16.5

Types of Mutagens

Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-53

Chemical mutagens come into three main types

1. Base modifiers 2. Intercalating agents 3. Base analogues

Mutagens Alter DNA Structure in Different Ways

Base modifiers covalently modify the structure of a nucleotide For example, nitrous acid, replaces amino groups with

keto groups (–NH2 to =O) This can change cytosine to uracil and adenine to

hypoxanthine

Refer to Figure 16.1

Mispairing of modified basesFigure 16.13

These mispairings create mutations in the newly replicated strand

Intercalating agents contain flat planar structures that intercalate themselves into the double helix

This distorts the helical structure When DNA containing these mutagens is replicated, the

daughter strands may contain single-nucleotide additions and/or deletions

Examples: Acridine dyes Proflavin Ethidium bromide

Base analogues become incorporated into daughter strands during DNA replication For example, 5-bromouracil is a thymine analogue

It can be incorporated into DNA instead of thymine

Figure 16.14

Normal pairing This tautomeric shift occurs at a relatively

high rate

Mispairing

Figure 16.14

In this way, 5-bromouracil can promote a change of an AT base pair into a GC base pair

Physical mutagens come into two main types 1. Ionizing radiation 2. Nonionizing radiation

Ionizing radiation Includes X rays and gamma rays Has short wavelength and high energy Can penetrate deeply into biological molecules Creates chemically reactive molecules termed free

radicals Can cause

Base deletions Single nicks in DNA strands Cross-linking Chromosomal breaks

Nonionizing radiation Includes UV light Has less energy Cannot penetrate deeply

into biological molecules Causes the formation of

cross-linked thymine dimers

Thymine dimers may cause mutations when that DNA strand is replicated

Figure 16.15

Gene recombination originate as a result of Crossing over Orientation of chromosome during cell division Random fusion of male and female gametes

during fertilization Read detail from book Pinciples of botany

pg#472

Gene recombination

The rate of cancer increases with age Diseases caused by new point mutations usually

come from the father Testicular tissues undergoes many more rounds of DNA

replication than ovarian tissue prior to meiosis

Cancers develop when one mutation promotes DNA replication and cell division

This promotes additional mutations Some of the new mutations further promote DNA replication and

cell division (or mutate genes that down-regulated replication and cell division)

This process continues to produce a malignant tumor

DNA Replication itself is mutagenic